Schema for TransMap RefGene - TransMap RefSeq Gene Mappings Version 5
  Database: hg38    Primary Table: transMapRefSeqV5 Data last updated: 2019-06-25
Big Bed File: /gbdb/hg38/transMap/V5/hg38.refseq.transMapV5.bigPsl
Item Count: 1,030,749
Format description: bigPsl derived pairwise alignment with additional information
fieldexampledescription
chromchr1Reference sequence chromosome or scaffold
chromStart166022198Start position in chromosome
chromEnd166022772End position in chromosome
namecolAng1:XR_001000761.1-1.1alignment Id
score956Score (0-1000), faction identity * 1000
strand++ or - indicates whether the query aligns to the + or - strand on the reference
thickStart166022772Start of where display should be thick (start codon)
thickEnd166022772End of where display should be thick (stop codon)
reserved0RGB value (use R,G,B string in input file)
blockCount3Number of blocks
blockSizes212,229,132,Comma separated list of block sizes
chromStarts0,212,442,Start positions relative to chromStart
oChromStart0Start position in other chromosome
oChromEnd577End position in other chromosome
oStrand++ or -, - means that psl was reversed into BED-compatible coordinates
oChromSize577Size of other chromosome.
oChromStarts0,216,445,Start positions relative to oChromStart or from oChromStart+oChromSize depending on strand
oSequencectttctgagtagcaccatggtggttggcaagaacaagtgtcttactaaaggtggcaaaaagggagccaagaagaaggtggttgatccattttctaagaaagattgctatgatgtgaaagcacctgctatgtttaatataagaaatattggaaggacactaatcaccaggacccaaggaaccaaaattatatctgatggcctcaagggtcatctgtttgaagtgagtcaagctgatttgcagaatgatgaagctgtatttagaaaattcaagatgattactgaagatgttcagggcaaaaactgcctgactaacttccatggcatggatcttacccatgacaaaatgtgttccatggtcaaaaaatggcagacaatgattgaaactcatgtcgatgtcaagactaatgatggctacttgtttaatctgttctgtgttggttttactaaaaaacgcaacaatcagatacggaagacctcttatattcagcaccaacaggtccgacaaatccagaagaagatttggaaatcatgacctgagaggtgcagacaaataacttgaaagaagtgatcaataaatSequence on other chrom (or edit list, or empty)
oCDSCDS in NCBI format
chromSize248956422Size of target chromosome
match548Number of bases matched.
misMatch25 Number of bases that don't match
repMatch0 Number of bases that match but are part of repeats
nCount0 Number of 'N' bases
seqType10=empty, 1=nucleotide, 2=amino_acid
srcDbcolAng1source database
srcTransIdXR_001000761.1source transcript id
srcChromNW_012113808v1source chromosome
srcChromStart6552131start position in source chromosome
srcChromEnd6552708end position in source chromosome
srcIdent1000source score (fraction identity * 1000)
srcAligned1000fraction of source transcript aligned (fraction aligned * 1000)
geneNameLOC105505524gene name
geneId105505524gene id
geneTypenon_codinggene type
transcriptTypenon_codingtranscript type
chainTypesyntype of chains used for mapping
commonNameAngolan colobuscommon name
scientificNameColobus angolensis palliatusscientific name
orgAbbrevColobuorganism abbreviation

Sample Rows
 
chromchromStartchromEndnamescorestrandthickStartthickEndreservedblockCountblockSizeschromStartsoChromStartoChromEndoStrandoChromSizeoChromStartsoSequenceoCDSchromSizematchmisMatchrepMatchnCountseqTypesrcDbsrcTransIdsrcChromsrcChromStartsrcChromEndsrcIdentsrcAlignedgeneNamegeneIdgeneTypetranscriptTypechainTypecommonNamescientificNameorgAbbrev
chr1166022198166022772colAng1:XR_001000761.1-1.1956+16602277216602277203212,229,132,0,212,442,0577+5770,216,445,ctttctgagtagcaccatggtggttggcaagaacaagtgtcttactaaaggtggcaaaaagggagccaagaagaaggtggttgatccattttctaagaaagattgctatgatgtgaaagcacctgcta ...24895642254825001colAng1XR_001000761.1NW_012113808v16552131655270810001000LOC105505524105505524non_codingnon_codingsynAngolan colobusColobus angolensis palliatusColobu
chr1166022214166022418ponAbe3:XM_024249457.1-1.1965+16602241816602241801204,0,0204+2040,atggtggttggtaagaacaagcgtcttaataaagatggcaaaaagggagccaagaagaaggtagttgatccattttctaagaaagattgctatgatgtgaaagcacctgctatgtttaatgtaagaaa ...1..2042489564221977001ponAbe3XM_024249457.1chr1844456158444581910001000LOC100434961100434961non_codingnon_codingsynOrangutanPongo pygmaeus abeliiPongo
chr1166040456166069784mm10:XR_865715.2-1.1662+166069784166069784010949,16,17,28,22,64,6,15,48,23,18,12,7,20,36,11,26,17,12,15,6,10,55,24,29,14,11,23,19,5,5,20,49,23,12,28,9,13,37,46,25,15,16,36,12 ...0,50,67,85,120,2505,2579,2602,2622,2674,2698,2732,2746,2770,2798,2834,2847,2876,2896,2910,2925,2931,4288,4344,4378,4407,4426,444 ...04970+49700,49,65,82,110,132,196,202,217,265,288,306,318,325,345,383,394,420,437,449,465,475,485,540,564,596,610,621,644,663,668,673,693,7 ...ccgtcctgctttagacagttcaagaggcaggctccagatccccttggaatggaagtataattacagcctgtgggaaaccctgcctggacccatggtgagggcgggacctgagaagtctttgtttgcag ...2489564221455100251201mm10XR_865715.2chr116707951316710508510001000Gm33610102636591non_codingnon_codingsynMouseMus musculusMus
chr1166040456166069832mm10:XR_865713.2-1.1666+166069832166069832011149,16,17,28,22,64,6,15,48,23,18,12,7,20,36,11,26,17,12,15,6,10,55,24,29,14,11,23,19,5,5,20,49,23,12,28,9,13,37,46,25,15,16,36,12 ...0,50,67,85,120,2505,2579,2602,2622,2674,2698,2732,2746,2770,2798,2834,2847,2876,2896,2910,2925,2931,4288,4344,4378,4407,4426,444 ...05048+50480,49,65,82,110,132,196,202,217,265,288,306,318,325,345,383,394,420,437,449,465,475,485,540,564,596,610,621,644,663,668,673,693,7 ...ccgtcctgctttagacagttcaagaggcaggctccagatccccttggaatggaagtataattacagcctgtgggaaaccctgcctggacccatggtgagggcgggacctgagaagtctttgtttgcag ...2489564221497101353101mm10XR_865713.2chr116707946716710508510001000Gm33610102636591non_codingnon_codingsynMouseMus musculusMus
chr1166055804166166350susScr11:XM_021089485.1-1.1830-166166350166166350010753,31,20,82,9,107,6,26,42,68,16,40,61,9,12,17,14,7,13,43,25,16,41,8,13,70,18,28,27,18,40,44,77,35,66,47,39,165,11,7,28,31,34,23, ...0,54,85,106,188,198,305,311,337,380,448,469,522,583,592,604,622,637,650,663,708,733,750,791,799,812,882,900,932,959,979,1365,140 ...06293+62930,53,620,640,735,744,852,859,888,930,1006,1022,1062,1135,1163,1258,1275,1289,1296,1310,1353,1379,1395,1437,1446,1461,1532,1551,1 ...agcgggcggcgcgtcgccatgccggtgtgacgggcgcccccggctgcccgcgcggtccccggcgctgccccacaccacgccgcgccggcgccgggcggcaggatgggctgtatccaaagcattacctg ...103..888248956422403792048601susScr11XM_021089485.1chr4845978238470506010001000FAM78B100153010non_codingnon_codingsynPigSus scrofaSus
chr1166055917166166755ponAbe3:XM_024249452.1-1.1978-16616675516616675507197,159,375,1308,2232,457,770,0,197,362,737,2048,4289,110068,05501+55010,198,357,734,2042,4274,4731,agccgcggtgcagaggttcatgcagcggcggcggcggcggcggctgctgctgctgccgccgcggaggcagacagaccgggcgctgccaccgccgccctcccccggctccatgccgccgccgctgccgc ...508..8252489564224369120100901ponAbe3XM_024249452.1chr1842954448440611910001000FAM78B100434589non_codingnon_codingsynOrangutanPongo pygmaeus abeliiPongo
chr1166057215166070763melGal5:XM_010715708.2-1.1713-16607076316607076303522,15,17,10,5,19,9,23,29,15,28,19,46,17,18,10,32,46,94,20,43,13,89,38,20,15,32,15,31,41,14,7,6,14,534,0,36,51,69,81,86,105,121,144,174,189,224,247,293,312,330,340,373,419,513,533,12633,12647,12737,12775,12795,12816,12862,12886,129 ...5554872+64211549,1571,1590,1607,1617,1625,1645,1654,1692,1721,1738,1766,1785,1832,1849,1870,1884,1916,1964,2065,2100,4987,5000,5089,5129,515 ...tgggctggggcttgctgagctgggtggccactgtcccctctccctgctcataattaccacgtggtgatcttctccatcgctacatctgcctggtgttgctaatgtggtttgcagccaagattttggct ...530..10782489564221003403001melGal5XM_010715708.2chr10106480101065475310001000LOC100539713100539713non_codingnon_codingrbestTurkeyMeleagris gallopavoMeleag
chr1166057395166166391mm10:NM_175461.4-1.1806-16616639116616639109166,36,170,35,20,3,10,20,3,30,6,121,7,62,41,21,37,194,42,12,20,38,35,62,45,16,11,75,11,39,31,11,18,49,21,28,34,32,31,5,18,29,27,4 ...0,66,103,273,309,332,343,354,379,384,415,424,562,573,636,680,701,738,933,979,1022,1043,1135,1170,1234,1295,1333,1345,1421,1437,1 ...54410+4668258,328,364,535,570,590,593,603,623,626,656,662,783,790,852,893,917,956,1150,1192,1204,1224,1298,1334,1396,1441,1457,1468,1543,1 ...gcggcggcggctcctcgctcttaggcgctagctgagctggaccgggagcgagcggcgcgtcgccatgccggcgtgacgggtgcccgcggctgcccgcgccgggcccccgcgctgccccacgccgcgcc ...150..935248956422301782542001mm10NM_175461.4chr116700141616709130210001000Fam78b226610protein_codingprotein_codingsynMouseMus musculusMus
chr1166057426166166409galGal6:XM_001232253.4-1.1731-1661664091661664090306,19,31,15,17,18,10,32,46,94,18,19,103,38,51,7,15,14,32,24,59,534,263,27,21,40,18,9,12,8,0,13,36,67,82,101,119,129,162,208,302,327,12422,12526,12564,12620,12636,12651,12674,12706,12744,12803,108559,108822,108849,10887 ...34514+45140,6,25,57,73,90,111,125,157,205,306,324,3221,3324,3364,3415,3422,3439,3453,3486,3510,3573,4107,4372,4403,4424,4464,4482,4491,450 ...ggcgcgttcgccctgccggcgccggtgcgggcgccggtgcgcgggcggcgatggtggggcgggcggcgaggggacgccgggccgccccctggcccccgcgtcgcggcggagggtgagcgcggtggagg ...145..9302489564221170430001galGal6XM_001232253.4chr84686723469421610001000FAM78B769830non_codingnon_codingrbestChickenGallus gallusGallus
chr1166057430166166391mm10:XM_006496789.1-1.1782-166166391166166391012631,36,170,35,20,3,10,20,3,30,6,121,7,62,41,21,37,194,42,12,20,38,35,62,45,16,11,75,11,39,31,11,18,49,21,28,34,32,31,5,18,29,27,4 ...0,31,68,238,274,297,308,319,344,349,380,389,527,538,601,645,666,703,898,944,987,1008,1100,1135,1199,1260,1298,1310,1386,1402,147 ...55421+54210,35,71,242,277,297,300,310,330,333,363,369,490,497,559,600,624,663,857,899,911,931,1005,1041,1103,1148,1164,1175,1250,1261,1300 ...gcggcggcggctcctcgctcttaggcgctagctgagctggaccgggagcgagcggcgcgtcgccatgccggcgtgacgggtgcccgcggctgcccgcgccgggcccccgcgctgccccacgccgcgcc ...150..9352489564223663114243801mm10XM_006496789.1chr116700141616709100910001000Fam78b226610non_codingnon_codingsynMouseMus musculusMus

TransMap RefGene (transMapRefSeqV5) Track Description
 

Description

This track contains RefSeq Gene alignments produced by the TransMap cross-species alignment algorithm from other vertebrate species in the UCSC Genome Browser. For closer evolutionary distances, the alignments are created using syntenically filtered BLASTZ alignment chains, resulting in a prediction of the orthologous genes in human.

Display Conventions and Configuration

This track follows the display conventions for PSL alignment tracks.

This track may also be configured to display codon coloring, a feature that allows the user to quickly compare cDNAs against the genomic sequence. For more information about this option, click here. Several types of alignment gap may also be colored; for more information, click here.

Methods

  1. Source transcript alignments were obtained from vertebrate organisms in the UCSC Genome Browser Database. BLAT alignments of RefSeq Genes, GenBank mRNAs, and GenBank Spliced ESTs to the cognate genome, along with UCSC Genes, were used as available.
  2. For all vertebrate assemblies that had BLASTZ alignment chains and nets to the human (hg38) genome, a subset of the alignment chains were selected as follows:
    • For organisms whose branch distance was no more than 0.5 (as computed by phyloFit, see Conservation track description for details), syntenic filtering was used. Reciprocal best nets were used if available; otherwise, nets were selected with the netfilter -syn command. The chains corresponding to the selected nets were used for mapping.
    • For more distant species, where the determination of synteny is difficult, the full set of chains was used for mapping. This allows for more genes to map at the expense of some mapping to paralogous regions. The post-alignment filtering step removes some of the duplications.
  3. The pslMap program was used to do a base-level projection of the source transcript alignments via the selected chains to the human genome, resulting in pairwise alignments of the source transcripts to the genome.
  4. The resulting alignments were filtered with pslCDnaFilter with a global near-best criteria of 0.5% in finished genomes (human and mouse) and 1.0% in other genomes. Alignments where less than 20% of the transcript mapped were discarded.

To ensure unique identifiers for each alignment, cDNA and gene accessions were made unique by appending a suffix for each location in the source genome and again for each mapped location in the destination genome. The format is:

   accession.version-srcUniq.destUniq
Where srcUniq is a number added to make each source alignment unique, and destUniq is added to give the subsequent TransMap alignments unique identifiers.

For example, in the cow genome, there are two alignments of mRNA BC149621.1. These are assigned the identifiers BC149621.1-1 and BC149621.1-2. When these are mapped to the human genome, BC149621.1-1 maps to a single location and is given the identifier BC149621.1-1.1. However, BC149621.1-2 maps to two locations, resulting in BC149621.1-2.1 and BC149621.1-2.2. Note that multiple TransMap mappings are usually the result of tandem duplications, where both chains are identified as syntenic.

Data Access

The raw data for these tracks can be accessed interactively through the Table Browser or the Data Integrator. For automated analysis, the annotations are stored in bigPsl files (containing a number of extra columns) and can be downloaded from our download server, or queried using our API. For more information on accessing track data see our Track Data Access FAQ. The files are associated with these tracks in the following way:

  • TransMap Ensembl - hg38.ensembl.transMapV4.bigPsl
  • TransMap RefGene - hg38.refseq.transMapV4.bigPsl
  • TransMap RNA - hg38.rna.transMapV4.bigPsl
  • TransMap ESTs - hg38.est.transMapV4.bigPsl
Individual regions or the whole genome annotation can be obtained using our tool bigBedToBed which can be compiled from the source code or downloaded as a precompiled binary for your system. Instructions for downloading source code and binaries can be found here. The tool can also be used to obtain only features within a given range, for example:

bigBedToBed http://hgdownload.soe.ucsc.edu/gbdb/hg38/transMap/V4/hg38.refseq.transMapV4.bigPsl -chrom=chr6 -start=0 -end=1000000 stdout

Credits

This track was produced by Mark Diekhans at UCSC from cDNA and EST sequence data submitted to the international public sequence databases by scientists worldwide and annotations produced by the RefSeq, Ensembl, and GENCODE annotations projects.

References

Siepel A, Diekhans M, Brejová B, Langton L, Stevens M, Comstock CL, Davis C, Ewing B, Oommen S, Lau C et al. Targeted discovery of novel human exons by comparative genomics. Genome Res. 2007 Dec;17(12):1763-73. PMID: 17989246; PMC: PMC2099585

Stanke M, Diekhans M, Baertsch R, Haussler D. Using native and syntenically mapped cDNA alignments to improve de novo gene finding. Bioinformatics. 2008 Mar 1;24(5):637-44. PMID: 18218656

Zhu J, Sanborn JZ, Diekhans M, Lowe CB, Pringle TH, Haussler D. Comparative genomics search for losses of long-established genes on the human lineage. PLoS Comput Biol. 2007 Dec;3(12):e247. PMID: 18085818; PMC: PMC2134963