Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1207 in window, 127836618 - 127836625, 8 bps 
B D                   Human  taactctg
B D                   Chimp  taactctg
B D                 Gorilla  taactctg
B D               Orangutan  taacgctg
B D                  Gibbon  taacgctg
B D                  Rhesus  taacgctg
B D     Crab-eating macaque  taacgctg
B D                  Baboon  taacgctg
B D            Green monkey  taacactg
         Chinese tree shrew  tagtgcta
B D          Naked mole-rat  ccgcactc
B D              Guinea pig  cagcactc
                 Chinchilla  cagcactg
B D                  Rabbit  tggtgctg
B D                    Pika  tggtact-
B D                     Pig  aaatgcta
B D                  Alpaca  aaatgcta
             Bactrian camel  aaatgcta
B D                 Dolphin  aaatgcta
               Killer whale  aaatgcta
           Tibetan antelope  aaacgcta
B D                     Cow  aaatgcta
B D                   Sheep  aaacgcta
              Domestic goat  aaacgcta
B D                     Cat  gaatgctg
B D                     Dog  tattgcta
B D                 Ferret   caatgcta
B D                   Panda  cagtggta
             Pacific walrus  caatgcta
               Weddell seal  caatgcta
            Star-nosed mole  tggagttg
B D                Elephant  tgatgcta
B D                 Manatee  cgatgcta
                   Aardvark  tgatgcta
B D               Armadillo  caaggcta
B D                   Shrew  NNNNNNNN
B D                     Rat  ========
B D                   Mouse  ========
       Cape elephant shrew  ========
              Prairie vole  ========
B D                Hedgehog  ========
             Big brown bat  --------
B D                Microbat  ========
      David's myotis (bat)  ========
B D                  Turkey  ========
B D                 Megabat  ========
    Lesser Egyptian jerboa  ========
          Brush-tailed rat  ========
B D                  Tenrec  ========
            Golden hamster  ========
B D         Chinese hamster  ========
B D                Squirrel  --------
          Black flying-fox  ========
B D                   Horse  ========
  D        Peregrine falcon  ========
        Tibetan ground jay  ========
  D            Mallard duck  ========
B D     Medium ground finch  ========
  D  White-throated sparrow  ========
          Cape golden mole  ========
  D     Collared flycatcher  ========
  D            Saker falcon  ========
B D              Budgerigar  ========
B D         Tasmanian devil  ========
B D                Platypus  ========
B D             Zebra finch  ========
  D         Green seaturtle  ========
B D                 Chicken  ========
B D                Bushbaby  ========
B D      American alligator  ========
B D                Marmoset  ========
  D             Rock pigeon  ========
B D         Squirrel monkey  NNNNNNNN
B D        White rhinoceros  ========
B D                 Opossum  ========
  D          Painted turtle  ========

Alignment block 2 of 1207 in window, 127836626 - 127836636, 11 bps 
B D                   Human  actgctaat--aa
B D                   Chimp  actgctaat--aa
B D                 Gorilla  actgctaat--aa
B D               Orangutan  actgctaat--aa
B D                  Gibbon  actgctaat--aa
B D                  Rhesus  actgctaat--aa
B D     Crab-eating macaque  actgctaat--aa
B D                  Baboon  actgctaat--aa
B D            Green monkey  actgctaat--aa
B D                Marmoset  attgctaat--ag
         Chinese tree shrew  actgctagt--aa
B D          Naked mole-rat  actgcccct--aa
B D              Guinea pig  atccctcct--aa
                 Chinchilla  gctgctgct--ga
B D                  Rabbit  attgctaac--aa
B D                    Pika  atagccaac--gg
B D                     Pig  attgctaat--ca
B D                  Alpaca  attgctaattgct
             Bactrian camel  attgctaattgct
B D                 Dolphin  attgctaat--ca
               Killer whale  attgctaat--ca
           Tibetan antelope  attgctaat--ca
B D                     Cow  attgctaat--ca
B D                   Sheep  attgctaat--ca
              Domestic goat  attgctaat--ca
B D                     Cat  actgctgaa--aa
B D                     Dog  actgccagt--aa
B D                 Ferret   cgtgctgat--aa
B D                   Panda  cttgctga-----
             Pacific walrus  cttgctgat--aa
               Weddell seal  cttgctgat--aa
            Star-nosed mole  atcgctaat--aa
B D                Elephant  ---attaat--ag
B D                 Manatee  ---atgaat--aa
                   Aardvark  ---attaat--aa
B D               Armadillo  ---at-aat--aa
B D                   Shrew  NNNNNNNNNNNNN
B D                     Rat  =============
B D                   Mouse  =============
       Cape elephant shrew  =============
              Prairie vole  =============
B D                Hedgehog  =============
             Big brown bat  -------------
B D                Microbat  =============
      David's myotis (bat)  =============
B D                  Turkey  =============
B D                 Megabat  =============
    Lesser Egyptian jerboa  =============
          Brush-tailed rat  =============
B D                  Tenrec  =============
            Golden hamster  =============
B D         Chinese hamster  =============
B D                Squirrel  -------------
          Black flying-fox  =============
B D                   Horse  =============
  D        Peregrine falcon  =============
        Tibetan ground jay  =============
  D            Mallard duck  =============
B D     Medium ground finch  =============
  D  White-throated sparrow  =============
          Cape golden mole  =============
  D     Collared flycatcher  =============
  D            Saker falcon  =============
B D              Budgerigar  =============
B D         Tasmanian devil  =============
B D                Platypus  =============
B D             Zebra finch  =============
  D         Green seaturtle  =============
B D                 Chicken  =============
B D                Bushbaby  =============
B D      American alligator  =============
  D             Rock pigeon  =============
B D         Squirrel monkey  NNNNNNNNNNNNN
B D        White rhinoceros  =============
B D                 Opossum  =============
  D          Painted turtle  =============

Inserts between block 2 and 3 in window
        Chinese tree shrew 235bp

Alignment block 3 of 1207 in window, 127836637 - 127836641, 5 bps 
B D                   Human  taaaa
B D                   Chimp  taaaa
B D                 Gorilla  taaaa
B D               Orangutan  taaaa
B D                  Gibbon  taaaa
B D                  Rhesus  taaaa
B D     Crab-eating macaque  taaaa
B D                  Baboon  taaaa
B D            Green monkey  taaaa
B D                Marmoset  taaaa
B D          Naked mole-rat  tgcga
B D              Guinea pig  tgaga
                 Chinchilla  tgaga
B D                  Rabbit  caaaa
B D                    Pika  cgaaa
B D                     Pig  taaaa
B D                  Alpaca  taaaa
             Bactrian camel  taaaa
B D                 Dolphin  taaaa
               Killer whale  taaaa
           Tibetan antelope  taaaa
B D                     Cow  taaaa
B D                   Sheep  taaaa
              Domestic goat  taaaa
B D                     Cat  tgaga
B D                     Dog  tgaaa
B D                 Ferret   tgaaa
B D                   Panda  --acg
             Pacific walrus  tgaaa
               Weddell seal  tgaaa
            Star-nosed mole  gaaaa
B D                Elephant  taaaa
B D                 Manatee  tacag
                   Aardvark  taaaa
B D               Armadillo  aaaa-
B D                   Shrew  NNNNN
B D                     Rat  =====
B D                   Mouse  =====
       Cape elephant shrew  =====
              Prairie vole  =====
B D                Hedgehog  =====
             Big brown bat  -----
B D                Microbat  =====
      David's myotis (bat)  =====
B D                  Turkey  =====
B D                 Megabat  =====
    Lesser Egyptian jerboa  =====
          Brush-tailed rat  =====
B D                  Tenrec  =====
            Golden hamster  =====
B D         Chinese hamster  =====
B D                Squirrel  -----
        Chinese tree shrew  =====
          Black flying-fox  =====
B D                   Horse  =====
  D        Peregrine falcon  =====
        Tibetan ground jay  =====
  D            Mallard duck  =====
B D     Medium ground finch  =====
  D  White-throated sparrow  =====
          Cape golden mole  =====
  D     Collared flycatcher  =====
  D            Saker falcon  =====
B D              Budgerigar  =====
B D         Tasmanian devil  =====
B D                Platypus  =====
B D             Zebra finch  =====
  D         Green seaturtle  =====
B D                 Chicken  =====
B D                Bushbaby  =====
B D      American alligator  =====
  D             Rock pigeon  =====
B D         Squirrel monkey  NNNNN
B D        White rhinoceros  =====
B D                 Opossum  =====
  D          Painted turtle  =====

Inserts between block 3 and 4 in window
B D         Naked mole-rat 2bp
B D             Guinea pig 3bp
                Chinchilla 3bp
B D                 Rabbit 3bp
B D                   Pika 3bp

Alignment block 4 of 1207 in window, 127836642 - 127836643, 2 bps 
B D                   Human  ta
B D                   Chimp  ta
B D                 Gorilla  ta
B D               Orangutan  ta
B D                  Gibbon  ta
B D                  Rhesus  ta
B D     Crab-eating macaque  ta
B D                  Baboon  ta
B D            Green monkey  ta
B D                Marmoset  ta
         Chinese tree shrew  ta
B D          Naked mole-rat  ta
B D              Guinea pig  ta
                 Chinchilla  ta
B D                  Rabbit  tt
B D                    Pika  ct
B D                     Pig  ta
B D                  Alpaca  ta
             Bactrian camel  ta
B D                 Dolphin  ta
               Killer whale  ta
           Tibetan antelope  ta
B D                     Cow  ta
B D                   Sheep  ta
              Domestic goat  ta
B D                     Cat  ta
B D                     Dog  ta
B D                 Ferret   ta
B D                   Panda  ta
             Pacific walrus  ga
               Weddell seal  ga
            Star-nosed mole  tc
B D                Elephant  ta
B D                 Manatee  ta
                   Aardvark  ca
B D                   Shrew  NN
B D                     Rat  ==
B D                   Mouse  ==
       Cape elephant shrew  ==
              Prairie vole  ==
B D                Hedgehog  ==
             Big brown bat  --
B D                Microbat  ==
      David's myotis (bat)  ==
B D                  Turkey  ==
B D                 Megabat  ==
    Lesser Egyptian jerboa  ==
          Brush-tailed rat  ==
B D                  Tenrec  ==
            Golden hamster  ==
B D         Chinese hamster  ==
B D                Squirrel  --
B D               Armadillo  --
          Black flying-fox  ==
B D                   Horse  ==
  D        Peregrine falcon  ==
        Tibetan ground jay  ==
  D            Mallard duck  ==
B D     Medium ground finch  ==
  D  White-throated sparrow  ==
          Cape golden mole  ==
  D     Collared flycatcher  ==
  D            Saker falcon  ==
B D              Budgerigar  ==
B D         Tasmanian devil  ==
B D                Platypus  ==
B D             Zebra finch  ==
  D         Green seaturtle  ==
B D                 Chicken  ==
B D                Bushbaby  ==
B D      American alligator  ==
  D             Rock pigeon  ==
B D         Squirrel monkey  NN
B D        White rhinoceros  ==
B D                 Opossum  ==
  D          Painted turtle  ==

Inserts between block 4 and 5 in window
B D                 Rabbit 9bp
B D                    Pig 3bp
B D                 Alpaca 3bp
            Bactrian camel 3bp
B D                Dolphin 3bp
              Killer whale 3bp
                  Aardvark 1457bp

Alignment block 5 of 1207 in window, 127836644 - 127836648, 5 bps 
B D                   Human  agaac
B D                   Chimp  agaat
B D                 Gorilla  agaac
B D               Orangutan  agaac
B D                  Gibbon  agaac
B D                  Rhesus  agaac
B D     Crab-eating macaque  agaac
B D                  Baboon  agaac
B D            Green monkey  agaac
B D                Marmoset  agaat
         Chinese tree shrew  agaat
B D          Naked mole-rat  ggact
B D              Guinea pig  agagt
                 Chinchilla  aggat
B D                  Rabbit  ggagc
B D                     Pig  cgagc
B D                  Alpaca  acaac
             Bactrian camel  ggaac
B D                 Dolphin  agaac
               Killer whale  agaac
           Tibetan antelope  agaat
B D                     Cow  agaat
B D                   Sheep  agaat
              Domestic goat  agaat
B D                     Cat  atagc
B D                     Dog  ataac
B D                 Ferret   atagc
B D                   Panda  atagc
             Pacific walrus  atagc
               Weddell seal  atagc
            Star-nosed mole  acaag
B D                Elephant  agaac
B D                 Manatee  agaac
B D               Armadillo  aggat
B D                   Shrew  NNNNN
B D                     Rat  =====
B D                   Mouse  =====
       Cape elephant shrew  =====
              Prairie vole  =====
B D                Hedgehog  =====
             Big brown bat  -----
B D                Microbat  =====
      David's myotis (bat)  =====
B D                  Turkey  =====
B D                 Megabat  =====
    Lesser Egyptian jerboa  =====
          Brush-tailed rat  =====
B D                  Tenrec  =====
            Golden hamster  =====
B D         Chinese hamster  =====
B D                Squirrel  -----
B D                    Pika  -----
          Black flying-fox  =====
B D                   Horse  =====
  D        Peregrine falcon  =====
        Tibetan ground jay  =====
  D            Mallard duck  =====
B D     Medium ground finch  =====
  D  White-throated sparrow  =====
          Cape golden mole  =====
  D     Collared flycatcher  =====
  D            Saker falcon  =====
B D              Budgerigar  =====
B D         Tasmanian devil  =====
B D                Platypus  =====
B D             Zebra finch  =====
  D         Green seaturtle  =====
B D                 Chicken  =====
B D                Bushbaby  =====
B D      American alligator  =====
  D             Rock pigeon  =====
B D         Squirrel monkey  NNNNN
B D        White rhinoceros  =====
B D                 Opossum  =====
                  Aardvark  =====
  D          Painted turtle  =====

Inserts between block 5 and 6 in window
B D                    Pig 5bp
B D                    Cow 259bp

Alignment block 6 of 1207 in window, 127836649 - 127836667, 19 bps 
B D                   Human  g--t--aaaa------------gagtgcttacagt
B D                   Chimp  g--t--aaaa------------gagtgcttacagt
B D                 Gorilla  g--t--aaaa------------gagtgcttacagt
B D               Orangutan  g--t--aaaa------------gagtgcttacagt
B D                  Gibbon  g--t--aaaa------------gagtgcttacagt
B D                  Rhesus  g--t--aaaa------------gagtgcttatagt
B D     Crab-eating macaque  g--t--aaaa------------gagtgcttatagt
B D                  Baboon  g--t--aaaa------------gagtgcttatagt
B D            Green monkey  g--t--aaaa------------gagtgcttatagt
B D                Marmoset  g--t--aaaa------------gagtgcttctagt
         Chinese tree shrew  a--t--gaaaaaagaacttcctgagtacttgcagt
B D          Naked mole-rat  g--t--gc---------------------cgtgct
B D              Guinea pig  g--t--cct-------------cagggctcgtgct
                 Chinchilla  g--t--cct-------------gagggcctgcgct
B D                  Rabbit  a--c--tt---------------------cctgat
B D                     Pig  ----------------------gtatgcttgcagg
B D                  Alpaca  ---t--cact------------gagtgctggcagt
             Bactrian camel  ---t--cacc------------gagtgctggcagt
B D                 Dolphin  ---t--tact------------gagcgcttgcact
               Killer whale  ---t--tact------------gagcgcttgcact
           Tibetan antelope  ---------t------------tggtgcttgcggg
B D                   Sheep  ---------t------------tggtgcttgcagg
              Domestic goat  ---------t------------tggtgcttgcagg
B D                     Cat  ---t--catg------------gggctcttaggat
B D                     Dog  ---t--tatg------------gagctcttgcttt
B D                 Ferret   ---t--tgtg------------ctgctcttgttct
B D                   Panda  ---t--tatg------------gacctcttgt---
             Pacific walrus  ---t--tatg------------gagctcttgctct
               Weddell seal  ---g--tatg------------gagctcttgctct
            Star-nosed mole  gatt--tatt------------gagggcttgcaac
B D                Elephant  ---c--tact------------gagcacttgtaat
B D                 Manatee  ---t--tgct------------gagcgcttgtaat
B D               Armadillo  ---aaggact------------gagtgcttgcgat
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ===================================
B D                   Mouse  ===================================
       Cape elephant shrew  ===================================
              Prairie vole  ===================================
B D                Hedgehog  ===================================
             Big brown bat  -----------------------------------
B D                Microbat  ===================================
      David's myotis (bat)  ===================================
B D                  Turkey  ===================================
B D                 Megabat  ===================================
    Lesser Egyptian jerboa  ===================================
          Brush-tailed rat  ===================================
B D                  Tenrec  ===================================
            Golden hamster  ===================================
B D         Chinese hamster  ===================================
B D                Squirrel  -----------------------------------
B D                    Pika  -----------------------------------
B D                     Cow  ===================================
          Black flying-fox  ===================================
B D                   Horse  ===================================
  D        Peregrine falcon  ===================================
        Tibetan ground jay  ===================================
  D            Mallard duck  ===================================
B D     Medium ground finch  ===================================
  D  White-throated sparrow  ===================================
          Cape golden mole  ===================================
  D     Collared flycatcher  ===================================
  D            Saker falcon  ===================================
B D              Budgerigar  ===================================
B D         Tasmanian devil  ===================================
B D                Platypus  ===================================
B D             Zebra finch  ===================================
  D         Green seaturtle  ===================================
B D                 Chicken  ===================================
B D                Bushbaby  ===================================
B D      American alligator  ===================================
  D             Rock pigeon  ===================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ===================================
B D                 Opossum  ===================================
                  Aardvark  ===================================
  D          Painted turtle  ===================================

Inserts between block 6 and 7 in window
          Tibetan antelope 120bp
B D                  Sheep 120bp
             Domestic goat 120bp

Alignment block 7 of 1207 in window, 127836668 - 127836709, 42 bps 
B D                   Human  gtgttacaggcactgc-tttaagtg------------------------ca-------------------
B D                   Chimp  gtgttacaggcactgc-tttaagtg------------------------ca-------------------
B D                 Gorilla  gtgttacaagcgctgc-tttaagta------------------------ca-------------------
B D               Orangutan  gttttacaggtgctgc-tttaagtg------------------------ca-------------------
B D                  Gibbon  gtgttacaggcactgc-tttaagtg------------------------ca-------------------
B D                  Rhesus  gtgttgtaggtgctgc-tttatgtg------------------------ca-------------------
B D     Crab-eating macaque  gtgttgtaggtgctgc-tttatgtg------------------------ca-------------------
B D                  Baboon  gtgttgtaggcactgc-tttatgtg------------------------ca-------------------
B D            Green monkey  gtgttataggcgctgc-tttatgtg------------------------ca-------------------
B D                Marmoset  gtgttatagacgctgc-tttatgtg------------------------ca-------------------
         Chinese tree shrew  gtgctgcacgctctgc-tacatgtgatatgaaaaaagaacttcctgagtac-------------------
B D          Naked mole-rat  gcagcacgggctcac--tgtgtggg------------------------ct-------------------
B D              Guinea pig  gtgacacaggcgcat--ttgatgag------------------------ct-------------------
                 Chinchilla  gcgacacaggctcat--tttatggg------------------------ct-------------------
B D                  Rabbit  gtgttgcaggcacagc-tggctgtg------------------------ca-------------------
B D                    Pika  -------aggcacaacttgtctggg------------------------ca-------------------
B D                     Pig  gtgt--caggcactac-tttgtgta------------------------ct-------------------
B D                  Alpaca  gcgt--caggcactgc-tttatgtg------------------------tg-------------------
             Bactrian camel  gcgt--caggcactgc-tttatgta------------------------tg-------------------
B D                 Dolphin  gcgt--caggcactgc-tttatgtg------------------------cg-------------------
               Killer whale  gtgt--caggcactgc-ttcatgta------------------------cg-------------------
B D                     Cat  atgc--caggcactgc-tttacatg-------------------------a-------------------
B D                     Dog  atg----------tgc-atta-------------------------------------------------
B D                 Ferret   atg----------tgc-acta-------------------------------------------------
B D                   Panda  --------------gc-atta-------------------------------------------------
             Pacific walrus  gtg----------ggc-ctta-------------------------------------------------
               Weddell seal  gtg----------ggc-cttac------------------------------------------------
            Star-nosed mole  gggt--caggcactgc-tttatgtt------------------------ca-------------------
B D                Elephant  --------------------------------------------------g-------------------
B D                 Manatee  --------------------------------------------------g-------------------
B D               Armadillo  --------------------------------------------------gtgtcagaccctgctttatg
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
       Cape elephant shrew  ======================================================================
              Prairie vole  ======================================================================
B D                Hedgehog  ======================================================================
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                  Turkey  ======================================================================
B D                 Megabat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
B D                     Cow  ======================================================================
          Tibetan antelope  ======================================================================
          Black flying-fox  ======================================================================
B D                   Horse  ======================================================================
  D        Peregrine falcon  ======================================================================
        Tibetan ground jay  ======================================================================
  D            Mallard duck  ======================================================================
B D     Medium ground finch  ======================================================================
  D  White-throated sparrow  ======================================================================
          Cape golden mole  ======================================================================
  D     Collared flycatcher  ======================================================================
  D            Saker falcon  ======================================================================
B D              Budgerigar  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
B D             Zebra finch  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Bushbaby  ======================================================================
B D      American alligator  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ======================================================================
B D                 Opossum  ======================================================================
                  Aardvark  ======================================================================
  D          Painted turtle  ======================================================================

                      Human  ---------ttacg-----t--------------------catttag------ttt
                      Chimp  ---------ttacg-----t--------------------catttag------ttt
                    Gorilla  ---------ttaca-----t--------------------catttag------ttt
                  Orangutan  ---------ttaca-----t--------------------catttag------ttt
                     Gibbon  ---------ttaca-----t--------------------catttag------ttt
                     Rhesus  ---------ttaca-----t--------------------catttag------ttt
        Crab-eating macaque  ---------ttaca-----t--------------------catttag------ttt
                     Baboon  ---------ttaca-----t--------------------catttag------ttt
               Green monkey  ---------ttaca-----t--------------------catttag------ttt
                   Marmoset  ---------ttaca-----a--------------------catttac------ttt
         Chinese tree shrew  ---------ttgca-----g--------------------cgtgttgcacgctctg
             Naked mole-rat  ---------ttaca-----t--------------------cacttca------tgg
                 Guinea pig  ---------tttaatccatt--------------------cgcttta------ccg
                 Chinchilla  ---------ttaaa-----t--------------------cacttaa------ctg
                     Rabbit  ---------tcgaa-----t--------------------catttaa------ttc
                       Pika  ---------ttgga-----t--------------------tgtttaa------ttc
                        Pig  ---------tt--g-----t--------------------cttc------------
                     Alpaca  ---------ctaag-----g--------------------ctcc------------
             Bactrian camel  ---------ctaag-----g--------------------ctcc------------
                    Dolphin  ---------ttata-----t--------------------gtct------------
               Killer whale  ---------ttatg-----t--------------------gccc------------
                        Cat  ---------ttaaa-----c--------------------ttcc------------
                        Dog  ------------ag-----t--------------------ctcc------------
                    Ferret   ------------ag-----t--------------------ctcc------------
                      Panda  ------------ag-----t--------------------ctcc------------
             Pacific walrus  --------------------------------------------------------
               Weddell seal  ---------ttaag-----t--------------------ctcc------------
            Star-nosed mole  ---------ttaaa-----tcacttacttcccccagctacctcc------------
                   Elephant  ---------ctaat-----t--------------------c---------------
                    Manatee  ---------ctaat-----t--------------------c---------------
                  Armadillo  tatagtcgtttaat-----t--------------------c---------------
                      Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Rat  ========================================================
                      Mouse  ========================================================
        Cape elephant shrew  ========================================================
               Prairie vole  ========================================================
                   Hedgehog  ========================================================
              Big brown bat  --------------------------------------------------------
                   Microbat  ========================================================
       David's myotis (bat)  ========================================================
                     Turkey  ========================================================
                    Megabat  ========================================================
     Lesser Egyptian jerboa  ========================================================
           Brush-tailed rat  ========================================================
                     Tenrec  ========================================================
             Golden hamster  ========================================================
            Chinese hamster  ========================================================
                   Squirrel  --------------------------------------------------------
              Domestic goat  ========================================================
                      Sheep  ========================================================
                        Cow  ========================================================
           Tibetan antelope  ========================================================
           Black flying-fox  ========================================================
                      Horse  ========================================================
           Peregrine falcon  ========================================================
         Tibetan ground jay  ========================================================
               Mallard duck  ========================================================
        Medium ground finch  ========================================================
     White-throated sparrow  ========================================================
           Cape golden mole  ========================================================
        Collared flycatcher  ========================================================
               Saker falcon  ========================================================
                 Budgerigar  ========================================================
            Tasmanian devil  ========================================================
                   Platypus  ========================================================
                Zebra finch  ========================================================
            Green seaturtle  ========================================================
                    Chicken  ========================================================
                   Bushbaby  ========================================================
         American alligator  ========================================================
                Rock pigeon  ========================================================
            Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           White rhinoceros  ========================================================
                    Opossum  ========================================================
                   Aardvark  ========================================================
             Painted turtle  ========================================================

Alignment block 8 of 1207 in window, 127836710 - 127836723, 14 bps 
B D                   Human  ccaca-----------------gttgtctcc
B D                   Chimp  ccaca-----------------gttgtctcc
B D                 Gorilla  ccaca-----------------gttgtctcc
B D               Orangutan  ccaca-----------------gttgtctcc
B D                  Gibbon  ccaca-----------------gttgtctcc
B D                  Rhesus  ccaca-----------------gttgtctcc
B D     Crab-eating macaque  ccaca-----------------gttgtctcc
B D                  Baboon  ccaca-----------------gttgtgtcc
B D            Green monkey  ccaca-----------------gttgtctcc
B D                Marmoset  ccata-----------------attgtctcc
         Chinese tree shrew  ctacatgttaagtcatgatcccgtagtcttt
B D          Naked mole-rat  cctgc-----------------gtcc-----
B D              Guinea pig  cctgt-----------------ggcc-----
                 Chinchilla  cctgt-----------------gtcc-----
B D                  Rabbit  ccac------------------gttgtctcc
B D                    Pika  tcaca-----------------gttgt----
B D                Elephant  ccata-----------------gttgtctcc
B D                 Manatee  ccata-----------------gttgtcccc
                   Aardvark  ccatg-----------------gttgtctct
B D               Armadillo  ccata-----------------gttgtctcc
           Star-nosed mole  -------------------------------
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ===============================
B D                   Mouse  ===============================
       Cape elephant shrew  ===============================
              Prairie vole  ===============================
B D                Hedgehog  ===============================
             Big brown bat  -------------------------------
B D                Microbat  ===============================
      David's myotis (bat)  ===============================
B D                  Turkey  ===============================
            Bactrian camel  -------------------------------
B D                  Alpaca  -------------------------------
B D                 Megabat  ===============================
    Lesser Egyptian jerboa  ===============================
          Brush-tailed rat  ===============================
B D                   Panda  -------------------------------
B D                  Tenrec  ===============================
            Golden hamster  ===============================
B D         Chinese hamster  ===============================
B D                Squirrel  -------------------------------
B D                 Ferret   -------------------------------
B D                     Cat  -------------------------------
B D                     Dog  -------------------------------
             Domestic goat  ===============================
B D                   Sheep  ===============================
B D                     Cow  ===============================
          Tibetan antelope  ===============================
              Killer whale  -------------------------------
          Black flying-fox  ===============================
B D                   Horse  ===============================
  D        Peregrine falcon  ===============================
        Tibetan ground jay  ===============================
  D            Mallard duck  ===============================
B D     Medium ground finch  ===============================
  D  White-throated sparrow  ===============================
          Cape golden mole  ===============================
  D     Collared flycatcher  ===============================
  D            Saker falcon  ===============================
B D              Budgerigar  ===============================
B D         Tasmanian devil  ===============================
B D                Platypus  ===============================
B D             Zebra finch  ===============================
  D         Green seaturtle  ===============================
B D                 Chicken  ===============================
B D                Bushbaby  ===============================
B D      American alligator  ===============================
  D             Rock pigeon  ===============================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Dolphin  -------------------------------
              Weddell seal  -------------------------------
            Pacific walrus  -------------------------------
B D        White rhinoceros  ===============================
B D                 Opossum  ===============================
  D          Painted turtle  ===============================
B D                     Pig  -------------------------------

Inserts between block 8 and 9 in window
B D         Naked mole-rat 65bp
B D             Guinea pig 2bp
                Chinchilla 2bp

Alignment block 9 of 1207 in window, 127836724 - 127836728, 5 bps 
B D                   Human  atgtt
B D                   Chimp  atgtt
B D                 Gorilla  atgtt
B D               Orangutan  atgtt
B D                  Gibbon  gtgtt
B D                  Rhesus  gtgtt
B D     Crab-eating macaque  gtgtt
B D                  Baboon  gtgtt
B D            Green monkey  gtgtt
B D                Marmoset  atgtt
         Chinese tree shrew  gtttt
B D                  Rabbit  gtttt
B D                     Pig  atttt
B D                  Alpaca  atttt
             Bactrian camel  atttt
B D                 Dolphin  atttt
               Killer whale  atttt
B D                     Cat  gtttc
B D                     Dog  atctt
B D                 Ferret   gtcgt
B D                   Panda  atctc
             Pacific walrus  --ctt
               Weddell seal  atctt
            Star-nosed mole  actt-
B D                Elephant  gtttt
B D                 Manatee  atttt
                   Aardvark  gtttc
B D               Armadillo  atttt
B D                   Shrew  NNNNN
B D                     Rat  =====
B D                   Mouse  =====
       Cape elephant shrew  =====
              Prairie vole  =====
B D                Hedgehog  =====
             Big brown bat  -----
B D                Microbat  =====
      David's myotis (bat)  =====
B D                  Turkey  =====
B D                 Megabat  =====
    Lesser Egyptian jerboa  =====
          Brush-tailed rat  =====
B D                  Tenrec  =====
            Golden hamster  =====
B D         Chinese hamster  =====
                Chinchilla  =====
B D              Guinea pig  =====
B D          Naked mole-rat  =====
B D                Squirrel  -----
             Domestic goat  =====
B D                    Pika  -----
B D                   Sheep  =====
B D                     Cow  =====
          Tibetan antelope  =====
          Black flying-fox  =====
B D                   Horse  =====
  D        Peregrine falcon  =====
        Tibetan ground jay  =====
  D            Mallard duck  =====
B D     Medium ground finch  =====
  D  White-throated sparrow  =====
          Cape golden mole  =====
  D     Collared flycatcher  =====
  D            Saker falcon  =====
B D              Budgerigar  =====
B D         Tasmanian devil  =====
B D                Platypus  =====
B D             Zebra finch  =====
  D         Green seaturtle  =====
B D                 Chicken  =====
B D                Bushbaby  =====
B D      American alligator  =====
  D             Rock pigeon  =====
B D         Squirrel monkey  NNNNN
B D        White rhinoceros  =====
B D                 Opossum  =====
  D          Painted turtle  =====

Alignment block 10 of 1207 in window, 127836729 - 127836744, 16 bps 
B D                   Human  acagagga-----gaggactg
B D                   Chimp  acagagga-----gaggactg
B D                 Gorilla  acagagga-----gaggactg
B D               Orangutan  acagagga-----gaggactg
B D                  Gibbon  acagagga-----gaggaccg
B D                  Rhesus  acagagga-----gagggctg
B D     Crab-eating macaque  acagagga-----gagggctg
B D                  Baboon  acaaagga-----gagggctg
B D            Green monkey  acagagga-----gagggctg
B D                Marmoset  acagaggg-----gaagactg
         Chinese tree shrew  acggagga-----ggaggctg
B D              Guinea pig  ------------------cta
                 Chinchilla  ------------------cca
B D                  Rabbit  atacagga-----ggagactg
B D                    Pika  ------------------ctg
B D                     Pig  acagaaga-----gaagactt
B D                  Alpaca  acagagga-----gaagactt
             Bactrian camel  acagagga-----gaagactt
B D                 Dolphin  acagagga-----gaagac--
               Killer whale  acagagga-----gaagactt
           Tibetan antelope  acagaggagcctggcaggctg
B D                   Sheep  acagaggagcctggcaggctg
              Domestic goat  acagaggagcctggcaggctg
B D                     Cat  acagagga-----ggtgact-
B D                     Dog  acagagga-----ggtgacc-
B D                 Ferret   atggagga------gtgccc-
B D                   Panda  acggagga-----ggtgacc-
             Pacific walrus  acagagga-----ggtgacc-
               Weddell seal  acagagga-----ggtgacc-
            Star-nosed mole  ctggagga-----ggaggct-
B D                Elephant  acagaggg-----ggagagtg
B D                 Manatee  acagaggg-----ggagagtg
                   Aardvark  acaga--------gaagagtg
B D               Armadillo  acagaggg-----ggcgactg
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNN
B D                     Rat  =====================
B D                   Mouse  =====================
       Cape elephant shrew  =====================
              Prairie vole  =====================
B D                Hedgehog  =====================
             Big brown bat  ---------------------
B D                Microbat  =====================
      David's myotis (bat)  =====================
B D                  Turkey  =====================
B D                 Megabat  =====================
    Lesser Egyptian jerboa  =====================
          Brush-tailed rat  =====================
B D                  Tenrec  =====================
            Golden hamster  =====================
B D         Chinese hamster  =====================
B D          Naked mole-rat  =====================
B D                Squirrel  ---------------------
B D                     Cow  =====================
          Black flying-fox  =====================
B D                   Horse  =====================
  D        Peregrine falcon  =====================
        Tibetan ground jay  =====================
  D            Mallard duck  =====================
B D     Medium ground finch  =====================
  D  White-throated sparrow  =====================
          Cape golden mole  =====================
  D     Collared flycatcher  =====================
  D            Saker falcon  =====================
B D              Budgerigar  =====================
B D         Tasmanian devil  =====================
B D                Platypus  =====================
B D             Zebra finch  =====================
  D         Green seaturtle  =====================
B D                 Chicken  =====================
B D                Bushbaby  =====================
B D      American alligator  =====================
  D             Rock pigeon  =====================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  =====================
B D                 Opossum  =====================
  D          Painted turtle  =====================

Inserts between block 10 and 11 in window
B D                    Pig 4bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 89bp
B D                  Sheep 89bp
             Domestic goat 89bp
B D                    Cat 5bp
B D                    Dog 5bp
B D                Ferret  8bp
B D                  Panda 5bp
            Pacific walrus 5bp
              Weddell seal 5bp

Alignment block 11 of 1207 in window, 127836745 - 127836792, 48 bps 
B D                   Human  aggcacagagtattac-----aataagaaacttggcccacagtcagcg------agca--a
B D                   Chimp  aggcacagagtattac-----aataagaaacttggcccacagtcagcg------agca--a
B D                 Gorilla  aggcacagagtattac-----aataagaaacttggcccacagtcagcg------agca--a
B D               Orangutan  aggcacagagtattac-----aataagaaacgtggcccacagtcagcg------agca--a
B D                  Gibbon  aggcacaaagtattac-----aataagaaacttggcgcacagtcagca------agca--a
B D                  Rhesus  aggcacagagtattac-----aataagaaatttggcccgcagtcagca------agca--a
B D     Crab-eating macaque  aggcacagagtattac-----aataagaaatttggcccgcagtcagca------agca--a
B D                  Baboon  aggcacagagtattac-----aataagaaatttggcccacagtcagca------agca--a
B D            Green monkey  aggcacagagtattac-----aataagaaatttggcccacagtcagca------agca--a
B D                Marmoset  aggcacagag----ac-----aataagaaacttggcccacagtcagcg------agca--a
         Chinese tree shrew  agacagggag----ag-----aataagaaatttgccccatagacagca------agca--a
B D              Guinea pig  ttgcctgagg----ag-----a------------------ggacagga------caga--g
                 Chinchilla  ttgcccgagg----ag-----a------------------tgacagga------caga--g
B D                  Rabbit  gggcacattg----ag-----aataaggagcttgtcctgcagatggggatggaacggc--g
B D                    Pika  aagcacaggg----aa-----aataaggagcttgttctgcagatgggg------tgaa--g
B D                     Pig  --gcatggag----a-----cgctaagaaacttgtttcccaggcagta------ggta--g
B D                  Alpaca  --------------------aacccagaga---gtgttccagacagtt------agca--g
             Bactrian camel  --------------------aacccagaga---atgtcccagacagta------agca--g
B D                 Dolphin  --acacagag----ag-----gttaagaaatttgtttccccgacagta------agca--g
               Killer whale  --acacagag----aa-----gttaagaaacttgtttcccagacagta------agca-gg
           Tibetan antelope  --gtatatta----agtttccattgagaaacatgtttcccagacagta------agca--g
B D                     Cow  --gtgtatta----agtttccattaagaaacttgtttcccacacagta------agca--g
B D                   Sheep  --gtatgtta----agtttccattgagaaacatgtttcccagacagta------agca--g
              Domestic goat  --gtatatt------gtttccattgagaaacatgtttcccagacagta------agca--g
B D                     Cat  --acccagag----ag-----gttaagaaac-----ccacaaacaatg------tgca--g
B D                     Dog  --ctccagag----ag-----gttaagaga------ctgcaaacaatg------atca--g
B D                 Ferret   --acccagag----ag-----gctgggaga------ccacacgttata------agc---g
B D                   Panda  --acccagag----ag-----gttgggaga------ccacagacaatg------agca--g
             Pacific walrus  --acccagag----aa-----gttggcaga------ccacagacaatg------agca--g
               Weddell seal  --acccagag----ag-----gttggcaga------ccacagacaatg------agca--g
            Star-nosed mole  -----------------------------------tcctgaaacagcg------agca--g
B D                Elephant  agacacagag----tg-----gttaagacacttacttcacaggtggtg------ag-----
B D                 Manatee  agacatagag----ag-----gataagaaacttagcccacagacggtg------aggg---
                   Aardvark  agacgcagag----gc-----gt--ggaaatgtgcgacacaggcagcg------aggg---
B D               Armadillo  agacacagag-----------gttaagaaacttgtcccactgagcgtg------agtgc--
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  =============================================================
B D                   Mouse  =============================================================
       Cape elephant shrew  =============================================================
              Prairie vole  =============================================================
B D                Hedgehog  =============================================================
             Big brown bat  -------------------------------------------------------------
B D                Microbat  =============================================================
      David's myotis (bat)  =============================================================
B D                  Turkey  =============================================================
B D                 Megabat  =============================================================
    Lesser Egyptian jerboa  =============================================================
          Brush-tailed rat  =============================================================
B D                  Tenrec  =============================================================
            Golden hamster  =============================================================
B D         Chinese hamster  =============================================================
B D          Naked mole-rat  =============================================================
B D                Squirrel  -------------------------------------------------------------
          Black flying-fox  =============================================================
B D                   Horse  =============================================================
  D        Peregrine falcon  =============================================================
        Tibetan ground jay  =============================================================
  D            Mallard duck  =============================================================
B D     Medium ground finch  =============================================================
  D  White-throated sparrow  =============================================================
          Cape golden mole  =============================================================
  D     Collared flycatcher  =============================================================
  D            Saker falcon  =============================================================
B D              Budgerigar  =============================================================
B D         Tasmanian devil  =============================================================
B D                Platypus  =============================================================
B D             Zebra finch  =============================================================
  D         Green seaturtle  =============================================================
B D                 Chicken  =============================================================
B D                Bushbaby  =============================================================
B D      American alligator  =============================================================
  D             Rock pigeon  =============================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  =============================================================
B D                 Opossum  =============================================================
  D          Painted turtle  =============================================================

Inserts between block 11 and 12 in window
B D             Guinea pig 18bp
                Chinchilla 17bp
B D                 Rabbit 3bp
B D                   Pika 3bp

Alignment block 12 of 1207 in window, 127836793 - 127836964, 172 bps 
B D                   Human  gaaagcctagattcatacct-gggca-tatggcttcagagtccacacgcttggcgc-----ctgcactg-
B D                   Chimp  gaaagcctagattcatacct-gggca-tatggcttcagagtccacacgcttggcgc-----ctgcactg-
B D                 Gorilla  gaaagcctagattcatacct-gggca-tatggcttcacagtccacaag-ttggcgc-----ctgcactg-
B D               Orangutan  gaaagcctagattcatacct-gggca-tatggcttcagagtccacacgcttggcgc-----ctgcactg-
B D                  Gibbon  gaaagcctaaattcatacct-gggca-tatggcttcagagtccacacgcttggcgc-----ctgcactg-
B D                  Rhesus  gaaaacctagattcatacct-gggca-tatggcttcagagtccacacacttggcgt-----ctgcattg-
B D     Crab-eating macaque  gaaaacctagattcatacct-gggca-tatggcttcagagtccacacacttggcgt-----ctgcattg-
B D                  Baboon  gaaaacctagattcatacct-gggca-tatggcttcagagtccacacacttggcgt-----ctgcattg-
B D            Green monkey  gaaaacctagattcatacct-gggca-tatggcttcagagtccacacacttggcgt-----ctgcactg-
B D                Marmoset  gaaagcctcgattcagacct-gggca-cgtggcttcagagtccacacgcttggcttctgcactgcactg-
         Chinese tree shrew  g----cgtggactcagaccc-gggca-tgtggcttcagaggc--caaggttaacct-----ctgc-ctg-
B D          Naked mole-rat  ---------------------gagag-tgtggcct-------cacgcctggg---c-----caaagcc--
B D              Guinea pig  ---------------------gagcg-catg-----------caggcctgtgtccc-----cacagcc--
                 Chinchilla  ---------------------gggcg-tgag-----------taggcctgtgtccc-----cgcagcc--
B D                  Rabbit  -------------------------g-tggg------------ttggatttgcccc-----ttgtgcct-
B D                    Pika  -------------------------g-tggg-----------actgcatttgcatc-----caatactt-
B D                     Pig  gggatcctggattcaaatcc-agatgccacaacttcagagtctacacagttaactc-----ctgtgtca-
B D                  Alpaca  gagagcctggattcgaacct-gggcaccacagctccagagtctgcacatgtaactt-----ctgcacca-
             Bactrian camel  gagagcctggattcgaacct-gggtaccgcagctccagagtctgcacgtgtaactt-----ctgcacca-
B D                 Dolphin  ggggccctggcttcgaacct-gggcaccagggctgcagggtctcgacagttaactc-----ctgcacca-
               Killer whale  ggggccctggcttcgaacct-gggcaccagggctgcagggtctcgacagttaactc-----ctgcacca-
           Tibetan antelope  gggagctttgcttcacatct-gagtaacacggctgcaggg--ttgaca----------------tacca-
B D                     Cow  gggagcctggcttcaaatcc-gagcaccagggctgcaggg---tgaca----------------tacca-
B D                   Sheep  gggagctttgcttcagatcc-gagtaacatggctgcaggg--ttgaca----------------tacca-
              Domestic goat  gggagctttgcttcagatcc-gagtaacacagctgcaggg--ttgaca----------------tacca-
B D                     Cat  gggaggctggattcgaacct-gggccccatgtctgctggc---------ttaagtc-----ctgcccta-
B D                     Dog  g---gtctggatttgaacccgggcccccacatcatcaagc---------tgaactc-----ctgcacta-
B D                 Ferret   ggaagtttgcgttcgaaccc-gggccccacgtctgtgtgc---------tgaactc-----ctatgcaa-
B D                   Panda  gggagtctggattcgaaccc-aggccccagatctgcatgc---------tgaactc-----ctgtacta-
             Pacific walrus  gggagtctggattagaacccggggccccagatctgcgtgc---------tgaactc-----ctctccta-
               Weddell seal  gggtgtctggatttgaacccggggccccagatctgcatgc---------tgaactc-----ctgtacta-
            Star-nosed mole  gggagcctgggtttgaacca-gggcacctcagttgaagtc--tgcatgattcacgc-----tcgcactaa
B D                Elephant  ---------------------gga---tttggattcagagtccacaagcttaac-c-----ctgcgcca-
B D                 Manatee  -ggagcct-------------gga---tttggattcagagtccaagtgcttaac-c-----ctgcacta-
                   Aardvark  -g-------------------gta---ctgtggagcagagtccacatgcttaac-c-----ctgcctca-
B D               Armadillo  aggagcct-------------ggg---tctgaactcag-gccctgtggcttcgg-a-----gtctcctt-
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
       Cape elephant shrew  ======================================================================
              Prairie vole  ======================================================================
B D                Hedgehog  ======================================================================
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                  Turkey  ======================================================================
B D                 Megabat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
          Black flying-fox  ======================================================================
B D                   Horse  ======================================================================
  D        Peregrine falcon  ======================================================================
        Tibetan ground jay  ======================================================================
  D            Mallard duck  ======================================================================
B D     Medium ground finch  ======================================================================
  D  White-throated sparrow  ======================================================================
          Cape golden mole  ======================================================================
  D     Collared flycatcher  ======================================================================
  D            Saker falcon  ======================================================================
B D              Budgerigar  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
B D             Zebra finch  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Bushbaby  ======================================================================
B D      American alligator  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ======================================================================
B D                 Opossum  ======================================================================
  D          Painted turtle  ======================================================================

                      Human  -caccgagaggggctg---ctgg----gccgg------------------gagtcccccacctg-ctc--
                      Chimp  -caccgagaggggctg---ccgg----gccgg------------------gagtcccccacctg-ctc--
                    Gorilla  -cgctgagaggggctg---ccgg----gcagg------------------gagtcccccacctg-ctc--
                  Orangutan  -cgctgagaggggctg---ccgg----gcagg------------------gagtcccccacctg-ctc--
                     Gibbon  -tgctgagaggggctg---ccgg----gcagg------------------gagtcccccacctg-ctc--
                     Rhesus  -ctctgagagggggtg---ccgg----gcagg------------------gagtcccccacctg-ctc--
        Crab-eating macaque  -ctctgagagggggtg---ccgg----gcagg------------------gagtcccccacctg-ctc--
                     Baboon  -ctctgagagggggta---cc-g----gcagg------------------gagtcccccacctg-ctc--
               Green monkey  -cactgagaggggctg---ccgg----gcagg------------------gagtctcccacctg-ctc--
                   Marmoset  -cactgagaggggctg---ccgg----gtagg------------------gagtcccccacctg-ctc--
         Chinese tree shrew  -tgctgagagaggctg---ttgggggcgaggg------------------gagt----ggactg-gtc--
             Naked mole-rat  ----------aggcct---ctgg----aggtt------------------cagg---tgagctg-ggcaa
                 Guinea pig  ----------tcattc---ctgg----tg-------------------------------actg-gtc--
                 Chinchilla  ----------ccattg---ctgg----gg-------------------------------actg-gtc--
                     Rabbit  -cc-------aggctg---cagg----ag-----------------------------gaaatg-gtc--
                       Pika  -cc------aaggctg---ccag----ag-----------------------------gagagg-atc--
                        Pig  -ttctgggggaggccg---tgat----ggagaagg---gagagaagagatggtctttgtacttg-ccc--
                     Alpaca  -tctttagagaggctg---cgat----gaaaaaggggagggcgtgggtggggtcctct-gcttg-ttc--
             Bactrian camel  -tctttagagaggctg---cgat----gaaaaaggggagggcgtgggggtggtcctcg-gcttg-ttc--
                    Dolphin  -tgtttagggaggctg---tgat----gaggcagg--agagagaggagatggtcctctcactcg-ctc--
               Killer whale  -tgtttagggaggctg---tgat----gaggcagg--agagagaggagatggtcctctcactcg-ctc--
           Tibetan antelope  -catttaaggaggctg---tgat----gaggaagggaagagagaggagatggtcctgtcacttg-ctc--
                        Cow  -cagttaaggaggctg---tgat----gaggaagtgaagagagaggagatggtcctctcacttg-ctc--
                      Sheep  -catttaaggaggctg---tgat----gaggaagggaagagagaggagatggtcctctcacttg-ctc--
              Domestic goat  -catttaaggaggctg---tgat----gaggaagggaagagagaggagatggtcctctcacttg-ctc--
                        Cat  -agttgagggaagctg---tgtt----ggtaa------------------tgtcctcgcatttt-ctc--
                        Dog  -cgttgagggaggaggcattgtg----gggaa------------------ggtcccctcacttg-ctc--
                    Ferret   -cactgagggaggctg---tgct----gggct------------------catcctctcactca-ctc--
                      Panda  -cattgagggaggctg---tgct----gggga------------------ggtcctctcacttg-ctc--
             Pacific walrus  -cgttgagggaggctg---tgcc----gggca------------------tgtcccctcacttg-ctc--
               Weddell seal  -cgttgagggaggctg---tgct----gggca------------------cgtcccctcacttg-ctc--
            Star-nosed mole  tttttgatggagacag---cgcg----tgagt------------------acccttttcgcagg------
                   Elephant  -cactgagggagac-g---ctgg----gaggcaa----------------tgtcccctaggttcaccc--
                    Manatee  -cactgagggaggcgg---ctgg----gaggcag----------------tgtcctctcggttc-ctc--
                   Aardvark  -caccgaggaggct-g---ctgg----gagccat----------------gagtccctcagttcctcc--
                  Armadillo  -cactgggggtggtcc---ctgg----gagggaa----------------ctttcc-----ttcctgc--
                      Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Rat  ======================================================================
                      Mouse  ======================================================================
        Cape elephant shrew  ======================================================================
               Prairie vole  ======================================================================
                   Hedgehog  ======================================================================
              Big brown bat  ----------------------------------------------------------------------
                   Microbat  ======================================================================
       David's myotis (bat)  ======================================================================
                     Turkey  ======================================================================
                    Megabat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
           Brush-tailed rat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
                   Squirrel  ----------------------------------------------------------------------
           Black flying-fox  ======================================================================
                      Horse  ======================================================================
           Peregrine falcon  ======================================================================
         Tibetan ground jay  ======================================================================
               Mallard duck  ======================================================================
        Medium ground finch  ======================================================================
     White-throated sparrow  ======================================================================
           Cape golden mole  ======================================================================
        Collared flycatcher  ======================================================================
               Saker falcon  ======================================================================
                 Budgerigar  ======================================================================
            Tasmanian devil  ======================================================================
                   Platypus  ======================================================================
                Zebra finch  ======================================================================
            Green seaturtle  ======================================================================
                    Chicken  ======================================================================
                   Bushbaby  ======================================================================
         American alligator  ======================================================================
                Rock pigeon  ======================================================================
            Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           White rhinoceros  ======================================================================
                    Opossum  ======================================================================
             Painted turtle  ======================================================================

                      Human  -------------tctgttttcaaactccccatttcaca-----cccatgccaggtg--------tgatg
                      Chimp  -------------tctgttttcaaactccccatttcaca-----cccatgccaggtg--------tgatg
                    Gorilla  -------------tctgttttcaaactccccatttcaca-----cccatgccaggtg--------tgatg
                  Orangutan  -------------tctgttttcaaactccccatttcaca-----cccatgccaggtg--------tgatg
                     Gibbon  -------------tccgttttcaaactccccatttcaca-----cccatgccaggtgtgatgaaatgatg
                     Rhesus  -------------tccgttttcaaactccccgtttcaca-----cccatgccaggtg--------tgatg
        Crab-eating macaque  -------------tccgttttcaaactccccgtttcaca-----cccatgccaggtg--------tgatg
                     Baboon  -------------tccgttttcaaactccccatttcaca-----cccatgccaggtg--------tcatg
               Green monkey  -------------tccgttttcaaactccccatttcaca-----cccatgccaggtg--------tgatg
                   Marmoset  -------------cccattttcaaat-----------ct-----cccatgccagacg--------tgatg
         Chinese tree shrew  -------------cc--ttctcttgctcgtttttgcacagagcttccgtgccaggtg-----gtacaatg
             Naked mole-rat  aggccagagctcttcagcgc-----tcttcctcttca-------ccgctgaca--ag--------ccccg
                 Guinea pig  -------------cctgcct----gcctctctgtccc-------aagcttgcatgtg--------tgacc
                 Chinchilla  -------------tgtgtgt-----cccctctgtccc-------aagcttgcatgtg--------tgccc
                     Rabbit  -------------cctcatc---cactccccttgtcttg-----aagcttccaggct--------aggtg
                       Pika  -------------ccctctc--gtgctcccctgttcagg-----aggcttcca-----------------
                        Pig  -------------cctttgtataaagcttctgtgccaag-----t--------gatg--------cagtg
                     Alpaca  -------------cctttgtacaaagcttccctgctggg-----t--------ggtg--------cagtg
             Bactrian camel  -------------cctttgtacaaagcttccctgctggg-----t--------ggtg--------cagtg
                    Dolphin  -------------cctttttacaaagcttccatgccagg-----t--------gatg--------caatg
               Killer whale  -------------cctttttacaaagcttccatgccagg-----t--------gatg--------caatg
           Tibetan antelope  -------------tttctttacaaagcttccacgacacg-----t--------gatg--------cagtg
                        Cow  -------------tctttttacaaagcttccatgacagg-----t--------gatg--------cagtg
                      Sheep  -------------tctctttacaaagcttccacgacatg-----c--------gatg--------cagtg
              Domestic goat  -------------tctctttacaaagcttccacaacacg-----t--------gatg--------cagtg
                        Cat  -------------gcttt-cacaaag--------------------------------------------
                        Dog  -------------ccttt-cacagag--------------------------------------------
                    Ferret   -------------ccttt-cacaaa---------------------------------------------
                      Panda  -------------ccttt-cacaaag--------------------------------------------
             Pacific walrus  -------------ccttt-cacaaag--------------------------------------------
               Weddell seal  -------------ccttt-cacaaag--------------------------------------------
            Star-nosed mole  -------------tctctgcaccaaa--------------------------------------------
                   Elephant  -------------cctttttgccaggcttccatggcaag-----t--------gagg--------gattg
                    Manatee  -------------ccttttttccaggcttccataccagg-----t--------gatg--------cagtg
                   Aardvark  -------------cccgtttcccagacttccatgcctgg-----g--------ggtg--------cagtg
                  Armadillo  -------------cctctttaccaggcctccgtgctggc-----t--------ggtg--------caggg
                      Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Rat  ======================================================================
                      Mouse  ======================================================================
        Cape elephant shrew  ======================================================================
               Prairie vole  ======================================================================
                   Hedgehog  ======================================================================
              Big brown bat  ----------------------------------------------------------------------
                   Microbat  ======================================================================
       David's myotis (bat)  ======================================================================
                     Turkey  ======================================================================
                    Megabat  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
           Brush-tailed rat  ======================================================================
                     Tenrec  ======================================================================
             Golden hamster  ======================================================================
            Chinese hamster  ======================================================================
                   Squirrel  ----------------------------------------------------------------------
           Black flying-fox  ======================================================================
                      Horse  ======================================================================
           Peregrine falcon  ======================================================================
         Tibetan ground jay  ======================================================================
               Mallard duck  ======================================================================
        Medium ground finch  ======================================================================
     White-throated sparrow  ======================================================================
           Cape golden mole  ======================================================================
        Collared flycatcher  ======================================================================
               Saker falcon  ======================================================================
                 Budgerigar  ======================================================================
            Tasmanian devil  ======================================================================
                   Platypus  ======================================================================
                Zebra finch  ======================================================================
            Green seaturtle  ======================================================================
                    Chicken  ======================================================================
                   Bushbaby  ======================================================================
         American alligator  ======================================================================
                Rock pigeon  ======================================================================
            Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           White rhinoceros  ======================================================================
                    Opossum  ======================================================================
             Painted turtle  ======================================================================

                      Human  aaatcctctag--gtg-a-t-gggcagtgg
                      Chimp  aaatcctctag--gtg-a-t-gggcagtgg
                    Gorilla  aaatcctctag--gtg-a-t-gggcagtgg
                  Orangutan  aaatcctctag--gtg-a-t-gggcagtgg
                     Gibbon  aaatcctctag--gtg-a-t-gggcagtgg
                     Rhesus  aaatcctctag--gtg-a-t-gggcagtgg
        Crab-eating macaque  aaatcctctag--gtg-a-t-gggcagtgg
                     Baboon  aaatcctctag--gtg-a-t-gggcagtgg
               Green monkey  aaatcctctag--gtg-a-t-gggcagtgg
                   Marmoset  acatcctctag--gtg-a-t-gggcagtgg
         Chinese tree shrew  aagtcctctgg--ttgca-t-atgcagtgg
             Naked mole-rat  ggttcctccagccgtggt-c-tccctgggg
                 Guinea pig  aagtccttcag--atgga-c-gggccgtgg
                 Chinchilla  gactcctccaa--ttgga-t-gagcagtgg
                     Rabbit  aagccgtcttc--atgga-cggggaagcag
                       Pika  --------ttc--attga-t-gggcagtga
                        Pig  aaattctctgg--gtgaatg-ggtaggtgg
                     Alpaca  aagtcctccgg--gggag-g-ggtgggtgg
             Bactrian camel  aagtcctccgg--gggag-g-ggtgggagg
                    Dolphin  aagtcctctag--ctggagg-ggtaggtgg
               Killer whale  aagtcctctag--ctggagg-ggtaggtgg
           Tibetan antelope  aagtcctctag--gtgga-g-ggtaggtgg
                        Cow  aagtcctctag--gtgga-g-ggcaggtgg
                      Sheep  aagtcctctag--gtggg-g-ggtaggtgg
              Domestic goat  aagtcctctag--gtgga-g-ggtaggtgg
                        Cat  ---tcctctag--gtgga-c-aggccgtga
                        Dog  ---tcctccat--gtgga-t-gggcagtgg
                    Ferret   ----cctccag--ctgga-t-ggcccgggg
                      Panda  ---tcctccaa--ctgga-t-gggcggggg
             Pacific walrus  ---tcctccag--ctgga-t-gggaagggg
               Weddell seal  ---tcctccag--ctgga-t-gggcagggg
            Star-nosed mole  ---tcctctag--tgaga-c-aggaagtgg
                   Elephant  aagccctccag--gtgga-c-agacagtgg
                    Manatee  aagcactccag--gtgga-c-agacagtgg
                   Aardvark  aa---ctccag--gtgga-c-agacaatgg
                  Armadillo  aaggttcctgg--gtgga-c-aggcattgg
                      Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Rat  ==============================
                      Mouse  ==============================
        Cape elephant shrew  ==============================
               Prairie vole  ==============================
                   Hedgehog  ==============================
              Big brown bat  ------------------------------
                   Microbat  ==============================
       David's myotis (bat)  ==============================
                     Turkey  ==============================
                    Megabat  ==============================
     Lesser Egyptian jerboa  ==============================
           Brush-tailed rat  ==============================
                     Tenrec  ==============================
             Golden hamster  ==============================
            Chinese hamster  ==============================
                   Squirrel  ------------------------------
           Black flying-fox  ==============================
                      Horse  ==============================
           Peregrine falcon  ==============================
         Tibetan ground jay  ==============================
               Mallard duck  ==============================
        Medium ground finch  ==============================
     White-throated sparrow  ==============================
           Cape golden mole  ==============================
        Collared flycatcher  ==============================
               Saker falcon  ==============================
                 Budgerigar  ==============================
            Tasmanian devil  ==============================
                   Platypus  ==============================
                Zebra finch  ==============================
            Green seaturtle  ==============================
                    Chicken  ==============================
                   Bushbaby  ==============================
         American alligator  ==============================
                Rock pigeon  ==============================
            Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           White rhinoceros  ==============================
                    Opossum  ==============================
             Painted turtle  ==============================

Inserts between block 12 and 13 in window
        Chinese tree shrew 610bp

Alignment block 13 of 1207 in window, 127836965 - 127836998, 34 bps 
B D                   Human  acat----------------ga---------------gtggttctggttaca--------------gttg
B D                   Chimp  acat----------------ga---------------gtggttctggttaca--------------gttg
B D                 Gorilla  acat----------------ga---------------gtggttctggttaca--------------gttg
B D               Orangutan  acat----------------ga---------------gtggttctggttaca--------------tttg
B D                  Gibbon  acat----------------ga---------------gtggttctggttaca--------------gttg
B D                  Rhesus  a-at----------------ga---------------gtggctctggttaca--------------cctg
B D     Crab-eating macaque  a-at----------------ga---------------gtggttctggttaca--------------cctg
B D                  Baboon  a-at----------------ga---------------gtggttctggttaca--------------gctg
B D            Green monkey  a-at----------------ga---------------gtggttctggttaca--------------gctg
B D                Marmoset  acac----------------ga---------------gtggtcctggttaca--------------gctg
B D          Naked mole-rat  actt----------------ggacacaccccggagatg-ggtgct--taggc--------------ctcc
B D              Guinea pig  acct----------------gg---------------g-ggtgct--actgg--------------cgca
                 Chinchilla  acct----------------gg---------------a-agtgct--gctta--------------caca
B D                  Rabbit  atgt----------------ga---------------gcagttat--ttccg--------------gttg
B D                    Pika  atgt----------------ga---------------gcacttct--ttcca--------------gttg
B D                     Pig  acgt----------------aa---------------ctggttctggtcaca--------------gtta
B D                  Alpaca  accc----------------tg---------------gtggttctggttaca--------------gtca
             Bactrian camel  accc----------------tg---------------gtggttctggttaca--------------gtca
B D                 Dolphin  gcat----------------gg---------------ctggttcacgttaca--------------atta
               Killer whale  gcat----------------gg---------------ctggttcacgttaca--------------atta
           Tibetan antelope  acat----------------gg---------------ctggttctggttaca--------------ttta
B D                     Cow  acat----------------gg---------------ctggttctggttaca--------------attg
B D                   Sheep  acat----------------gg---------------ctggttctggtgaca--------------atta
              Domestic goat  acat----------------gg---------------ctggttctggtgaca--------------atta
B D                     Cat  tcat----------------gg---------------gtggttctggtta--------------------
B D                     Dog  tctt----------------gg---------------gtggttctagttagg--------------atta
B D                 Ferret   tcgtgggggattccagttaagg---------------ggggttccagttaggggggattccagttagggg
B D                   Panda  ccgt----------------gg---------------gtggttctaattacg--------------atga
             Pacific walrus  tggt-----------------g---------------gtggttctggttacg--------------acga
               Weddell seal  tcgt-----------------g---------------gtggttctggttacg--------------atga
            Star-nosed mole  atgt----------------g------------------ggttctggttacc--------------atta
B D                Elephant  gcat----------------gg---------------gtggctttcattatg--------------gctg
B D                 Manatee  gcat-----------------g---------------gtggctcgcattatg--------------gatg
                   Aardvark  gcat----------------gg---------------gtgcttctgattatg--------------agtg
B D               Armadillo  gcct----------------gg---------------gtggttctgattacc--------------actg
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
       Cape elephant shrew  ======================================================================
              Prairie vole  ======================================================================
B D                Hedgehog  ======================================================================
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                  Turkey  ======================================================================
B D                 Megabat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
            Golden hamster  ======================================================================
B D         Chinese hamster  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
        Chinese tree shrew  ======================================================================
          Black flying-fox  ======================================================================
B D                   Horse  ======================================================================
  D        Peregrine falcon  ======================================================================
        Tibetan ground jay  ======================================================================
  D            Mallard duck  ======================================================================
B D     Medium ground finch  ======================================================================
  D  White-throated sparrow  ======================================================================
          Cape golden mole  ======================================================================
  D     Collared flycatcher  ======================================================================
  D            Saker falcon  ======================================================================
B D              Budgerigar  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
B D             Zebra finch  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D                Bushbaby  ======================================================================
B D      American alligator  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ======================================================================
B D                 Opossum  ======================================================================
  D          Painted turtle  ======================================================================

                      Human  gacttcact
                      Chimp  gccttcact
                    Gorilla  gccttcact
                  Orangutan  gccttcact
                     Gibbon  gccttcact
                     Rhesus  gccttcact
        Crab-eating macaque  gccttcact
                     Baboon  gcctttact
               Green monkey  gccttcact
                   Marmoset  gccttcgct
             Naked mole-rat  ggctgggtt
                 Guinea pig  gtc----ct
                 Chinchilla  gcctgcgcc
                     Rabbit  accttcact
                       Pika  accttcact
                        Pig  accttcact
                     Alpaca  gccttcact
             Bactrian camel  gccttcact
                    Dolphin  gcattcact
               Killer whale  gcattcact
           Tibetan antelope  cctttcact
                        Cow  cctttcact
                      Sheep  cctttcact
              Domestic goat  cctttcact
                        Cat  gtcttcact
                        Dog  gtcttcatt
                    Ferret   gtcttcccc
                      Panda  gtcttcacg
             Pacific walrus  gtcttcact
               Weddell seal  gtcttcact
            Star-nosed mole  gcattcacg
                   Elephant  gctgtcact
                    Manatee  gccctcact
                   Aardvark  tccttcac-
                  Armadillo  gcctttgct
                      Shrew  NNNNNNNNN
                        Rat  =========
                      Mouse  =========
        Cape elephant shrew  =========
               Prairie vole  =========
                   Hedgehog  =========
              Big brown bat  ---------
                   Microbat  =========
       David's myotis (bat)  =========
                     Turkey  =========
                    Megabat  =========
     Lesser Egyptian jerboa  =========
           Brush-tailed rat  =========
                     Tenrec  =========
             Golden hamster  =========
            Chinese hamster  =========
                   Squirrel  ---------
         Chinese tree shrew  =========
           Black flying-fox  =========
                      Horse  =========
           Peregrine falcon  =========
         Tibetan ground jay  =========
               Mallard duck  =========
        Medium ground finch  =========
     White-throated sparrow  =========
           Cape golden mole  =========
        Collared flycatcher  =========
               Saker falcon  =========
                 Budgerigar  =========
            Tasmanian devil  =========
                   Platypus  =========
                Zebra finch  =========
            Green seaturtle  =========
                    Chicken  =========
                   Bushbaby  =========
         American alligator  =========
                Rock pigeon  =========
            Squirrel monkey  NNNNNNNNN
           White rhinoceros  =========
                    Opossum  =========
             Painted turtle  =========

Inserts between block 13 and 14 in window
B D         Naked mole-rat 257bp

Alignment block 14 of 1207 in window, 127836999 - 127837003, 5 bps 
B D                   Human  ggc----ct
B D                   Chimp  ggc----ct
B D                 Gorilla  ggc----ct
B D               Orangutan  ggc----ct
B D                  Gibbon  ggc----ct
B D                  Rhesus  ggc----ct
B D     Crab-eating macaque  ggc----ct
B D                  Baboon  ggc----ct
B D            Green monkey  ggc----ct
B D                Marmoset  ggc----ct
B D              Guinea pig  ggc----ct
                 Chinchilla  ggc----ct
B D                  Rabbit  ggt----ct
B D                    Pika  gat----ct
B D                     Pig  agc----ct
B D                  Alpaca  agc----ct
             Bactrian camel  agc----ct
B D                 Dolphin  agc----ct
               Killer whale  agc----ct
           Tibetan antelope  agc----cc
B D                     Cow  agc----ct
B D                   Sheep  agc----ct
              Domestic goat  agc----ct
B D                     Cat  ggc----ct
B D                     Dog  ggc----cc
B D                 Ferret   agc----ct
B D                   Panda  ggc----ca
             Pacific walrus  ggc----c-
               Weddell seal  ggc----c-
            Star-nosed mole  gac----ct
B D                Elephant  ggt----ct
B D                 Manatee  ggt----ct
B D               Armadillo  ggttggact
B D                   Shrew  NNNNNNNNN
B D                     Rat  =========
B D                   Mouse  =========
       Cape elephant shrew  =========
              Prairie vole  =========
B D                Hedgehog  =========
             Big brown bat  ---------
B D                Microbat  =========
      David's myotis (bat)  =========
B D                  Turkey  =========
B D                 Megabat  =========
    Lesser Egyptian jerboa  =========
          Brush-tailed rat  =========
B D                  Tenrec  =========
            Golden hamster  =========
B D         Chinese hamster  =========
B D          Naked mole-rat  =========
B D                Squirrel  ---------
        Chinese tree shrew  =========
          Black flying-fox  =========
B D                   Horse  =========
  D        Peregrine falcon  =========
        Tibetan ground jay  =========
  D            Mallard duck  =========
B D     Medium ground finch  =========
  D  White-throated sparrow  =========
          Cape golden mole  =========
  D     Collared flycatcher  =========
  D            Saker falcon  =========
B D              Budgerigar  =========
B D         Tasmanian devil  =========
B D                Platypus  =========
B D             Zebra finch  =========
  D         Green seaturtle  =========
B D                 Chicken  =========
B D                Bushbaby  =========
B D      American alligator  =========
  D             Rock pigeon  =========
B D         Squirrel monkey  NNNNNNNNN
B D        White rhinoceros  =========
B D                 Opossum  =========
                  Aardvark  ---------
  D          Painted turtle  =========

Alignment block 15 of 1207 in window, 127837004 - 127837040, 37 bps 
B D                   Human  gtcccacacc---tgaggata----------tggattctagccca---------tggga
B D                   Chimp  gtcccacacg---tgaggata----------tggattctagccca---------tggga
B D                 Gorilla  gtcccacacc---tgaggata----------tggattctagccca---------tggga
B D               Orangutan  gtccaacacc---tgagcata----------cggattctagccca---------tggga
B D                  Gibbon  gtcccacacc---tgaggata----------tggattctagccca---------tggga
B D                  Rhesus  gtcccacacc---tgagtata----------tggattctagccca---------tggga
B D     Crab-eating macaque  gtcccacacc---tgagtata----------tggattctagccca---------tggga
B D                  Baboon  gtcccacacc---tgaggata----------tagattctagccca---------tggga
B D            Green monkey  gtcccacacc---tgaggata----------tggattctagccca---------tggga
B D                Marmoset  gtcccacacc---taaggata----------tggattctagccca---------ctgga
               Prairie vole  gtcccacgtt---agtgaata----------tggcttctct-cag--------------
B D              Guinea pig  gtcccatact---ga----tg----------tggcctcagg-ctg---------tgg--
                 Chinchilla  gtcccgcgcc---ga-gagtg----------tggcctcttg-ctg---------tgg--
B D                  Rabbit  gtcccacact---gcagagca----------cagacgcaaa-cca---------tcggg
B D                    Pika  g-cccacact---ggcacaca----------tagacaaaaatcta---------ctggg
B D                     Pig  gtcccacatc---agagaata----------tgaactcaagttca---------tgggc
B D                  Alpaca  gccccaggct---ggagaatt----------tggactcaagttcatgggactcttgggg
             Bactrian camel  gccccaggct---ggagaatt----------tggactcaagttcatgggactcttgggg
B D                 Dolphin  gtcccacacc---ggacaatacggactcaagtgggctcaagtcca---------cgggg
               Killer whale  gtcccacacc---ggacaatacagactcaagtgggctcaagtcca---------cgggg
           Tibetan antelope  gtgtcttact---ggagaata----------tggactcacgttca---------tgggg
B D                     Cow  gtgtcttgct---ggagaaca----------tggactcccgttca---------tggga
B D                   Sheep  gtgtcttgct---ggagaata----------tggactcatgttca---------tgggg
              Domestic goat  gtgtcttgct---ggagaata----------tggactcacgttca---------tgggg
B D                     Cat  atctcacacc---agagaatg----------tggactcaagtcca---------tggg-
B D                     Dog  atctcacacc---agagaatg----------tggactcaagtcca---------tggg-
B D                 Ferret   gtctcgcacc---ggagagtg----------tggactgtagtgcg---------tggg-
B D                   Panda  gtctcacgcc---agagaatc----------tggactccagtccg---------tggg-
             Pacific walrus  -tctcaagcc---agagaatg----------tggactccagtccg---------tggg-
               Weddell seal  -tctcacgcc---agagaatg----------tggactccagtccg---------tggg-
            Star-nosed mole  gtccc-catc---agggagca----------tgagttggtgcccg---------cgggg
B D                Elephant  gccccacaccggaggagaatg----------tggactaaagccca---------cgagg
B D                 Manatee  gtcccatgcc---ggagaatg----------tggactatagccca---------tgtgg
                   Aardvark  -------------------------------cagactaaagccca---------cgtgg
B D               Armadillo  gtcccacct----ggaaaata----------tagacacaagtcca---------cgtgg
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ===========================================================
B D                   Mouse  ===========================================================
       Cape elephant shrew  ===========================================================
B D                Hedgehog  ===========================================================
             Big brown bat  -----------------------------------------------------------
B D                Microbat  ===========================================================
      David's myotis (bat)  ===========================================================
B D                  Turkey  ===========================================================
B D                 Megabat  ===========================================================
    Lesser Egyptian jerboa  ===========================================================
          Brush-tailed rat  ===========================================================
B D                  Tenrec  ===========================================================
            Golden hamster  ===========================================================
B D         Chinese hamster  ===========================================================
B D          Naked mole-rat  ===========================================================
B D                Squirrel  -----------------------------------------------------------
        Chinese tree shrew  ===========================================================
          Black flying-fox  ===========================================================
B D                   Horse  ===========================================================
  D        Peregrine falcon  ===========================================================
        Tibetan ground jay  ===========================================================
  D            Mallard duck  ===========================================================
B D     Medium ground finch  ===========================================================
  D  White-throated sparrow  ===========================================================
          Cape golden mole  ===========================================================
  D     Collared flycatcher  ===========================================================
  D            Saker falcon  ===========================================================
B D              Budgerigar  ===========================================================
B D         Tasmanian devil  ===========================================================
B D                Platypus  ===========================================================
B D             Zebra finch  ===========================================================
  D         Green seaturtle  ===========================================================
B D                 Chicken  ===========================================================
B D                Bushbaby  ===========================================================
B D      American alligator  ===========================================================
  D             Rock pigeon  ===========================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ===========================================================
B D                 Opossum  ===========================================================
  D          Painted turtle  ===========================================================

Alignment block 16 of 1207 in window, 127837041 - 127837049, 9 bps 
B D                   Human  ccataagcc
B D                   Chimp  ccataagcc
B D                 Gorilla  ccataagcc
B D               Orangutan  ccataagcc
B D                  Gibbon  ccataagcc
B D                  Rhesus  ccataagcc
B D     Crab-eating macaque  ccataagcc
B D                  Baboon  ccataagcc
B D            Green monkey  ccataagcc
B D                Marmoset  ccataagcc
B D                Bushbaby  ccacaagct
               Prairie vole  ccagaagta
B D         Chinese hamster  ccccaagtg
             Golden hamster  ccccaagtg
B D              Guinea pig  gtcagagtt
                 Chinchilla  gccaaagcc
B D                  Rabbit  ccagaagtc
B D                    Pika  ccagaa-tc
B D                     Pig  ccagaggtc
B D                  Alpaca  ccagaagcc
             Bactrian camel  ccagaagcc
B D                 Dolphin  ccagaagcc
               Killer whale  ccagaagcc
           Tibetan antelope  ccagaagcc
B D                     Cow  ccagaagcc
B D                   Sheep  ccagaagcc
              Domestic goat  ccagaagcc
B D                     Cat  ccagaagcc
B D                     Dog  ccagaagcc
B D                 Ferret   ccagaagcc
B D                   Panda  ccagaagcc
             Pacific walrus  ccataagcc
               Weddell seal  ccagaagcc
            Star-nosed mole  gcagaagac
B D                Elephant  caggaagcc
B D                 Manatee  tgggaagcc
                   Aardvark  cgggaaggc
B D               Armadillo  ctgga----
B D                   Shrew  NNNNNNNNN
B D                     Rat  =========
B D                   Mouse  =========
       Cape elephant shrew  =========
B D                Hedgehog  =========
             Big brown bat  ---------
B D                Microbat  =========
      David's myotis (bat)  =========
B D                  Turkey  =========
B D                 Megabat  =========
    Lesser Egyptian jerboa  =========
          Brush-tailed rat  =========
B D                  Tenrec  =========
B D          Naked mole-rat  =========
B D                Squirrel  ---------
        Chinese tree shrew  =========
          Black flying-fox  =========
B D                   Horse  =========
  D        Peregrine falcon  =========
        Tibetan ground jay  =========
  D            Mallard duck  =========
B D     Medium ground finch  =========
  D  White-throated sparrow  =========
          Cape golden mole  =========
  D     Collared flycatcher  =========
  D            Saker falcon  =========
B D              Budgerigar  =========
B D         Tasmanian devil  =========
B D                Platypus  =========
B D             Zebra finch  =========
  D         Green seaturtle  =========
B D                 Chicken  =========
B D      American alligator  =========
  D             Rock pigeon  =========
B D         Squirrel monkey  NNNNNNNNN
B D        White rhinoceros  =========
B D                 Opossum  =========
  D          Painted turtle  =========

Alignment block 17 of 1207 in window, 127837050 - 127837113, 64 bps 
B D                   Human  aggccccctgagggtctgtta---tttgtctg--ggaagtggcagcgctcttt-ggaatctt---g----
B D                   Chimp  aggccccctgagggtctgtta---tttgtctg--ggaagtgcgagcgctcttt-ggaatctt---g----
B D                 Gorilla  aggccccctgagggtctgtta---tttgtctg--ggaagtgccagcactcttt-ggaatctt---g----
B D               Orangutan  aggccccctgagggtctgtta---tttgtctg--ggaagtgccagcgctcttt-ggaatctt---g----
B D                  Gibbon  agccccgctgagggtctgcta---tttgtctg--ggaagtgccagcgctcttt-agaatctt---g----
B D                  Rhesus  aggccccctgagggtctgtta---tttgtctg--ggaaatgccagtgctcttt-agaatctt---g----
B D     Crab-eating macaque  aggccccctgagggtctgtta---tttgtctg--ggaaatgccagtgctcttt-agaatctt---g----
B D                  Baboon  aggctccctgaaggtctgtta---tttgtctg--ggaaatgccagcgctcttt-agaatctt---g----
B D            Green monkey  aggccccccgagggtctgtta---tttgtctg--ggaaatgccagcactcttt-agaatctt---g----
B D                Marmoset  agaccccctgagggtcagtta---tttggc------aaatgccagtgctcttt-ggaatctt---g----
B D                Bushbaby  aggctcccctgagatgagtta---tttggc------aaatatcagagctcttt-gga-------------
               Prairie vole  aggccttctgagggctggttg---cttgcagg--gcaaatgccagggctcttg-gggatctt---gcgcc
B D         Chinese hamster  aggcctgctgaggg-agctgg---cttgcagg--gcaagtgccagggctcttt-ggaatcttgtggttcc
             Golden hamster  aggcccgcggagggcagctgg---cttgcacgcagccagtgccagggctcttt-ggaatcct---gttcc
B D                   Mouse  agggcttcggagggtgggtag---cttgcctg--gtaaatgctagggcttttt-ggaatctt---gcacc
B D              Guinea pig  -ggtcgctggaggttgagctg---tctct-gg--gcaaacactggag----gt-gaagtttt---gttcc
                 Chinchilla  aggccactggaggttgagctg---tcagt-gg--gcaaa---tgtag----tc-aaagtctt---gttct
B D                  Rabbit  aggcctcctgagag----------------ga-------------agttctca-acagtgtt---gctcc
B D                    Pika  aggccttctttctg----------------gg-------------cgttctag-atggtgct---gctcc
B D                     Pig  agggctcctgaggctgagttactgtttgcctg--gc-aatgccagagctattt-ggaatctt---gttcc
B D                  Alpaca  agggctcctgaggatgagttagcatttgcctg--gcaaatgccagagctcttt-ggagtctt---gttcc
             Bactrian camel  agggctcctgaggctgagttagcatttgcccg--gcaaatgccagagctcttt-ggagtctt---gttcc
B D                 Dolphin  agggctcccgaggctgagttactatttgcctg--gcaaatgccagagctcttt-ggagtatt---gttcc
               Killer whale  agggctcccgaggctgagttactatttgcctg--gcaaatgccagagctcttt-ggagtatt---gttcc
           Tibetan antelope  agggctcccaaggctgtgttattattttcctg--gcaaatgccagagctcttt-ggagtctt---gttcc
B D                     Cow  agggctcccaaggctgagttattatttacctg--gcaaatgccagagctcttt-ggagtctt---gttct
B D                   Sheep  agggcttccaaggctgtgttattattttcctg--gcaaatgccagagctcttt-ggagtctt---gttcc
              Domestic goat  agggctcccaaggctgtgttattattttcctg--gcaaatgccagagttcttt-ggagtctt---gttcc
B D                     Cat  aggcctcctgagg-tgagtta---ttta------------gccagccctcttt-ggggta-t---gttcc
B D                     Dog  aggcctcctgagg-tgagtta---tttg------------accagagctcgtt-ggagtctt---gttcc
B D                 Ferret   aggcctcccgagg-tgagtga---tttg------------gctagagctcttt-ggggtctt---gttct
B D                   Panda  aggcctcctgagg-tgagtta---tttg------------accagagctcttt-ggggtctt---gttcc
             Pacific walrus  aggcctcctgagg-tgaggta----ttg------------actagagatctct-ggggtctt---gttcc
               Weddell seal  aggcctcctgagg-tgagtta---tttg------------accagagatctct-ggggtctt---gttcc
            Star-nosed mole  a-gtctcccgaga------------------g--gcacatgtcacagcttttt-ggggtgct---gttct
B D                Elephant  aggcctctgcagggtgagtta---tttgactg--gccagtgccacagctcttt--gggtatt---gttcc
B D                 Manatee  aggcctctg--gggtgagtta---tttgactg--gtcaatgccttagcaattt-ggggtatt---gttcc
                   Aardvark  aggcctcta-ggagagagtta---ctttactg--acaaatgccacagctctttgggggtaat---gttcc
B D               Armadillo  -----------gggtgagtta---attgcctg--ccaaggaccagagctctt---gggtctt---gttgc
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ======================================================================
       Cape elephant shrew  ======================================================================
B D                Hedgehog  ======================================================================
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                  Turkey  ======================================================================
B D                 Megabat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
        Chinese tree shrew  ======================================================================
          Black flying-fox  ======================================================================
B D                   Horse  ======================================================================
  D        Peregrine falcon  ======================================================================
        Tibetan ground jay  ======================================================================
  D            Mallard duck  ======================================================================
B D     Medium ground finch  ======================================================================
  D  White-throated sparrow  ======================================================================
          Cape golden mole  ======================================================================
  D     Collared flycatcher  ======================================================================
  D            Saker falcon  ======================================================================
B D              Budgerigar  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
B D             Zebra finch  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D      American alligator  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ======================================================================
B D                 Opossum  ======================================================================
  D          Painted turtle  ======================================================================

                      Human  ---ttcatga
                      Chimp  ---ttcatga
                    Gorilla  ---ctcatga
                  Orangutan  ---ttcatga
                     Gibbon  ---ttcatga
                     Rhesus  ---ttaatga
        Crab-eating macaque  ---ttaatga
                     Baboon  ---ttcatga
               Green monkey  ---ttcatga
                   Marmoset  ---ctcatga
                   Bushbaby  ---------g
               Prairie vole  c-tttcacca
            Chinese hamster  c-tttcacac
             Golden hamster  a-tttcacaa
                      Mouse  a-ttttacaa
                 Guinea pig  a--ttcactg
                 Chinchilla  g-tttcacta
                     Rabbit  a-ttccagca
                       Pika  a-tttgaccg
                        Pig  a-tttggtgg
                     Alpaca  attttcacgg
             Bactrian camel  attttcacgg
                    Dolphin  a-tttcacga
               Killer whale  a-tttcacga
           Tibetan antelope  a-tttcatga
                        Cow  a-tttcatga
                      Sheep  a-tttcatga
              Domestic goat  a-tttcatga
                        Cat  t-tttcacag
                        Dog  a-tttcacag
                    Ferret   g-tttcacag
                      Panda  g-tttcacag
             Pacific walrus  g-tttcacag
               Weddell seal  g-tttcacag
            Star-nosed mole  a-tttcatg-
                   Elephant  a-tttctcag
                    Manatee  a-tttctcag
                   Aardvark  a-t-------
                  Armadillo  a-tttc----
                      Shrew  NNNNNNNNNN
                        Rat  ==========
        Cape elephant shrew  ==========
                   Hedgehog  ==========
              Big brown bat  ----------
                   Microbat  ==========
       David's myotis (bat)  ==========
                     Turkey  ==========
                    Megabat  ==========
     Lesser Egyptian jerboa  ==========
           Brush-tailed rat  ==========
                     Tenrec  ==========
             Naked mole-rat  ==========
                   Squirrel  ----------
         Chinese tree shrew  ==========
           Black flying-fox  ==========
                      Horse  ==========
           Peregrine falcon  ==========
         Tibetan ground jay  ==========
               Mallard duck  ==========
        Medium ground finch  ==========
     White-throated sparrow  ==========
           Cape golden mole  ==========
        Collared flycatcher  ==========
               Saker falcon  ==========
                 Budgerigar  ==========
            Tasmanian devil  ==========
                   Platypus  ==========
                Zebra finch  ==========
            Green seaturtle  ==========
                    Chicken  ==========
         American alligator  ==========
                Rock pigeon  ==========
            Squirrel monkey  NNNNNNNNNN
           White rhinoceros  ==========
                    Opossum  ==========
             Painted turtle  ==========

Inserts between block 17 and 18 in window
B D             Guinea pig 1bp
           Star-nosed mole 7bp

Alignment block 18 of 1207 in window, 127837114 - 127837131, 18 bps 
B D                   Human  ctgacaaaca--c-cc--ccacg
B D                   Chimp  ctgacaaaca--c-cc--ccaca
B D                 Gorilla  ctgacaaaca--c-cc--ccacg
B D               Orangutan  ctgacaaaca--c-cc--ccacg
B D                  Gibbon  ctgataaaca--c-cc--ccatg
B D                  Rhesus  ctgacaaaca--c-cc--ccatg
B D     Crab-eating macaque  ctgacaaaca--c-cc--ccatg
B D                  Baboon  ctgactaaca----ac--ccatg
B D            Green monkey  ctgacaaaca--c-ac--ccaag
B D                Marmoset  ctgacaaaca--cacc--ccacg
B D                Bushbaby  ctggcaatcaaac-cc--taaaa
         Chinese tree shrew  ctgatgaacg--c-ct--ccctc
               Prairie vole  ccaactgata--g-cc--ctgct
B D         Chinese hamster  ctggcagaca--a-cc--cggct
             Golden hamster  ccggcaggca--a-ct--ctgct
B D                   Mouse  ccagcacgaa--a-cc--tggct
B D              Guinea pig  ccgatggagg--c-c---cagct
                 Chinchilla  ctaacaagtg--c-ctggctgct
B D                  Rabbit  ctggcaaaca--g-gc--ccgct
B D                    Pika  ctggcagata--g-cc--cccct
B D                     Pig  ctgacacctg--c-cc---cctc
B D                  Alpaca  ctgacaaacg--c-cc--gcctc
             Bactrian camel  ctgacaaacg--c-cc--gcctc
B D                 Dolphin  ctgacaaacg--c-cc--ttctc
               Killer whale  ctgacaaacg--c-cc--ttctc
           Tibetan antelope  ctgacaaatg--c-cc--ccttc
B D                     Cow  ctgacaaatg--c-cc--ccttc
B D                   Sheep  ctgacaaatg--c-cc--ccttc
              Domestic goat  ctgacaaatg--a-cc--ccttc
B D                     Cat  ctgacaaacg--c-tt--ccctc
B D                     Dog  ctgacaga---------------
B D                 Ferret   ctgacaaagg--c-tt--ccctc
B D                   Panda  ctgaccagtg--c-tc--ccctc
             Pacific walrus  ctgaccaatg--t-tc--ccttc
               Weddell seal  ctgaccaacg--t-tc--ccttc
B D                Elephant  ctgacagatg--c-cc--cc--t
B D                 Manatee  ctgacagatg--c-ct--cctgt
                   Aardvark  --------tg--c-cc--cctct
B D               Armadillo  ----------------------t
           Star-nosed mole  =======================
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  =======================
       Cape elephant shrew  =======================
B D                Hedgehog  =======================
             Big brown bat  -----------------------
B D                Microbat  =======================
      David's myotis (bat)  =======================
B D                  Turkey  =======================
B D                 Megabat  =======================
    Lesser Egyptian jerboa  =======================
          Brush-tailed rat  =======================
B D                  Tenrec  =======================
B D          Naked mole-rat  =======================
B D                Squirrel  -----------------------
          Black flying-fox  =======================
B D                   Horse  =======================
  D        Peregrine falcon  =======================
        Tibetan ground jay  =======================
  D            Mallard duck  =======================
B D     Medium ground finch  =======================
  D  White-throated sparrow  =======================
          Cape golden mole  =======================
  D     Collared flycatcher  =======================
  D            Saker falcon  =======================
B D              Budgerigar  =======================
B D         Tasmanian devil  =======================
B D                Platypus  =======================
B D             Zebra finch  =======================
  D         Green seaturtle  =======================
B D                 Chicken  =======================
B D      American alligator  =======================
  D             Rock pigeon  =======================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  =======================
B D                 Opossum  =======================
  D          Painted turtle  =======================

Inserts between block 18 and 19 in window
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                    Cat 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp

Alignment block 19 of 1207 in window, 127837132 - 127837156, 25 bps 
B D                   Human  ccccttcagccataattatcaccta
B D                   Chimp  ccccttcagccataattatcaccta
B D                 Gorilla  ccccttcagccataattatcaccta
B D               Orangutan  ccccttcagccataattatcaccta
B D                  Gibbon  ccccttcagccataattatcaccta
B D                  Rhesus  cgccttcagccgtaattatcaccta
B D     Crab-eating macaque  cgccttcagccgtaattatcaccta
B D                  Baboon  ccccttcagccgtaattatcaccta
B D            Green monkey  ccccttcagccgtaattatcaccta
B D                Marmoset  ccccttcagccataattttcacctc
B D                Bushbaby  cccctctagccataattgtcacctg
         Chinese tree shrew  tctcttcggtcacagctcccactgg
               Prairie vole  ttcctccagcc------atcacct-
B D         Chinese hamster  tccctgcagctgctattatcacctg
             Golden hamster  cccctgcagctgccaagatcacctg
B D                   Mouse  tccctctggccatcattatcacctg
B D              Guinea pig  ccctcccatctg---tggtcaccct
                 Chinchilla  ccctcccagcca----ggtcacctt
B D                  Rabbit  tcctt-cagccgtggttgctacctg
B D                    Pika  tcctt-cagtcgtgtttatgactag
B D                     Pig  ccaggacagctgtaatccccaactg
B D                  Alpaca  ccggggcagccatagttgccacctg
             Bactrian camel  ccggggcagccatagttgccacccg
B D                 Dolphin  ccagggcagccgtcattaccaccca
               Killer whale  ccagggcagccgtcattaccaccca
           Tibetan antelope  ccaaggcagctggaattgctaccca
B D                     Cow  ccagggcagctggaattactacccg
B D                   Sheep  ccgaggcagctggaattgctaccca
              Domestic goat  ccaaggcagctggaattgctaccca
B D                     Cat  ccagggtgg---------ccatctg
B D                     Dog  ----ggcgg---------ccatctg
B D                 Ferret   cctgggtgg---------ccctctg
B D                   Panda  ccagggcgg---------ccatctg
             Pacific walrus  ccagggcgg---------ccatctg
               Weddell seal  ccagggcgg---------tcatctg
B D                Hedgehog  tcagggcggttgtaaacaccagccg
            Star-nosed mole  ccagggcagc------------ctg
B D                Elephant  ccagggtagccttagtaagcacctg
B D                 Manatee  ccagggcagccctaataagcacctg
                   Aardvark  ctggggcagccctaactagcacctg
B D               Armadillo  ccaggacagccataattaccacctg
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  =========================
       Cape elephant shrew  =========================
             Big brown bat  -------------------------
B D                Microbat  =========================
      David's myotis (bat)  =========================
B D                  Turkey  =========================
B D                 Megabat  =========================
    Lesser Egyptian jerboa  =========================
          Brush-tailed rat  =========================
B D                  Tenrec  =========================
B D          Naked mole-rat  =========================
B D                Squirrel  -------------------------
          Black flying-fox  =========================
B D                   Horse  =========================
  D        Peregrine falcon  =========================
        Tibetan ground jay  =========================
  D            Mallard duck  =========================
B D     Medium ground finch  =========================
  D  White-throated sparrow  =========================
          Cape golden mole  =========================
  D     Collared flycatcher  =========================
  D            Saker falcon  =========================
B D              Budgerigar  =========================
B D         Tasmanian devil  =========================
B D                Platypus  =========================
B D             Zebra finch  =========================
  D         Green seaturtle  =========================
B D                 Chicken  =========================
B D      American alligator  =========================
  D             Rock pigeon  =========================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  =========================
B D                 Opossum  =========================
  D          Painted turtle  =========================

Inserts between block 19 and 20 in window
              Prairie vole 7bp
                Chinchilla 1bp
B D                    Pig 5bp
B D               Elephant 3bp
B D                Manatee 3bp
                  Aardvark 3bp

Alignment block 20 of 1207 in window, 127837157 - 127837182, 26 bps 
B D                   Human  gt-c---cccaga--gaagggccatgggtggg
B D                   Chimp  gt-c---cccaga--gaagggccatgggtggg
B D                 Gorilla  gt-t---cccaga--gaagggccatgggtggg
B D               Orangutan  gt-c---cccaga--gaagggccatgggtggg
B D                  Gibbon  gt-c---cccaga--gaagggccatgggtggg
B D                  Rhesus  gt-c---cccaga--gaagggctat-ggtggg
B D     Crab-eating macaque  gt-c---cccaga--gaagggctat-ggtggg
B D                  Baboon  gt-c---cccaga--gaagggctatgggtggg
B D            Green monkey  gt-c---cccaga--gaagggctatgggtggg
B D                Marmoset  gt-a---cccaga--ga---------------
B D                Bushbaby  gt-g---cctgca--gaggggccatggctggg
         Chinese tree shrew  gt-g---cccaca--gaagagcca-gggtgag
B D         Chinese hamster  gt-g---cctgca--cagggaatgc--ctggg
             Golden hamster  at-gcctcctgca--caggggatgc--ctggg
B D                   Mouse  at-g---cctgca--cccgga-----------
B D              Guinea pig  cg-g---cccgca--gaggggcctt---gagg
                 Chinchilla  gg-g---cccaca--gagaggccgc--agatg
B D                  Rabbit  gt-g---cctccc--gaagggccggggatggg
B D                    Pika  ga-g---cctccg--gaaggg-cgttgatcgg
B D                     Pig  gt-g---cctgta--ggcgagccgtg------
B D                  Alpaca  ga-g---cccaca--ggagagctgtgggtgag
             Bactrian camel  ga-g---cccaca--ggagagctgtgggtgag
B D                 Dolphin  gt-a---cccaca--ggcgagccatggatgag
               Killer whale  gt-a---cccaca--ggcgagccatggatgag
           Tibetan antelope  gt-g---cccaca--ggcaagccgtggatgac
B D                     Cow  gt-g---ccctca--ggcaagccatggatgac
B D                   Sheep  gt-g---cccaca--ggcaagctgcagatgac
              Domestic goat  gt-g---cccaca--ggcaagccgtgaatgac
B D                     Cat  gt-g---cccaca--ggagggccatggatgag
B D                     Dog  gt-g---ctcaca--gaagggccatggatgga
B D                 Ferret   gt-g---cccgca--ggagggccgtggatgaa
B D                   Panda  gt-g---cccaca--ggagggccatggatgag
             Pacific walrus  gt-g---cc-gca--ggagaaccttgcatgaa
               Weddell seal  gt-g---cctgca--ggagggccttgcatgag
B D                Hedgehog  gg-g---ctcaga--gatagacctgt------
            Star-nosed mole  gt-g---cccaca--gggccacgaag------
B D                Elephant  ---g---cccatg--gaagggccacgggtgag
        Cape elephant shrew  ---g---cccacagcgaagggccgtgtgggag
B D                 Manatee  ---g---cccacg--gaagggccacgggtgag
                   Aardvark  ---g---tgcaca--gaaaggccatgggtgag
B D               Armadillo  ggtt---cccaca---aagggtcttgggtgca
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ================================
              Prairie vole  ================================
             Big brown bat  --------------------------------
B D                Microbat  ================================
      David's myotis (bat)  ================================
B D                  Turkey  ================================
B D                 Megabat  ================================
    Lesser Egyptian jerboa  ================================
          Brush-tailed rat  ================================
B D                  Tenrec  ================================
B D          Naked mole-rat  ================================
B D                Squirrel  --------------------------------
          Black flying-fox  ================================
B D                   Horse  ================================
  D        Peregrine falcon  ================================
        Tibetan ground jay  ================================
  D            Mallard duck  ================================
B D     Medium ground finch  ================================
  D  White-throated sparrow  ================================
          Cape golden mole  ================================
  D     Collared flycatcher  ================================
  D            Saker falcon  ================================
B D              Budgerigar  ================================
B D         Tasmanian devil  ================================
B D                Platypus  ================================
B D             Zebra finch  ================================
  D         Green seaturtle  ================================
B D                 Chicken  ================================
B D      American alligator  ================================
  D             Rock pigeon  ================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ================================
B D                 Opossum  ================================
  D          Painted turtle  ================================

Inserts between block 20 and 21 in window
B D        Chinese hamster 2667bp
            Golden hamster 76bp

Alignment block 21 of 1207 in window, 127837183 - 127837225, 43 bps 
B D                   Human  ctgactgtagagatagacgctt-gggt-------------------ctctggctggga-ac---------
B D                   Chimp  ctgactgtagagatagacgctt-gggt-------------------ctctggctggga-ac---------
B D                 Gorilla  ctgactgtagagatagacgctt-gggt-------------------ctctggctggga-ac---------
B D               Orangutan  ctgactgtagagatagacactt-gggt-------------------ctctggctggga-ac---------
B D                  Gibbon  ctgactgtagagatagacgctt-gggt-------------------ctctggctggga-ac---------
B D                  Rhesus  ctgactgtggagatagatgctt-gggt-------------------ctcctgctggga-ac---------
B D     Crab-eating macaque  ctgactgtggagatagatgctt-gggt-------------------ctccttctggga-ac---------
B D                  Baboon  ctgactgtggagatagatgcttggggt-------------------ctcctgccggga-ac---------
B D            Green monkey  ctgactgtggagatagatgctt-gggt-------------------ctcctgctggga-ac---------
B D                Marmoset  -----------------------gag--------------------------------------------
B D                Bushbaby  ctggctgtagaggtggatgcct-agat-------------------ctctggatgggg-ac---------
         Chinese tree shrew  cgg--tgcaggtgtacatgagt-ggg--------------------------------------------
               Prairie vole  -----------------tgcct-gggc-------------------ttctgggtgggg-gc---------
             Golden hamster  cagcttgctgccccatctgcct-gctcccaccccctgccctcctttctttgggtttgt-gtttttttttt
B D                   Mouse  ----------------aagcct-gggt-------------------ctctgggtgggg-cc---------
B D              Guinea pig  --cactgtggac--gggtgctc-gggt-------------------ctctggctgggt-tc---------
                 Chinchilla  --cacgggggacagggatgcgg-gggt-------------------ctcgggctggga-tc---------
B D                  Rabbit  ----ctgtggcgatggatgttt-ggat-------------------ttctggttgggg-cc---------
B D                    Pika  ----ctgtgtcgatggacg-tt-gggt-------------------ctcaggttgggg-ac---------
B D                     Pig  --gaccgaggagct----------ggt-------------------ggctggctggggacc---------
B D                  Alpaca  ctgactgaggagat----------gat-------------------atctggctgggg-cc---------
             Bactrian camel  ctgactgaggagat----------ggt-------------------atctggccgggg-cc---------
B D                 Dolphin  ctgactaaggagat----------gcc-------------------atctggctgggg-cc---------
               Killer whale  ctgactaaggagat----------gcc-------------------atctggctgggg-cc---------
           Tibetan antelope  ctgaataagcagat----------ggt-------------------gtctggccgggg-cc---------
B D                     Cow  ctgactaaggagat----------ggt-------------------gtctggccgggg-cc---------
B D                   Sheep  ctgactaaggagat----------ggt-------------------atctggccgggg-cc---------
              Domestic goat  ctgactaaggagat----------ggt-------------------gtctggccgggg-cc---------
B D                     Cat  caggctgtggagat-ggcactt--ggt-------------------ttctgg-tgcag-cc---------
B D                     Dog  caggctatgaggatgggcactt--ggt-------------------ggctggttgggg-cc---------
B D                 Ferret   cagacgctgaagatgggcactg--ggg-------------------gtctggttggga-cc---------
B D                   Panda  cagactgtgaggatgggcattt--ggt-------------------gtct-gttgggg-cc---------
             Pacific walrus  caggctgtgaagatgggcactt--ggt-------------------gtctggttggga-cc---------
               Weddell seal  caggctgtgaagatgggca-tt--ggt-------------------gtctggttgggg-cc---------
B D                Hedgehog  --ggcgatgacacc----------tga-------------------ggcctggctggg-gc---------
            Star-nosed mole  --agcagtgcacag----------agg-------------------ggctcaccagtc-gc---------
B D                Elephant  ctgtctgtggagacagactcca--tgt-------------------ctctggctagga-gg---------
        Cape elephant shrew  cagcc--tagggatgaccccca--ggt-------------------ctctggctgagg-gg---------
B D                 Manatee  ccaaccgtgaagacagactcca--tgt-------------------ttctggctgaga-gg---------
                   Aardvark  ctgacagtgcagacagattcca--tgt-------------------ctctggctggaa-gg---------
B D               Armadillo  ctggctg-gggaatggatgctg--ggg-------------------ctctggctggga-gt---------
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ======================================================================
             Big brown bat  ----------------------------------------------------------------------
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                  Turkey  ======================================================================
B D                 Megabat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
B D         Chinese hamster  ======================================================================
B D          Naked mole-rat  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
          Black flying-fox  ======================================================================
B D                   Horse  ======================================================================
  D        Peregrine falcon  ======================================================================
        Tibetan ground jay  ======================================================================
  D            Mallard duck  ======================================================================
B D     Medium ground finch  ======================================================================
  D  White-throated sparrow  ======================================================================
          Cape golden mole  ======================================================================
  D     Collared flycatcher  ======================================================================
  D            Saker falcon  ======================================================================
B D              Budgerigar  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
B D             Zebra finch  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D      American alligator  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ======================================================================
B D                 Opossum  ======================================================================
  D          Painted turtle  ======================================================================

                      Human  --------acc
                      Chimp  --------acc
                    Gorilla  --------acc
                  Orangutan  --------acc
                     Gibbon  --------acc
                     Rhesus  --------acc
        Crab-eating macaque  --------acc
                     Baboon  --------acc
               Green monkey  --------acc
                   Marmoset  -----------
                   Bushbaby  --------acc
         Chinese tree shrew  -----------
               Prairie vole  --------agc
             Golden hamster  tctttaggagc
                      Mouse  --------agc
                 Guinea pig  --------acc
                 Chinchilla  --------acc
                     Rabbit  --------acc
                       Pika  --------atc
                        Pig  --------acc
                     Alpaca  --------act
             Bactrian camel  --------act
                    Dolphin  --------acc
               Killer whale  --------acc
           Tibetan antelope  --------acc
                        Cow  --------acc
                      Sheep  --------acc
              Domestic goat  --------acc
                        Cat  --------acc
                        Dog  --------acc
                    Ferret   --------agc
                      Panda  --------acc
             Pacific walrus  --------acc
               Weddell seal  --------acc
                   Hedgehog  --------agc
            Star-nosed mole  --------agc
                   Elephant  --------cct
        Cape elephant shrew  --------acc
                    Manatee  --------ccc
                   Aardvark  --------cct
                  Armadillo  --------gcc
                      Shrew  NNNNNNNNNNN
                        Rat  ===========
              Big brown bat  -----------
                   Microbat  ===========
       David's myotis (bat)  ===========
                     Turkey  ===========
                    Megabat  ===========
     Lesser Egyptian jerboa  ===========
           Brush-tailed rat  ===========
                     Tenrec  ===========
            Chinese hamster  ===========
             Naked mole-rat  ===========
                   Squirrel  -----------
           Black flying-fox  ===========
                      Horse  ===========
           Peregrine falcon  ===========
         Tibetan ground jay  ===========
               Mallard duck  ===========
        Medium ground finch  ===========
     White-throated sparrow  ===========
           Cape golden mole  ===========
        Collared flycatcher  ===========
               Saker falcon  ===========
                 Budgerigar  ===========
            Tasmanian devil  ===========
                   Platypus  ===========
                Zebra finch  ===========
            Green seaturtle  ===========
                    Chicken  ===========
         American alligator  ===========
                Rock pigeon  ===========
            Squirrel monkey  NNNNNNNNNNN
           White rhinoceros  ===========
                    Opossum  ===========
             Painted turtle  ===========

Inserts between block 21 and 22 in window
B D             Guinea pig 103bp
                Chinchilla 218bp
B D               Elephant 1bp
       Cape elephant shrew 1bp
B D                Manatee 1bp

Alignment block 22 of 1207 in window, 127837226 - 127837259, 34 bps 
B D                   Human  acat-gcaa--gag----aagaggccatg-------ggct--------cgcc-ttcc
B D                   Chimp  acat-gcaa--gag----aaaaggccgtg-------ggct--------cgcc-ttcc
B D                 Gorilla  acat-gcaa--gag----aagaggccatg-------ggct--------tgcc-ttcc
B D               Orangutan  acct-gcaa--gag----aagaggccatg-------tgct--------cgcc-ttcc
B D                  Gibbon  acgt-gcaa--gag----aagaggccata-------tgct--------cgcc-ttcc
B D                  Rhesus  acgt-gcaa--gag----aggaggccatg-------agct--------tgcc-ttcc
B D     Crab-eating macaque  acgt-gcaa--gag----aagaggccatg-------agct--------tgcc-ttcc
B D                  Baboon  atgt-gcaa--gag----aagagaccatg-------agct--------tgcc-ttcc
B D            Green monkey  acgt-gcaa--gag----aagaggccatg-------agct--------tgcc-ttcc
B D                Marmoset  -------------------aagggccatg-------ggct--------cacc-ttcc
B D                Bushbaby  aagt-gcca--gag----gaaaggccata-------atcc--------tgcc-ttcc
         Chinese tree shrew  ------------ag----aggagccctgt-------ggct--------tgct-c---
               Prairie vole  -------aagtgagcacaaagaagcctca-------ggct--------gtct-tcc-
             Golden hamster  -------ca--gagtccaggctggcctcaaaggcatggcg--------atcc-tcc-
B D                   Mouse  -------aagtgagccaaaggaggcttta-------ggct--------gtct-ttc-
B D                  Rabbit  ---t-cccagagag----gagaggccgtg-------ggtg--------ctccttcc-
B D                    Pika  ---a-cgtggggag----gagaggccacg-------ggcg--------ttcc-tct-
B D                     Pig  ggat-ggga--gag----aagaggctgtg-------cgctccccttct---------
B D                  Alpaca  aggt-gaga--gag----aagagcctgtg-------ggctcaccgtcc---------
             Bactrian camel  aggt-gaga--gag----aagagcctgtg-------ggctcaccgtcc---------
B D                 Dolphin  aggt-ggga--gag----aagaggc--tg-------ggct-----------------
               Killer whale  aggt-ggga--gag----aagaggc--tg-------ggct-----------------
           Tibetan antelope  aggt-gggg--gag----aagaggcggtg-------gacttgccttcc---------
B D                     Cow  aggt-tggg--gag----aagaggctgtg-------gacttgccttcc---------
B D                   Sheep  aggt-tggg--gag----aagaggcggtg-------gacttgccttcc---------
              Domestic goat  aggt-gggg--gag----aagaggcggtg-------gacttgccttcc---------
B D                     Cat  agtt-ggga--cag----aagaggctggg-------ggcc-----------------
B D                     Dog  aggtgggga--cag----aagaggctgga-------ggcc-----------------
B D                 Ferret   agat-ggga--cag----tcgaggctgga-------ggcc-----------------
B D                   Panda  aggt-ggga--cag----aagtgactggg-------ggcc-----------------
             Pacific walrus  aggt-ggga--cgg----aagaggctggg-------ggcc-----------------
               Weddell seal  aggt-ggga--cgg----aagaggctggg-------ggcc-----------------
B D                Hedgehog  aggt-gcga--gaa-------------gg-------ggtt-----------------
            Star-nosed mole  tcgc-tggt--gac-------------gg-------cctg-----------------
B D                Elephant  aggt-ggga--gta----a-gaggccatg-------ggcttggcttca---------
        Cape elephant shrew  aggt-gggt--gcg----g-gagggtgt--------ggcttggccaca---------
B D                 Manatee  aggt-ggga--gca----a-gaggccatg-------ggcttagcatcg---------
                   Aardvark  aggc-tgga--gca----g-ggggctgtg-------ggcttggctcca---------
B D               Armadillo  tggt-ggaa--gag----acgaggtcctg-------ggcctgtcgcca---------
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  =========================================================
             Big brown bat  ---------------------------------------------------------
B D                Microbat  =========================================================
      David's myotis (bat)  =========================================================
B D                  Turkey  =========================================================
B D                 Megabat  =========================================================
    Lesser Egyptian jerboa  =========================================================
          Brush-tailed rat  =========================================================
B D                  Tenrec  =========================================================
B D         Chinese hamster  =========================================================
                Chinchilla  =========================================================
B D              Guinea pig  =========================================================
B D          Naked mole-rat  =========================================================
B D                Squirrel  ---------------------------------------------------------
          Black flying-fox  =========================================================
B D                   Horse  =========================================================
  D        Peregrine falcon  =========================================================
        Tibetan ground jay  =========================================================
  D            Mallard duck  =========================================================
B D     Medium ground finch  =========================================================
  D  White-throated sparrow  =========================================================
          Cape golden mole  =========================================================
  D     Collared flycatcher  =========================================================
  D            Saker falcon  =========================================================
B D              Budgerigar  =========================================================
B D         Tasmanian devil  =========================================================
B D                Platypus  =========================================================
B D             Zebra finch  =========================================================
  D         Green seaturtle  =========================================================
B D                 Chicken  =========================================================
B D      American alligator  =========================================================
  D             Rock pigeon  =========================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  =========================================================
B D                 Opossum  =========================================================
  D          Painted turtle  =========================================================

Inserts between block 22 and 23 in window
              Prairie vole 904bp
            Golden hamster 3bp
B D                  Mouse 2bp
B D                 Rabbit 2bp
B D                   Pika 2bp

Alignment block 23 of 1207 in window, 127837260 - 127837260, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Marmoset  a
B D                Bushbaby  a
B D                     Pig  g
B D                  Alpaca  a
             Bactrian camel  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                Elephant  g
        Cape elephant shrew  g
B D                 Manatee  t
                   Aardvark  g
B D               Armadillo  g
           Star-nosed mole  -
B D                   Shrew  N
B D                     Rat  =
B D                   Mouse  =
              Prairie vole  =
B D                Hedgehog  -
             Big brown bat  -
B D                Microbat  =
      David's myotis (bat)  =
B D                  Turkey  =
B D                 Megabat  =
    Lesser Egyptian jerboa  =
          Brush-tailed rat  =
B D                   Panda  -
B D                  Tenrec  =
            Golden hamster  =
B D         Chinese hamster  =
                Chinchilla  =
B D              Guinea pig  =
B D          Naked mole-rat  =
B D                Squirrel  -
B D                 Ferret   -
B D                     Cat  -
B D                  Rabbit  =
B D                     Dog  -
B D                    Pika  =
        Chinese tree shrew  -
              Killer whale  -
          Black flying-fox  =
B D                   Horse  =
  D        Peregrine falcon  =
        Tibetan ground jay  =
  D            Mallard duck  =
B D     Medium ground finch  =
  D  White-throated sparrow  =
          Cape golden mole  =
  D     Collared flycatcher  =
  D            Saker falcon  =
B D              Budgerigar  =
B D         Tasmanian devil  =
B D                Platypus  =
B D             Zebra finch  =
  D         Green seaturtle  =
B D                 Chicken  =
B D      American alligator  =
  D             Rock pigeon  =
B D         Squirrel monkey  N
B D                 Dolphin  -
              Weddell seal  -
            Pacific walrus  -
B D        White rhinoceros  =
B D                 Opossum  =
  D          Painted turtle  =

Alignment block 24 of 1207 in window, 127837261 - 127837267, 7 bps 
B D                   Human  tccagct
B D                   Chimp  tccagct
B D                 Gorilla  tccagct
B D               Orangutan  tccagcc
B D                  Gibbon  tccagcc
B D                  Rhesus  tcctgcc
B D     Crab-eating macaque  tcctgcc
B D                  Baboon  tcttgcc
B D            Green monkey  tcctgcc
B D                Marmoset  tccaacc
B D                Bushbaby  tccagct
         Chinese tree shrew  ----acc
             Golden hamster  ctcagct
B D                   Mouse  cccagct
B D              Guinea pig  ttaaact
B D                  Rabbit  tgggcct
B D                    Pika  tccagct
B D                     Pig  tctggcc
B D                  Alpaca  tcaggcc
             Bactrian camel  ttgggcc
           Tibetan antelope  tgtgctc
B D                     Cow  tgtggtc
B D                   Sheep  tgtgctc
              Domestic goat  tgtgctc
B D                Elephant  cccagcc
        Cape elephant shrew  agcagcc
B D                 Manatee  cccctgc
                   Aardvark  tccagcc
B D               Armadillo  acccgcc
           Star-nosed mole  -------
B D                   Shrew  NNNNNNN
B D                     Rat  =======
              Prairie vole  =======
B D                Hedgehog  -------
             Big brown bat  -------
B D                Microbat  =======
      David's myotis (bat)  =======
B D                  Turkey  =======
B D                 Megabat  =======
    Lesser Egyptian jerboa  =======
          Brush-tailed rat  =======
B D                   Panda  -------
B D                  Tenrec  =======
B D         Chinese hamster  =======
                Chinchilla  =======
B D          Naked mole-rat  =======
B D                Squirrel  -------
B D                 Ferret   -------
B D                     Cat  -------
B D                     Dog  -------
              Killer whale  -------
          Black flying-fox  =======
B D                   Horse  =======
  D        Peregrine falcon  =======
        Tibetan ground jay  =======
  D            Mallard duck  =======
B D     Medium ground finch  =======
  D  White-throated sparrow  =======
          Cape golden mole  =======
  D     Collared flycatcher  =======
  D            Saker falcon  =======
B D              Budgerigar  =======
B D         Tasmanian devil  =======
B D                Platypus  =======
B D             Zebra finch  =======
  D         Green seaturtle  =======
B D                 Chicken  =======
B D      American alligator  =======
  D             Rock pigeon  =======
B D         Squirrel monkey  NNNNNNN
B D                 Dolphin  -------
              Weddell seal  -------
            Pacific walrus  -------
B D        White rhinoceros  =======
B D                 Opossum  =======
  D          Painted turtle  =======

Inserts between block 24 and 25 in window
            Golden hamster 8bp
B D                  Mouse 417bp
B D             Guinea pig 1bp

Alignment block 25 of 1207 in window, 127837268 - 127837282, 15 bps 
B D                   Human  gaagtctttctggcc--
B D                   Chimp  gaagtctttctggcc--
B D                 Gorilla  gaagtctttctggcc--
B D               Orangutan  gaagtctttctggcc--
B D                  Gibbon  gaagtctttctggcc--
B D                  Rhesus  caggtctttctggcc--
B D     Crab-eating macaque  caggtctttctggcc--
B D                  Baboon  caggtctttctggcc--
B D            Green monkey  caggtctttctggcc--
B D                Marmoset  caagtctttctggcc--
B D                Bushbaby  cagatcttgtcagcc--
         Chinese tree shrew  ccagccttaccagcc--
             Golden hamster  ggtggcatttcaagt--
B D              Guinea pig  agcggcttcccggcc--
B D                  Rabbit  -gagccttgcc--ct--
B D                    Pika  -gagccttgctcact--
B D                     Pig  caggccttgctggca--
B D                  Alpaca  caggccttgatagcc--
             Bactrian camel  caggccttgatggcc--
B D                 Dolphin  caggccttgctggtg--
               Killer whale  caggccttgctggtg--
           Tibetan antelope  caggacttgctggtg--
B D                     Cow  caggacttgctggcg--
B D                   Sheep  caggacttgctggtg--
              Domestic goat  caggacttgctggtg--
B D                     Cat  caagcctttccggcg--
B D                     Dog  cgagccttgctggca--
B D                 Ferret   caagccttgctggtg--
B D                   Panda  caagccttgctggca--
             Pacific walrus  caagccttgctggtg--
               Weddell seal  caagccttgctggtg--
B D                Hedgehog  tgggacttg--------
            Star-nosed mole  caggctccg--------
B D                Elephant  cacaccttgcagaggag
        Cape elephant shrew  tgcatc-tgctgtggag
B D                 Manatee  caagccttgctgaggag
                   Aardvark  ctgacactgcagaggaa
B D               Armadillo  ca-----aggggacaaa
B D                   Shrew  NNNNNNNNNNNNNNNNN
B D                     Rat  =================
B D                   Mouse  =================
              Prairie vole  =================
             Big brown bat  -----------------
B D                Microbat  =================
      David's myotis (bat)  =================
B D                  Turkey  =================
B D                 Megabat  =================
    Lesser Egyptian jerboa  =================
          Brush-tailed rat  =================
B D                  Tenrec  =================
B D         Chinese hamster  =================
                Chinchilla  =================
B D          Naked mole-rat  =================
B D                Squirrel  -----------------
          Black flying-fox  =================
B D                   Horse  =================
  D        Peregrine falcon  =================
        Tibetan ground jay  =================
  D            Mallard duck  =================
B D     Medium ground finch  =================
  D  White-throated sparrow  =================
          Cape golden mole  =================
  D     Collared flycatcher  =================
  D            Saker falcon  =================
B D              Budgerigar  =================
B D         Tasmanian devil  =================
B D                Platypus  =================
B D             Zebra finch  =================
  D         Green seaturtle  =================
B D                 Chicken  =================
B D      American alligator  =================
  D             Rock pigeon  =================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNN
B D        White rhinoceros  =================
B D                 Opossum  =================
  D          Painted turtle  =================

Inserts between block 25 and 26 in window
B D              Orangutan 2bp
B D                 Gibbon 2bp
B D                 Rhesus 2bp
B D    Crab-eating macaque 2bp
B D                 Baboon 2bp
B D           Green monkey 2bp
B D               Marmoset 2bp
B D               Bushbaby 2bp
        Chinese tree shrew 2bp
            Golden hamster 2bp
B D             Guinea pig 89bp
B D                 Rabbit 2bp
B D                   Pika 2bp
B D                    Pig 2bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                Dolphin 2bp
              Killer whale 2bp
          Tibetan antelope 2bp
B D                    Cow 2bp
B D                  Sheep 2bp
             Domestic goat 2bp
B D                    Cat 2bp
B D                    Dog 2bp
B D                Ferret  2bp
B D                  Panda 2bp
            Pacific walrus 2bp
              Weddell seal 2bp

Alignment block 26 of 1207 in window, 127837283 - 127837305, 23 bps 
B D                   Human  gggctgc-aggc--------ttcatgcaacac
B D                   Chimp  ggactgc-aggc--------ttcatgcaacac
B D                 Gorilla  ggactgc-aggc--------ttcatgcaacac
B D               Orangutan  ggactct-aggc--------ttcatgcaacac
B D                  Gibbon  ggactgc-aggc--------ttcgtgcaacac
B D                  Rhesus  ggactgc-aggc--------ttcatgcaacac
B D     Crab-eating macaque  ggactgc-aggc--------ttcatgcaacac
B D                  Baboon  ggactgc-aggc--------ttcatgcaacac
B D            Green monkey  ggactgc-aggc--------ttcatgcaacac
B D                Marmoset  ggactgc-aggc--------ttcaagcaacac
B D                Bushbaby  ggactgc-aggt--------ttcaagcaacac
         Chinese tree shrew  aggctgc-agcc--------tttaaaaaacc-
             Golden hamster  gggctat-aatc--------ct---------c
B D              Guinea pig  gggttgc-agcc--------ctgtcccaccag
                 Chinchilla  gggttgc-agac--------ccgtgacaccag
B D                  Rabbit  ggactgc-aggc--------tc-------cag
B D                    Pika  ggcccgc-aggc--------tc-------cag
B D                     Pig  ggactgg-gggc--------ttcaagcagcac
B D                  Alpaca  ggactgt-gggc--------ttcaggcaacac
             Bactrian camel  ggactgt-gggc--------ttcaggcaacac
B D                 Dolphin  ggac--t-gggc--------ttcaaacaacac
               Killer whale  ggac--t-gggc--------ttcaaacaacac
           Tibetan antelope  ggactgt-gggc--------ttccagcaatac
B D                     Cow  ggactgt-gggc--------ttccagcaatac
B D                   Sheep  ggactgt-gggc--------ttccagcaatac
              Domestic goat  ggactgt-gggt--------ttccagcaatac
B D                     Cat  gggctgt-ggccttcaagtgttcaagcaacac
B D                     Dog  ggaccat-gggc--------tttgagcaacac
B D                 Ferret   ggactgtggggc--------ttccagcaacac
B D                   Panda  ggactgt-gggc--------ttcaagaaacac
             Pacific walrus  ggactgt-gggc--------ttcaagcaacac
               Weddell seal  ggactgt-gggc--------ttcaagcaacac
B D                Hedgehog  -----gc-tgtc--------ctccagtcctgg
            Star-nosed mole  -----gc-aacc--------ctt---------
B D                Elephant  agactgc-aggc--------ttcaggccacac
        Cape elephant shrew  gggctgc-aggt--------atcaa-------
B D                 Manatee  ggactgt-gggc--------ttcaggccacat
                   Aardvark  ggacggt--ggc--------ttcaggtgaccc
B D               Armadillo  tggctgc-cagc--------ttgcagtaccgc
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ================================
B D                   Mouse  ================================
              Prairie vole  ================================
             Big brown bat  --------------------------------
B D                Microbat  ================================
      David's myotis (bat)  ================================
B D                  Turkey  ================================
B D                 Megabat  ================================
    Lesser Egyptian jerboa  ================================
          Brush-tailed rat  ================================
B D                  Tenrec  ================================
B D         Chinese hamster  ================================
B D          Naked mole-rat  ================================
B D                Squirrel  --------------------------------
          Black flying-fox  ================================
B D                   Horse  ================================
  D        Peregrine falcon  ================================
        Tibetan ground jay  ================================
  D            Mallard duck  ================================
B D     Medium ground finch  ================================
  D  White-throated sparrow  ================================
          Cape golden mole  ================================
  D     Collared flycatcher  ================================
  D            Saker falcon  ================================
B D              Budgerigar  ================================
B D         Tasmanian devil  ================================
B D                Platypus  ================================
B D             Zebra finch  ================================
  D         Green seaturtle  ================================
B D                 Chicken  ================================
B D      American alligator  ================================
  D             Rock pigeon  ================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ================================
B D                 Opossum  ================================
  D          Painted turtle  ================================

Inserts between block 26 and 27 in window
            Golden hamster 12bp
B D             Guinea pig 9bp
                Chinchilla 9bp
B D                 Rabbit 3bp
B D                   Pika 3bp

Alignment block 27 of 1207 in window, 127837306 - 127837306, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Marmoset  c
B D                Bushbaby  c
B D          Naked mole-rat  c
B D              Guinea pig  c
                 Chinchilla  c
B D                  Rabbit  c
B D                    Pika  g
B D                     Pig  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  t
B D                     Cow  t
B D                   Sheep  t
              Domestic goat  t
B D                     Cat  c
B D                     Dog  c
             Pacific walrus  c
               Weddell seal  c
B D                Hedgehog  a
B D                Elephant  c
B D                 Manatee  c
                   Aardvark  c
B D               Armadillo  c
           Star-nosed mole  -
B D                   Shrew  N
B D                     Rat  =
B D                   Mouse  =
       Cape elephant shrew  -
              Prairie vole  =
             Big brown bat  -
B D                Microbat  =
      David's myotis (bat)  =
B D                  Turkey  =
B D                 Megabat  =
    Lesser Egyptian jerboa  =
          Brush-tailed rat  =
B D                   Panda  -
B D                  Tenrec  =
            Golden hamster  =
B D         Chinese hamster  =
B D                Squirrel  -
B D                 Ferret   -
        Chinese tree shrew  -
          Black flying-fox  =
B D                   Horse  =
  D        Peregrine falcon  =
        Tibetan ground jay  =
  D            Mallard duck  =
B D     Medium ground finch  =
  D  White-throated sparrow  =
          Cape golden mole  =
  D     Collared flycatcher  =
  D            Saker falcon  =
B D              Budgerigar  =
B D         Tasmanian devil  =
B D                Platypus  =
B D             Zebra finch  =
  D         Green seaturtle  =
B D                 Chicken  =
B D      American alligator  =
  D             Rock pigeon  =
B D         Squirrel monkey  N
B D        White rhinoceros  =
B D                 Opossum  =
  D          Painted turtle  =

Alignment block 28 of 1207 in window, 127837307 - 127837335, 29 bps 
B D                   Human  t-----ttc-aacctg------t--aaaagg--------aaaa---a-agaaggc
B D                   Chimp  t-----ttc-aacctg------t--aaaagg--------aaaa---a-agaaggc
B D                 Gorilla  t-----ttc-aacctg------t--aaaagg--------aaaa---a-agaaggc
B D               Orangutan  t-----ttc-aacctt------t--aaaagg--------aaaa---a-agaaggc
B D                  Gibbon  t-----ttc-aacctt------t--aaaagg--------aaaa---a-agaaggc
B D                  Rhesus  t-----ttc-aacctt------t--aaaagg--------aaaa---a-agt---c
B D     Crab-eating macaque  t-----ttc-aacctt------t--aaaagg--------aaaa---a-agt---c
B D                  Baboon  t-----ttc-aacctt------t--aaaagg--------aaaa---a-aga---c
B D            Green monkey  t-----ttc-aacctt------t--aaaagg--------aaaa---a-agt---c
B D                Marmoset  t-----ttc-aacctc------t--gaaagg--------aaaa---a-agaaggc
B D                Bushbaby  t-----ttc-aacct-----------aaagg--------aaaa---a-aaaggtt
             Golden hamster  t-----ttt-aatctt------t--aaaggg--------aaga---a-gta---g
B D                   Mouse  t-----ttt-aatctg------t--aaaggg--------agaagaca-gta---t
B D          Naked mole-rat  t-----tct-aacctt------t--agaggg--------ccga---a-aag---c
B D              Guinea pig  c-----tct-aacctt------t--aaaggg--------gtga---a-aa----t
                 Chinchilla  t-----tcc-agcctt------t--aaaggg--------ggta---a-aa----t
B D                  Rabbit  t-----ggc-agcctg------tggagaaaa--------ggga---a-ggc---t
B D                    Pika  t-----gacaagctag------agcaaaaaa--------agga---a-tgt---t
B D                     Pig  t-----tt--catctg------g--aaagaattaaaaaaaaaa---a-aaa----
B D                  Alpaca  t-----ttc-aacgtg------g--aaagaatggaaaaaaaaa---a-tgt----
             Bactrian camel  t-----ttc-aacctg------g--aaagaatgg-aaaaaaaa---a-tgt----
B D                 Dolphin  t-----tt--aacctg------g--aaagaatca-----aaaa---a-ggt----
               Killer whale  t-----tt--aacctg------g--aaagaatca-----aaaa---a-ggt----
           Tibetan antelope  t-----tt--aaactg------g--aaagaat-------aaaa---g-agt----
B D                     Cow  t-----tt--aacctg------g--aaagaat-------aaaa---g-agt----
B D                   Sheep  t-----tt--aaactg------g--aaagaat-------aaaa---g-agt----
              Domestic goat  a-----tt--aaactg------g--aaagaat-------aaaa---g-agt----
B D                     Cat  t-----ctc-aacctt------g--gaagaatga-----agaa---a-ggt----
B D                     Dog  t-----ctc-cacctt------g--gaagaataa-----aaaa---acggt----
B D                 Ferret   ------ttc-cagctt------g--agagaatag-----gaaa---a-ggt----
B D                   Panda  ------ctc-agcctt------g--gaagagtag-----aaaa---a-ggt----
             Pacific walrus  t-----ctc-aacctt------g--gaagaatag-----aaaa---a-ggt----
               Weddell seal  t-----ctc-aacctt------g--gaagaatag-----aaag---a-ggt----
B D                Hedgehog  tgtgtgtt--gac---------------------------aca---g-gac----
            Star-nosed mole  ------tt--gaccct------g--aagggcta------aaca---a-ggt----
B D                Elephant  t-----ttc-ctcctt---tagg--ggaaaa--------gaaa---a-gc-----
        Cape elephant shrew  ----------ctcctt---gagt--gcaggc--------tcag---g-gc-----
B D                 Manatee  t-----ttt-ctcctt------g--ggaaaa--------gaaa---a-g------
                   Aardvark  t-----ctc-ctcttt---ccag--ggagaa--------gaaa---a-gt-----
B D               Armadillo  t-----ttcactctttaaagaaa--aaaaaa--------taaa---g-ga-----
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  =======================================================
              Prairie vole  =======================================================
             Big brown bat  -------------------------------------------------------
B D                Microbat  =======================================================
      David's myotis (bat)  =======================================================
B D                  Turkey  =======================================================
B D                 Megabat  =======================================================
    Lesser Egyptian jerboa  =======================================================
          Brush-tailed rat  =======================================================
B D                  Tenrec  =======================================================
B D         Chinese hamster  =======================================================
B D                Squirrel  -------------------------------------------------------
        Chinese tree shrew  -------------------------------------------------------
          Black flying-fox  =======================================================
B D                   Horse  =======================================================
  D        Peregrine falcon  =======================================================
        Tibetan ground jay  =======================================================
  D            Mallard duck  =======================================================
B D     Medium ground finch  =======================================================
  D  White-throated sparrow  =======================================================
          Cape golden mole  =======================================================
  D     Collared flycatcher  =======================================================
  D            Saker falcon  =======================================================
B D              Budgerigar  =======================================================
B D         Tasmanian devil  =======================================================
B D                Platypus  =======================================================
B D             Zebra finch  =======================================================
  D         Green seaturtle  =======================================================
B D                 Chicken  =======================================================
B D      American alligator  =======================================================
  D             Rock pigeon  =======================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  =======================================================
B D                 Opossum  =======================================================
  D          Painted turtle  =======================================================

Inserts between block 28 and 29 in window
B D               Bushbaby 107bp

Alignment block 29 of 1207 in window, 127837336 - 127837349, 14 bps 
B D                   Human  cgggggtgg------------------------------g--cctc
B D                   Chimp  tgggggtgg------------------------------g--cctc
B D                 Gorilla  tgggggtgg------------------------------g--cctc
B D               Orangutan  tgggggtgg------------------------------g--cctc
B D                  Gibbon  tgggggtgg------------------------------g--cctc
B D                  Rhesus  cgggggtgg------------------------------g--cctc
B D     Crab-eating macaque  cgggggtgg------------------------------a--cctc
B D                  Baboon  tgggagtgg------------------------------g--cctc
B D            Green monkey  tggg-gtgg------------------------------g--cctc
B D                Marmoset  tgggggtgg------------------------------g--tctt
B D                Bushbaby  tgagactga------------------------------g--tctc
         Chinese tree shrew  cagaggtgg-----------------------------------tg
             Golden hamster  tcacagtaa------------------------------a--tctc
B D                   Mouse  taaaggtag------------------------------a--cctc
B D          Naked mole-rat  tgggagtgg------------------------------g--cctc
B D              Guinea pig  tgggggt-g------------------------------g--tttc
                 Chinchilla  caggggt-g------------------------------g--cttc
B D                  Rabbit  g---ggctg------------------------------g--ctt-
B D                    Pika  gagagatgg------------------------------g--ctc-
B D                     Pig  tggtcgtgg----------------------------ccagacctc
B D                  Alpaca  tgcgggtgg------------------------------a--tctc
             Bactrian camel  tgcgggtgg------------------------------a--tctc
B D                 Dolphin  tgagggtgg----------------------------acacacctc
               Killer whale  tgagggtgg----------------------------acacacctc
           Tibetan antelope  ttagggtgg------------------------------acccctc
B D                     Cow  tgagggtgg------------------------------acccctc
B D                   Sheep  tgagggtgg------------------------------acccctc
              Domestic goat  tgagggtgg------------------------------acccctc
B D                     Cat  tccgggtgg------------------------------a--cctc
B D                     Dog  t-cgagtgg------------------------------a--cctc
B D                 Ferret   t-cgggcgg------------------------------g--cctc
B D                   Panda  t-cgggtgg------------------------------a--cctc
             Pacific walrus  t-tgggtgg------------------------------a--ccta
               Weddell seal  t-tgggtgg------------------------------a--cctc
B D                Hedgehog  tgagtgctg------------------------------g--ctgc
            Star-nosed mole  tgggcgtga------------------------------a--cttc
B D                Elephant  tgggggtgg------------------------------g--tctc
        Cape elephant shrew  tgcgggtggtaccagcacctctcctcttctaagggcagtg--tcgg
B D                 Manatee  tgggggtgg------------------------------g--cctc
                   Aardvark  tgcgagtgg------------------------------g--cctc
B D               Armadillo  tgaggctgg------------------------------c--cctc
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ==============================================
              Prairie vole  ==============================================
             Big brown bat  ----------------------------------------------
B D                Microbat  ==============================================
      David's myotis (bat)  ==============================================
B D                  Turkey  ==============================================
B D                 Megabat  ==============================================
    Lesser Egyptian jerboa  ==============================================
          Brush-tailed rat  ==============================================
B D                  Tenrec  ==============================================
B D         Chinese hamster  ==============================================
B D                Squirrel  ----------------------------------------------
          Black flying-fox  ==============================================
B D                   Horse  ==============================================
  D        Peregrine falcon  ==============================================
        Tibetan ground jay  ==============================================
  D            Mallard duck  ==============================================
B D     Medium ground finch  ==============================================
  D  White-throated sparrow  ==============================================
          Cape golden mole  ==============================================
  D     Collared flycatcher  ==============================================
  D            Saker falcon  ==============================================
B D              Budgerigar  ==============================================
B D         Tasmanian devil  ==============================================
B D                Platypus  ==============================================
B D             Zebra finch  ==============================================
  D         Green seaturtle  ==============================================
B D                 Chicken  ==============================================
B D      American alligator  ==============================================
  D             Rock pigeon  ==============================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ==============================================
B D                 Opossum  ==============================================
  D          Painted turtle  ==============================================

Alignment block 30 of 1207 in window, 127837350 - 127837384, 35 bps 
B D                   Human  agctgctg----------cca-c-----------tggc-at------tgt---atcactg----------
B D                   Chimp  agctgctg----------cca-c-----------tgac-at------tgt---atcactg----------
B D                 Gorilla  agctgctg----------cca-c-----------tgac-at------tgt---atcactg----------
B D               Orangutan  agctgctg----------cca-c-----------tgac-at------tgt---atcactg----------
B D                  Gibbon  agctgctg----------cca-c-----------tgac-at------tgt---atcactg----------
B D                  Rhesus  agctgctg----------cca-c-----------tgac-at------tgc---attgttg----------
B D     Crab-eating macaque  agctgctg----------cca-c-----------tgac-at------tgt---attgttg----------
B D                  Baboon  agctgctg----------cca-c-----------tgac-at------tgt---attgttg----------
B D            Green monkey  agctgctg----------cca-c-----------tgac-gt------tgt---attgttg----------
B D                Marmoset  agctgctg----------cca-c-----------tgac-at------ttt---attgttt----------
B D                Bushbaby  actt--tg----------tca-cccttggtagagtgcc-ac------ggc---atcacagctcatagtaa
         Chinese tree shrew  gtacactg----------cca-c-----------tgac-at------ttt---agcattt----------
             Golden hamster  g------------------cagc-----------tgac-ac------t-----gtcactt----------
B D                   Mouse  agctgctg----------ctgtc-----------tgac-ac------ttg---atcattt----------
B D          Naked mole-rat  agctgttg----------cca-c-----------tgac-ct------ttt---atcattt----------
B D              Guinea pig  tgctgttg----------ccg-t-----------tgac-at------ttt---atcattt----------
                 Chinchilla  agctattg----------cca-c-----------tgac-at------ttt---atcattt----------
B D                  Rabbit  -gctgctg----------tca-c-----------gacc--c------ttt---atcacgt----------
B D                    Pika  -gctgctg----------tta-c-----------tgatggc------ttt---accatgt----------
B D                     Pig  agctgctg----------cca-c-----------tgac-at------ctt---atcattt----------
B D                  Alpaca  agctgctg----------cca-c-----------tgac-at------ttt---atcattt----------
             Bactrian camel  agctgctg----------cca-c-----------tgac-at------ttt---atcattt----------
B D                 Dolphin  agctg-----------------c-----------tgac-at------ttt---atcattt----------
               Killer whale  agctg-----------------c-----------tgac-at------ttt---atcattt----------
           Tibetan antelope  agctgctc----------ctg-c-----------tgac-at------ctt---atcactt----------
B D                     Cow  agctgctg----------ctg-c-----------tgac-at------ctt---atcactt----------
B D                   Sheep  agctgctc----------cta-c-----------tgac-at------ctt---atcactt----------
              Domestic goat  agctgctc----------ctg-c-----------tgac-at------ctt---atcactt----------
B D                     Cat  agctgctg----------cca-t-----------ggac-at------ttt---gtcattt----------
B D                     Dog  agctgcc-----------------------------ac-at------tct---gtcattg----------
B D                 Ferret   cgctgctg----------cca-c-----------tgac-cc------tct---gtccatg----------
B D                   Panda  agctgctg----------cca-c-----------tgac-ct------tct---gtcattg----------
             Pacific walrus  agcttccg----------cca-c-----------tgac-at------tct---gtcatcg----------
               Weddell seal  agctgccg----------cca-c-----------tgat-gt------tct---gtcatcg----------
              Big brown bat  agcgactg----------caa-g-----------tgac-at------tgg---atcacgt----------
B D                Hedgehog  aggcagtggaggtgagactca-g-----------ctgc-at------ccttgaagcatc-----------
            Star-nosed mole  gaccactg----------cca-c-----------cgac-ac------gttaatcacatt-----------
B D                Elephant  agctgctg----------cca-c-----------tgac-ac------ttt---atcgtga----------
        Cape elephant shrew  ggctgccg----------ctg-c-----------tgac-aa--------c---atcagga----------
B D                 Manatee  agctgctg----------cca-c-----------taac-ac------ttt---atcatga----------
                   Aardvark  cgttgctg----------cca-c-----------tgcc-actgccatttt---atctcga----------
B D               Armadillo  agctgctg----------cca-c-----------tgac-at-----tttc---atcacta----------
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                  Turkey  ======================================================================
B D                 Megabat  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
B D         Chinese hamster  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
          Black flying-fox  ======================================================================
B D                   Horse  ======================================================================
  D        Peregrine falcon  ======================================================================
        Tibetan ground jay  ======================================================================
  D            Mallard duck  ======================================================================
B D     Medium ground finch  ======================================================================
  D  White-throated sparrow  ======================================================================
          Cape golden mole  ======================================================================
  D     Collared flycatcher  ======================================================================
  D            Saker falcon  ======================================================================
B D              Budgerigar  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
B D             Zebra finch  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D      American alligator  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ======================================================================
B D                 Opossum  ======================================================================
  D          Painted turtle  ======================================================================

                      Human  -------------------a------agcgt---t
                      Chimp  -------------------a------agcgt---t
                    Gorilla  -------------------a------agcgt---t
                  Orangutan  -------------------a------agcgt---t
                     Gibbon  -------------------a------agcg-----
                     Rhesus  -------------------a------agctt---t
        Crab-eating macaque  -------------------a------agctt---t
                     Baboon  -------------------a------agctt---t
               Green monkey  -------------------a------agctt---t
                   Marmoset  -------------------a------gggtt---t
                   Bushbaby  tctcaaactcctgggctcaa------gggat---t
         Chinese tree shrew  -------------------a------aacat---a
             Golden hamster  -------------------a------agcat----
                      Mouse  -------------------a------agctc----
             Naked mole-rat  -------------------g------agctt----
                 Guinea pig  -------------------g------agcat----
                 Chinchilla  -------------------atcatttcgcat----
                     Rabbit  -------------------a------agcat----
                       Pika  -------------------a------aacat----
                        Pig  -------------------a------agcac----
                     Alpaca  -------------------a------agcac----
             Bactrian camel  -------------------a------agcac----
                    Dolphin  -------------------a------agcac-t--
               Killer whale  -------------------a------agcacat--
           Tibetan antelope  -------------------a------agcac----
                        Cow  -------------------a------agcac----
                      Sheep  -------------------a------agcat----
              Domestic goat  -------------------a------agcac----
                        Cat  -------------------a------agcat--a-
                        Dog  -------------------a------aacat--a-
                    Ferret   -------------------a------agcct--g-
                      Panda  -------------------a------agcct--a-
             Pacific walrus  -------------------a------agcct--a-
               Weddell seal  -------------------a------agcct--a-
              Big brown bat  -------------------a------ggcat--a-
                   Hedgehog  -----------------------------------
            Star-nosed mole  -----------------------------------
                   Elephant  -------------------a------agca-----
        Cape elephant shrew  -------------------a------agca-----
                    Manatee  -------------------a------agca-----
                   Aardvark  -------------------g------agca-----
                  Armadillo  -------------------a------agca-----
                      Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Rat  ===================================
               Prairie vole  ===================================
                   Microbat  ===================================
       David's myotis (bat)  ===================================
                     Turkey  ===================================
                    Megabat  ===================================
     Lesser Egyptian jerboa  ===================================
           Brush-tailed rat  ===================================
                     Tenrec  ===================================
            Chinese hamster  ===================================
                   Squirrel  -----------------------------------
           Black flying-fox  ===================================
                      Horse  ===================================
           Peregrine falcon  ===================================
         Tibetan ground jay  ===================================
               Mallard duck  ===================================
        Medium ground finch  ===================================
     White-throated sparrow  ===================================
           Cape golden mole  ===================================
        Collared flycatcher  ===================================
               Saker falcon  ===================================
                 Budgerigar  ===================================
            Tasmanian devil  ===================================
                   Platypus  ===================================
                Zebra finch  ===================================
            Green seaturtle  ===================================
                    Chicken  ===================================
         American alligator  ===================================
                Rock pigeon  ===================================
            Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           White rhinoceros  ===================================
                    Opossum  ===================================
             Painted turtle  ===================================

Inserts between block 30 and 31 in window
B D                    Pig 2bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
          Tibetan antelope 2bp
B D                    Cow 2bp
B D                  Sheep 2bp
             Domestic goat 2bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
             Big brown bat 1bp

Alignment block 31 of 1207 in window, 127837385 - 127837398, 14 bps 
B D                   Human  ttttgt------------------------------------------tg-----ttgttt
B D                   Chimp  tttttt------------------------------------------ggttttttttttt
B D                 Gorilla  ttttt--------------------------------------------------tttttt
B D               Orangutan  tttttt------------------------------------------tgtttttttgctt
B D                  Gibbon  -------------------------------------------------------tttgtt
B D                  Rhesus  tttttg-------------------------------------------------tttgtt
B D     Crab-eating macaque  tttttg------------------------------------------tttgttttttgtt
B D                  Baboon  tttttg-------------------------------------------------tttgtt
B D            Green monkey  tttttg-----------------------------------------------tttgtgtt
B D                Marmoset  -------------------------------------------------------tttttt
B D                Bushbaby  ctcttgcctcagcttcccaagtagctgggactaaggagcccaccacaatgcctggctattt
         Chinese tree shrew  tatt---------------------------------------------------------
B D                 Dolphin  -----------------------------------------------------------tt
               Killer whale  -----------------------------------------------------------tt
B D                Elephant  ----------------------------------------------------------gct
        Cape elephant shrew  ----------------------------------------------------------gct
B D                 Manatee  ----------------------------------------------------------gct
                   Aardvark  ----------------------------------------------------------ttt
B D               Armadillo  ----------------------------------------------------------tat
           Star-nosed mole  -------------------------------------------------------------
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  =============================================================
B D                   Mouse  -------------------------------------------------------------
              Prairie vole  =============================================================
B D                Hedgehog  -------------------------------------------------------------
             Big brown bat  =============================================================
B D                Microbat  =============================================================
      David's myotis (bat)  =============================================================
B D                  Turkey  =============================================================
            Bactrian camel  =============================================================
B D                  Alpaca  =============================================================
B D                 Megabat  =============================================================
    Lesser Egyptian jerboa  =============================================================
          Brush-tailed rat  =============================================================
B D                   Panda  =============================================================
B D                  Tenrec  =============================================================
            Golden hamster  -------------------------------------------------------------
B D         Chinese hamster  =============================================================
                Chinchilla  -------------------------------------------------------------
B D              Guinea pig  -------------------------------------------------------------
B D          Naked mole-rat  -------------------------------------------------------------
B D                Squirrel  -------------------------------------------------------------
B D                 Ferret   =============================================================
B D                     Cat  =============================================================
B D                  Rabbit  -------------------------------------------------------------
B D                     Dog  =============================================================
             Domestic goat  =============================================================
B D                    Pika  -------------------------------------------------------------
B D                   Sheep  =============================================================
B D                     Cow  =============================================================
          Tibetan antelope  =============================================================
          Black flying-fox  =============================================================
B D                   Horse  =============================================================
  D        Peregrine falcon  =============================================================
        Tibetan ground jay  =============================================================
  D            Mallard duck  =============================================================
B D     Medium ground finch  =============================================================
  D  White-throated sparrow  =============================================================
          Cape golden mole  =============================================================
  D     Collared flycatcher  =============================================================
  D            Saker falcon  =============================================================
B D              Budgerigar  =============================================================
B D         Tasmanian devil  =============================================================
B D                Platypus  =============================================================
B D             Zebra finch  =============================================================
  D         Green seaturtle  =============================================================
B D                 Chicken  =============================================================
B D      American alligator  =============================================================
  D             Rock pigeon  =============================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Weddell seal  =============================================================
            Pacific walrus  =============================================================
B D        White rhinoceros  =============================================================
B D                 Opossum  =============================================================
  D          Painted turtle  =============================================================
B D                     Pig  =============================================================

Alignment block 32 of 1207 in window, 127837399 - 127837400, 2 bps 
B D                   Human  tt
B D                   Chimp  tt
B D                 Gorilla  tt
B D               Orangutan  tt
B D                  Gibbon  tt
B D                  Rhesus  tt
B D     Crab-eating macaque  tt
B D                  Baboon  tt
B D            Green monkey  tt
B D                Marmoset  tt
B D                Bushbaby  tt
B D                 Dolphin  tt
               Killer whale  tt
B D                 Opossum  tt
           Star-nosed mole  --
B D                   Shrew  NN
B D                     Rat  ==
B D                   Mouse  --
       Cape elephant shrew  --
              Prairie vole  ==
B D                Hedgehog  --
             Big brown bat  ==
B D                Microbat  ==
      David's myotis (bat)  ==
B D                  Turkey  ==
            Bactrian camel  ==
B D                  Alpaca  ==
B D                 Megabat  ==
    Lesser Egyptian jerboa  ==
          Brush-tailed rat  ==
B D                   Panda  ==
B D                  Tenrec  ==
            Golden hamster  --
B D         Chinese hamster  ==
                Chinchilla  --
B D              Guinea pig  --
B D          Naked mole-rat  --
B D                Squirrel  --
B D                 Ferret   ==
B D               Armadillo  --
B D                     Cat  ==
B D                  Rabbit  --
B D                 Manatee  --
B D                     Dog  ==
             Domestic goat  ==
B D                    Pika  --
B D                Elephant  --
        Chinese tree shrew  --
B D                   Sheep  ==
B D                     Cow  ==
          Tibetan antelope  ==
          Black flying-fox  ==
B D                   Horse  ==
  D        Peregrine falcon  ==
        Tibetan ground jay  ==
  D            Mallard duck  ==
B D     Medium ground finch  ==
  D  White-throated sparrow  ==
          Cape golden mole  ==
  D     Collared flycatcher  ==
  D            Saker falcon  ==
B D              Budgerigar  ==
B D         Tasmanian devil  ==
B D                Platypus  ==
B D             Zebra finch  ==
  D         Green seaturtle  ==
B D                 Chicken  ==
B D      American alligator  ==
  D             Rock pigeon  ==
B D         Squirrel monkey  NN
              Weddell seal  ==
            Pacific walrus  ==
B D        White rhinoceros  ==
                  Aardvark  --
  D          Painted turtle  ==
B D                     Pig  ==

Inserts between block 32 and 33 in window
B D              Orangutan 2bp
B D               Bushbaby 121bp
B D                Dolphin 2bp
              Killer whale 2bp

Alignment block 33 of 1207 in window, 127837401 - 127837436, 36 bps 
B D                   Human  tt---ttttttgaataccggaaa-tta--------------aggggaaattcgg----------------
B D                   Chimp  tt---ttttttgaataccggaaa-tta--------------aggggaagttcgg----------------
B D                 Gorilla  tt---tttttttaataccggaaa-tta--------------aggggaagttcag----------------
B D               Orangutan  tt---ttttttgaataccggaaa-tta--------------aggggaagtttag----------------
B D                  Gibbon  tt---ttttttgaataccggaaa-tta--------------aggggaagtttag----------------
B D                  Rhesus  tt---gtttttgaatactggaaa-tta--------------gggggaagtttag----------------
B D     Crab-eating macaque  tt---gtttttgaatactggaaa-tta--------------gggggaagtttag----------------
B D                  Baboon  tt---gtttttgaataccagaaa-tta--------------aggggaagtttag----------------
B D            Green monkey  tt---gtttttgaataccggaaa-tta--------------aggggaagtttag----------------
B D                Marmoset  tt---ttttttgaataccggaaa-tta--------------aggggaagtttag----------------
B D                Bushbaby  ta---ttttttcaatactggaaa-tta--------------aggggaagtttag----------------
         Chinese tree shrew  ------cttttaaataccagaaa-cta--------------agggaacattttg----------------
             Golden hamster  -t---tattcttggaaa-tggac-tta--tttttctctcttgttgggaaccgaa----------------
B D                   Mouse  -a---tattctggaaaactggac-ttggtttttcttctgttgttgagaactgag----------------
B D          Naked mole-rat  -atattcttttgaatgccagaaa-tta--------------aatggaagttcag----------------
B D              Guinea pig  -a---ttctttgaatagcagaaa-tta--------------aatggaagtttag----------------
                 Chinchilla  -----tattttgaataccaaaaa-tta--------------aatggaagtttag----------------
B D                  Rabbit  cg---ccttgtgaagaccagaag-tta---------------ggggaagttctg----------------
B D                    Pika  ca---tgttttgaaagccagaag-tta---------------caggaaggttaa----------------
B D                     Pig  ag---ttttttgattaccagaaa-ttc--------------aggggaagtttag----------------
B D                  Alpaca  at---ttttttgaataccggaaa-tta--------------aggggaagtttag----------------
             Bactrian camel  at---ttttttgaataccggaaa-tta--------------aggggaagtttag----------------
B D                 Dolphin  tt---ttttttgaaaaccggaaa-tta--------------aggggaagtttag----------------
               Killer whale  tt---ttttttgaaaaccggaaa-tta--------------aggggaagtttag----------------
           Tibetan antelope  at---ttttctgaaaaccagaaa-tta--------------agaggaaatttag----------------
B D                     Cow  at---ttttctgaataccagaaa-tta--------------agaggaaatttag----------------
B D                   Sheep  at---ttttctgaatgccagaaa-tta--------------agaggaaatttag----------------
              Domestic goat  at---ttttctgaatgccagaaa-tta--------------agaggaaatttag----------------
B D                     Cat  at---tattttgaatgctagaaa-tta--------------aggggacatttag----------------
B D                     Dog  at---tattttgaatactggaga-tta--------------aggggacattgag----------------
B D                 Ferret   gt---tattttggatactggaag-cta--------------aggggacgcttag----------------
B D                   Panda  at---tattttgagtaccagaag-tta--------------aggggacgcttag----------------
             Pacific walrus  at---tattttgaacaccggaag-tta--------------atgggacgcttag----------------
               Weddell seal  at---tattttgaacaccggaag-tta--------------aggggacgcttag----------------
           Black flying-fox  tt---ttttttgaatactggaaa-tta--------------agtggaaatt-ag----------------
B D                 Megabat  tt---ttttttgaatactggaaa-ttg--------------agtggaaatt-ag----------------
              Big brown bat  at---ttttctgaatgccggaaa-tta--------------agggcacgttgag----------------
B D                Hedgehog  -t---gcttttcagtgctgggag-tta--------------aggggaagtttcc----------------
            Star-nosed mole  -t---gc------atactggaaa-tga--------------agggggagtttag----------------
B D                Elephant  at---tttttagaatactgggaattta--------------aggggatgtttag----------------
        Cape elephant shrew  at---ttttttgaatactggaaaatta--------------aggggaagtttaa----------------
B D                 Manatee  at---gttttggaatcctggaaaatta--------------aggggaaatttag----------------
                   Aardvark  at---tttt--gaatactagaaaacga--------------agggggagttttg----------------
B D               Armadillo  at---gtttttggatactggaaaatta--------------aggggaagtttag----------------
B D                 Opossum  tt---ttttttaaattttggaaaatta--------------ggggaaggagtagtggaagggaggataat
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
B D                  Turkey  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
          Brush-tailed rat  ======================================================================
B D                  Tenrec  ======================================================================
B D         Chinese hamster  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
B D                   Horse  ======================================================================
  D        Peregrine falcon  ======================================================================
        Tibetan ground jay  ======================================================================
  D            Mallard duck  ======================================================================
B D     Medium ground finch  ======================================================================
  D  White-throated sparrow  ======================================================================
          Cape golden mole  ======================================================================
  D     Collared flycatcher  ======================================================================
  D            Saker falcon  ======================================================================
B D              Budgerigar  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                Platypus  ======================================================================
B D             Zebra finch  ======================================================================
  D         Green seaturtle  ======================================================================
B D                 Chicken  ======================================================================
B D      American alligator  ======================================================================
  D             Rock pigeon  ======================================================================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ======================================================================
  D          Painted turtle  ======================================================================

                      Human  -
                      Chimp  -
                    Gorilla  -
                  Orangutan  -
                     Gibbon  -
                     Rhesus  -
        Crab-eating macaque  -
                     Baboon  -
               Green monkey  -
                   Marmoset  -
                   Bushbaby  -
         Chinese tree shrew  -
             Golden hamster  -
                      Mouse  -
             Naked mole-rat  -
                 Guinea pig  -
                 Chinchilla  -
                     Rabbit  -
                       Pika  -
                        Pig  -
                     Alpaca  -
             Bactrian camel  -
                    Dolphin  -
               Killer whale  -
           Tibetan antelope  -
                        Cow  -
                      Sheep  -
              Domestic goat  -
                        Cat  -
                        Dog  -
                    Ferret   -
                      Panda  -
             Pacific walrus  -
               Weddell seal  -
           Black flying-fox  -
                    Megabat  -
              Big brown bat  -
                   Hedgehog  -
            Star-nosed mole  -
                   Elephant  -
        Cape elephant shrew  -
                    Manatee  -
                   Aardvark  -
                  Armadillo  -
                    Opossum  t
                      Shrew  N
                        Rat  =
               Prairie vole  =
                   Microbat  =
       David's myotis (bat)  =
                     Turkey  =
     Lesser Egyptian jerboa  =
           Brush-tailed rat  =
                     Tenrec  =
            Chinese hamster  =
                   Squirrel  -
                      Horse  =
           Peregrine falcon  =
         Tibetan ground jay  =
               Mallard duck  =
        Medium ground finch  =
     White-throated sparrow  =
           Cape golden mole  =
        Collared flycatcher  =
               Saker falcon  =
                 Budgerigar  =
            Tasmanian devil  =
                   Platypus  =
                Zebra finch  =
            Green seaturtle  =
                    Chicken  =
         American alligator  =
                Rock pigeon  =
            Squirrel monkey  N
           White rhinoceros  =
             Painted turtle  =

Inserts between block 33 and 34 in window
B D              Armadillo 425bp

Alignment block 34 of 1207 in window, 127837437 - 127837455, 19 bps 
B D                   Human  a--aacctcataatggc-t-----tca-
B D                   Chimp  a--aacctcataatggc-t-----tca-
B D                 Gorilla  a--aacctcataatggc-t-----tca-
B D               Orangutan  a--aacctcataatggc-t-----tca-
B D                  Gibbon  a--aacctcataatggc-t-----tca-
B D                  Rhesus  a--agcctcataatggc-t-----tca-
B D     Crab-eating macaque  a--agcctcataatggc-t-----tca-
B D                  Baboon  a--aacctcataatggc-t-----tca-
B D            Green monkey  a--aacctcataatggc-t-----tca-
B D                Marmoset  a--aacttcataatggc-g-----tca-
B D                Bushbaby  a--actttcagagtggc-t-----tca-
         Chinese tree shrew  a--aacttcataattgc-t-----atg-
             Golden hamster  actaca-tcttcacaca-tgctaatcg-
B D                   Mouse  ccaacc-ttctcacgta-tgttaattg-
B D          Naked mole-rat  a--aac-atttaatgac-c-----tca-
B D              Guinea pig  a--aag-ttttaatgaa-t-----tca-
                 Chinchilla  a--aac-ttttaatgta-t-----tca-
B D                  Rabbit  a--aac--cctggtgac-t-----tca-
B D                    Pika  a--aac--tgtgatgtc-a-----tta-
B D                     Pig  a--aacttcctaatggc-t-----tca-
B D                  Alpaca  a--agcttcgtaatagc-t-----tca-
             Bactrian camel  a--agcttcgtaatagc-t-----tca-
B D                 Dolphin  a--aacttcatcatggc-c-----tca-
               Killer whale  a--aacttcatcatggc-c-----tca-
           Tibetan antelope  a--aacgccattctgaagt-----tca-
B D                     Cow  a--aactacattctgaagt-----tca-
B D                   Sheep  a--aacgccattctgaagt-----tca-
              Domestic goat  a--aacgccattctgaagt-----tca-
B D                     Cat  a--aacttccagatggc-t-----ttg-
B D                     Dog  a--aacttccacgtggc-t-----tcg-
B D                 Ferret   a--aacttccagatggc-t-----tca-
B D                   Panda  a--aactt-cacatggc-t-----ttg-
             Pacific walrus  a--aacttccaaatggc-t-----tcg-
               Weddell seal  a--aacttccaaatggc-t-----tcg-
           Black flying-fox  a--aacttcatcatggt-t-----gt--
B D                 Megabat  a--aacttcatcatggt-t-----gt--
              Big brown bat  a--aacttcccactggc-t-----tta-
B D                Hedgehog  a--aacttcagaatgg---------ca-
            Star-nosed mole  a--catctcatgatgac-t-----tca-
B D                Elephant  a--agtgtcataatggc-t-----tca-
        Cape elephant shrew  g--agcgtcattatggc-t-----tca-
B D                 Manatee  a--agcgtcataat-gc-t-----tca-
                   Aardvark  a--agagccgtgatggc-t-----tca-
B D               Armadillo  a--aaagtcctgttggc-c-----tca-
B D                 Opossum  g--aagttgattgctgc-t-----tacc
B D                   Shrew  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Rat  ============================
              Prairie vole  ============================
B D                Microbat  ============================
      David's myotis (bat)  ============================
B D                  Turkey  ============================
    Lesser Egyptian jerboa  ============================
          Brush-tailed rat  ============================
B D                  Tenrec  ============================
B D         Chinese hamster  ============================
B D                Squirrel  ----------------------------
B D                   Horse  ============================
  D        Peregrine falcon  ============================
        Tibetan ground jay  ============================
  D            Mallard duck  ============================
B D     Medium ground finch  ============================
  D  White-throated sparrow  ============================
          Cape golden mole  ============================
  D     Collared flycatcher  ============================
  D            Saker falcon  ============================
B D              Budgerigar  ============================
B D         Tasmanian devil  ============================
B D                Platypus  ============================
B D             Zebra finch  ============================
  D         Green seaturtle  ============================
B D                 Chicken  ============================
B D      American alligator  ============================
  D             Rock pigeon  ============================
B D         Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D        White rhinoceros  ============================
  D          Painted turtle  ============================

Alignment block 35 of 1207 in window, 127837456 - 127837471, 16 bps 
B D                   Human  t----gaacc---at----tgcac----ttg
B D                   Chimp  t----gaacc---at----tgcac----ttg
B D                 Gorilla  t----gaacc---at----tgcgc----ttg
B D               Orangutan  t----gaacc---at----tgcac----ttg
B D                  Gibbon  t----gaacc---at----tgcac----ttg
B D                  Rhesus  t----gaacc---at----tgcac----ttg
B D     Crab-eating macaque  t----gaacc---at----tgcac----ttg
B D                  Baboon  t----gaacc---at----tgcac----ttg