Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 520 in window, 59238568 - 59238625, 58 bps 
B D                     Human  aacaaatc-taatttttattgttccttaaggaca---tggctgtgttggagacaaag-gagag
B D                     Chimp  aacaaatc-taatttttattgttccttaaggaca---tggctgtgtcggagacaaag-gagag
B D                   Gorilla  aacaaatc-taatttttattgttccttaaggaca---tggttgtgtcggagacaaag-gagag
B D                 Orangutan  aacaaatc-taatttttattgttccttaaggaca---tggctgtgtcggagacaaag-gagag
B D                    Gibbon  aacaaatc-taatttttattgttccttaaggaca---tggctgtgtcggagacaaag-gagag
B D                    Rhesus  aacaaatc-taatttttattgttccttaaggaca---tggctgtgtcggagacaaag-gagag
B D       Crab-eating macaque  aacaaatc-taatttttattgttccttaaggaca---tggctgtgtcggagacaaag-gagag
B D                    Baboon  aacaaatc-taatttttattgttccttaaggaca---tggctgtgtcggagacaaag-gagag
B D              Green monkey  aacaaatc-taatttttattgttccttaaggaca---tggctgtgtcggagacaaag-gagag
B D                  Marmoset  aacaaatc-taatttttattgttccttaaggaca---tggctgtgttggagacaaag-gagag
B D           Squirrel monkey  aacaaatc-taatttttattgttccttaaggaca---tggctgtgtcggagacaaag-gagag
B D                  Bushbaby  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacaaag-gagag
           Chinese tree shrew  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacaaag-gagag
B D                  Squirrel  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacaaag-gagag
       Lesser Egyptian jerboa  aacaaatc-taatttttattgttcctggagggga---tggctgtgtcggagacaaag-gagaa
                 Prairie vole  aacaaatc-taatttttattgttccttaaggaga---tgtctgtgccggagacaaag-gagaa
B D           Chinese hamster  aacaaatt-taatttttattgttccttaaggaga---tgtctgtgctggagacaaag-gagaa
               Golden hamster  aacaaatc-taatttttattgttccttaaggaga---tgtctgtgccggagacaaag-gagaa
B D                     Mouse  aacaaatc-taatttttattgttccttaaggaga---tgtctgtgccggagacaaag-gagaa
B D                       Rat  aacaaatc-taatttttattgttccttaaggaga---tgtctgtgccggagacaaag-gagaa
B D            Naked mole-rat  aacaaatc-taatttttattgttccttaaggaga---tggctgtgttggagacaaag-gagag
B D                Guinea pig  aacaaatc-taattgttattgttccttaaagaga---tggctgtgttggagacaaaa-gggtg
                   Chinchilla  aacaaatc-taatttttattgttccttaaggaga---tagctgtgtcggaaacaaag-gagag
             Brush-tailed rat  aacaaatt-taatttttattgttccttgaggaga---tagctgggttggaaacaaag-gagag
B D                    Rabbit  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacaaag-gagag
B D                      Pika  aacaaatc-taatttttagtgttccttaaggaga---tggttgtgttgaagacaaag-gagcg
B D                       Pig  aacaaatc-taatttttattgttccttaaggaga---tgactgtgtcggagacaaag-gagag
B D                    Alpaca  aacaaatc-taatttttattattccttaaggaga---tagctgtgttggagacaaag-gagag
               Bactrian camel  aacaaatc-taatttttattgttccttaaggaga---tagctgtgttggagacaaag-gagag
B D                   Dolphin  aacaaatc-taatttttattgttccttaaggaga---tgactgtgtcagagacaaag-gagag
                 Killer whale  aacaaatc-taatttttattgttccttaaggaga---tgactgtgtcagagacaaag-gagag
             Tibetan antelope  aacaaatc-taatttttattgttccttaaggaga---tgactatgtcggagacaaag-gagag
B D                       Cow  aacaaatc-taatttttattgttccttaaggaga---tgactatgtcggagacaaag-gagag
B D                     Sheep  aacaaatc-taatttttattgttccttaaggaga---tgactatgtcggagacaaag-gagag
                Domestic goat  aacaaatc-taatttttattgttccttaaggaga---tgactatgtcggagacaaag-gagag
B D                     Horse  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacaaag-gagag
B D          White rhinoceros  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacaaag-gagag
B D                       Cat  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacagag-gagag
B D                       Dog  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacagag-gagag
B D                   Ferret   aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacagag-gagag
B D                     Panda  aacaaatc-taatttttattgttccttaaggaga---tggctgtgttggagacagag-gagag
               Pacific walrus  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacagag-gagag
                 Weddell seal  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacagag-gagag
             Black flying-fox  aacaaatc-taatttttattgttccttaaggaga---tggctgtgtcggagacaaag-gagga
B D                   Megabat  aacaaatc-taatttttattgtt-cttaaggaga---tggctgtgtcggagacaaag-gagga
                Big brown bat  aacaaatc-taatttttattgttctttaaggaga---tggctgtgttggagacaaag-aaggg
         David's myotis (bat)  aacaaatc-taatttttattgttctttaaggaga---tggctgtatcggagacaaag-gaagg
B D                  Microbat  aacaaatc-taatttttattgttctttaaggaga---tggctgtatcggagacaaag-gaggg
B D                  Hedgehog  aacaaatc-taatttttattgttccttaaggaga---tggttgtgtcgcagacaaag-gagag
B D                     Shrew  aacaaatc-taatttttattgttccttaaggaga---tggttgtgtcggagacaaag-gagag
              Star-nosed mole  aacaaatc-taatttttattgttccttaaggaga---tggttgtgttgaagacaaag-gagag
B D                  Elephant  aacaaatc-taatttttattgttccttaaggaga---tggctatgttggagacaaag-gagaa
          Cape elephant shrew  aacaaatc-tcatttttattgttccttaaggaga---tggctgtgttggagacaaag-gagag
B D                   Manatee  aacaaatc-taatttttattgttccttaaggaga---tggctgtgttggagacaaag-gagag
             Cape golden mole  aacaaatc-taatttttattgttccttaaggaga---tgactgtgttggagacaaag-gagag
B D                    Tenrec  aacaaata-taatttttattgttccttaaggaga---tggctatgctggagacaaaa-gacag
                     Aardvark  aacaaatt-taattgttattgtcccttaaggaga---tgactctgttggagacaaag-gagag
B D                 Armadillo  aacaaatc-taatttttattgttccttgaggaga---tggc-atgttagagacaaag-gagag
B D                   Opossum  aacatatt------tctagcctttctgcaggaga---tggcacatttggagacaaag-gaggg
B D           Tasmanian devil  aatacatctttttttctatcctcccttcaggaga---tggtgcgtttggagacaaag-aaggt
B D                   Wallaby  aacacatc-tcatttctatcctttcttcaggaga---tggagtatttggagacaaag-aagga
  D               Rock pigeon  aacaaatc-taatttttattgttccttaaggaga---tgtctgtgtaggagacaaaa-gtggg
  D              Saker falcon  aacaaatc-taatttttattgttccttaaggaga---tgtctgtataggagacaaaa-ggggg
  D          Peregrine falcon  aacaaatc-taatttttattgttccttaaggaga---tgtctgtataggagacaaaa-ggggg
  D       Collared flycatcher  aacaaatc-taatttttattgttccttaaggaga---tgtctgtacaggagacaaaa-ggggg
  D    White-throated sparrow  aacaaatc-taatttttattgttccttgaggaga---tgtctatacaggagacaaaa-ggggg
B D       Medium ground finch  aacaaatc-taatttttattgttccttaaggaga---tgtctatacaggagacaaaa-ggggg
B D               Zebra finch  aacaaatc-taatttttattgttccttaaggaga---tgtctgtacaggagacaaaa-ggggg
           Tibetan ground jay  aacaaatc-taatttttattgttccttaaggaga---tgtctgtacaggagacaaaagggggg
B D                Budgerigar  aacaaatc-taatttttattgttccttaaggaga---tgtctgcacaggagacaaaa-ggggg
  D                    Parrot  aacaaatc-taatttttattgttccttaaggaga---tgcctgcacaggagacaaaa-gggga
  D             Scarlet macaw  aacaaatc-taggttttattgttccttaaggaga---tgtctgcacaggagacaaaa-gggga
  D              Mallard duck  aacaaatc-tcatttttattgttcctagaggaga---tgtctgcacaggagacaaaa-ggggg
B D                   Chicken  aacaaatc-taatttttattgttccttaaggaga---tgtctgtataggagacaaaa-ggagg
B D                    Turkey  aacaaatc-taatttttattgttccttaaggaga---tgtctgtataggggacaaaa-ggagg
B D        American alligator  aacaaatc-taatttttattgttccttaaggaga---tgtctgcataggagacaaaa-gagag
  D           Green seaturtle  aacaaatc-taatttttattgttccttaaggaga---tgtctgtataggagacaaaa-gaggg
  D            Painted turtle  aacaaatc-taatttttattgttccttaaggaga---tgtctgtagaggagacaaaa-gaggg
  D  Chinese softshell turtle  aacaaatc-taatttttatagttccttaaggaga---tgtctgtataggagacaaaa-gagga
  D    Spiny softshell turtle  aacaaatc-taatttttatagttccttaaggaga---tgtctgtataggagacaaaa-gaggg
B D                    Lizard  aacaaatt-tcatttttattgttccttaaggagatagtgtctgtgtgagagacaaag-aaagg
B D                Coelacanth  aa---atg-tcagttttatttttccttaaggagg---tgtcctttt---agacaatg-aagag

Inserts between block 1 and 2 in window
B D               Coelacanth 15850bp

Alignment block 2 of 520 in window, 59238626 - 59238769, 144 bps 
B D                     Human  ----aggcaggaggccagtt----------ag------aa----------ag-----------a----a-
B D                     Chimp  ----aggcaggaggccagtt----------ag------aa----------ag--a--------a----a-
B D                   Gorilla  ----aggcaggaggccagtt----------aa------aa----------ag-----------a----a-
B D                 Orangutan  ----aggcaggaggccagtt----------ag------aa----------ag------------------
B D                    Gibbon  ----aggcaggaggccagtt----------ag------aa----------ag----------------a-
B D                    Rhesus  ----aggcaggaggccagtt----------ag------aa----------ag--a--------a----a-
B D       Crab-eating macaque  ----aggcaggaggccagtt----------ag------aa----------ag--a--------a----a-
B D                    Baboon  ----aggcaggaggccagtt----------ag------aa----------ag--a--------a--aca-
B D              Green monkey  ----aggcaggaggccagtt----------ag------aa----------ag--a--------a--a-g-
B D                  Marmoset  ----aggcaggaggccagtt----------ag------aa----------ag--a-------------a-
B D           Squirrel monkey  ----aggcaggaggccagtt----------ag------aa----------ag--a--------a--aga-
B D                  Bushbaby  ----aggcaggaggccagtt----------ag------gg----------ag--a--------a--g-a-
           Chinese tree shrew  ----aggcaggaggccagtt----------ag------ag----------a-----------------g-
B D                  Squirrel  ----aggcaggaggccagtt----------ag------ga----------ag--a--------g--g-g-
       Lesser Egyptian jerboa  ----aggcaggaggccagtt----------ag------aa----------ag--a--------a--a-a-
                 Prairie vole  ----aggcaggaggccagtt----------ca------ga----------ag--a--------g--a-a-
B D           Chinese hamster  ----aggcaggaggccagtt----------ca------aa----------cg--a--------g--a-a-
               Golden hamster  ----atgctggaggccagtt----------ca------aa----------aa--g--------a--a-g-
B D                     Mouse  ----aagcaagaggccagtt----------ca------ga----------ag--a--------g--a-a-
B D                       Rat  ----aggcaagaggccagtt----------ca------ga----------ag--a--------g--a-a-
B D            Naked mole-rat  ----aggcaggaggccagtt----------ag------ga----------ag--a--------g--a-g-
B D                Guinea pig  ----aggcaggaggccagtt----------ca------ga----------aa--a--------g--a-g-
                   Chinchilla  ----agacaggaggccagtt----------ag------ga----------ag--a--------g------
             Brush-tailed rat  ----agacaggaggccagct----------aa------ga----------ag--a--------g------
B D                    Rabbit  ----aggcaggaggccagtt----------ag------aa----------ag--a--------aaga-a-
B D                      Pika  ----aggcagaaggccagtt----------ag------aa----------ag--a--------a--a-a-
B D                       Pig  ----aggcaggaggccagtt----------ag------aa----------ag--g--------g----g-
B D                    Alpaca  ----aggcaggaggccagtt----------ag------aa----------ag--a--------a----a-
               Bactrian camel  ----aggcaggaggccagtt----------ag------aa----------ag--g--------a----a-
B D                   Dolphin  ----aggcaggaggccagtt----------ag------aa----------ag----------------a-
                 Killer whale  ----aggcaggaggccagtt----------ag------aa----------ag-----------a----a-
             Tibetan antelope  ----aggcagaaggccagtt----------ag------aa----------ag--a--------a----a-
B D                       Cow  ----aggcagaaggccagtt----------ag------aa----------aggaa--------a----a-
B D                     Sheep  ----aggcagaaggccagtt----------ag------aa----------agaaa--------a----a-
                Domestic goat  ----aggcagaaggccagtt----------ag------aa----------ag--a--------a----a-
B D                     Horse  ----aggcaggaggccagtt----------ag------aa----------aggaa--------a----a-
B D          White rhinoceros  ----aggcaggaggccagtt----------ag------aa----------ag------------------
B D                       Cat  ----aggcaggaggccagtt----------ag---gaagg----------aa----------------a-
B D                       Dog  ----aggcaggaggccagtt----------ag-gaagaaa----------aa----------------a-
B D                   Ferret   ----aggcaggaggccagtt----------agaaagaaaa----------aa----------------a-
B D                     Panda  ----aggcaggaggccagtt----------ag-------a----------ag----------------a-
               Pacific walrus  ----aggcaggaggccagtt----------ag------aa----------ag----------------a-
                 Weddell seal  ----aggcaggaggccagtt----------ag------aa----------ag----------------a-
             Black flying-fox  ----aggcaggaggccagtt----------ag------aa----------ag----------------a-
B D                   Megabat  ----aggcaggaggccagtt----------ag------aa----------a-----------------a-
                Big brown bat  ----aggcaggaggccagtt----------ag------aa----------ag----------------a-
         David's myotis (bat)  ----aggcaggaggccagct----------ag------aa----------ag----------------a-
B D                  Microbat  ----aggcaggaggccagct----------ag------aa----------ag----------------a-
B D                  Hedgehog  ----aggcagaaggccagtt----------ag------aa----------ag-aa--------a----a-
B D                     Shrew  ----aggcaggaggccagtt----------ag------aa----------ag----------------g-
              Star-nosed mole  ----aggcaagaggccagtt----------ag------aa----------a-------------------
B D                  Elephant  ----aggcaggagacaagtt----------ag------ga----------aa--a--------a----a-
          Cape elephant shrew  ----aagcactagacaagtt----------ag------aaagaaagaaagaa--a--------a----g-
B D                   Manatee  ----aggcaggaggcaagtt----------ag------aa----aggaaaaa--a--------a----a-
             Cape golden mole  ----agacaggaggcaagtt----------ag------aaagaaagagaaaa--a--------c----ac
B D                    Tenrec  ----aggcaagaggcaagtt----------ag------cgagaaaaagagag--a--------g----ag
                     Aardvark  ----aggcaggaggcaagtt----------ac------aa----------ag--g--------g----g-
B D                 Armadillo  ----aggcaggaggcaagtt----------aa--------------------------------------
B D                   Opossum  ctccatgcagaaagcaagtt----------ca------aa----------aa--g---aaaaaa----g-
B D           Tasmanian devil  tgacatacaggaggcaagtt----------ca------ac----------aa--a-------------a-
B D                   Wallaby  cagcatataggaggcaagtt----------ca------aa----------aa--agtgagagag----a-
  D               Rock pigeon  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
  D              Saker falcon  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
  D          Peregrine falcon  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
  D       Collared flycatcher  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
  D    White-throated sparrow  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
B D       Medium ground finch  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
B D               Zebra finch  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
           Tibetan ground jay  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
B D                Budgerigar  ----ctgcagccatcaggtt----------aa------aa----------aa--c--------c----a-
  D                    Parrot  -----tgcagccatcgggtt----------aa------aa----------aa--t--------c----a-
  D             Scarlet macaw  -----tgcagccatcgggtt----------aa------aa----------aa--t--------c----a-
  D              Mallard duck  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
B D                   Chicken  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
B D                    Turkey  ----atgcagccgtcaggtt----------aa------aa----------aa--t--------c----a-
B D        American alligator  ----atgcagcagtcaggtt----------aa------aa----------aa--t--------c----a-
  D           Green seaturtle  ----atgcagcagccaggtt-----------a------aa----------aa--t--------c----a-
  D            Painted turtle  ----atgcagccgccaggtt-----------a------aa----------aa--t--------c----a-
  D  Chinese softshell turtle  ----atacagcagccaggtt-----------a------aa----------aa--t--------c----a-
  D    Spiny softshell turtle  ----atacagcagccaggtt-----------a------aa----------aa--t--------c----a-
B D                    Lizard  ----atggggtagggatttttttttttaaaaa------aa----------ac--c--------c----a-
B D                Coelacanth  ======================================================================

                        Human  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                        Chimp  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                      Gorilla  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                    Orangutan  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                       Gibbon  --------------aaa------aaaaaa-----a-ccctgaga----ggccttaaaaaattaaatgttc
                       Rhesus  --------------gaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
          Crab-eating macaque  --------------gaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                       Baboon  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                 Green monkey  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                     Marmoset  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
              Squirrel monkey  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                     Bushbaby  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
           Chinese tree shrew  --------------ggg------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                     Squirrel  --------------ggg-----gaaaaaa-----a-ccttaaga----ggccttaaaaaattaaatgttc
       Lesser Egyptian jerboa  --------------gaa----aaaaaaca-----c-ccttaaga----ggccttaaaaaattaaatgttc
                 Prairie vole  --------------gcg----aaaaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
              Chinese hamster  --------------ggg------gaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
               Golden hamster  --------------ggg------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                        Mouse  --------------ggggaa-ggaaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                          Rat  --------------ggggaagggaaaaaa-----a-ccttaaga----ggccttaaaaaattaaatgttc
               Naked mole-rat  --------------aga-----gaaaaaa-----a-acttaaga----ggccttaagaaattaaatgttc
                   Guinea pig  --------------gaa-----aaaaaaa-----a-acctaaga----ggccttaaaaaattaaatgttc
                   Chinchilla  ----------------------agaaaaa-----a-acctaaga----ggccttaaaaaattaaatgttc
             Brush-tailed rat  -----------------------gaaaaa-----a-acctaaga----ggccttaaaaaattaaatgttc
                       Rabbit  --------------aaa------aaaaca-----a-ccctaaga----ggccttaaaaaactaaatgttc
                         Pika  --------------aaa------aaaaca-----a-ccctaaga----ggccttaaaaaattaaatgttc
                          Pig  --------------ggg------aaaaaa-----a---ctaaga----ggcctta-aaaattaaatgttc
                       Alpaca  --------------aaa------aaaaaa-----accccggaga----ggtcttaaaaaattaaatgttc
               Bactrian camel  --------------aaa------aaaaaa-----a-cctggaga----ggtcttaaaaaattaaatgttc
                      Dolphin  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                 Killer whale  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
             Tibetan antelope  --------------gaa------aaaaaa-----a--cccgaga----ggccttaaaaaattaaatgttc
                          Cow  --------------aaa------aaaaca-----a--cctaaga----ggccttaaaaaattaaatgttc
                        Sheep  --------------aaa------aaaaaa-----a-ccctaaga----ggccttacaaaattaaatgttc
                Domestic goat  --------------aaa------aaaaca-----a-ccctaaga----ggccttaaaaaattaaatgttc
                        Horse  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
             White rhinoceros  ---------------aa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                          Cat  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                          Dog  --------------aaa------aaaaac-----a-ccctaaga----ggccttaaaaaattaaatgttc
                      Ferret   --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                        Panda  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
               Pacific walrus  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                 Weddell seal  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
             Black flying-fox  --------------taa------aaagaa-----a-acctaaga----ggccttaaaaaattaaatgttc
                      Megabat  --------------taa------aaagaa-----a-acctaagaggccggccttaaaaaattaaatgttc
                Big brown bat  --------------aaa------aaagaa-----a-accctaga----ggccttaaaaaattaaatgttc
         David's myotis (bat)  --------------aaa------aaaaaacac--a-ccctgaga----ggccttaaaaaattaaatgttc
                     Microbat  --------------aaa------aaaca------a-ccctgaga----ggccttaaaaaattaaatgttc
                     Hedgehog  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                        Shrew  --------------ggg------aaaaca-----a-ccctaaga----ggccttaaaaaattaaatgttc
              Star-nosed mole  --------------gaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                     Elephant  --------------aaa------aaaaac-----a-ccctgaga----ggccttaaaaaattaaatgctc
          Cape elephant shrew  --------------aaa------aaaaacaaacaa-acctaaga----gaccttaaaaaattaaatgttc
                      Manatee  --------------aaa------aaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
             Cape golden mole  atacacacactcacaca------caaaaa-----g-ccctaaga----gaccttaaaaaatgaaatgttc
                       Tenrec  aaaggggga-----aaa------aaagaa-----a-tcctaaga----ggccttaaaaaattaagtgttc
                     Aardvark  --------------ggg------ggggga-----a-ctctaaga----ggccttaaaaaattaaatgttc
                    Armadillo  --------------aaa------gaaaaa-----a-ccctaaga----ggccttaaaaaattaaatgttc
                      Opossum  --------------gta------aaaaaa-----a----tagaa----gctcttaaaaaaataaatg---
              Tasmanian devil  --------------aag------aggaaa-----a----tagag----gatttttacaa---aaatg---
                      Wallaby  --------------gag------agagaa-----a----tagag----ggtttttataa---agatg---
                  Rock pigeon  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
                 Saker falcon  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
             Peregrine falcon  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
          Collared flycatcher  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
       White-throated sparrow  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
          Medium ground finch  --------------gga-----------------t-------------gcctttaaaaaattaaatgttc
                  Zebra finch  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
           Tibetan ground jay  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
                   Budgerigar  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
                       Parrot  --------------aga-----------------t-------------gcctctaaaaaattaaatgttc
                Scarlet macaw  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
                 Mallard duck  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
                      Chicken  --------------aga-----------------t-------------gcctttaaaaaattaaatgttc
                       Turkey  --------------aga-----------------t-------------gcctttaaaaaattaaacgttc
           American alligator  --------------aga-----------------t-------------gccttaaaaaaattaaatgttc
              Green seaturtle  --------------aga-----------------t-------------gcctt-aaaaaattaaatgttc
               Painted turtle  --------------aga-----------------t-------------gcctt-aaaaaattaaatgttc
     Chinese softshell turtle  --------------aga-----------------t-------------gcctt--aaaaattaaatgttc
       Spiny softshell turtle  --------------aga-----------------t-------------gcctt-aaaaaattaaatgttc
                       Lizard  --------------aga-----------------t-------------gccttttaaaaattaaatgatc
                   Coelacanth  ======================================================================

                        Human  aaaaga--gctgtggcaggcaagataaatgatatattac-------actgctggtttaaacctaattgat
                        Chimp  aaaaga--gccgtggcaggcaagataaatgatatattac-------actgctggtttaaacctaattgat
                      Gorilla  aaaaga--gccatggcaggcaagataaatgatatattac-------actgctggtttaaacctaattgat
                    Orangutan  aaaaga--gccgtggcaggcaagataaatgatatattac-------actgctggtttaaacctaattgat
                       Gibbon  aaaaga--gccgtggcaggcaagataaatgatatattac-------actgctggtttaaacctaattgat
                       Rhesus  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
          Crab-eating macaque  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                       Baboon  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                 Green monkey  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                     Marmoset  aaaaga--gccatggcaggcaagataaatgatatattgc-------agtgctggtttaaacctaattgat
              Squirrel monkey  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                     Bushbaby  aaaaga--gccgtggcaggcaagataaatgatatattac-------agggctggtttaaacctaattgat
           Chinese tree shrew  aaaaga--gtcgtggcaggcaagataaatgatatattac-------agtgccggtttaaacttaattgat
                     Squirrel  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggcttaaacctaattgat
       Lesser Egyptian jerboa  aaaaga--gctgtggcaggcaagataaatgatatattgc-------aatgctggtctaaccctaattgat
                 Prairie vole  aaaaga--gctgtggcaggcaagataaatgatatattac-------agttctggtttaaacctaattgat
              Chinese hamster  aaaaga--gctgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
               Golden hamster  aaaaga--gctgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                        Mouse  aaaaga--gctgtggcaggcaagataaatgatatattac-------agtgctagtttaaacctaattgat
                          Rat  aaaaga--gctgtggcaggcaagataaatgatatattac-------agtgctggtttaaacgtaattgat
               Naked mole-rat  aaaaga--cccatggcaggcaagataaatgatatattac-------agtgctggtttaaccctaattgat
                   Guinea pig  aaaaga--gccatggcaggaaagataaatgatatattac-------agtgctggtttaaccctaattgat
                   Chinchilla  aaaaga--gccatggcaggcaagataaatgatatattac-------agtgctggtttaaccctaattgat
             Brush-tailed rat  aaaaga--ggcttggcaggcaagataaatgatatcttac-------agcgctggtttaaccctaattgat
                       Rabbit  aaaaga--gctgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                         Pika  aaaaga--gctatggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                          Pig  aaaaga--accgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                       Alpaca  aaaaga--accatggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
               Bactrian camel  aaaaga--accatggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                      Dolphin  aaaaga--accatggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                 Killer whale  aaaaga--accatggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
             Tibetan antelope  agaaga--accgtggcaggcaagataaatgatatattac-------agtgccggtttaaacctaattgat
                          Cow  agaaga--accgtggcaggcaagataaatgatatattac-------agtgccggtttaaacctaattgat
                        Sheep  agaaga--accgtggcaggcaagataaatgatatattac-------agtgccggtttaaacctaattgat
                Domestic goat  agaaga--accgtggcaggcaagataaatgatatattac-------agtgccggtttaaacctaattgat
                        Horse  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctgttttaaacctaattgat
             White rhinoceros  aaaaga--accgtggcaggcaagataaatgctatattac-------agtgctggtttaaacctaattgat
                          Cat  aaaaga--gccgtggcaggcaagataaatgatatattac-------agcgctggtttaaacctaattgat
                          Dog  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                      Ferret   aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                        Panda  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
               Pacific walrus  -aaaga--gccgtggcaggcaagataaatgatatattgc-------agtgctggtttaaacctaattgat
                 Weddell seal  aaaaga--gccgtggcaggcaggataaatgatatattac-------agtgctggtttaaacctaattgat
             Black flying-fox  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                      Megabat  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                Big brown bat  aaaaga--gctgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
         David's myotis (bat)  aaaaga--gctgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                     Microbat  aaaaga--gctgtggcaggcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                     Hedgehog  aaaaga--gccatggcaagcaagataaatgatatattac-------agtgctggtttaaacctaattgat
                        Shrew  acaaga--gctgtggcaggcaagacaaatgatatattac-------agtgctggtttaaacctaattgat
              Star-nosed mole  aaaaga--gccatggcaggcaagataaatgatatattgc-------agtgctggtttaaacctaattgat
                     Elephant  aaaaga--gctgtggcaggcaagatagatgatatattac-------aatgctggtttaaacctaattgat
          Cape elephant shrew  aaaaga--gctgtggcaggcaagataaatgatatattac-------aatgctggtttaaacctaattgat
                      Manatee  aaaaga--gctgtggcaggcaagataaatgatatattac-------aatgctggtttaaacttaattgat
             Cape golden mole  aaaaga--gctgtggcaggcaagataaatgatatattac-------aatgctggtttaaacctaattgat
                       Tenrec  aaaaga--gctgtggcaggcaagataaatgatatattac-------aaggctggtttaaacctaattgat
                     Aardvark  aaaaga--gctgtggcaggcaagataaatgatatattac-------aatgctggtttaaacctaattgat
                    Armadillo  aaaaga--gccgtggcaggcaagataaatgatatattac-------agtgctggtttaaatctaattgat
                      Opossum  --aaag--gcagccttgggctcgg-cagtgatatattac-------cgggctggctgaaacctaattgat
              Tasmanian devil  --aaaa--gcagcatcaggctgggacaatgatttattat-------caggctggttgaaacctaattgat
                      Wallaby  --aaaa--acagcatcaggctggggcagtgatatattac-------caggctggctgtaacctaattgat
                  Rock pigeon  acaatagtgctacagcaagctagataaatgatatattac-------agcgatggtttaaaactaattgat
                 Saker falcon  acaatagtgctacagcaagctagataaatgatatattac-------agcgatggtttaaaactaattgat
             Peregrine falcon  acaatagtgctacagcaagctagataaatgatatattac-------agcgatggtttaaaactaattgat
          Collared flycatcher  acaatagtgctacagcaagctggataaatgatatattac-------agcgatggtttaaaactaattgat
       White-throated sparrow  acaatagtgctacagcaagctggataaatgatatattac-------agggatggtttaaaactaattgat
          Medium ground finch  acaatagtgctacagcaagctggataaatgatatattac-------agggatggtttaaaactaattgat
                  Zebra finch  acaatattgctacagcaagctggataaatgatatattac-------agcgatggtttaaaactaattgat
           Tibetan ground jay  acaatagtgctacagcaagctggataaatgatatattac-------agcgatggtttaaaactaattgat
                   Budgerigar  acaatagtgctacagcaagcgagatcaatgatatattgc-------agcgatggtttaaacctaattgat
                       Parrot  acaatagtgctacagcaagcgagataaatgatatattgc-------agcgatggtttaaaactaattgat
                Scarlet macaw  acagtagtgctacagcaagcgagataaatgatatattgc-------agcaatggtttaaaactaattgat
                 Mallard duck  acaatagtgctacagcaagctagataaatgatatattac-------agcgatggtttaaaactaattgat
                      Chicken  acaatagtgctacagcaagctagataaatgatatattac-------tgcgatggtttaaaactaattgat
                       Turkey  acaatagtgctacagcaagctagataaatgatatattac-------tgtgatggtttaaaactaattgat
           American alligator  acaacagtgctacagcagactggataaatgatata------------gtgatggtttaaaactaattgat
              Green seaturtle  acaatagtgctacagcaggctagataaatgatatattgt-------agtggtggtttaaaactaattgat
               Painted turtle  acaatagtgctacagcaggctagataaatgatatattgt-------agtggtggtttaaaactaattgat
     Chinese softshell turtle  acaacagtgctatggcaggctagataaatgatatattgt-------gggggtggtttaaaactaattgat
       Spiny softshell turtle  acaatagtgctacagcaggctagataaatgatatattgt-------gggggtggtttaaaactaattgat
                       Lizard  acaggagtgccacaataggctagatagatgatgtattatctatctaagctggagtttaaaactaattgat
                   Coelacanth  ======================================================================

                        Human  gactaatgttgtaatgcat
                        Chimp  gactaatgttgtaatgcat
                      Gorilla  gactaatgttgtaatgcat
                    Orangutan  gactaatgttgtaatgcat
                       Gibbon  gactaatgttgtaatgcat
                       Rhesus  gactaatgttgtaatgcat
          Crab-eating macaque  gactaatgttgtaatgcat
                       Baboon  gactaatgttgtaatgcat
                 Green monkey  gactaatgttgtaatgcat
                     Marmoset  gactaatgttgtaatgcat
              Squirrel monkey  gactaatgttgtaatgcat
                     Bushbaby  gactaatgttgtaatgcat
           Chinese tree shrew  gactaatgttgtaatgcat
                     Squirrel  gactaatgttgtaatgcat
       Lesser Egyptian jerboa  gagtaatgttgtaatgcat
                 Prairie vole  gactaatgttgtaatgcag
              Chinese hamster  gactaatgttgtaatgcag
               Golden hamster  gactaatgttgtaatgcag
                        Mouse  gactaatgttgtaatgcag
                          Rat  gactaatgttgtaatgtat
               Naked mole-rat  gactaatgttgtaatgcat
                   Guinea pig  gactaatgttgtaatgcat
                   Chinchilla  gactaatgttgtaatgcat
             Brush-tailed rat  gactaatgttgtaatgcat
                       Rabbit  gactaatgttgtaatgcat
                         Pika  gactaatgttgtaatgtag
                          Pig  gactaatgttgtaatgcat
                       Alpaca  gactaatgttgtaatgcat
               Bactrian camel  gactaatgttgtaatgcat
                      Dolphin  gactaatgttgtaatgcat
                 Killer whale  gactaatgttgtaatgcat
             Tibetan antelope  gactaatgttgcaatgcat
                          Cow  gactaatgttgcaatgcat
                        Sheep  gactaatgtcgcaatgcat
                Domestic goat  gactaatgtcgcaatgcat
                        Horse  gactaatgttgtaatgctt
             White rhinoceros  gactaatgttgtaatgcat
                          Cat  gactaatgttgtaatgcat
                          Dog  gactaatgttgtaatgcat
                      Ferret   gactaatgttgtaatgcat
                        Panda  gactaatgttgtaatgcat
               Pacific walrus  gactaatgttgtaatgcat
                 Weddell seal  gactaatgttgtaatgcat
             Black flying-fox  gactaatgttgtaatgcat
                      Megabat  gactaatgttgtaatgcat
                Big brown bat  gactaatgttgtaatgcat
         David's myotis (bat)  gactaatgttgtaatgcat
                     Microbat  gactaatgttgtaatgcat
                     Hedgehog  gactaatgttgtaatgcat
                        Shrew  gactaatgttgtaatgcat
              Star-nosed mole  gactaatgttgtaatgcat
                     Elephant  gactaatgttgtaatgcgt
          Cape elephant shrew  ggctaatgttgtaatgcat
                      Manatee  gactaatgttgtaatgcat
             Cape golden mole  gactaatgttgtaatgcat
                       Tenrec  gactaatgttgtaatgtat
                     Aardvark  gactaatgttgtaatgctt
                    Armadillo  gactaatgttgtaatgcat
                      Opossum  gactaatgttgtaatgtag
              Tasmanian devil  gactaatgttgtaatgcat
                      Wallaby  gactaatgttgtaatgcat
                  Rock pigeon  gactaatgttgtaatgcat
                 Saker falcon  gactaatgttgtaatgcat
             Peregrine falcon  gactaatgttgtaatgcat
          Collared flycatcher  gactaatgttgtaatgcat
       White-throated sparrow  gactaatgttgtaatgcat
          Medium ground finch  gactaatgttgtaatgcat
                  Zebra finch  gactaatgttgtaatgcat
           Tibetan ground jay  gactaatgttgtaatgcat
                   Budgerigar  gactaatgttgtaatgcat
                       Parrot  gactaatgttgtaatgcat
                Scarlet macaw  gactaatgttgtaatgcat
                 Mallard duck  gactaatgttgtaatgcat
                      Chicken  gactaatgttgtaatgcat
                       Turkey  gactaatgttgtaatgcat
           American alligator  gactaatgttgtaatgcat
              Green seaturtle  gactaatgttgtaatgcat
               Painted turtle  gactaatgttgtaatgcat
     Chinese softshell turtle  gagtaatggtgtaatgcat
       Spiny softshell turtle  gagtaatggtgtaatgcat
                       Lizard  gactaatgttgtaattccc
                   Coelacanth  ===================

Inserts between block 2 and 3 in window
  D Chinese softshell turtle 168bp

Alignment block 3 of 520 in window, 59238770 - 59238823, 54 bps 
B D                     Human  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                     Chimp  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                   Gorilla  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                 Orangutan  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                    Gibbon  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                    Rhesus  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D       Crab-eating macaque  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                    Baboon  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D              Green monkey  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                  Marmoset  ctgaacctacactgatctattatctgtctggtccatgc-tgaagggacactgc-aa
B D           Squirrel monkey  ctgaacctgcactgatctattatttgcctggtccatgc-tgaagggacactgc-aa
B D                  Bushbaby  ctgaacctacactgatctattatccgtctggtccgggc-tgaagggacagtgc-aa
           Chinese tree shrew  ctgaacctacactgatctattatccatctggtccagac-tgaagggacactac-aa
B D                  Squirrel  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
       Lesser Egyptian jerboa  ctgaacctacactgatgtattatccgtttcctccaagc-caatgggacactgc-aa
                 Prairie vole  ttgaacctatgctgatctattatccgtctgctccgggc-tgaagagacgctgc-aa
B D           Chinese hamster  ttgaacctatgctgatctattatccgtctggtccaggc-tgaagggacactgc-aa
               Golden hamster  ttgaacctatgctgatctattatccgtctggtccaagc-tgaagggacactgc-aa
B D                     Mouse  ctgaacctatgctgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                       Rat  ctgaacctatgctgatctattatacgtctggtccatgc-tggagggacactgc-aa
B D            Naked mole-rat  ctgaacctacactgatctattatccgtctggtccaagc-tgaagggacacagc-ga
B D                Guinea pig  ctgaacctacactgatctattatctgtctggtccaagc-tgaaggggcaccac-aa
                   Chinchilla  ctgaacctacactgatctattatccgtctggcccaaac-tgaagggacactgc-aa
             Brush-tailed rat  ctgaacctacactgatctattatctgtctggcccaagc-tgaagggacactgc-aa
B D                    Rabbit  ctgaacctgcactgatctattatccgtctggtccagacttgaagggacactgc-aa
B D                      Pika  ctgaacctgcactgatctattatccttctgatccaggcttgaagggacactgc-aa
B D                       Pig  ctgaacctacactgatctattatccgtctggtccagga-tgaagggacactgc-aa
B D                    Alpaca  ctgaacctacactgatctattatccgtctggtccagga-tgaagggacattgc-aa
               Bactrian camel  ctgaacctacactgatctattatccgtctggtccagga-tgaagggacattgc-aa
B D                   Dolphin  ctgaacctacactgatctattatccgtctggttcagga-tgaagggacactgg-ga
                 Killer whale  ctgaacctacactgatctattatccgtctggttcagga-tgaagggacactgg-ga
             Tibetan antelope  ctgaacctacactgatctattatccgtctggtccagga-tgaagggacactgc-aa
B D                       Cow  ctgaacctacactgatctattatccgtctggtgcagga-tgaagggacactgc-aa
B D                     Sheep  ctgaacctacactgatctattatccgtctggtccagga-tgaagggacactgc-aa
                Domestic goat  ctgaacctacactgatctattatccgtctggtccagga-tgaagggacactgc-aa
B D                     Horse  ctgaacctacactgatctattatccgtctggtccagac-tgaagggacactgc-aa
B D          White rhinoceros  ctgaacctacactgatctattatctgtctggtccagac-tgaagggacactgc-aa
B D                       Cat  ctgaacctacactgatctattatccgtctggtccaggc-tgaaggaacactgc-aa
B D                       Dog  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                   Ferret   ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                     Panda  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
               Pacific walrus  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
                 Weddell seal  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
             Black flying-fox  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
B D                   Megabat  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
                Big brown bat  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacacagc-aa
         David's myotis (bat)  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacacagc-aa
B D                  Microbat  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacacagc-aa
B D                  Hedgehog  ctgaacctacactgatctattatccatctggtccaggc-tgaagggacactac-aa
B D                     Shrew  ctgaacctctactgatctattatccgtctggtccaggc-tgaagggacactgcaaa
              Star-nosed mole  ctgaacctacactgatgtattatccgtctggtccaagc-tgaagggacactgc-aa
B D                  Elephant  ctgaacctacactgatctattatccgtctggttcaggc-tgaagggacattgc-aa
          Cape elephant shrew  ctgaacctacactgatctattatctgtctggtccaggc-tgaagggacactgc-aa
B D                   Manatee  ctgaacctacactgatctattatctgtctagtccaggc-tgaagggacactgc-aa
             Cape golden mole  ctgagcctacactgatctattatccgtctggtctaggc-tgaagggatactgc-aa
B D                    Tenrec  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggacactgc-aa
                     Aardvark  ctgaacctacactgatctattatccgtctggtccaggc-tgaagggatactgc-aa
B D                 Armadillo  ctgaacctatactgatctatcatccgtctggtctaggc-tgaagggacactgc-aa
B D                   Opossum  ttgaagccaccctgatctatgatctgtctcaatgagaa-tgaagggacattgc-aa
B D           Tasmanian devil  ttgaagctacactgatctatgatctgtctcaacgacga-tgaagggacactgc-aa
B D                   Wallaby  ttgaagctccactgatctatgatctgtctcaacgagag-tgaagggacgttgc-aa
  D               Rock pigeon  ttgtagctacactgatctattatatatcttggccaaac-tgaagggacacttc-aa
  D              Saker falcon  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
  D          Peregrine falcon  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
  D       Collared flycatcher  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
  D    White-throated sparrow  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
B D       Medium ground finch  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacatttc-aa
B D               Zebra finch  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
           Tibetan ground jay  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
B D                Budgerigar  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
  D                    Parrot  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
  D             Scarlet macaw  ttgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
  D              Mallard duck  tcgtagctacactgatctattatatatcttggccaagc-tgaagggacacttc-aa
B D                   Chicken  tcgtagctacactgatctattatatatcttggctaagc-tgaagggacgcttc-aa
B D                    Turkey  tcgtagctacactgatctattatatatcttggccaagc-tgaagggacgcttc-aa
B D        American alligator  tcatagctacactgatctattatacgtctcagccatgt-tgaagggacacttc-aa
  D           Green seaturtle  tcatagctacactgatctgttatacatctcggtcatgc-tgaagggacacttc-aa
  D            Painted turtle  tcatagctacactgatctgttatacatctcggtcatgc-tgaagggacacttc-aa
  D    Spiny softshell turtle  tcatagctacactgatctgtgatacatctcggtcctgc-tgaagggacacttc-aa
B D                    Lizard  tgatagctaggcggatct---atatatctcagccaagc-tgaagggacatttt-aa
B D                Coelacanth  ========================================================
  D  Chinese softshell turtle  ========================================================

Alignment block 4 of 520 in window, 59238824 - 59238831, 8 bps 
B D                     Human  ggagaaaa
B D                     Chimp  ggagaaaa
B D                   Gorilla  ggagaaaa
B D                 Orangutan  ggagaaaa
B D                    Gibbon  ggagaaaa
B D                    Rhesus  ggagaaaa
B D       Crab-eating macaque  ggagaaaa
B D                    Baboon  ggagaaaa
B D              Green monkey  ggagaaaa
B D                  Marmoset  ggagaaaa
B D           Squirrel monkey  ggagaaaa
B D                  Bushbaby  ggagaaaa
           Chinese tree shrew  ggagaaaa
B D                  Squirrel  ggagaaaa
       Lesser Egyptian jerboa  ggagaaaa
                 Prairie vole  ggagaaaa
B D           Chinese hamster  ggagaaaa
               Golden hamster  ggagaaaa
B D                     Mouse  ggagaaaa
B D                       Rat  ggagaaaa
B D            Naked mole-rat  ggagaaaa
B D                Guinea pig  ggagaaaa
                   Chinchilla  ggagaaaa
             Brush-tailed rat  ggagaaaa
B D                    Rabbit  ggagaaaa
B D                      Pika  ggagaaaa
B D                       Pig  ggagaaaa
B D                    Alpaca  ggagaaaa
               Bactrian camel  ggagaaaa
B D                   Dolphin  ggagaaaa
                 Killer whale  ggagaaaa
             Tibetan antelope  ggagaaaa
B D                       Cow  ggagaaaa
B D                     Sheep  ggagaaaa
                Domestic goat  ggagaaaa
B D                     Horse  ggagaaaa
B D          White rhinoceros  ggagaaaa
B D                       Cat  ggagaaaa
B D                       Dog  ggagaaaa
B D                   Ferret   ggagaaaa
B D                     Panda  ggagaaaa
               Pacific walrus  ggagaaaa
                 Weddell seal  ggagaaaa
             Black flying-fox  ggagaaaa
B D                   Megabat  ggagaaaa
                Big brown bat  ggagaaaa
         David's myotis (bat)  ggagaaaa
B D                  Microbat  ggagaaaa
B D                  Hedgehog  ggagaaaa
B D                     Shrew  ggagaaaa
              Star-nosed mole  ggagaaaa
B D                  Elephant  ggagaaaa
          Cape elephant shrew  ggagaaaa
B D                   Manatee  ggagaaaa
             Cape golden mole  ggagaaaa
B D                    Tenrec  ggagaaaa
                     Aardvark  ggagaaaa
B D                 Armadillo  ggagaaaa
B D                   Opossum  ggagaaaa
B D           Tasmanian devil  ggagaaaa
B D                   Wallaby  ggagaaag
  D               Rock pigeon  ggagaaaa
  D              Saker falcon  ggagaaaa
  D          Peregrine falcon  ggagaaaa
  D       Collared flycatcher  ggagaaaa
  D    White-throated sparrow  ggagaaaa
B D       Medium ground finch  ggagaaaa
B D               Zebra finch  ggagaaaa
           Tibetan ground jay  ggagaaaa
B D                Budgerigar  ggagaaaa
  D                    Parrot  ggagaaaa
  D             Scarlet macaw  ggagaaaa
  D              Mallard duck  ggagaaaa
B D                   Chicken  ggagaaaa
B D                    Turkey  ggagaaaa
B D        American alligator  ggagaaaa
  D           Green seaturtle  ggagaaaa
  D            Painted turtle  ggagaaaa
  D  Chinese softshell turtle  ggagaaaa
  D    Spiny softshell turtle  ggaaaaaa
B D                    Lizard  gaaaagaa
B D                Coelacanth  ========

Inserts between block 4 and 5 in window
B D                  Opossum 38bp

Alignment block 5 of 520 in window, 59238832 - 59238854, 23 bps 
B D                     Human  attgctaaccattttaacctgat
B D                     Chimp  attgctaaccattttaacctgat
B D                   Gorilla  attgctaaccattttaacctgat
B D                 Orangutan  attgctaaccattttaacctgat
B D                    Gibbon  attgctaaccattttaacctgat
B D                    Rhesus  attgctaaccattttaacctgat
B D       Crab-eating macaque  attgctaaccattttaacctgat
B D                    Baboon  attgctaaccattttaacctgat
B D              Green monkey  attgctaaccattttaacctgat
B D                  Marmoset  attgctaaccgttttaacctgat
B D           Squirrel monkey  attgctaaccgttttaacctgat
B D                  Bushbaby  attgctaactgttttaacctgat
           Chinese tree shrew  attgctaactgttttaacctgat
B D                  Squirrel  attgctaactgttttaacctgat
       Lesser Egyptian jerboa  attgttaactgttttaacctgat
                 Prairie vole  attgctaactgttttaacctgat
B D           Chinese hamster  attgctaactgttttaacctgat
               Golden hamster  attgctaactgttttaacctgat
B D                     Mouse  attgctaactgttttaacctgat
B D                       Rat  attgctaactgttttaacctgat
B D            Naked mole-rat  attgctaactgttttaacctgat
B D                Guinea pig  attgctaactgttttaacctgat
                   Chinchilla  attgctaaccgttttaacctgat
             Brush-tailed rat  attgctaaccattttaacctgaa
B D                    Rabbit  attgctaactgctttaacctgat
B D                      Pika  attgctaaatgttttatcccgat
B D                       Pig  attgctaactgttttaacctgat
B D                    Alpaca  attgctaactgttttaacctgat
               Bactrian camel  attgctaactgttttaacctgat
B D                   Dolphin  attgctaactgttttaacctgat
                 Killer whale  attgctaactgttttaacctgat
             Tibetan antelope  attgctaactgttttaacctgat
B D                       Cow  attgctaactgttttaacctgat
B D                     Sheep  attgctaactgttttaacctgat
                Domestic goat  attgctaactgttttaacctgat
B D                     Horse  attgctaactgttttaacctgat
B D          White rhinoceros  attgctaactgttttaacctgat
B D                       Cat  attgctaactgttttaacctgat
B D                       Dog  attgctaactgttttaacctgat
B D                   Ferret   attgctaactgttttaacctgat
B D                     Panda  attgctaactgttttaacctgat
               Pacific walrus  attgctaactgttttaacctgat
                 Weddell seal  attgctaactgttttaacctgat
             Black flying-fox  attgctaactgttttaacctgat
B D                   Megabat  attgctaactgttttaacctgat
                Big brown bat  attgctaactgttttaacctgat
         David's myotis (bat)  attgctaactgttttaacctgat
B D                  Microbat  attgctaactgttttaacctgat
B D                  Hedgehog  atcgctagctgttttaacctgat
B D                     Shrew  atcgctaactcttttaacctgat
              Star-nosed mole  attgctaactgttttaacctg--
B D                  Elephant  attgctaacagttttaacctgat
          Cape elephant shrew  attgctaactgttttaacctgat
B D                   Manatee  attgctaactgttttaacctgat
             Cape golden mole  attgctaactgttttaacctgat
B D                    Tenrec  attgctaactgttttaacctgat
                     Aardvark  attgctaactgttttaacccgat
B D                 Armadillo  attgctaactgttttaacccgat
B D           Tasmanian devil  -tttctaactgatttaaccctat
B D                   Wallaby  -attcta----ttttaacctgac
  D               Rock pigeon  attgctaactgttttaacctgat
  D              Saker falcon  attgctaactgttttaacctgat
  D          Peregrine falcon  attgctaactgttttaacctgat
  D       Collared flycatcher  attgctaactgttttaacctgat
  D    White-throated sparrow  attgctaactgttttaacctgat
B D       Medium ground finch  attgctaactgttttaacctgat
B D               Zebra finch  attgctaactgttttaacctgat
           Tibetan ground jay  attgctaactgttttaacctgat
B D                Budgerigar  attgctaactgttttaacccgat
  D                    Parrot  attgctaactgttttaacctgat
  D             Scarlet macaw  attgctaactgttttaacctgat
  D              Mallard duck  attgctaactgttttaacctgat
B D                   Chicken  attgctaactgttttaacctgat
B D                    Turkey  attgctaactgttttaacctgat
B D        American alligator  attgctaactgttttaacctgat
  D           Green seaturtle  attgctaactcttttaacctgat
  D            Painted turtle  attgctaactcttttaacctgat
  D  Chinese softshell turtle  attgctaactcttttaacctgat
  D    Spiny softshell turtle  attgctaactcttttaacctgat
B D                    Lizard  atcataaat--ttttaaccttat
B D                Coelacanth  =======================
B D                   Opossum  =======================

Inserts between block 5 and 6 in window
B D                   Lizard 17914bp

Alignment block 6 of 520 in window, 59238855 - 59238878, 24 bps 
B D                     Human  ggaac-tt-----t------aaaaaaa----taa-ccggtc
B D                     Chimp  ggaac-tt-----t------aaaaaaa----taa-ccggtc
B D                   Gorilla  ggaac-tt-----t------aaaaaaa----taa-ccggtc
B D                 Orangutan  ggaac-tt-----t------aaaaaaa----taa-ccggtc
B D                    Gibbon  ggaac-tt-----t------aaaaaaa----taa-ctggtc
B D                    Rhesus  ggaac-tt-----t------aaaaaaa----taa-ccagtc
B D       Crab-eating macaque  ggaac-tt-----t------aaaaaaa----taa-ccagtc
B D                    Baboon  ggaac-tt-----t------aaaaaaa----taa-ccagtc
B D              Green monkey  ggaac-tt-----t------aaaaaaa----taa-ccagtc
B D                  Marmoset  ggaac-tt-----t------aaaaaaa----taa-ccagtc
B D           Squirrel monkey  ggaac-tt-----t------aaaaaaa----taa-ccagtc
B D                  Bushbaby  ggaac-tt--aaaa------aaaaaaa----taa-tcagtc
           Chinese tree shrew  ggaac-tt-----t------aaaaaaa----taa-ccagtc
B D                  Squirrel  ggaac-tt-----t-----aaaaaaaaaaaataa-ccagtc
       Lesser Egyptian jerboa  ggaac-tt-----t-----gaaaaaaa---ataa-ccagtc
                 Prairie vole  ggaac-tt-----t-----gaaaaaaa----caa-ccagtc
B D           Chinese hamster  ggaac-tt-----t-----gaaaaaaa----taa-ccagtc
               Golden hamster  ggaac-tt-----t-----gaaaaaaa-----aa-ccagtc
B D                     Mouse  ggaac-tt-----t-----ggaaaaaa----taa-ccagtc
B D                       Rat  ggaac-tt-----t-----ggaaaaaa----taa-ccaggc
B D            Naked mole-rat  ggaac-tt-----t------aaaaaaa----taa-ccagtc
B D                Guinea pig  ggaac-tt-----t------aaaaaaa----taa-ccagta
                   Chinchilla  gggac-tt-----t------aaaaaaa----taa-gcagtc
             Brush-tailed rat  gggac-tt-----t------aaaaaaa----caa-ccagtc
B D                    Rabbit  ggaac-tt-----t-----aaaaaaaa----taa-ccagtc
B D                      Pika  agaac-tt-----t-----ttaaaaaa----taa-ccagtc
B D                       Pig  ggaac-tt-----a------aaaaaaa----taa-ccagcc
B D                    Alpaca  ggaac-tt-----a-----aaaaaaaa----taa-ccagcc
               Bactrian camel  ggaacttt-----a-----aaaaaaaa----taa-ccagcc
B D                   Dolphin  ggaac-tt-----t------aaaaaaa----taa-ccagcc
                 Killer whale  ggaac-tt-----t------aaaaaaa----taa-ccagcc
             Tibetan antelope  ggaac-tt-----t-----aaaaaaaa----taa-ccagcc
B D                       Cow  ggaac-tt-----t-----aaaaaaaa----taa-ccagcc
B D                     Sheep  ggaac-tt-----t-----aaaaaaaa----taa-ccagcc
                Domestic goat  ggaac-tt-----t-----aaaaaaaa----taa-ccagcc
B D                     Horse  ggaac-tt-----t------aaaaaaa----taa-ccagcc
B D          White rhinoceros  ggaac-tt-----g------aaaaaaa----taa-ccagcc
B D                       Cat  ggaac-tt-----t------aaaaaaa----taa-ccagcc
B D                       Dog  ggaac-tt-----t------aaaaaaa----taa-ccagtc
B D                   Ferret   ggaac-tt-----t------aaaaaaa----taa-ccagcc
B D                     Panda  ggaac-tt-----t------aaaaaaa----taa-ccagcc
               Pacific walrus  ggaac-tt-----t------aaaaaaa----taa-ccaatc
                 Weddell seal  ggaac-tt-----t------aaaaaaa----taa-ccagcc
             Black flying-fox  agaac-tt----ta------aaaaaaa----taa-ccagcc
B D                   Megabat  agaac-tt----ta------aaaaaaa----taa-ccagcc
                Big brown bat  ggaac-tt----aa------aaaaaaa----taa-ccagca
         David's myotis (bat)  ggaac-ttaaaaaa------aaaaaaa----taa-ccagca
B D                  Microbat  ggaac-tt---aaa------aaaaaaa----taa-ccagca
B D                  Hedgehog  ggaac-aa-----tgacaaaaaaaaaa----aaa-aaagcc
B D                     Shrew  ggatc-tt-----t------aaaaaaa----taa-ccagct
              Star-nosed mole  ------tt-----t------taaaaaa----taa-ccagtc
B D                  Elephant  ggaac-tt-----t------aaaaaaa----taa-ccagcc
          Cape elephant shrew  ggaac-tt-----t------aaaaaaa----taa-ccagcc
B D                   Manatee  ggaac-tt-----t------aaaaaaa----taa-ccagcc
             Cape golden mole  ggaac-tt-----t------aaaaaaa----taaaccagcc
B D                    Tenrec  ggaac-tt-------------aaaaaa----aaacacagcc
                     Aardvark  ggaac-tt-----t------aaaaaaa----taa-ccaacc
B D                 Armadillo  ggaac-tt----tt------aaaaaaa----taa-ccagcc
B D           Tasmanian devil  ggaac-ct-----t------aaacaca----cac-acacac
B D                   Wallaby  ggaac-ct-----t------atgcaca----cac-acacac
  D               Rock pigeon  ggaac-tt-----g------gggaaaa----aa--------
  D              Saker falcon  ggaac-tt-----g------gggaaaa----aa--------
  D          Peregrine falcon  ggaac-tt-----g------gggaaaa----aa--------
  D       Collared flycatcher  ggaac-tc-----g------gggaaaa----aa--------
  D    White-throated sparrow  ggaac-tc-----g------gggaaaa----aa--------
B D       Medium ground finch  ggaac-tc-----g------gggaaaa----aa--------
B D               Zebra finch  ggaac-tc-----a------gggaaaa----aa--------
           Tibetan ground jay  ggaac-tc-----a------gggaaaa----aa--------
B D                Budgerigar  ggaac-tt-----g------gggaaaa----aa--------
  D                    Parrot  ggaac-tt-----g------gggaaaa----aa--------
  D             Scarlet macaw  ggaac-tt-----g------gggaaaa----aa--------
  D              Mallard duck  ggaac-tt-----g------gggaaaa----aa--------
B D                   Chicken  ggaac-tt-----g------gggaaaa----aa--------
B D                    Turkey  ggaac-tt-----g------gggaaaa----aa--------
B D        American alligator  ggaac-tc-----a------gggaaaa----aa--------
  D           Green seaturtle  ggaac-tt-----g------gggaaaa----aa--------
  D            Painted turtle  ggaac-tt----gg------gggaaaa----aa--------
  D  Chinese softshell turtle  ggaac-tt-----g------gggaaaa----aa--------
  D    Spiny softshell turtle  ggaac-tt-----g------gggaaaa----aa--------
B D                Coelacanth  =========================================
B D                   Opossum  =========================================
B D                    Lizard  =========================================

Inserts between block 6 and 7 in window
B D          Tasmanian devil 25bp
B D                  Wallaby 27bp

Alignment block 7 of 520 in window, 59238879 - 59238974, 96 bps 
B D                     Human  cagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagggtcttgcaatgc--aaa
B D                     Chimp  cagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagggtcttgcaatgc--aaa
B D                   Gorilla  cagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagggtcttgcaatgc--aaa
B D                 Orangutan  cagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagggtcttgcaatgc--aaa
B D                    Gibbon  cagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagggtcttgcaatgc--aaa
B D                    Rhesus  tagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagggtcttgcaatgc--aaa
B D       Crab-eating macaque  tagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagggtcttgcaatgc--aaa
B D                    Baboon  tagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagggtcttgcaatgc--aaa
B D              Green monkey  cagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagggtcttgcaatgc--aaa
B D                  Marmoset  cagttactttaaaagataaatgactgggtagtgaccttttaatgtatatcagcgtcttgcaatgc--aaa
B D           Squirrel monkey  cagttactttaaaagataaatgactgggtggtgaccttttaatgtatatcagcgtcttgcaatgc--aaa
B D                  Bushbaby  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgcaatgc--aaa
           Chinese tree shrew  cagttactttaagagataaatggctgggtggtgacctcctaatgtatatcagagtcttgcaatgc--aaa
B D                  Squirrel  tagttactttaaaagaaaaatggctgggtggtgacctcctaatgtatatcagggtcttgcaatgc--aaa
       Lesser Egyptian jerboa  tagttgctttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgaagtgc--aaa
                 Prairie vole  tagttactttaaaagataaatggctgggcggtgaccttctaatgtatatcagggtcttgcaaagc--aaa
B D           Chinese hamster  tagttactttaaaagataaatggctgggtggtgaccttctaatgtatatcagggtcttgcaatgc--aaa
               Golden hamster  tagttactttaaaagataaatggctgggtggcgaccttctaatgtatatcagggtcttgcaatac--aaa
B D                     Mouse  tagttactttaaaagatgaatggctgggcagtgaccttctaatgtatatcagagccctgcaatgc--aaa
B D                       Rat  tagttactttaaaagataaatggctgggcggtgaccttctaatgtatatcagggtcctgcaatgc--aaa
B D            Naked mole-rat  tagttactttaaaagacaaatggctgggtggtgacctcctgatgtatatcagggtcttgcaatgc--aaa
B D                Guinea pig  cagttacttta-aagataaatggctgggcaatgaccttctgatgtacatcaagatcttgctatac--aaa
                   Chinchilla  cagttactttaaaagataaatggctgggtactgacctcttgatgtacatcagaatcttgcaatgc--aaa
             Brush-tailed rat  cagttactttagaagataaatggatgggtggtgaccccctgatgtacatcaggatcttgcaaggc--aaa
B D                    Rabbit  cagttactttaaaagataaatgactgggtggtgacctcctaatgtatatcagggtcttgcaatgc--aaa
B D                      Pika  cagttagtttaaaagataaatggctgggtggtgccctcctaatgtatatcagggttctgcaatgc---aa
B D                       Pig  cagttactttaaaagataaatggttgggtggtgacctcctaatgtatatcagggtcttgcaatgc--aaa
B D                    Alpaca  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtctcgcaatgc--aaa
               Bactrian camel  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgcaatgc--aaa
B D                   Dolphin  cagttactttaaaagataaatggctcggtggtgacctcctaatgtatatcagggtcttgcaatgc--aaa
                 Killer whale  cagttactttaaaagataaatggcttggtggtgacctcctaatgtatatcagggtcttgcaacgc--aaa
             Tibetan antelope  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgcaaggc--aaa
B D                       Cow  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgcaaggc--aaa
B D                     Sheep  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgcaaggc--aaa
                Domestic goat  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgcaaggc--aaa
B D                     Horse  cagttactttaaaagataaatgactggatggtgacctcctaatgtatatcagggtcttgaaaagcaaaaa
B D          White rhinoceros  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgcgatgc--aaa
B D                       Cat  cagttactttaaaagatagatggctgggtggtgacctcctaatgtatatctgggtcttgcaatgc--aaa
B D                       Dog  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatctgggtcttgcaatgc--aaa
B D                   Ferret   cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatctgggtcttgcaatgc--aaa
B D                     Panda  cagttagtttaaaagataaatggctgggtggtgacctcctaatgtatatctgggtcttgcaatgc--aaa
               Pacific walrus  cagttactttaaaagataaatggctgggtggtgacctcttaatgtatatctgggtcttgcaatgc--aaa
                 Weddell seal  cagttactttaaaagataaatggctgggtggtgacctcttaatgtatatctgggtcttgcaatgc--aaa
             Black flying-fox  cagttattttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgcaatgc--aaa
B D                   Megabat  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatatcagggtcttgcaatgc--aaa
                Big brown bat  cagttactttaaaagataaatggctgggtgttgacctcctaatgtatatcagggtcttgcaatgc--aaa
         David's myotis (bat)  cagttactttaaaagataaatggctgggtgttgacctcctaatgtatatcagggtcttgcaatgc--aaa
B D                  Microbat  cagttactttaaaagataaatggctgagtgttgacctcctaatgtatatcagggtcttgcaatgc--aaa
B D                  Hedgehog  cagcttcttttaaagattaatgactgggtggtgacctcctaatgtatatcagggtcttgctatgc--aaa
B D                     Shrew  cagttactttaaaagataaatggctgggtggtgacctcctaatgtatattagggtcttgcaatgc--aaa
              Star-nosed mole  cggttactttaaaagataaatgggtgggcggtgacctcttaatgtatatcagggtcttgcaatgc--aaa
B D                  Elephant  cagttactttaaaagattaatggttgggtggtgaccttctaatgtatatcagggtcttgcaatgc--aaa
          Cape elephant shrew  cagttactttaaaagattaatggctgagtggtgaccttctaacgtatatcagggtcttgcaatgc--aaa
B D                   Manatee  cagttactttaaaagattaatggttgggtggtgaccttctaatgtatatcagggtcttgcaatgc--aaa
             Cape golden mole  cagttactttaaaagattaatagctgggtggtgaccttctaatgtatattagggttttgcaatgc--aaa
B D                    Tenrec  cagttactttaaaagattaatggctgagtggtgaccttctaatgtatatcagggtcttgcaatgc--aaa
                     Aardvark  cagttactttaaaagattaatgcctgggtggtgaccttctaatgtatatcagggtcttgcaatgc--aaa
B D                 Armadillo  cagttactttaaaagataaatggctgggtggtgacctcttaatgtatatcagggtcttgcaaggc--aaa
B D                   Opossum  catccacgttaagagacagatggccaggtgttgatctcccaatgtatatcaaggtcttgcaatgt--aga
B D           Tasmanian devil  ----cactttcagagacagataatcagctgttgacctccttatatatatcagggtcttggaatac--aga
B D                   Wallaby  cacttactttgtaagacagatggccaggtgatgacctcctaatgtacatcatggtcttacaatgt--aga
  D               Rock pigeon  tagttactttaagagataaatggaaaggttgtaacctcctaatgtacatccgggtcttgcaatgc--aaa
  D              Saker falcon  tagttactttaagagataaatggaaaggttgtgacctcctaatgcacatctgggtcttgcaatgc--aaa
  D          Peregrine falcon  tagttactttaagagataaatggaaaggttgtgacctcctaatgcacatctgggtcttgcaatgc--aaa
  D       Collared flycatcher  tagttactttacgagataaatggaaaggttgtgacctcctaatgtacatctgggtcttgcaatgc--aaa
  D    White-throated sparrow  tagttactttacgagataaatggaaaggttgtgacctcctaatgtacatctgggtcttgcaatgc--aaa
B D       Medium ground finch  tagttactttatgagataaatggaaaggttgtgacctcctaatgtacatctgggtcttgcaatgc--aaa
B D               Zebra finch  tagttactttacgagataaatggaaaggttgtgacctcctaatgtacatctgggtcttgcaatgc--aaa
           Tibetan ground jay  tagttactttacgagataaatggaaaggttatgacctcctaatgtacatctaggtcttgcaatgc--aaa
B D                Budgerigar  tagttactttaagagataaatggaaaggttgtgaccccctaatgtacatctgggtcttgcaatgc--aaa
  D                    Parrot  tagttactttaagagataaatggaaaggttgtgaccccctaatgtacatctgggtcttgcaatgc--aaa
  D             Scarlet macaw  tagttactttaggagataaatggaaaggttgtgaccccctaatgtacctctgggtcttgcaatgc--aaa
  D              Mallard duck  tagttactttaagagataaatggaaaggttgtgacctcctaatgtacatctgggtcttgcaatgc--aaa
B D                   Chicken  tagttactttaagagataaatggaaaggttgtgacctcctaatgtacgtctgggtcttacaacgc--aaa
B D                    Turkey  tagttactttaaaagataaatggaaaggttgtgacctcctaatgtatgtctgggtcttgcaatgc--aaa
B D        American alligator  tagttactttaaaagataaatgtgaaggttgtgacctcctaatgtacagctgggtcttgcaatgc--aaa
  D           Green seaturtle  tagttactttaagtgataaatgggaaggttgcgacctcctaatgtacagctgggtcttgcgatgc--aaa
  D            Painted turtle  tagttactttaagtgataaatgggaaggttgcgacctcctaatgtacagctgggtcttgcgatgc--aaa
  D  Chinese softshell turtle  tagttacttcaagtgataaattggaaggttgtgaccccctaatgtacagctgggtcttgcgatgc--aaa
  D    Spiny softshell turtle  tagttacttcaagtgataaattggaaggttgtgacctcctaatgtacagctgggtcttgcgatgc--aaa
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================

                        Human  atcaaatgttaattaaatagaatccagt
                        Chimp  atcaaatgttaattaaatagaatccagt
                      Gorilla  atcaaatgttaattaaatagaatccagt
                    Orangutan  atcaaatgttaattaaatagaatccagt
                       Gibbon  atcaaatgttaattaaatagaatccagt
                       Rhesus  atcaaatgttaattaaatagaatccagt
          Crab-eating macaque  atcaaatgttaattaaatagaatccagt
                       Baboon  atcaaatgttaattaaatagaatccagt
                 Green monkey  atcaaatgttaattaaatagaatccagt
                     Marmoset  atcaaatgttaattaaatagaatccagt
              Squirrel monkey  atcaaatgttaatgaaatagaatccagt
                     Bushbaby  atcaaatgttaattaaatagaatccagt
           Chinese tree shrew  atcaaatgttaattaaatagaatccagt
                     Squirrel  atcaaatgttaattaaatagaatccagt
       Lesser Egyptian jerboa  atcaaatgttaattaaatggaatccagt
                 Prairie vole  atcaaaagttaattaaatagaatccagc
              Chinese hamster  atcaaaagttaattaaatagaatccagc
               Golden hamster  atcaaaagttaattaaatggagtccagc
                        Mouse  atcaaaagttaattaaatagaaaccagc
                          Rat  atcaaaagttaattaaatagaatccagc
               Naked mole-rat  atcaaatgttaattaaatagaatccagt
                   Guinea pig  atcaaatgttaattaaatagaatccagt
                   Chinchilla  atcaaatgttaattaaatagaatccagt
             Brush-tailed rat  ataaaatgttaattaaatagaatacagc
                       Rabbit  atcaaatgttaattaaatagaatccagc
                         Pika  atcaaatgttaattaaatagaatcctgc
                          Pig  atcaaatgttaattaaatagaatccagt
                       Alpaca  atcaaatattaattaaatagaatccagt
               Bactrian camel  atcaaatattaattaaatagaatccagt
                      Dolphin  atcaaatgttaattaaatagaatccagt
                 Killer whale  atcaaatgttaattaaatagaatccagt
             Tibetan antelope  atcaaatgttaattaaatagaatccagt
                          Cow  atcaaatgttaattaaatagaatccagt
                        Sheep  atcaaatgttaattaaatagaatccagt
                Domestic goat  atcaaatgttaattaaatagaatccagt
                        Horse  atcaaatgtgaattaaatagaatccagt
             White rhinoceros  atcaaatgttaattaaatagaatccagt
                          Cat  atcaaatgttaattaaatagaatccagt
                          Dog  atcaaatgttaattaaatagaatccagt
                      Ferret   atcagatgttaattaaatagaatccagt
                        Panda  atcaaatgttaattaaatagaatccagt
               Pacific walrus  atcaaatgttaattaaatagaatccagt
                 Weddell seal  atcaaatgttaattaaatagaatccagt
             Black flying-fox  atcaaatgttaattaaatagaatctgat
                      Megabat  atcaaatgttaattaaatagaatctgat
                Big brown bat  atcaaatgttaattaaatagaatccagt
         David's myotis (bat)  atcaaatgttaattaaatagaatccagt
                     Microbat  atcaaatgttaattaaatagaatccagt
                     Hedgehog  atcaaatgttaattaaatagaatccagt
                        Shrew  atcaaatgttaactaaatagaatccagt
              Star-nosed mole  atcaaatgttaattaaatagaatccagt
                     Elephant  atcaaatgttaattaaatagaatccagt
          Cape elephant shrew  atcaaacgttaattaaatagaatccagt
                      Manatee  atcaaatgttaattaaatagaatccagt
             Cape golden mole  atcaaccattaattaaatagaatccagt
                       Tenrec  atcaaatgttaattaaatagaatctagt
                     Aardvark  atcaaatgttaattaaatagaatccagt
                    Armadillo  atcaaatgttaattaaatagaatccagt
                      Opossum  atcaaattataattaaacagaacctag-
              Tasmanian devil  atcaaattataattaattagaatctag-
                      Wallaby  atcaaattataattaaatagaacctag-
                  Rock pigeon  atcaaattatcattaaacagaatgagat
                 Saker falcon  atcaaattatcattaaacagaatgtgat
             Peregrine falcon  atcaaattatcattaaacagaatgtgat
          Collared flycatcher  atcaaattatcattaaacagaatgtgat
       White-throated sparrow  atcaaattatcattaaacagaatgtgat
          Medium ground finch  atcaaattatcattaaacagaatgtgat
                  Zebra finch  atcaaattatcattaaacagaatgtgat
           Tibetan ground jay  atcaaattatcattaaacagaatgtgat
                   Budgerigar  atcaaattatcattaaacagaatgtgat
                       Parrot  atcaaattatcattaaacagaatgtgat
                Scarlet macaw  atcaaattatcattaaacagaatgtgat
                 Mallard duck  atcaaattatcattaaacagaatgtgat
                      Chicken  atcaaattatcattaaacagaatgtgat
                       Turkey  atcaaattatcattaaacagaatgcgat
           American alligator  atcaaattatcattaaacagattgtgat
              Green seaturtle  atcaaattaccattaaacagaatgtgat
               Painted turtle  atcaaattaccattaaacagaatgtgat
     Chinese softshell turtle  atcaaatgaccatt-aacagaatggaat
       Spiny softshell turtle  atcaaatgaccatt-aacagaatgggat
                   Coelacanth  ============================
                       Lizard  ============================

Inserts between block 7 and 8 in window
  D              Rock pigeon 4bp
  D             Saker falcon 4bp
  D         Peregrine falcon 4bp
  D      Collared flycatcher 4bp
  D   White-throated sparrow 4bp
B D      Medium ground finch 4bp
B D              Zebra finch 4bp
          Tibetan ground jay 4bp
B D               Budgerigar 4bp
  D                   Parrot 4bp
  D            Scarlet macaw 4bp
  D             Mallard duck 4bp
B D                  Chicken 4bp
B D                   Turkey 3549bp
B D       American alligator 4bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 8 of 520 in window, 59238975 - 59238981, 7 bps 
B D                     Human  gctggga
B D                     Chimp  gctggga
B D                   Gorilla  gctggaa
B D                 Orangutan  gctggaa
B D                    Gibbon  gctggaa
B D                    Rhesus  gccagaa
B D       Crab-eating macaque  gccagaa
B D                    Baboon  gccagaa
B D              Green monkey  gccggaa
B D                  Marmoset  gccggaa
B D           Squirrel monkey  gccggaa
B D                  Bushbaby  gcaggaa
           Chinese tree shrew  gcaggaa
B D                  Squirrel  gcaagaa
       Lesser Egyptian jerboa  gcaggag
                 Prairie vole  ccaagaa
B D           Chinese hamster  acaagaa
               Golden hamster  acgagaa
B D                     Mouse  acaagaa
B D                       Rat  acaagaa
B D            Naked mole-rat  gtaggaa
B D                Guinea pig  atgggaa
                   Chinchilla  gtgggaa
             Brush-tailed rat  gtggaaa
B D                    Rabbit  acaggaa
B D                      Pika  acaagaa
B D                       Pig  gcagaaa
B D                    Alpaca  gcaggaa
               Bactrian camel  gcaggaa
B D                   Dolphin  gcaggaa
                 Killer whale  gcaggaa
             Tibetan antelope  gcaagaa
B D                       Cow  gcaagaa
B D                     Sheep  gcaagaa
                Domestic goat  gcaagaa
B D                     Horse  acaaaaa
B D          White rhinoceros  acaaaaa
B D                       Cat  gcaggaa
B D                       Dog  gcaggaa
B D                   Ferret   gcaggaa
B D                     Panda  gcgggaa
               Pacific walrus  gtaggaa
                 Weddell seal  gtaggaa
             Black flying-fox  gcaggaa
B D                   Megabat  gcaggaa
                Big brown bat  gcaggaa
         David's myotis (bat)  gaaggaa
B D                  Microbat  gcaggaa
B D                  Hedgehog  acagaaa
B D                     Shrew  gcaaaaa
              Star-nosed mole  gcaggga
B D                  Elephant  gtaggaa
          Cape elephant shrew  gtaggaa
B D                   Manatee  gtaggaa
             Cape golden mole  gtagaaa
B D                    Tenrec  gcaagaa
                     Aardvark  gtaggaa
B D                 Armadillo  gcagaaa
B D                   Opossum  ------a
B D           Tasmanian devil  ------a
B D                   Wallaby  ------g
  D               Rock pigeon  gatggaa
  D              Saker falcon  gatggaa
  D          Peregrine falcon  gatggaa
  D       Collared flycatcher  gatggaa
  D    White-throated sparrow  gatggaa
B D       Medium ground finch  gatggaa
B D               Zebra finch  gatggaa
           Tibetan ground jay  gatggaa
B D                Budgerigar  gatggaa
  D                    Parrot  gatggaa
  D             Scarlet macaw  gatggaa
  D              Mallard duck  gatggaa
B D                   Chicken  gatggaa
B D        American alligator  gatggta
  D           Green seaturtle  tgtgaa-
  D            Painted turtle  cgtgaa-
  D  Chinese softshell turtle  catgaa-
  D    Spiny softshell turtle  catgaa-
B D                Coelacanth  =======
B D                    Turkey  =======
B D                    Lizard  =======

Inserts between block 8 and 9 in window
  D              Rock pigeon 3252bp
  D             Saker falcon 3709bp
  D         Peregrine falcon 3700bp
  D      Collared flycatcher 3271bp
  D   White-throated sparrow 3263bp
B D      Medium ground finch 3393bp
B D              Zebra finch 3379bp
          Tibetan ground jay 3212bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 1bp
B D                  Chicken 3650bp
B D       American alligator 6bp

Alignment block 9 of 520 in window, 59238982 - 59238989, 8 bps 
B D                     Human  c-aatg-c--------------------ag
B D                     Chimp  c-aatg-c--------------------ag
B D                   Gorilla  c-aatg-c--------------------ag
B D                 Orangutan  c-aatg-c--------------------ag
B D                    Gibbon  c-aatg-c--------------------ag
B D                    Rhesus  c-aatg-c--------------------ag
B D       Crab-eating macaque  c-aatg-c--------------------ag
B D                    Baboon  c-aatg-c--------------------ag
B D              Green monkey  c-aatg-c--------------------ag
B D                  Marmoset  t-aatg-c-----------------aaaaa
B D           Squirrel monkey  c-aatg-caaaaaaaaaaaaaaaaaaaaaa
B D                  Bushbaby  c-agag-a--------------------ag
           Chinese tree shrew  c-a---------------------------
B D                  Squirrel  c-agtg-c--------------------ag
       Lesser Egyptian jerboa  c-aatg-c--------------------ag
                 Prairie vole  c-catg-t--------------------ag
B D           Chinese hamster  c-aatg-t--------------------aa
               Golden hamster  c-aaag-t-------------------aaa
B D                     Mouse  caaatg-t--------------------ag
B D                       Rat  c-aatg-c--------------------ag
B D            Naked mole-rat  c-aatg-c--------------------ag
B D                Guinea pig  c-aatg-c--------------------ag
                   Chinchilla  c-aatg-t--------------------ag
             Brush-tailed rat  c-aatg-c--------------------ag
B D                    Rabbit  t-catg-c--------------------ag
B D                      Pika  c-catg-c--------------------ag
B D                       Pig  c-aatg-c--------------------ag
B D                    Alpaca  c-gatg-c--------------------ag
               Bactrian camel  c-gatg-c--------------------ag
B D                   Dolphin  t-gatg-c--------------------ag
                 Killer whale  t-gatg-c--------------------ag
             Tibetan antelope  c-gatg-c--------------------ag
B D                       Cow  c-gatg-c--------------------ag
B D                     Sheep  c-gatg-c--------------------ag
                Domestic goat  c-gatg-c--------------------ag
B D                     Horse  c-aatg-c--------------------ag
B D          White rhinoceros  c-aatg-c--------------------ag
B D                       Cat  c-gatg-c--------------------ag
B D                       Dog  c-gatg-c--------------------ag
B D                   Ferret   c-gatg-c--------------------ag
B D                     Panda  c-gatg-a--------------------ag
               Pacific walrus  c-gatg-c--------------------ag
                 Weddell seal  c-gatg-c--------------------ag
             Black flying-fox  c-aatg-c--------------------ag
B D                   Megabat  c-aatg-c--------------------ag
                Big brown bat  c-aatg-c--------------------ag
         David's myotis (bat)  c-aatg-c--------------------ag
B D                  Microbat  c-aatg-c--------------------ag
B D                  Hedgehog  c-aatg-c--------------------aa
B D                     Shrew  t-aatg-c--------------------ag
              Star-nosed mole  c-aagg-c--------------------ag
B D                  Elephant  c-aatt-c--------------------ag
          Cape elephant shrew  t-aatt-c--------------------ag
B D                   Manatee  t-gatt-c--------------------ag
             Cape golden mole  c-aattcc--------------------aa
B D                    Tenrec  t-gatt-c--------------------ag
                     Aardvark  c-aatt-c--------------------ag
B D                 Armadillo  c-aatt-c--------------------ag
B D                   Opossum  a-gagg-a--------------------aa
B D           Tasmanian devil  a-gagg-a--------------------aa
B D                   Wallaby  a-gatg-g--------------------aa
B D                Budgerigar  -taaaa-c--------------------aa
  D                    Parrot  -taaaa-c--------------------aa
  D             Scarlet macaw  -taaaa-c--------------------aa
  D              Mallard duck  -taaag-c--------------------ag
B D        American alligator  --caag-c--------------------ag
  D           Green seaturtle  -ggaat-t--------------------aa
  D            Painted turtle  -ggaat-t--------------------aa
  D  Chinese softshell turtle  -ggaat-t--------------------aa
  D    Spiny softshell turtle  -ggaat-t--------------------aa
B D                Coelacanth  ==============================
B D                    Turkey  ==============================
B D                   Chicken  ==============================
          Tibetan ground jay  ==============================
B D               Zebra finch  ==============================
  D    White-throated sparrow  ==============================
  D               Rock pigeon  ==============================
  D       Collared flycatcher  ==============================
B D       Medium ground finch  ==============================
B D                    Lizard  ==============================
  D          Peregrine falcon  ==============================
  D              Saker falcon  ==============================

Inserts between block 9 and 10 in window
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D            Scarlet macaw 2bp
  D             Mallard duck 3480bp

Alignment block 10 of 520 in window, 59238990 - 59239015, 26 bps 
B D                     Human  aaaa-agtg----------tg-ttt-----t-agagctcaacag
B D                     Chimp  aaaa-agtg----------tg-ttt-----t-agagctcaagag
B D                   Gorilla  aaaa-agtg----------tg-ttt-----t-agagctcaagag
B D                 Orangutan  aaaa-agtg----------tg-ttt-----t-agagctcaagag
B D                    Gibbon  aaaa-agtg----------tg-ttt-----t-agagctcaagag
B D                    Rhesus  aaaa-agcg----------tg-ttt-----t-agagctcaagag
B D       Crab-eating macaque  aaaa-agcg----------tg-ttt-----t-agagctcaagag
B D                    Baboon  aaaa-aggg----------tg-ttt-----t-agagctcaagaa
B D              Green monkey  aaaa-agcg----------tg-ttt-----t-agagctcaagag
B D                  Marmoset  aaaa-agcg----------tg-ttg-----t-ag--------ag
B D           Squirrel monkey  aaaa-agca----------tg-ttt-----t-agagctcaacag
B D                  Bushbaby  aaag-agtg----------tg-ttt-----t-agagcttaagag
           Chinese tree shrew  ------------------------t-----t-agagcacaaggg
B D                  Squirrel  aaag-agta----------tg-ttt-----t-agagctcaagag
       Lesser Egyptian jerboa  ac---aaag----------tg-ctt-----t-ggagctcaagag
                 Prairie vole  aa---agtg----------tg-ttt-----t-cgagctcaagtg
B D           Chinese hamster  aa---agtg----------tg-ttt-----taagagctcaagtg
               Golden hamster  aa---agtg----------tg-ttt-----tttgagttcaagta
B D                     Mouse  aa---agtg----------tg-ttt-----t-agagcacaagta
B D                       Rat  aa---agtg----------tg-ttt-----t-agaacaggagta
B D            Naked mole-rat  taaaaatca----------tg-ttt-----t-aga---------
B D                Guinea pig  agag-aaca----------tg-ttt-----t-aga---------
                   Chinchilla  aaaa-gata----------tg-ttt-----t-aga---------
             Brush-tailed rat  aaaaggaca----------tg-ttt-----t-aga---------
B D                    Rabbit  aaag-agca----------tg-ctt-----t-agaacttaagag
B D                      Pika  aaag-aaca----------tg-ttt-----t-agagtttac-ag
B D                       Pig  aaag-agtg----------gg-gtt-----t-agagactaagag
B D                    Alpaca  aaag-agcg----------tg-gtt-----t-agagcctaagag
               Bactrian camel  aaag-agcg----------tg-gtt-----t-agagcctaagag
B D                   Dolphin  aaag-agcg----------tg-gtt-----t-agagcccaagag
                 Killer whale  aaag-agcg----------tg-gtt-----t-agagcccaagag
             Tibetan antelope  aaag-agcg----------tg-gtt-----t-agagcccaagag
B D                       Cow  aaag-agcg----------tg-gtt-----t-agagcccaagag
B D                     Sheep  gaag-agca----------tg-gtt-----t-agagcccaagag
                Domestic goat  aaag-agcg----------tg-gtt-----t-agagcccaagag
B D                     Horse  aaag-agca----------tg-gtt-----t-aaagctcaaggg
B D          White rhinoceros  aaag-agca----------ta-gtt-----t-agaactcaagag
B D                       Cat  aaag-aacg----------tg-gtt-----t-agagctcaagag
B D                       Dog  aaag-agca----------tg-gtt-----t-agagctcaagag
B D                   Ferret   aaag-agca----------cg-gtt-----a-ggagctcaagag
B D                     Panda  aaac-aaca----------tg-gtt-----t-agagctcaagag
               Pacific walrus  gaag-agga----------tg-gtt-----t-agagctcaagag
                 Weddell seal  gaag-agca----------tg-gtt-----t-agagctcaagag
             Black flying-fox  aaag-agcg----------tg-gtt-----c-agagctcaagag
B D                   Megabat  aaag-agtg----------tg-gtt-----c-agagctcaagag
                Big brown bat  aaag-agcg----------tg-gtt-----c-agagctcaaggg
         David's myotis (bat)  aaag-agca----------tg-gtt-----c-aaagcgcaaggg
B D                  Microbat  aaag-agcg----------tg-gtt-----c-aaagctcaaggg
B D                  Hedgehog  aaag-agta----------tg-ttt-----t-agagcccaagag
B D                     Shrew  aaag-agca----------ag-ctt-----t-agagctcaagag
              Star-nosed mole  aaag-agca----------tgtttt-----t-agagctcagggg
B D                  Elephant  aagg-agca----------tg-ttt-----t-agagctcaagag
          Cape elephant shrew  aaag-agtg----------tg-tttttcgat-agagctcaaggg
B D                   Manatee  aaag-agca----------tg-ttt-----t-agagctcaagag
             Cape golden mole  aaat-agtg----------tg-ttt-----t-agagctcaagag
B D                    Tenrec  aaag-aatg----------tg-ttt-----t-ggagctcagggg
                     Aardvark  aaag-agca-------------ttt-----t-agagctcaagag
B D                 Armadillo  aaag-agta----------tg-ttt-----t-aaagctcaagag
B D                   Opossum  gaaa-ggtgcaaaggtgtgta-ttc-----c-aaagctgagcac
B D           Tasmanian devil  gaag-ggca----------gc-ttc-----a-ggagctcaggag
B D                   Wallaby  aagg-ggcatgtgggtatgta-ttc-----c-agagctcagggg
B D                Budgerigar  --------a----------ca-aac-----c-aggacagaaag-
  D                    Parrot  --------a----------ga-aac-----c-aggactgaaag-
  D             Scarlet macaw  --------a----------ca-aac-----c-aggacagaaag-
B D        American alligator  --------------------a-atc-----c-agaa--gagag-
  D           Green seaturtle  aaca-agca----------tg-atc-----c-agagc-aaagg-
  D            Painted turtle  aaca-agca----------tg-gtc-----c-agagc-aaagg-
  D  Chinese softshell turtle  aaca-agca----------tg-atc-----c-agagc-aaagg-
  D    Spiny softshell turtle  aaca-agca----------tg-atc-----t-agagc-aaagg-
B D                Coelacanth  ============================================
B D                    Turkey  ============================================
B D                   Chicken  ============================================
  D              Mallard duck  ============================================
          Tibetan ground jay  ============================================
B D               Zebra finch  ============================================
  D    White-throated sparrow  ============================================
  D               Rock pigeon  ============================================
  D       Collared flycatcher  ============================================
B D       Medium ground finch  ============================================
B D                    Lizard  ============================================
  D          Peregrine falcon  ============================================
  D              Saker falcon  ============================================

Inserts between block 10 and 11 in window
B D               Budgerigar 1202bp
  D                   Parrot 2821bp
  D            Scarlet macaw 2852bp
B D       American alligator 12bp
  D          Green seaturtle 2bp
  D           Painted turtle 2bp
  D Chinese softshell turtle 2bp
  D   Spiny softshell turtle 2bp

Alignment block 11 of 520 in window, 59239016 - 59239026, 11 bps 
B D                     Human  gccatgg-------ggaa
B D                     Chimp  gccatgg-------ggaa
B D                   Gorilla  gccatgg-------ggaa
B D                 Orangutan  gccatgg-------ggaa
B D                    Gibbon  gccatgg-------ggaa
B D                    Rhesus  gccatgg-------ggaa
B D       Crab-eating macaque  gccatgg-------ggaa
B D                    Baboon  gccatgg-------ggaa
B D              Green monkey  gccatgg-------ggaa
B D                  Marmoset  gccatgg-------ggaa
B D           Squirrel monkey  tccatgg-------ggaa
B D                  Bushbaby  tctaggg-------ggaa
           Chinese tree shrew  gccataa-------ggag
B D                  Squirrel  gccagag-------ggaa
       Lesser Egyptian jerboa  gccatag-------ggaa
                 Prairie vole  gccataa-------tgaa
B D           Chinese hamster  tccgtaa-------tgaa
               Golden hamster  tccataa-------tgaa
B D                     Mouse  gctataa-------tgaa
B D                       Rat  gccataa-------tgaa
B D            Naked mole-rat  -ccacag-------ggaa
B D                Guinea pig  -ccacag-------ggaa
                   Chinchilla  -ccacag-------ggaa
             Brush-tailed rat  -ccacag-------ggaa
B D                    Rabbit  gccatag-------ggaa
B D                      Pika  gccagtg-------ggaa
B D                       Pig  gccttag-------ggaa
B D                    Alpaca  accatag-------ggaa
               Bactrian camel  accttag-------ggaa
B D                   Dolphin  gccatag-------ggaa
                 Killer whale  gccatag-------ggaa
             Tibetan antelope  gccacaa-------ggaa
B D                       Cow  gccacag-------ggaa
B D                     Sheep  gccacag-------ggaa
                Domestic goat  gccacag-------ggaa
B D                     Horse  gccatag-------ggaa
B D          White rhinoceros  gccatag-------ggaa
B D                       Cat  gccgtag-------ggaa
B D                       Dog  gccatag-------ggaa
B D                   Ferret   gccagag-------agaa
B D                     Panda  gccatag-------ggaa
               Pacific walrus  gccatag-------ggaa
                 Weddell seal  gccatag-------ggaa
             Black flying-fox  gccatag-------ggaa
B D                   Megabat  gccatag-------ggaa
                Big brown bat  gccatag-------ggaa
         David's myotis (bat)  gccatag-------ggaa
B D                  Microbat  gccatag-------ggaa
B D                  Hedgehog  gccagag-------gaaa
B D                     Shrew  gccagag-------ggaa
              Star-nosed mole  gccagag-------ggaa
B D                  Elephant  gccgttg-------ggaa
          Cape elephant shrew  accatag-------agaa
B D                   Manatee  gccattg-------ggaa
             Cape golden mole  accat-a-------ggaa
B D                    Tenrec  gccataa-------ggaa
                     Aardvark  gccatag-------ggaa
B D                 Armadillo  gccatag-------ggaa
B D                   Opossum  gctgtaggacgtgagaaa
B D           Tasmanian devil  gctgtag-------gaaa
B D                   Wallaby  tctatag-------gaaa
B D        American alligator  gcaatag-------ggca
  D           Green seaturtle  tctgtgg-------agaa
  D            Painted turtle  tctgtgg-------agaa
  D  Chinese softshell turtle  tctgtgg-------tgaa
  D    Spiny softshell turtle  tctgtgg-------tgaa
B D                Coelacanth  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
  D              Mallard duck  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ==================
  D    White-throated sparrow  ==================
  D             Scarlet macaw  ==================
B D                Budgerigar  ==================
  D               Rock pigeon  ==================
  D       Collared flycatcher  ==================
B D       Medium ground finch  ==================
B D                    Lizard  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D                    Parrot  ==================

Inserts between block 11 and 12 in window
B D       American alligator 8bp
  D Chinese softshell turtle 3003bp

Alignment block 12 of 520 in window, 59239027 - 59239039, 13 bps 
B D                     Human  ttg------tgt-------------------------tg-tt-g-g-g
B D                     Chimp  ttg------tgt-------------------------tg-tt-g-g-g
B D                   Gorilla  ttg------tgt-------------------------tg-tt-g-g-g
B D                 Orangutan  ttg------tgt-------------------------tg-tt-g-g-g
B D                    Gibbon  ttg------tgt-------------------------tg-tt-g-g-g
B D                    Rhesus  ttg------tgt-------------------------tg-tt-g-g-g
B D       Crab-eating macaque  ttg------tgt-------------------------tg-tt-g-g-g
B D                    Baboon  ttg------tgt-------------------------tg-tt-g-g-g
B D              Green monkey  ttg------tat-------------------------tg-tt-g-g-g
B D                  Marmoset  tta------tgt-------------------------tg-ct-g-g-g
B D           Squirrel monkey  ttg------tgt-------------------------tg-tt-g-g-g
B D                  Bushbaby  ttg------tgt-------------------------tg-ttgg-g-g
           Chinese tree shrew  ttg------tgt-------------------------tg-tt-g-gag
B D                  Squirrel  ttg------tgt-------------------------tgttt-g-g-g
       Lesser Egyptian jerboa  tcg------tgt-------------------------tg-ct-g-g-g
                 Prairie vole  ttg------ttc-------------------------tg-tt-g-g-g
B D           Chinese hamster  ttg------ttc-------------------------tg-tt-g-g-g
               Golden hamster  ttg------ttc-------------------------tg-tt-g-g-g
B D                     Mouse  ttg------ttc-------------------------tg-tt-g-t-g
B D                       Rat  ttg------ttc-------------------------tg-tt-g-t-g
B D            Naked mole-rat  ttg------tgt-------------------------tg-tt-ggg-g
B D                Guinea pig  ttg------tgt-------------------------tg-tt-gga-g
                   Chinchilla  tta------tgt-------------------------tg-tt-gag-g
             Brush-tailed rat  ttg------tgt-------------------------tg-tt-ggg-g
B D                    Rabbit  ttg------tgt-------------------------tg-tt-tag-g
B D                      Pika  ttg------cgt-------------------------tg-tt-tgg-a
B D                       Pig  gtg------tgt-------------------------tg-tt-g-g-a
B D                    Alpaca  ttg------tgt-------------------------tg-tt-g-g-a
               Bactrian camel  ttg------tgt-------------------------tg-tt-g-g-a
B D                   Dolphin  ttg------tgt-------------------------tg-tc-g-g-g
                 Killer whale  ttg------tgt-------------------------tg-tc-g-t-g
             Tibetan antelope  ttg------tgt-------------------------tg-tc-a-g-a
B D                       Cow  ttg------tgt-------------------------tg-tc-a-g-a
B D                     Sheep  ttg------tgt-------------------------tg-tc-a-g-a
                Domestic goat  ttg------tgt-------------------------tg-tc-a-g-a
B D                     Horse  ttg------tgt-------------------------tg-tt-g-g-g
B D          White rhinoceros  ttg------tgt-------------------------tg-tt-g-g-g
B D                       Cat  ttg------tgt-------------------------tg-tt-g-g-g
B D                       Dog  ttg------tgt-------------------------tg-tt-g-g-g
B D                   Ferret   tta------tgt-------------------------tg-tt-g-g-g
B D                     Panda  ttg------tgt-------------------------tg-tt-g-g-g
               Pacific walrus  ttg------tgt-------------------------tg-tt-g-g-g
                 Weddell seal  ttg------tgt-------------------------tg-tt-g-g-g
             Black flying-fox  ttg------tgt-------------------------tg-tt-g-g-g
B D                   Megabat  ttg------tgt-------------------------tg-tt-g-g-g
                Big brown bat  tga------tgt-------------------------tg-tt-g-g-g
         David's myotis (bat)  tga------tgt-------------------------tg-tt-g-a-g
B D                  Microbat  tga------tgt-------------------------tg-tt-g-g-g
B D                  Hedgehog  tta------tgt-------------------------tg-tt-g-g-g
B D                     Shrew  ttg------tgt-------------------------tg-tt-g-g-g
              Star-nosed mole  ttg------tgt-------------------------tt-tg-g-g-g
B D                  Elephant  ttg------tgt-------------------------tg-tc-a-a-g
          Cape elephant shrew  ttg------cat-------------------------tg-tt-g-g-g
B D                   Manatee  ttg------tgt-------------------------tg-tc-a-g-g
             Cape golden mole  ttg------tgtgtttcctacaaaaggtttctaagaatt-gc-a-g-g
B D                    Tenrec  ctg------cat-------------------------tg-tc-g-a-g
                     Aardvark  ttg------tgt-------------------------tg-cc-a-g-g
B D                 Armadillo  atg------ttt-------------------------tg-tt-g-g-g
B D                   Opossum  tggggatagtat-------------------------tg-tc-a-g-g
B D           Tasmanian devil  taggggtaatgt-------------------------tg-tt-g-g-g
B D                   Wallaby  ttggggtagtat-------------------------tg-tt-g-a-g
B D        American alligator  ttg------ggg-------------------------tg-gc-a-t-c
  D           Green seaturtle  ata------caa-------------------------tg-at-g-c-a
  D            Painted turtle  atg------caa-------------------------tg-at-g-c-a
  D    Spiny softshell turtle  agg------caa-------------------------tg-ac-a-c-a
B D                Coelacanth  ================================================
B D                    Turkey  ================================================
B D                   Chicken  ================================================
  D              Mallard duck  ================================================
          Tibetan ground jay  ================================================
B D               Zebra finch  ================================================
  D    White-throated sparrow  ================================================
  D             Scarlet macaw  ================================================
B D                Budgerigar  ================================================
  D               Rock pigeon  ================================================
  D       Collared flycatcher  ================================================
B D       Medium ground finch  ================================================
B D                    Lizard  ================================================
  D          Peregrine falcon  ================================================
  D              Saker falcon  ================================================
  D                    Parrot  ================================================
  D  Chinese softshell turtle  ================================================

Inserts between block 12 and 13 in window
B D                 Hedgehog 1bp
B D                  Opossum 3bp
B D                  Wallaby 1797bp

Alignment block 13 of 520 in window, 59239040 - 59239043, 4 bps 
B D                     Human  t--tct
B D                     Chimp  t--tct
B D                   Gorilla  t--tct
B D                 Orangutan  t--tct
B D                    Gibbon  t--tct
B D                    Rhesus  t--ttg
B D       Crab-eating macaque  t--ttg
B D                    Baboon  t--ttg
B D              Green monkey  t--ttg
B D                  Marmoset  t--tcc
B D           Squirrel monkey  t--tcc
B D                  Bushbaby  t--tcc
           Chinese tree shrew  t--tcc
B D                  Squirrel  t--ttc
       Lesser Egyptian jerboa  a--tcc
                 Prairie vole  t--cct
B D           Chinese hamster  t--cct
               Golden hamster  t--cct
B D                     Mouse  t--ccc
B D                       Rat  t--ccc
B D            Naked mole-rat  t--tcc
B D                Guinea pig  t--tcc
                   Chinchilla  t--tcc
             Brush-tailed rat  t--tcc
B D                    Rabbit  t--ttc
B D                      Pika  t--ttc
B D                       Pig  t-----
B D                    Alpaca  t-----
               Bactrian camel  t-----
B D                   Dolphin  t-----
                 Killer whale  t-----
             Tibetan antelope  t-----
B D                       Cow  t-----
B D                     Sheep  t-----
                Domestic goat  t-----
B D                     Horse  t-ttcc
B D          White rhinoceros  t-ttcc
B D                       Cat  t-ttcc
B D                       Dog  t-ttcc
B D                   Ferret   t-ttcc
B D                     Panda  t-ttcc
               Pacific walrus  t-ttcc
                 Weddell seal  t-ttcc
             Black flying-fox  t-tttc
B D                   Megabat  t-tttc
                Big brown bat  t-ttcc
         David's myotis (bat)  t-ttcc
B D                  Microbat  t-ttct
B D                  Hedgehog  t-ttcc
B D                     Shrew  t-tttc
              Star-nosed mole  t-ttcc
B D                  Elephant  g-ttcc
          Cape elephant shrew  gattcc
B D                   Manatee  g-tttc
             Cape golden mole  g-ttcc
B D                    Tenrec  g-ttcc
                     Aardvark  g-ttcc
B D                 Armadillo  g--tcc
B D                   Opossum  t-----
B D           Tasmanian devil  t-----
B D        American alligator  --g---
  D           Green seaturtle  --gtct
  D            Painted turtle  --gtct
  D    Spiny softshell turtle  --gtcg
B D                Coelacanth  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                   Wallaby  ======
  D  Chinese softshell turtle  ======

Inserts between block 13 and 14 in window
B D                  Opossum 5812bp
B D          Tasmanian devil 3497bp
  D          Green seaturtle 2522bp
  D           Painted turtle 1610bp
  D   Spiny softshell turtle 6bp

Alignment block 14 of 520 in window, 59239044 - 59239076, 33 bps 
B D                     Human  tacaaaatttt-tcaaaga--aactaccaatagaga
B D                     Chimp  tacaaaatttt-tcaaaga--aactaccaatagaga
B D                   Gorilla  tacaaaatttt-tcaaaga--aactaccaatagaga
B D                 Orangutan  tacaagatttt-tcaaaga--aactaccaatagaga
B D                    Gibbon  tacaaaatttt-tcaaaga--aactaacaacagaga
B D                    Rhesus  ---aaaatttt-tcaagga--aactaccaatagaga
B D       Crab-eating macaque  ---aaaatttt-tcaagga--aactaccaatagaga
B D                    Baboon  ---aaaatttt-tcaagga--aactaccaatagaga
B D              Green monkey  ---aaaatttt-tcaagga--aactaccaatagaga
B D                  Marmoset  tataaaattgt-t-ataaa--agctaccaatagaga
B D           Squirrel monkey  tacaaaattgt-t-ataaa--aactaccaatagaga
B D                  Bushbaby  tacaaaatatt-ccaaaga--aactaccagtggaga
           Chinese tree shrew  tacaaaatatt-tcaaaga--aactaccaa---agg
B D                  Squirrel  tacaaaatatt-tcaagga--aactaccaacgggga
       Lesser Egyptian jerboa  tacaaaatctt-tcaa--t--atctaacaggaga--
                 Prairie vole  tacaaaatatt-tcaaaga--tgctaccaatgaacc
B D           Chinese hamster  tacaaaacagt-tcaaaga--agctaccaacagaga
               Golden hamster  tacaaaatatt-tcaaaga--agctaccagtggaga
B D                     Mouse  ttcaaaatatt-tcaaagt--aactatcaaccgaga
B D                       Rat  ttcaaaatatc-tcaaaga--agctatcaatggaga
B D            Naked mole-rat  tataaaatctt-ccaaaga--cattaccaatggaaa
B D                Guinea pig  tat-aaatctt-tcaaaga--tattaccagtgaaga
                   Chinchilla  tatcaaatcctatcaaaga--cattaccaatagaga
             Brush-tailed rat  tatcaaatctt-tcaaaga--cattacccatagaaa
B D                    Rabbit  tacaaaatatt-tcaaaga--agctaccaagggaaa
B D                      Pika  tgttaagtatt-tcaagga--aactaccatgggaaa
B D                       Pig  ----------t-tcagaga--aactaccaatggaga
B D                    Alpaca  ----------t-tcagaga--aactaccaatggaga
               Bactrian camel  ----------t-tcagaga--aattaccaatggaga
B D                   Dolphin  ----------t-tcaaaga--aactaccagtggaga
                 Killer whale  ----------t-tcaaaga--aactaccagtggaga
             Tibetan antelope  ----------t-tcaaaga--aactaccaatggaga
B D                       Cow  ----------t-tcaaaga--aactaccaatggaga
B D                     Sheep  ----------t-tcaaaga--aactaccaatggaga
                Domestic goat  ----------t-tcaaaga--aactaccaatggaga
B D                     Horse  tacaaaatgtt-tccaaga--gactaccaatggaga
B D          White rhinoceros  tacaaaatg-t-tacaaaa--gactaccgatggaga
B D                       Cat  tacaaaatgtt-tcaaaga--aactaccagtggaaa
B D                       Dog  tacaaaatgtt-tcaaaga--aactaccaatggaaa
B D                   Ferret   tacaaaatgtt-tcaaaaa--aactaccaatggaaa
B D                     Panda  tacaaaatgtt-tcaaaga--aactaccaatggaaa
               Pacific walrus  tacaaaatgtt-tcaaaga--aactaccaatggaaa
                 Weddell seal  tacaaaatgtt-tcaaaga--aactaccaatggaaa
             Black flying-fox  tacaaaatgtt-tcaaaga--aaataccaatggaaa
B D                   Megabat  tacaaaatgtt-tcaaaga--aaataccaatggaaa
                Big brown bat  tacaaaatgtt-tcaaaga--cactaccaatggaaa
         David's myotis (bat)  tacaaaatggt-tcaaaga--cactaccaatggaaa
B D                  Microbat  tacaaaatagt-tcaaaga--cactaccaatggaaa
B D                  Hedgehog  tacaaaatatt-tcaaaga--aatcatcaacagaca
B D                     Shrew  tataaaatgtg-taagaaa--gctaccaaagagaaa
              Star-nosed mole  tacaaagtgtt-tcaaaga--ctgac--aatggaga
B D                  Elephant  tacaaaatgtt-tccaaga--aattaccaatgaaga
          Cape elephant shrew  tacaaaattat-tccaaga--aaccactaatgtata
B D                   Manatee  tacaaaatgtt-tccaaga--aattaccagtgaaga
             Cape golden mole  tacaaaaggtt-tctaaga--aaccaccaatggaaa
B D                    Tenrec  tacaacacatt-tccaaga--aaccacccgtggaaa
                     Aardvark  tacaaaatgtt-tccaaga--aactaccaatggaga
B D                 Armadillo  tacaaaatgtt-tcagaga--aacaat--ggggaga
B D        American alligator  gctaacctgca-tcaaaaacagcctggctttaggac
  D    Spiny softshell turtle  ---------------------gactagggtttaaac
B D                Coelacanth  ====================================
B D                    Turkey  ====================================
B D                   Chicken  ====================================
  D              Mallard duck  ====================================
          Tibetan ground jay  ====================================
B D               Zebra finch  ====================================
  D    White-throated sparrow  ====================================
B D           Tasmanian devil  ====================================
  D            Painted turtle  ====================================
  D           Green seaturtle  ====================================
  D             Scarlet macaw  ====================================
B D                Budgerigar  ====================================
B D                   Opossum  ====================================
  D               Rock pigeon  ====================================
  D       Collared flycatcher  ====================================
B D       Medium ground finch  ====================================
B D                    Lizard  ====================================
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
  D                    Parrot  ====================================
B D                   Wallaby  ====================================
  D  Chinese softshell turtle  ====================================

Inserts between block 14 and 15 in window
              Golden hamster 1975bp
B D                    Mouse 2bp
B D                      Rat 2bp

Alignment block 15 of 520 in window, 59239077 - 59239086, 10 bps 
B D                     Human  agaaataa--tg
B D                     Chimp  agaaataa--tg
B D                   Gorilla  agaaataa--tg
B D                 Orangutan  agaaataa--tg
B D                    Gibbon  agaaataa--tg
B D                    Rhesus  ggaaataa--tg
B D       Crab-eating macaque  ggaaataa--tg
B D                    Baboon  ggaaataa--tg
B D              Green monkey  ggaaataa--tg
B D                  Marmoset  gaaaataa--tg
B D           Squirrel monkey  ggaaataa--tg
B D                  Bushbaby  ggcagtaa--tg
           Chinese tree shrew  agaagtaa--tg
B D                  Squirrel  atcagtaa--tg
       Lesser Egyptian jerboa  accagtaa--tg
                 Prairie vole  gccggtaa--tg
B D           Chinese hamster  gccagtag--tg
B D                     Mouse  ---ggcaa--tg
B D                       Rat  ---ggtaa--ta
B D            Naked mole-rat  gccagtaa--tg
B D                Guinea pig  gccactaa--tg
                   Chinchilla  gccagtaa--tg
             Brush-tailed rat  gccagtaa--tg
B D                    Rabbit  gtcagtgg--tg
B D                      Pika  accagtga--t-
B D                       Pig  tacagtaa--t-
B D                    Alpaca  ggcagtaa--tg
               Bactrian camel  ggcagtaa--tg
B D                   Dolphin  ggcagtaa--tg
                 Killer whale  ggcagtaa--tg
             Tibetan antelope  ggcagtaa--tg
B D                       Cow  ggcagtaa--tg
B D                     Sheep  ggcagtaa--tg
                Domestic goat  ggcagtaa--tg
B D                     Horse  ggcagtaa--tg
B D          White rhinoceros  ggcagtaa--tg
B D                       Cat  ggcagcaa--ta
B D                       Dog  ggcagtaa--tg
B D                   Ferret   ggcagtaa--tg
B D                     Panda  ggcaataa--tg
               Pacific walrus  ggcaataa--ta
                 Weddell seal  ggcaataa--ta
             Black flying-fox  ggtaatga--tg
B D                   Megabat  ggtaatga--tg
                Big brown bat  ggtagtga--tg
         David's myotis (bat)  ggtggtga--tg
B D                  Microbat  ggtggtga--tg
B D                  Hedgehog  gtgagcaa--tg
B D                     Shrew  aacagc-a--tg
              Star-nosed mole  ggcagtaa--tg
B D                  Elephant  gggagtaa--ca
          Cape elephant shrew  ggcagtaa--ct
B D                   Manatee  ggcagtaa--ca
             Cape golden mole  ggcagtag--cc
B D                    Tenrec  gacagtaa--ca
                     Aardvark  ggcagtaa--ca
B D                 Armadillo  gatagtag--tg
B D        American alligator  ---agtta--ta
  D    Spiny softshell turtle  ---tgctaacca
              Golden hamster  ============
B D                Coelacanth  ============
B D                    Turkey  ============
B D                   Chicken  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
  D    White-throated sparrow  ============
B D           Tasmanian devil  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
  D             Scarlet macaw  ============
B D                Budgerigar  ============
B D                   Opossum  ============
  D               Rock pigeon  ============
  D       Collared flycatcher  ============
B D       Medium ground finch  ============
B D                    Lizard  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
  D                    Parrot  ============
B D                   Wallaby  ============
  D  Chinese softshell turtle  ============

Inserts between block 15 and 16 in window
B D          Chinese hamster 1962bp
B D                    Mouse 4bp
B D                      Rat 4bp

Alignment block 16 of 520 in window, 59239087 - 59239113, 27 bps 
B D                     Human  atagatcacat--agcaa---tcat--tg---aa--------aaa
B D                     Chimp  atagatcacat--agcaa---tcat--tg---aa--------aaa
B D                   Gorilla  atagatcacat--agcaa---tcat--tg---aa--------aaa
B D                 Orangutan  gtagatcacat--agcaa---tcat--tg---aa--------aaa
B D                    Gibbon  atagatcacat--agcaa---tcat--tg---aa--------aaa
B D                    Rhesus  atagatcacat--agcaa---ttat--tg---aa--------gaa
B D       Crab-eating macaque  atagatcacat--agcaa---ttat--tg---aa--------gaa
B D                    Baboon  atagatcacat--agcaa---tcat--tg---aa--------gaa
B D              Green monkey  atagatcacat--agcaa---tcac--tg---aa--------gaa
B D                  Marmoset  atagatcacat--agcaa---tcac--tg---aa--------taa
B D           Squirrel monkey  atagatcacat--agcaa---tcac--tg---aa--------gaa
B D                  Bushbaby  gcggaccacat--agc------cac--tg---aa--------aca
           Chinese tree shrew  gaagaccatac--agtag---tcat--tg---aa--------aaa
B D                  Squirrel  ggagaccacag--agtag---tcat--tg-aaaa--------aaa
       Lesser Egyptian jerboa  gtagatcacat--agtag---tcat--tt---aa--------aac
                 Prairie vole  ccagatagcac--agtgg---tcat--tg---ag--------aag
B D                     Mouse  agagataacat--agt-g---ttat--tg---ag--------aaa
B D                       Rat  agagataacat--agt-g---ctgt--tg---ag--------aaa
B D            Naked mole-rat  gcagaccacat--agtag---tcac--tg---aa--------aaa
B D                Guinea pig  gtagaccacat--agtag---tcac--tg---aa--------aaa
                   Chinchilla  tcagaccacat--agcag---tcac--tg---aa--------aaa
             Brush-tailed rat  gcagagcacat--agcag---tcac--ta---aa--------aaa
B D                    Rabbit  gcagactacat--agtag---ttat--tg---aa--------aaa
B D                      Pika  gcagaccacat--agcag---ttaa--tg---aa--------aaa
B D                       Pig  gcagatcacat--aggac---caat--tgaaaaa--------aaa
B D                    Alpaca  gcagaccacatacaggaa---taac--tg--aaa--------aaa
               Bactrian camel  gcagaccacatataggag---taac--ta--aaa--------aaa
B D                   Dolphin  gcagaccacat--aggag---taactatg-aaaa--------aaa
                 Killer whale  gcagaccacat--aggag---taac--tg-aaaa--------aaa
             Tibetan antelope  gcagactacat--agaag---tagc--tg--aaa--------aaa
B D                       Cow  gcagaccacat--aggag---tagc--tg-aaaa--------aaa
B D                     Sheep  gcagaccacat--agaag---tagc--tg--aaa--------aaa
                Domestic goat  gcagaccacat--agaag---tagc--tg--aaa--------aaa
B D                     Horse  gtagaccacaa--aggag---tcgt--tg---aa--------gga
B D          White rhinoceros  gtagaccacat--aggag---tcat--tg---aa--------gaa
B D                       Cat  gcagaccacat--aggag---tcat--tg---aa--------aaa
B D                       Dog  gcagaccacat--aggag---tcat--tg---aa--------aga
B D                   Ferret   gcagaccacat--aggag---tcac--tg---aa--------aga
B D                     Panda  gcagaccacat--aggag---tcat--tg---aa--------aga
               Pacific walrus  gcagaccacat--aggag---tcac--tg---aa--------aga
                 Weddell seal  gcagaccacat--aggaa---tcat--tg---aa--------aga
             Black flying-fox  gcaacccacat--aggag---tcat--tg---aa--------aaa
B D                   Megabat  gcaacccacat--aggag---tcat--tg---aa--------aaa
                Big brown bat  gtagaccatat--acaag---tcat--tg---aa--------aaa
         David's myotis (bat)  gtagaccatat--acgag---tcgt--tg---aa--------aaa
B D                  Microbat  gtagaccatat--acgag---tcat--tg---aa--------aaa
B D                  Hedgehog  gcaggccacat--gagac---tcat--tt---aa--------gaa
B D                     Shrew  aaagaacatag--ggtag---tcat--tt---aa--------gaa
              Star-nosed mole  gcagaa----------------cat--tt---aa--------gaa
B D                  Elephant  gcagataatat--agaag---tcac--tg---aa--------aaa
          Cape elephant shrew  at-ggttatgt--agaagtattttt--tt---tt--------aaa
B D                   Manatee  gcagataatat--agaat---tcat--tg---aa--------aaa
             Cape golden mole  tctgcgaatct--agaag---tcac--tg---aa--------ata
B D                    Tenrec  gctgataatatg-ggagg---tcat--tg---ga--------ata
                     Aardvark  gcagataatag--aggag---taat--tg---aa--------ata
B D                 Armadillo  gcagaccacata-aggag---tccc--tg--aaa--------aaa
B D        American alligator  atagctcatat--ggatt---tgat--tg---gcttt-----aaa
  D    Spiny softshell turtle  gcagtttaaag--tgaca---tgat--ca---aatttctgaaaaa
              Golden hamster  =============================================
B D                Coelacanth  =============================================
B D                    Turkey  =============================================
B D                   Chicken  =============================================
  D              Mallard duck  =============================================
          Tibetan ground jay  =============================================
B D               Zebra finch  =============================================
  D    White-throated sparrow  =============================================
B D           Tasmanian devil  =============================================
  D            Painted turtle  =============================================
  D           Green seaturtle  =============================================
  D             Scarlet macaw  =============================================
B D                Budgerigar  =============================================
B D                   Opossum  =============================================
  D               Rock pigeon  =============================================
  D       Collared flycatcher  =============================================
B D       Medium ground finch  =============================================
B D                    Lizard  =============================================
  D          Peregrine falcon  =============================================
  D              Saker falcon  =============================================
  D                    Parrot  =============================================
B D                   Wallaby  =============================================
B D           Chinese hamster  =============================================
  D  Chinese softshell turtle  =============================================

Alignment block 17 of 520 in window, 59239114 - 59239124, 11 bps 
B D                     Human  gcaaa-tataca
B D                     Chimp  gcaaa-tataca
B D                   Gorilla  gcaaa-tataca
B D                 Orangutan  gcaga-tataca
B D                    Gibbon  gcaaa-tataca
B D                    Rhesus  acaaa-tataca
B D       Crab-eating macaque  acaaa-tataca
B D                    Baboon  acaaa-tataca
B D              Green monkey  acaaa-tataca
B D                  Marmoset  gcaaa-tataca
B D           Squirrel monkey  gcaaa-tataca
B D                  Bushbaby  gcaaa-tgtaca
           Chinese tree shrew  tcaaa-cataca
B D                  Squirrel  tcaaa-tgtaca
       Lesser Egyptian jerboa  tcaaa-agtgca
                 Prairie vole  tgaaa-tggaca
B D                     Mouse  tccaa-tgcgca
B D                       Rat  tccaa-tgcaca
B D            Naked mole-rat  tcaaa-tgtaca
B D                Guinea pig  acgaa-tgcaca
                   Chinchilla  tcaaa-tgtaca
             Brush-tailed rat  tcaaattgtaca
B D                    Rabbit  tcaaa-tataca
B D                      Pika  tcaaa-tatgta
B D                       Pig  tcaga-tgtaca
B D                    Alpaca  tcaga-tgtaca
               Bactrian camel  tcaga-tgtaca
B D                   Dolphin  tcaga-tgtaca
                 Killer whale  taaga-tgtaca
             Tibetan antelope  ccaga-tgtaca
B D                       Cow  ccaga-tgtaca
B D                     Sheep  ccaga-tgtaca
                Domestic goat  ccaga-tgtaca
B D                     Horse  tcaaa-tgcaca
B D          White rhinoceros  tcaaa-tgcaca
B D                       Cat  tcaaa-cgtaca
B D                       Dog  tcaaa-tgtaca
B D                   Ferret   tcaaa-tgtaca
B D                     Panda  tcgaa-tgtaca
               Pacific walrus  tcaaa-tgtaca
                 Weddell seal  tcaaa-tgtaca
             Black flying-fox  tcaaa-tgtaca
B D                   Megabat  tcaaa-tgtaca
                Big brown bat  tcaaa-tgtaca
         David's myotis (bat)  tc-aa-tgtaca
B D                  Microbat  tc-aa-tgtaca
B D                  Hedgehog  tcaaa-tggaca
B D                     Shrew  tcaag-tgtgca
              Star-nosed mole  tcaaa-tgt-ta
B D                  Elephant  tcaaa-tgtata
          Cape elephant shrew  tcaca-tatata
B D                   Manatee  tcaaa-tgtatg
             Cape golden mole  tccaa-tgtata
B D                    Tenrec  tcaaa-tgtaca
                     Aardvark  tcaaa-tgtaca
B D                 Armadillo  tcaaa-tgtaca
B D        American alligator  gtaaa-agttca
              Golden hamster  ============
B D                Coelacanth  ============
B D                    Turkey  ============
B D                   Chicken  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
  D    White-throated sparrow  ============
B D           Tasmanian devil  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
  D             Scarlet macaw  ============
B D                Budgerigar  ============
B D                   Opossum  ============
  D               Rock pigeon  ============
  D       Collared flycatcher  ============
B D       Medium ground finch  ============
B D                    Lizard  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
  D                    Parrot  ============
B D                   Wallaby  ============
B D           Chinese hamster  ============
  D  Chinese softshell turtle  ============

Inserts between block 17 and 18 in window
B D       American alligator 3793bp

Alignment block 18 of 520 in window, 59239125 - 59239147, 23 bps 
B D                     Human  c--acaa-----acaccatttg-------------gataacac
B D                     Chimp  c--acaa-----acaccatttg-------------gataacac
B D                   Gorilla  c--acaa-----acaccatttg-------------gataacac
B D                 Orangutan  c--acaa-----acaccatttg-------------gataacac
B D                    Gibbon  c--acaa-----acaccatttg-------------ggtaacac
B D                    Rhesus  c--acaa-----gcaccatttg-------------gataacac
B D       Crab-eating macaque  c--acaa-----gcaccatttg-------------gataacac
B D                    Baboon  c--acaa-----gcaccatttg-------------gataacac
B D              Green monkey  c--acaa-----gcactatttg-------------gataacac
B D                  Marmoset  c--acaa-----acaccgtttg-------------gataacac
B D           Squirrel monkey  c--acaa-----aaaccagttg-------------gataacac
B D                  Bushbaby  ca-acaa-----acaccaccca-------------ggtaacgc
           Chinese tree shrew  cacacaa-----acaccatctg-------------gacaacac
B D                  Squirrel  c--acaa-----acaccatctg-------------gaaaacac
       Lesser Egyptian jerboa  t--acaa-----agcccatcta-------------gaaaacac
                 Prairie vole  t--gcaa-----acaccatctg-------------gaaaa---
B D                     Mouse  t--gcaa-----acaccatatt-------------ggaaacac
B D                       Rat  g--gcaa-----acaccatctg-------------ggaaactg
B D            Naked mole-rat  ----caa-----ataccacctg-------------gaaaacat
B D                Guinea pig  ----cca-----ccaccacctg-------------gaaaacac
                   Chinchilla  ----caa-----acaccacctg-------------gaaaacac
             Brush-tailed rat  ----caa-----acaccacctg-------------gaaaacac
B D                    Rabbit  c--ac-a-----acaccatctg-------------gaaaacag
B D                      Pika  t--acaa-----acaccatctg-------------gaaaacag
B D                       Pig  c--acca-----aaagcatcta-------------ggtaacac
B D                    Alpaca  c--acaa-----acaccatcta-------------gattgcac
               Bactrian camel  c--acaa-----acaccatcta-------------gattgcac
B D                   Dolphin  c--acaa-----acaccatcta-------------gataacac
                 Killer whale  c--acaa-----acaccatcta-------------gataacac
             Tibetan antelope  c--acaa-----acaccatcta-------------aataatac
B D                       Cow  c--acaa-----acaccatcta-------------aataatac
B D                     Sheep  c--acaa-----acaccatcta-------------aataatac
                Domestic goat  c--acaa-----acaccatcta-------------aataatac
B D                     Horse  c--gcaa-----acatcatctt-------------gataacac
B D          White rhinoceros  c--acaa-----acgccatctg-------------gataacac
B D                       Cat  c--acaa-----acaccatctg-------------gataacac
B D                       Dog  c--acag-----ataccatctg-------------cataatac
B D                   Ferret   c--acaa-----acaccatctg-------------gatagcac
B D                     Panda  c--acaa-----acaccatctg-------------gatagcac
               Pacific walrus  c--acaa-----acaccatctg-------------aatagcac
                 Weddell seal  c--acaa-----acaccatctg-------------gatagcac
             Black flying-fox  c--acaa-----accccatctg-------------gataacac
B D                   Megabat  c--acaa-----accccatctg-------------gataacac
                Big brown bat  c--acaa-----a-cccacctg-------------gataacac
         David's myotis (bat)  c--agaa-----accccacctg-------------gataacac
B D                  Microbat  c--acaa-----accccacctg-------------gataacac
B D                  Hedgehog  t--acaa-----acatcatcta-------------gataacgc
B D                     Shrew  t--gcaa-----acctcatctg-------------aataatgt
              Star-nosed mole  c--aaag-----acaccatttg--------------gtaacac
B D                  Elephant  c--acaa-----ataccatctg-------------gataacac
          Cape elephant shrew  c--acaa-----agaccatctaagtaatacatgatgataacac
B D                   Manatee  c--acaa-----agaccatctg-------------gataacac
             Cape golden mole  a--atga-----agaatac--a-------------cataatac
B D                    Tenrec  t--acaa-----agactatcaa-------------tataatac
                     Aardvark  t--acaa-----agaccatctg-------------gataacac
B D                 Armadillo  c--acaatgtacacaccacctg-------------gacttcac
              Golden hamster  ===========================================
B D                Coelacanth  ===========================================
B D                    Turkey  ===========================================
B D                   Chicken  ===========================================
  D              Mallard duck  ===========================================
          Tibetan ground jay  ===========================================
B D               Zebra finch  ===========================================
  D    White-throated sparrow  ===========================================
B D           Tasmanian devil  ===========================================
  D            Painted turtle  ===========================================
  D           Green seaturtle  ===========================================
B D        American alligator  ===========================================
  D             Scarlet macaw  ===========================================
B D                Budgerigar  ===========================================
B D                   Opossum  ===========================================
  D               Rock pigeon  ===========================================
  D       Collared flycatcher  ===========================================
B D       Medium ground finch  ===========================================
B D                    Lizard  ===========================================
  D          Peregrine falcon  ===========================================
  D              Saker falcon  ===========================================
  D                    Parrot  ===========================================
B D                   Wallaby  ===========================================
B D           Chinese hamster  ===========================================
  D  Chinese softshell turtle  ===========================================

Inserts between block 18 and 19 in window
B D                   Tenrec 987bp

Alignment block 19 of 520 in window, 59239148 - 59239157, 10 bps 
B D                     Human  ctg----catatag
B D                     Chimp  cta----catatag
B D                   Gorilla  cta----catatag
B D                 Orangutan  cta----catatag
B D                    Gibbon  cta----catatag
B D                    Rhesus  cta----tgtatag
B D       Crab-eating macaque  cta----tgtatag
B D                    Baboon  cta----tgtatag
B D              Green monkey  cta----tgtatag
B D                  Marmoset  c-a----tgtatag
B D           Squirrel monkey  ctg----tgtatag
B D                  Bushbaby  cta----catgtag
           Chinese tree shrew  cta----catgcag
B D                  Squirrel  cta----catacag
       Lesser Egyptian jerboa  caa----atcacca
B D                     Mouse  c-------------
B D                       Rat  c-------------
B D            Naked mole-rat  ctg----catacag
B D                Guinea pig  cta----cgtacag
                   Chinchilla  cta----catacag
             Brush-tailed rat  -----------cag
B D                    Rabbit  cta----catacag
B D                      Pika  tta----catatag
B D                       Pig  ata----tatacta
B D                    Alpaca  cta----catacaa
               Bactrian camel  cta----catacaa
B D                   Dolphin  cta----cataaaa
                 Killer whale  cta----cataaaa
             Tibetan antelope  tta----catacaa
B D                       Cow  tta----catacaa
B D                     Sheep  tta----aatacaa
                Domestic goat  tta----catacaa
B D                     Horse  ctc----catgcag
B D          White rhinoceros  cta----catacag
B D                       Cat  cta----tatgtag
B D                       Dog  cta----catatag
B D                   Ferret   ctg----catgtag
B D                     Panda  cta----catagac
               Pacific walrus  cta----catatag
                 Weddell seal  cta----catatag
             Black flying-fox  cta----catagag
B D                   Megabat  cta----tatagag
                Big brown bat  cta----catatag
         David's myotis (bat)  cta----catacag
B D                  Microbat  cta----catacag
B D                  Hedgehog  aaa----catgcag
B D                     Shrew  ctt----caaacta
              Star-nosed mole  cta----cacacag
B D                  Elephant  cta----catacag
          Cape elephant shrew  ctgagataatgtag
B D                   Manatee  cta----catacag
             Cape golden mole  cta----tatacag
                     Aardvark  cta----tgcacag
B D                 Armadillo  cta----cctacag
                Prairie vole  --------------
              Golden hamster  ==============
B D                Coelacanth  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
  D              Mallard duck  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
  D    White-throated sparrow  ==============
B D           Tasmanian devil  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D        American alligator  ==============
  D             Scarlet macaw  ==============
B D                Budgerigar  ==============
B D                   Opossum  ==============
  D               Rock pigeon  ==============
  D       Collared flycatcher  ==============
B D       Medium ground finch  ==============
B D                    Lizard  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D                    Parrot  ==============
B D                   Wallaby  ==============
B D           Chinese hamster  ==============
B D                    Tenrec  ==============
  D  Chinese softshell turtle  ==============

Inserts between block 19 and 20 in window
            Cape golden mole 406bp
                    Aardvark 28bp

Alignment block 20 of 520 in window, 59239158 - 59239188, 31 bps 
B D                     Human  gttacat--a------aaat---agcatgttgacacagctaa
B D                     Chimp  gttacat--a------aaat---agcatgttgacacagctaa
B D                   Gorilla  gttacat--a------aaat---agcatgttggcacagctaa
B D                 Orangutan  gttacat--a------taat---agcatgttggcacagctaa
B D                    Gibbon  gttacat--c------taac---agcatgttggcacagctaa
B D                    Rhesus  gttacat--a------aaat---agcatgttggcacagctaa
B D       Crab-eating macaque  gttacat--a------aaat---agcatgttggcacagctaa
B D                    Baboon  gttacat--a------taat---agcatgttggcacagctaa
B D              Green monkey  gttacat--a------taat---agcatgttggcacagctaa
B D                  Marmoset  gttacgt--a------taat---agcatgtaggcacagctaa
B D           Squirrel monkey  gttatat--a------taat---agtgtgtaggcacagctaa
B D                  Bushbaby  ------------------------gcatgtgagcacagttaa
           Chinese tree shrew  gttatat--a------tagt---agcatgtgggcacagctaa
B D                  Squirrel  gttttat--a------tagt---agcatgtgggcacagctaa
       Lesser Egyptian jerboa  gttttca--t------cagt---agcatgtcggcacagctaa
                 Prairie vole  -----------------------tacatacagacacagctaa
B D                     Mouse  -----------------------tgcatacaggcacggttaa
B D                       Rat  -----------------------tgcatacaagcacagctaa
B D            Naked mole-rat  actttat--a------caat---agcatgtgggcacagttaa
B D                Guinea pig  gctttct--a------cacc---agcatagggg--cagttaa
                   Chinchilla  gctttat--t------taat---actgtgtgggcacagttaa
             Brush-tailed rat  gttttac--a------taat---agcatgtgggcacagttaa
B D                    Rabbit  gttttat--g------tggt---agcatgtgggtatagctaa
B D                      Pika  gtttgat--g------cagtctgagcatgtgggtacagctaa
B D                       Pig  gttatat--a------gagt---agcctgtgggcacagctaa
B D                    Alpaca  agtacac--a------gact---agcctgtgagcatagctaa
               Bactrian camel  agtacac--a------gact---agcctgtgagcatagctaa
B D                   Dolphin  gttatac--a------gagt---agcctgtgggcacagctaa
                 Killer whale  gttatac--a------gagt---agcctgtgggcacagctaa
             Tibetan antelope  ggtatat--g------gaac---agcctttgggcacagctaa
B D                       Cow  ggtatat--a------gaac---aggctttgggcacagctaa
B D                     Sheep  ggtatat--g------gaac---agcctttgggcacagctaa
                Domestic goat  ggtatat--g------gaac---agcctttgggcacagctaa
B D                     Horse  gttatat--a------gagt---aattgttaggcacagctaa
B D          White rhinoceros  gttatat--a------gagc---aactgttgggcacaactaa
B D                       Cat  gttatat--a------gagt---ggcatgtgggcacggctaa
B D                       Dog  attatac--a------gaga---aac--gtgggcacagctaa
B D                   Ferret   gttatat--g------gagt---agca-gtgggcacagctaa
B D                     Panda  gttctat--a------gagt---agcatgtgggcacagcaaa
               Pacific walrus  gttatat--a------gagt---agcacatgggcacagctaa
                 Weddell seal  gttatat--a------gagt---agcacgtgggcatagctaa
             Black flying-fox  gttatat--a------gagc---agcatgtgggcacaattca
B D                   Megabat  gttatat--a------gagc---agcatgtgggcacaattca
                Big brown bat  tttatat--a------gagc-----------tgtacacctaa
         David's myotis (bat)  tttatat--a------gagc-----------tgcacgcctaa
B D                  Microbat  tttatat--a------gagc-----------tgcacgcctaa
B D                  Hedgehog  gttatag--a------gagt---agcctggggaaatagataa
B D                     Shrew  tttatac--a------gaga---agcatgtggcacag-ccaa
              Star-nosed mole  gttatat--atttatggaga---ttcacattgaagggactgg
B D                  Elephant  gttatat--a------gagt---agcacatgggtacagctaa
          Cape elephant shrew  tcagcat--g------tagt---ataatgtagggatctctat
B D                   Manatee  gttatat--a------gagt---agcacgtgggcacagctaa
             Cape golden mole  gttatat--a------gagt---agcatgtgggtactgtaat
                     Aardvark  gctatataga------gagt---agcatgtgagagcagctct
B D                 Armadillo  gtaagct--a------tagt---agcaagtgggtacagctaa
              Golden hamster  ==========================================
B D                Coelacanth  ==========================================
B D                    Turkey  ==========================================
B D                   Chicken  ==========================================
  D              Mallard duck  ==========================================
          Tibetan ground jay  ==========================================
B D               Zebra finch  ==========================================
  D    White-throated sparrow  ==========================================
B D           Tasmanian devil  ==========================================
  D            Painted turtle  ==========================================
  D           Green seaturtle  ==========================================
B D        American alligator  ==========================================
  D             Scarlet macaw  ==========================================
B D                Budgerigar  ==========================================
B D                   Opossum  ==========================================
  D               Rock pigeon  ==========================================
  D       Collared flycatcher  ==========================================
B D       Medium ground finch  ==========================================
B D                    Lizard  ==========================================
  D          Peregrine falcon  ==========================================
  D              Saker falcon  ==========================================
  D                    Parrot  ==========================================
B D                   Wallaby  ==========================================
B D           Chinese hamster  ==========================================
B D                    Tenrec  ==========================================
  D  Chinese softshell turtle  ==========================================

Inserts between block 20 and 21 in window
B D                 Elephant 1845bp
         Cape elephant shrew 3bp

Alignment block 21 of 520 in window, 59239189 - 59239200, 12 bps 
B D                     Human  attaca-gtca-t----t
B D                     Chimp  attaca-gtca-t----t
B D                   Gorilla  attaca-gtca-t----t
B D                 Orangutan  attaca-gtca-t----t
B D                    Gibbon  attaca-gtca-t----t
B D                    Rhesus  attata-gtca-t----t
B D       Crab-eating macaque  attata-gtca-t----t
B D                    Baboon  attata-gtca-t----t
B D              Green monkey  attaca-gtca-t----t
B D                  Marmoset  attaca-gtca-t----t
B D           Squirrel monkey  attaca-gtca-t----t
B D                  Bushbaby  attaca-gtgg-t----t
           Chinese tree shrew  attaca-gtca-t----t
B D                  Squirrel  atcaca-ggct-g----t
       Lesser Egyptian jerboa  gtcatt-ctca-t----t
                 Prairie vole  gccgca-gtca-t----t
B D                     Mouse  gccact-gtca-t----g
B D                       Rat  gccact-gtca-tgcaag
B D            Naked mole-rat  gt--ca-ggca-c----t
B D                Guinea pig  gt--ta-gaca-t----t
                   Chinchilla  gtcaca-ggca-t----t
             Brush-tailed rat  gtcaca-tatg-t----t
B D                    Rabbit  atcact-gtcg-t----t
B D                      Pika  atcatt-gttg-g----t
B D                       Pig  atcaca-atca-t----t
B D                    Alpaca  atcaca-gtct-t----t
               Bactrian camel  atcaca-gtct-t----t
B D                   Dolphin  atcaca-gtca-t----t
                 Killer whale  atcaca-gtca-t----t
             Tibetan antelope  atcaca-gtcc-t----t
B D                       Cow  atcaca-atct-t----t
B D                     Sheep  atcaca-gtcc-t----t
                Domestic goat  atcaca-gtcc-t----t
B D                     Horse  atcacc-atca-c----t
B D          White rhinoceros  atcacc-atca-t----t
B D                       Cat  atcacaggtca-t----t
B D                       Dog  atcaca-gtca-t----t
B D                   Ferret   gtcaca-gtca-t----t
B D                     Panda  atcaca-gtca-t----t
               Pacific walrus  atcaca-gtca-t----t
                 Weddell seal  atcaca-gtca-t----t
             Black flying-fox  gtcaca-gtca-t----t
B D                   Megabat  gtcaca-gtca-t----t
                Big brown bat  atcaca-gtca-t----t
         David's myotis (bat)  atcaca-gtca-t----t
B D                  Microbat  atcaca-gtca-t----t
B D                  Hedgehog  ttcatt-cata-t----t
B D                     Shrew  atcacc-atca-t----t
              Star-nosed mole  attatc-aaca-------
B D                  Elephant  ---acg-gtca-t----t
          Cape elephant shrew  ---atg-gtag-t----t
B D                   Manatee  atcata-gtca-t----t
             Cape golden mole  accaca-gtcatt----t
B D                    Tenrec  attgta-atca-t----t
                     Aardvark  atcata-gtta-t----t
B D                 Armadillo  -------atca-t----t
              Golden hamster  ==================
B D                Coelacanth  ==================
B D                    Turkey  ==================
B D                   Chicken  ==================
  D              Mallard duck  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ==================
  D    White-throated sparrow  ==================
B D           Tasmanian devil  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
B D        American alligator  ==================
  D             Scarlet macaw  ==================
B D                Budgerigar  ==================
B D                   Opossum  ==================
  D               Rock pigeon  ==================
  D       Collared flycatcher  ==================
B D       Medium ground finch  ==================
B D                    Lizard  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D                    Parrot  ==================
B D                   Wallaby  ==================
B D           Chinese hamster  ==================
  D  Chinese softshell turtle  ==================

Inserts between block 21 and 22 in window
B D                 Elephant 3bp
         Cape elephant shrew 3bp
B D                  Manatee 1833bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
                    Aardvark 3bp

Alignment block 22 of 520 in window, 59239201 - 59239214, 14 bps 
B D                     Human  gaaagggcag---gg---cg
B D                     Chimp  gaaagggcag---gg---cg
B D                   Gorilla  gaaagggcag---gg---cg
B D                 Orangutan  gaaagggcag---gg---cg
B D                    Gibbon  gaaagggcag---gg---cg
B D                    Rhesus  gaaagggcag---gg---cg
B D       Crab-eating macaque  gaaagggcag---gg---cg
B D                    Baboon  gaaagggcag---gg---cg
B D              Green monkey  gaaagggcag---gg---cg
B D                  Marmoset  gaaa-ggcag---gg---ca
B D           Squirrel monkey  gaaa-ggcag---ga---ca
B D                  Bushbaby  gaaagggcag---gg---tc
           Chinese tree shrew  gaaaggacag---gg---tc
B D                  Squirrel  gaaagggcag---gg---tc
       Lesser Egyptian jerboa  gagatggcag---ag---tc
                 Prairie vole  gttagggcagtaagg---tc
B D                     Mouse  gggaaggcgataagg---tc
B D                       Rat  gggagggcagtaggg---ac
B D            Naked mole-rat  gaaaaggcaa---ga---tc
B D                Guinea pig  gaaagggcaa---gg---tc
                   Chinchilla  gaaagggcga---ta---tc
             Brush-tailed rat  gaaagggcaa---ag---tc
B D                    Rabbit  ga-agggcag---gg---tc
B D                      Pika  ga-aggacag---ga---tc
B D                       Pig  ggaaggacag---ga---tc
B D                    Alpaca  ggaagggcag---gg---tt
               Bactrian camel  ggaagcacag---gg---tt
B D                   Dolphin  ggaagggcag---gg---tt
                 Killer whale  ggaagggcag---gt---tt
             Tibetan antelope  ggaagggcaa---tg---tt
B D                       Cow  ggaagggcag---tg---tt
B D                     Sheep  cgaagggcag---tg---tt
                Domestic goat  ggaagggcag---tg---tt
B D                     Horse  gaaagggcag---ct---tc
B D          White rhinoceros  gaaagggcaa---gc---tc
B D                       Cat  ggaaggacag---ggtcatc
B D                       Dog  ggaaggacag---tt---tc
B D                   Ferret   gggaagacag---gt---tc
B D                     Panda  gggaggaaaa---gt---tt
               Pacific walrus  ggaaagacag---gt---tc
                 Weddell seal  ggaaggacag---gt---tc
             Black flying-fox  ggaaaggtag---gg---gc
B D                   Megabat  ggaaaggtag---gg---gc
                Big brown bat  ggaaggagag---ag---tc
         David's myotis (bat)  ggaaggggag---ag---tc
B D                  Microbat  ggaaggggag---ag---tc
B D                  Hedgehog  gaaagagcag---gg---t-
B D                     Shrew  ggaagggtag----------
B D                  Elephant  gaaaggggag---gg---tc
          Cape elephant shrew  taaaggtg-g---gg---tc
B D                   Manatee  gaaagcggag---gg---tc
             Cape golden mole  gaaagacgaa---gg---tc
B D                    Tenrec  gaaagaggag---gg---cc
                     Aardvark  gaaaggggag---gg---tc
B D                 Armadillo  -gaaagggag---gg---tc
              Golden hamster  ====================
B D                Coelacanth  ====================
B D                    Turkey  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
          Tibetan ground jay  ====================
B D               Zebra finch  ====================
  D    White-throated sparrow  ====================
B D           Tasmanian devil  ====================
  D            Painted turtle  ====================
  D           Green seaturtle  ====================
B D        American alligator  ====================
  D             Scarlet macaw  ====================
B D                Budgerigar  ====================
B D                   Opossum  ====================
  D               Rock pigeon  ====================
  D       Collared flycatcher  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D                    Parrot  ====================
B D                   Wallaby  ====================
B D           Chinese hamster  ====================
  D  Chinese softshell turtle  ====================
             Star-nosed mole  --------------------

Inserts between block 22 and 23 in window
B D                Armadillo 2758bp

Alignment block 23 of 520 in window, 59239215 - 59239250, 36 bps 
B D                     Human  accaatagagttgcttaaattcact----gggatagg-tca
B D                     Chimp  accaatagagttgcttaaattcact----gggatagg-tca
B D                   Gorilla  accaatagagttgcttaaattcact----gggatagg-tca
B D                 Orangutan  accaatagagttgcttaaattcact----gggatagg-tca
B D                    Gibbon  accaacagagttgctcaaattcact----gggatagg-tca
B D                    Rhesus  accaacagagttgcttaaattcact----gggatggg-tca
B D       Crab-eating macaque  accaacagagttgcttaaattcact----gggatggg-tca
B D                    Baboon  accaacagagttgcttaaattcact----gggatggg-tca
B D              Green monkey  accaacagagttgcttaaattcact----gggatagg-tca
B D                  Marmoset  accaacagagttgcttaaattccct----aggat-ga-tca
B D           Squirrel monkey  accaacaaagttgcttaaattccct----gggat-gg-tca
B D                  Bushbaby  accaac--agctgtttcaatttgct----ggaatgga-tca
           Chinese tree shrew  accaacagaattgcttaaattcact----ggaatgaa-tca
B D                  Squirrel  accagtacagttggttaaattcatg----tgcatggaatta
       Lesser Egyptian jerboa  attaacaaagtcaccataactcaca----ggagtggc-tta
                 Prairie vole  atcaacagagttg-tgtgg--------------tggg---a
B D                     Mouse  atcaacagagctgctgtga--------------tggg-tta
B D                       Rat  atcaacagagttgctgtga--------------tggg-cta
B D            Naked mole-rat  accaacacagttgcttacatccatg----agaatgta-tta
B D                Guinea pig  accaacagagctgcttaactttgtg----agaatgca-tta
                   Chinchilla  accaacagagctgtttaactttgcg----agaatgga-taa
             Brush-tailed rat  actaacagagctgcttaacttcttg----agaatgga-tga
B D                    Rabbit  tc---tagagttgcttaagttcact----gaaatg-a-tca
B D                      Pika  ac---cagaattactgaagttcaat----agcatg-a-tca
B D                       Pig  accaacagagttgcttaaattcac---------cata-tct
B D                    Alpaca  accaacagagttccttaaattcact----ggggtgga-tca
               Bactrian camel  accaacagagttgcttaaattcact----ggggtgga-tca
B D                   Dolphin  accaacagagttgcttaaattcact----gaggtgga-tca
                 Killer whale  accaacagagttgcttaaattcact----gaggtgga-tca
             Tibetan antelope  atcaacagagccacttaaattcact----ggggtgga-tca
B D                       Cow  atcaacagagccacttaaattcact----ggggtgga-tca
B D                     Sheep  atcaacagagccacttaaattcacg----ggggtgga-tca
                Domestic goat  atcaacagagccacttaaattcatg----ggggtgga-tca
B D                     Horse  accagcagagttacttaaattcact----ggagtgga-tc-
B D          White rhinoceros  accagcagagttgcttaaattgcct----ggagtgga-tc-
B D                       Cat  accaccagagtcgtttaaattcact----ggggtgga-tca
B D                       Dog  accacccgagttgtttaaattcact--gaagggtaaa-tca
B D                   Ferret   atcaccagagctgtttaaattcatt--gggcggtgga-tca
B D                     Panda  accaccagagttgtttaaattcattggggggggtgaa-tca
               Pacific walrus  accaccagaaatgtttaaattcctt--ggggggtgga-tca
                 Weddell seal  accaccagaaatgtttaaattcatt--ggggggtgga-tca
             Black flying-fox  -ccaacagaattgcttaaatccact----gtgatgag-tcc
B D                   Megabat  -ccaacagaattgcttaaatccact----gtgatgag-tcc
                Big brown bat  -ccaacag---tgtttaaatccact----gagataaa-ttg
         David's myotis (bat)  -ccaacag---tgtttaaacccgct----gaggtaaa-tta
B D                  Microbat  -ccaacag---tgtttaaacccact----gaggtaaa-tta
B D                  Hedgehog  --------cactgacagagttgttt----aagtttgt-t--
B D                     Shrew  --------aattgcttgcattcact----agggtgca-tca
              Star-nosed mole  --------aagtggcttaatccact----aaattgga-tc-
B D                  Elephant  accaacagaattgcttaaattcact----ggggtgga-tca
          Cape elephant shrew  tccaagagcattgtttaaactcatt----aatgtgta-tca
B D                   Manatee  accaacagagttgcgtaaattcact----ggagtaga-tca
             Cape golden mole  accaacagcattacttaaattcact----tgggtgga-tca
B D                    Tenrec  accaactacattgtttgaatccact-------ataga-cca
                     Aardvark  accaacagtgttgcttaaattcact----gaggttaa-tca
              Golden hamster  =========================================
B D                Coelacanth  =========================================
B D                    Turkey  =========================================
B D                   Chicken  =========================================
  D              Mallard duck  =========================================
          Tibetan ground jay  =========================================
B D               Zebra finch  =========================================
  D    White-throated sparrow  =========================================
B D           Tasmanian devil  =========================================
  D            Painted turtle  =========================================
  D           Green seaturtle  =========================================
B D        American alligator  =========================================
  D             Scarlet macaw  =========================================
B D                Budgerigar  =========================================
B D                   Opossum  =========================================
  D               Rock pigeon  =========================================
  D       Collared flycatcher  =========================================
B D       Medium ground finch  =========================================
B D                    Lizard  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
  D                    Parrot  =========================================
B D                   Wallaby  =========================================
B D           Chinese hamster  =========================================
  D  Chinese softshell turtle  =========================================
B D                 Armadillo  =========================================

Alignment block 24 of 520 in window, 59239251 - 59239292, 42 bps 
B D                     Human  aaaag---gctttattttcctg--atctgc-----catagcttc-cacacaat
B D                     Chimp  gaaag---gctttattttcctg--atctgc-----catagcttc-cacacaat
B D                   Gorilla  gaaag---gctttattttcctg--atctgc-----catagcttc-cacacaat
B D                 Orangutan  gaaag---gctttattttcctg--atctgc-----catagcttc-catacaaa
B D                    Gibbon  gaaag---gctttattttcctg--atctgc-----catagcttc-cacacaat
B D                    Rhesus  gaaag---gctttattttcctg--atctgc-----cacagcttc-cacgtaat
B D       Crab-eating macaque  gaaag---gctttattttcctg--atctgc-----cacagcttc-cacgtaat
B D                    Baboon  gaaag---gctttattttcctg--atctgc-----cacagcttc-cacataat
B D              Green monkey  gaaag---gcttt-ttttcctg--atctgc-----cacagcttc-cacataat
B D                  Marmoset  gaaag---cctttattttcctg--atctgc-----cacaacttc-cacacaat
B D           Squirrel monkey  gaaag---gctttattttcctg--atctgc-----cacagctcc-cacataat
B D                  Bushbaby  aagag---gctttattttcttg--acgtgc-----aacagactc-cacacaat
           Chinese tree shrew  gaaaa---gggttattttcttg--atcttc-----aacagcctt-aacacagc
B D                  Squirrel  taggg---gctttgttttctag--ttttgc-----aacaacctt-gacacaac
       Lesser Egyptian jerboa  gagg----gggatattttcttatttt----------------------tcaat
                 Prairie vole  ggggatttgttttattgtgtta--ta----------------------acagc
B D                     Mouse  gagga---gatgtattttctta--ta----------------------acaac
B D                       Rat  gagga---gatgaactttctta--ta----------------------acaac
B D            Naked mole-rat  cagag---tccttatcttcttg--ctttgc-----aacaactttaaatgcatc
B D                Guinea pig  caggg---cctttaactttttg--ttttgc-----aacaaccct-aatacaac
                   Chinchilla  cagag---gctttatcttcttg--ttttgc-----aaacacctt-aatacaac
             Brush-tailed rat  cagag---gctttctctttttg--ttttgc-----aacaacctt-attataac
B D                    Rabbit  c-------ttttttttttcttg--atctgc-----aacagtctc-agtaaaac
B D                      Pika  c-----------ttttcccttg--atctgc-----aacaacttc-agtgcagc
B D                       Pig  gagag---gctttatcttctca--atctgtatcaacacaatctt-gacaccac
B D                    Alpaca  gagag---gctttattttcttg--atctgtatcaacacaatctc-aacacaac
               Bactrian camel  gagag---gctttattttcttg--atctgtatcaacacaatctc-aacacaac
B D                   Dolphin  gagag---gctttattttcttg--atctgttacagcacaacctc-aacacaac
                 Killer whale  gagag---gctttattttcttg--atctgttacagcacaacctc-aacataac
             Tibetan antelope  gagac---attttatttttctg--atctatatcaatatattctc-aacacaac
B D                       Cow  gagat---gttttatttttctg--atctatatcaatataatctc-aacacaac
B D                     Sheep  gagac---gttttatttttctg--atctatatcaatatattctc-aacacaac
                Domestic goat  gagac---gttttatttttctg--atctatatcaatatattctc-aacacaac
B D                     Horse  -agag---gctttattttcctg--atctgtgtcaacacaatctc-gacacaac
B D          White rhinoceros  -agag---gctttattttctt---atctacatcaacaaaatcgc-aacacaac
B D                       Cat  gagag---gctttattttcttc--atctgcatcaacacaatccc-aacacaac
B D                       Dog  aagag---gctttattttcttc--atctggatcaacacaaatcc-aacacaac
B D                   Ferret   gagag---cctttatgttcttc--atctgcatcaacagaatccc-aatacaac
B D                     Panda  gagag---gctttattttcttc--atctgcatcaacacaatctc-aatacaac
               Pacific walrus  gagag---gctttattttcttc--atctgcatcaacacaatccc-aatacaac
                 Weddell seal  gagag---gctttattttcttc--atctgcatcaacacaatccc-aatacaac
             Black flying-fox  gagag---gctttatcttcttg--atatgcatcaacacaatctc-gacccaac
B D                   Megabat  gagag---gctttatcttcttg--atatgcatcaacacaatctc-gacccaac
                Big brown bat  gagag---gctttatatttttg--agctgtatcaatacaatctc-agcacaac
         David's myotis (bat)  gagag---gctttatcttcttg--agctgtatcaatacaatctc-agcgcaac
B D                  Microbat  gagag---gctttatcttcttg--agctgtatcaatacaatctc-agcacaac
B D                  Hedgehog  ---gg---gcttgattttcttg--atctacactaacataacagc-aatacaac
B D                     Shrew  taaag---tctttgttttcttt--acctgagtcagtactgcctg-aatacaat
              Star-nosed mole  ---ag---gctttattttgccg--atctgattcaacagaacctg-aacataac
B D                  Elephant  gagag---gctttattttcttg--atctga-----aacaacctc-aatacaac
          Cape elephant shrew  gaaag---attttattttcttg--gactgc-----aacaacttc-aacccaac
B D                   Manatee  gagag---gctttattttcttg--atctgc-----aacaacctc-aatacaac
             Cape golden mole  gagag---gccttattttctta--atctgc-----aacattctc-agcacaac
B D                    Tenrec  gagag---actgtatggtcttg--accttt-----aacagctcc-ag------
                     Aardvark  gagag---gctttgttttctcg--gtttgc-----aacaacctc-aacacaac
B D                Budgerigar  aaaac---gtttgatgttccaa--accccc-----catagcctc-catatgat
              Golden hamster  =====================================================
B D                Coelacanth  =====================================================
B D                    Turkey  =====================================================
B D                   Chicken  =====================================================
  D              Mallard duck  =====================================================
          Tibetan ground jay  =====================================================
B D               Zebra finch  =====================================================
  D    White-throated sparrow  =====================================================
B D           Tasmanian devil  =====================================================
  D            Painted turtle  =====================================================
  D           Green seaturtle  =====================================================
B D        American alligator  =====================================================
  D             Scarlet macaw  =====================================================
B D                   Opossum  =====================================================
  D               Rock pigeon  =====================================================
  D       Collared flycatcher  =====================================================
B D       Medium ground finch  =====================================================
B D                    Lizard  =====================================================
  D          Peregrine falcon  =====================================================
  D              Saker falcon  =====================================================
  D                    Parrot  =====================================================
B D                   Wallaby  =====================================================
B D           Chinese hamster  =====================================================
  D  Chinese softshell turtle  =====================================================
B D                 Armadillo  =====================================================

Inserts between block 24 and 25 in window
B D               Budgerigar 1571bp

Alignment block 25 of 520 in window, 59239293 - 59239378, 86 bps 
B D                     Human  tttca----g-aag--gaaaaacaagcaaata----atgt-aagaaca----------------------
B D                     Chimp  tttca----g-aag--gaaaaacaagcaaata----atgt-aagaaca----------------------
B D                   Gorilla  tttca----g-aag--gaaaaacaagcaaata----atgt-aagaaca----------------------
B D                 Orangutan  tttca----g-aag--gaaaaacaagcgaata----atgt-aagaaca----------------------
B D                    Gibbon  tttca----g-aag--gaaaaacaggcaaata----atgt-aagaaca----------------------
B D                    Rhesus  tttca----g-aag--gaaaaacaagctaata----atgt-aagaaca----------------------
B D       Crab-eating macaque  tttca----g-aag--gaaaaacaagctaata----atgt-aagaaca----------------------
B D                    Baboon  tttca----g-aag--gaaaaacaagcgaata----atgt-aagaaca----------------------
B D              Green monkey  tttca----g-aag--gaaaaacaagtgaata----atgt-aagaaca----------------------
B D                  Marmoset  tttca----g-gag--gaaaaacaaggaagta----atgt-aagagca----------------------
B D           Squirrel monkey  tttca----g-gag--gaaaaccaagcaagta----atgt-aagaaca----------------------
B D                  Bushbaby  cttca----g-gag--gaaaaacaag------------gt-aagagcg----------------------
           Chinese tree shrew  cttca----g-aag--aaaaaacaagcaaaca----atgc-tagacta----------------------
B D                  Squirrel  cttca----g-aagaaaaaaaataagcaaatg----atga-aagaaca----------------------
       Lesser Egyptian jerboa  atccaaggga-aaa--aagaaataagcaaatg----atgt-aagaagag---------------------
                 Prairie vole  attca----g-aat--aaaacataagcatatg----atg--aaggata----------------------
B D                     Mouse  attca----g-aat--aaaatataagaaatga----atgtaaaaaatac---------------------
B D                       Rat  attca----g-aag--aaaatataagcaaata----atgt-aaaaatac---------------------
B D            Naked mole-rat  cttca----g-aag--aaaaatcaaacaaatg----atgt-aagaaaa----------------------
B D                Guinea pig  cttca----g-aag--aaaaatcaagccaaca----atgt-aagagca----------------------
                   Chinchilla  cttca----gaaag--aaaaatcaggcaaact----atgt-aagaaca----------------------
             Brush-tailed rat  cttca----g-aag--aaaaatcaggcaaatg----atgt-aagaaca----------------------
B D                    Rabbit  ctttg----g-aag--gaaaaataagcaaaga----atat-aagaaca----------------------
B D                      Pika  ctttg----g-aag--gaaaaataagcaaacc----atgt-aagaaca----------------------
B D                       Pig  cctca----g-aaa--gcgaaacaatgtaa-g----atgt-aagaata----------------------
B D                    Alpaca  cctca----g-aaa--gcaaaacaatgtaa-g----atgt-aagaatg----------------------
               Bactrian camel  cctca----g-aaa--gcaaaacaatgtaa-a----atgt-aagaatg----------------------
B D                   Dolphin  cctca----g-aaa--acaaaacaatgcaa-g----atgt-aagaata----------------------
                 Killer whale  cctca----g-aaa--acaaaacaatgcaa-g----atgt-aagaata----------------------
             Tibetan antelope  tctca----g-aag--gcaaaacaatgtaa-g----atgt-aagaatc----------------------
B D                       Cow  tctca----g-aag--gcaaaacaatgtaa-g----atgt-aagaatt----------------------
B D                     Sheep  tctca----g-aag--gcaaaacaatgtaa-g----atgt-aagaatc----------------------
                Domestic goat  tctca----g-aag--gcaaaacaatgtaa-g----atgt-aagaatt----------------------
B D                     Horse  cctca----g-aag--gaaaaatagtgcaa-g----atgt-aagagta----------------------
B D          White rhinoceros  cctca----g-tat--gaaaaacaatgtaa-g----gtgt-aagaata----------------------
B D                       Cat  cctca----g-aag--gaaaaacaatgtga-g----atgt-aagatta----------------------
B D                       Dog  cctta----g-aag--gaaaaacaatgtaa-g----atgt-aagaata----------------------
B D                   Ferret   cctta----g-aag--gaaaaacaatgtaa-t----atgt-aagaata----------------------
B D                     Panda  cc----------------aaaacaatgtaa-g----atgt-aagacta----------------------
               Pacific walrus  cctca----g-aag--gaaaaacaatgtaa-g----atgt-aagaata----------------------
                 Weddell seal  cctca----g-aag--gaaaaacaatgtaa-g----atgc-aagaata----------------------
             Black flying-fox  cctca----g---g--gaaaagaaatgtaa-g----atgt-aggaata----------------------
B D                   Megabat  cctca----g---g--gaaaagaaatgtaa-g----atgt-aggaata----------------------
                Big brown bat  cctca----g-aag--gaaaaacaaagtaa-g----atgt-aagaatg----------------------
         David's myotis (bat)  cctca----g-aag--gaaaaacaatgtaa-g----a---------------------------------
B D                  Microbat  cctcg----g-aag--gaaaaacaatgtaa-g----atgt-aagaatg----------------------
B D                  Hedgehog  tctca----g-aag--gaattcaaacataa-g----atgg-aagaata----------------------
B D                     Shrew  cctca----g-aag--aaaaaatgatgtaa-ataatatgt-aaaaata----------------------
              Star-nosed mole  cctcc----g-aag--gacaaacaatgtca-g----atgt-aagaata----------------------
B D                  Elephant  cctca----g-aag--gaaaaacaggcaaaca----atat-aagaaca----------------------
          Cape elephant shrew  cctca----g-aaa--gaaaatcaggtaaatc----atat-aaaagca----------------------
B D                   Manatee  cctca----g-aag--gaaaaacaggcaaata----atgt-aagaaca----------------------
             Cape golden mole  cctca----g-aaa--caaaatcaaacaaaca----atgg-aaggagt----------------------
B D                    Tenrec  ------------ga--ggaaaacggacaaaca----atgt-aggaggtggcttcacaaagtttgtagaaa
                     Aardvark  cctca----g-aag--aaaaaacaggcacaca----atgt-aaaaaca----------------------
              Golden hamster  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                   Wallaby  ======================================================================
B D           Chinese hamster  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                 Armadillo  ======================================================================

                        Human  -----------------------------------------------------tttcaa-aaggattcag
                        Chimp  -----------------------------------------------------tttcaa-aaggattcag
                      Gorilla  -----------------------------------------------------tttcaa-aaggattcag
                    Orangutan  -----------------------------------------------------tttcaa-aagaattcag
                       Gibbon  ------------------------------------------------------ttcaa-aagggttcag
                       Rhesus  -----------------------------------------------------tttcaa-aaggattcag
          Crab-eating macaque  -----------------------------------------------------tttcaa-aaggattcag
                       Baboon  -----------------------------------------------------tttcaa-aaggattcag
                 Green monkey  -----------------------------------------------------tttcaa-aaggattcgg
                     Marmoset  -----------------------------------------------------tttcaa-aaggattcag
              Squirrel monkey  -----------------------------------------------------tttc----aggattcac
                     Bushbaby  -----------------------------------------------------tgtcgg-aaggactcag
           Chinese tree shrew  -----------------------------------------------------tgtcaa-aaagattcat
                     Squirrel  -----------------------------------------------------tgtaaa-aagatttgag
       Lesser Egyptian jerboa  -----------------------------------------------------ttttaa-gtgactcaaa
                 Prairie vole  -------------------------------------------------------------------cag
                        Mouse  -----------------------------------------------------ttttaa-atgatttcag
                          Rat  -----------------------------------------------------ttttaa-ac-agttcag
               Naked mole-rat  -----------------------------------------------------cattaa-acggattcag
                   Guinea pig  -----------------------------------------------------tcttaa-aaggattcaa
                   Chinchilla  -----------------------------------------------------tcttaa-acggattcag
             Brush-tailed rat  -----------------------------------------------------tctcta-aaagattcag
                       Rabbit  -----------------------------------------------------tgtcaa-aaggatttag
                         Pika  -----------------------------------------------------tgtagc-aaggattcag
                          Pig  -----------------------------------------------------tatcaa-aaggattcga
                       Alpaca  -----------------------------------------------------tgtcaa-aaggattcaa
               Bactrian camel  -----------------------------------------------------tgtcaa-aaggattcaa
                      Dolphin  -----------------------------------------------------cgtcaa-aaggattcaa
                 Killer whale  -----------------------------------------------------cgtcaa-aaggattcaa
             Tibetan antelope  -----------------------------------------------------tgtcaa-agggattcaa
                          Cow  -----------------------------------------------------tgtcaa-agggattcaa
                        Sheep  -----------------------------------------------------tgtcaa-agggattcaa
                Domestic goat  -----------------------------------------------------tgtcaa-agggattcaa
                        Horse  -----------------------------------------------------tgtcaa-aaggattcaa
             White rhinoceros  -----------------------------------------------------tgtcaa-aaggattcaa
                          Cat  -----------------------------------------------------tgtcca-aaggattcaa
                          Dog  -----------------------------------------------------tgtcaa-aaggattcaa
                      Ferret   -----------------------------------------------------tgtcaa-aaggattcaa
                        Panda  -----------------------------------------------------tgtcaa-aaggattcaa
               Pacific walrus  -----------------------------------------------------tgacaa-aaggattcaa
                 Weddell seal  -----------------------------------------------------cgacaa-aaggattcaa
             Black flying-fox  -----------------------------------------------------tgt----aagaatttaa
                      Megabat  -----------------------------------------------------tgt----aagaatttaa
                Big brown bat  -----------------------------------------------------tgt----aagaattcaa
         David's myotis (bat)  -----------------------------------------------------tgt----aagcattcaa
                     Microbat  -----------------------------------------------------tgt----aagcattcaa
                     Hedgehog  -----------------------------------------------------aataaa-taggattcaa
                        Shrew  -----------------------------------------------------tatcaagaaagattcaa
              Star-nosed mole  -----------------------------------------------------tgtcaa-aaggactcaa
                     Elephant  -----------------------------------------------------tgtcaa-aaggaatcag
          Cape elephant shrew  -----------------------------------------------------tattaa-aa--cattag
                      Manatee  -----------------------------------------------------tgtcaa-aagaaatcag
             Cape golden mole  -----------------------------------------------------tatcag-aagaaatcag
                       Tenrec  attccattaattccttttttccatgaactttttgaagctgcctcataggtatataaaaa-aagaaaccaa
                     Aardvark  -----------------------------------------------------ttccaa-aagaaatcag
               Golden hamster  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                      Wallaby  ======================================================================
              Chinese hamster  ======================================================================
     Chinese softshell turtle  ======================================================================
                    Armadillo  ======================================================================

                        Human  tgaccagc-ttgaaagga-----ttt--tcagtggccatgtc
                        Chimp  tggccagc-ttgaaagga-----ttt--tcagtggccatgtc
                      Gorilla  tggccagc-ttgaaagga-----ttt--tcagtggccatgtc
                    Orangutan  tggccagc-ttgaaagga-----ttt--tcagtggccacatc
                       Gibbon  tggccagc-ttgaaagaa-----ttt--tcagtggccacatc
                       Rhesus  tggccagc-ttgaaagga-----ttt--tcaatggccacatc
          Crab-eating macaque  tggccagc-ttgaaagga-----ttt--tcaatggccacatc
                       Baboon  tggccagc-ttgaaagga-----ttt--tcaatggccacatc
                 Green monkey  tggccagc-ttgaaagga-----ttt--tcaatggccacatc
                     Marmoset  tggccagc-ttgaaaggg-----ttt--tcaatggccaagtt
              Squirrel monkey  tggccagc-ttgaaaggg-----ttt--tcaatggccaagtc
                     Bushbaby  gagccaac-ttcaaagag-----ttt--ccaatggccaagtc
           Chinese tree shrew  gagccaac-ttgaaaggg-----ttt--ccaatggccagaca
                     Squirrel  aagccaac-ttgaatggg-----ctt--ccaatggtcaactc
       Lesser Egyptian jerboa  gggctaacatggaaaggc------tt--ctgatgggcaagct
                 Prairie vole  gagtcagc-ttgaaaggg------tt--ccagtggccaggtc
                        Mouse  gagtcaac-ttgaaaggg------tt--ctaatggccatgtc
                          Rat  gagtcaac-ttgaaaggg------tt--ctagtgcccatgtc
               Naked mole-rat  aagccaac-tggaaaggg-----ctt--ccaatggccaagtc
                   Guinea pig  aagccaac-ttgaaagag-----ttt--ccagtggccaagtc
                   Chinchilla  aagccaac-ttgaaaggg-----ctt--ccagtggctaattc
             Brush-tailed rat  aagccaac-ttgaaaggg-----ctg--ccaatggccaagtc
                       Rabbit  aagtcagt-ttgaaaagg-----ctt--ccaatggccaagtc
                         Pika  gagtcaac-ttgaaaagg-----ctt--ccatttgccaagtc
                          Pig  gagtcacc-ttgaaaggg-----ctc--ttgatggtcaagtc
                       Alpaca  gag---------------------------------caaatc
               Bactrian camel  gagctaac-ttgaaaggg-----ctc--cagatgcccaaatc
                      Dolphin  gagacaac-ttgaaatgg-----ctc--cagatggccaagtc
                 Killer whale  gagacaac-ttgaaatgg-----ctc--cagatggccaagtc
             Tibetan antelope  gagccaac-ttgaaatgg-----ctc--cagatggccaagtc
                          Cow  gagccaac-ttgaaatgg-----ctc--cagatggccaagtc
                        Sheep  gagccaac-ttgaaatgg-----ctc--cagatggccaagtc
                Domestic goat  aagcc-ac-ttcaaatgg-----ctc--cagatggccaagtc
                        Horse  gagccaac-tcgaaaagg-----ctc--ccaatggccaagtc
             White rhinoceros  gagccaac-ttgaaaggg-----ctc--ccaatggccaagtc
                          Cat  gagccaac-ttgagaacactgttctc--ttgatagccaaggc
                          Dog  gagccaac-ttgaaagcactgtcctactttgatagcc-agtc
                      Ferret   gagccaac-ttgaaagcactgccctc--ttgatagcc-agtc
                        Panda  gagccaac-ttgaaagcactgtccta--ttgatagcc-agtc
               Pacific walrus  gagccaac-ttgaaagcactgtcctg--ttgatagcc-aatc
                 Weddell seal  gagccaac-ttgaaagcactatcctg--ttgatagcc-agtc
             Black flying-fox  gagccaac-ttgaaaggg-----ctc--ctgatggccaagtc
                      Megabat  gagccaac-ttgaaaggg-----ctc--ctgatggccaagtc
                Big brown bat  gagccaac-ttaaaaggg-----ctc--ctgatgaccaagtc
         David's myotis (bat)  gagccaaa-ttgaaaggg-----ctc--ctgatgaccaagtc
                     Microbat  gggccaac-ttgaaaggg-----ctc--ctgatgaccaagtc
                     Hedgehog  gatacagc-ctgaaagaa-----ccc--ttgataaccaagtc
                        Shrew  gaaacaac-tttatagac-----ct---cagaggaccaagtc
              Star-nosed mole  caaccaac-ctgaaaggg-----ctc--ccgatggccaaatt
                     Elephant  gaaccaac-ttaaaagga-----ctt--ccgatggacaaatc
          Cape elephant shrew  atataaac-ataagagga-----ctt--ctgatggtcaagtg
                      Manatee  aaaccaac-ttaaaagga-----ctt--ctgatagccaagtc
             Cape golden mole  gatccaac-ttaaaataa-----ctt--ctgatggtcaagtc
                       Tenrec  gaaccaaa-ttaaaagga-----cat--ctggtggcctagtc
                     Aardvark  gaaccaac-ttaaaagga-----ctc--ctgatggccgtgcc
               Golden hamster  ==========================================
                   Coelacanth  ==========================================
                       Turkey  ==========================================
                      Chicken  ==========================================
                 Mallard duck  ==========================================
           Tibetan ground jay  ==========================================
                  Zebra finch  ==========================================
       White-throated sparrow  ==========================================
              Tasmanian devil  ==========================================
               Painted turtle  ==========================================
              Green seaturtle  ==========================================
           American alligator  ==========================================
                Scarlet macaw  ==========================================
                   Budgerigar  ==========================================
                      Opossum  ==========================================
                  Rock pigeon  ==========================================
          Collared flycatcher  ==========================================
          Medium ground finch  ==========================================
                       Lizard  ==========================================
             Peregrine falcon  ==========================================
                 Saker falcon  ==========================================
                       Parrot  ==========================================
                      Wallaby  ==========================================
              Chinese hamster  ==========================================
     Chinese softshell turtle  ==========================================
                    Armadillo  ==========================================

Inserts between block 25 and 26 in window
            Cape golden mole 8191bp

Alignment block 26 of 520 in window, 59239379 - 59239405, 27 bps 
B D                     Human  tagc-------gtaa-gttagctac-aaaa-tcgtga
B D                     Chimp  tagc-------gtaatgttagccac-aaaa-tcgtga
B D                   Gorilla  tagg-------gtaatgttagccac-aaaa-tcgtga
B D                 Orangutan  tagg-------gtaatgttagccac-aaaa-tcgtga
B D                    Gibbon  tagg-------gtaatgttagccac-aaaa-tcatga
B D                    Rhesus  tagg-------gtaatgttagccac-aaaa-tcgtga
B D       Crab-eating macaque  tagg-------gtaatgttagccac-aaaa-tcgtga
B D                    Baboon  tagg-------gtaatgttagccac-aaaa-tcgtga
B D              Green monkey  tagg-------gtaatgttagccac-aaaa-tcgtga
B D                  Marmoset  taga-------gtaatgttagccac-aaaa-tcatga
B D           Squirrel monkey  tagg-------gtaatgttagccac-aaaa-tcgtga
B D                  Bushbaby  tgag-------ataacgttaaccat-aaaa-tagtgg
           Chinese tree shrew  caggaggaccagccatgttagccac-aaaa-tagaga
B D                  Squirrel  taga-------ataatgttaaccat-aaat-taatga
       Lesser Egyptian jerboa  tagg-------aaggtaatagccac-aaaa-tagtgg
                 Prairie vole  taaa-------agagtgttagccat-ggag-taatga
B D                     Mouse  taga-------atagggttagccac-cgag-cagtaa
B D                       Rat  taga-------ataatgttacccac-caag-tagtga
B D            Naked mole-rat  tggg-------atattgttagccac-aaaa-tagtga
B D                Guinea pig  tggg-------atattgttagccac-ataa-cagtga
                   Chinchilla  tggg-------aaactgttagccac-acaa-aagtga
             Brush-tailed rat  tgag-------atattgttagccac-acag-cagtaa
B D                    Rabbit  tagg-------attactttatccat-aaaa-cagtga
B D                      Pika  tagg-------ataacgtgatccat-aaaa-tagtga
B D                       Pig  tagg-------atcatgttaaccgcaaaaa-cagtgg
B D                    Alpaca  ttga-------ataatgttagccac-aaaa-tagtga
               Bactrian camel  ttga-------ataatgttagccac-aaaa-tagtga
B D                   Dolphin  tagg-------atgatgttagccac-aaaa-gagtga
                 Killer whale  tagg-------atgatgttagccac-aaaa-gagtga
             Tibetan antelope  tggg-------ataatgttagccac-aaaa-tagtga
B D                       Cow  tggg-------ataatgttagccac-aaaa-tagtga
B D                     Sheep  tggg-------ataatgttagccac-aaaa-tagtga
                Domestic goat  tggg-------ataatgttagccac-aaaa-tagtga
B D                     Horse  tagg-------ataatgttaaccac-aaaa-tagtaa
B D          White rhinoceros  taga-------acaatgttaaccac-aaaa-tagtaa
B D                       Cat  tagg-------ataatattagccac-aaaa-cagtaa
B D                       Dog  taag-------ataatgttagccac-aaaa-tagtaa
B D                   Ferret   tagg-------ataatgttagc---------------
B D                     Panda  tagg-------ataatgttagc---------------
               Pacific walrus  tagg-------ataatgttagc---------------
                 Weddell seal  tagg-------ataatgttagc---------------
             Black flying-fox  tggg-------ataacatcagctat--aaa-tagtaa
B D                   Megabat  tggg-------ataacatccgctat--aaa-tagtaa
                Big brown bat  tagc-------ataacgttagccac---aa-tagtga
         David's myotis (bat)  tagc-------ataaggttagccat---aa-tagttg
B D                  Microbat  tagc-------ataaggttagccac---aa-tagtga
B D                  Hedgehog  tagg-------ataatgttagctcc-aagg-tagtaa
B D                     Shrew  tagg-------at---attaaccac-aatg--aatga
              Star-nosed mole  tagg-------accaagttagtcac-aagaataatga
B D                  Elephant  gagg-------ataaatttaattac-aaag-tagtga
          Cape elephant shrew  tagg-------attattttcattac-aaaa-tagtgg
B D                   Manatee  tagg-------ataatttttgttac-aaag-tagtga
B D                    Tenrec  taag-------ataatgttaattac-aaaa-tagtaa
                     Aardvark  tagg-------ataatt----ttac-aaaa-cagtga
              Golden hamster  =====================================
            Cape golden mole  =====================================
B D                Coelacanth  =====================================
B D                    Turkey  =====================================
B D                   Chicken  =====================================
  D              Mallard duck  =====================================
          Tibetan ground jay  =====================================
B D               Zebra finch  =====================================
  D    White-throated sparrow  =====================================
B D           Tasmanian devil  =====================================
  D            Painted turtle  =====================================
  D           Green seaturtle  =====================================
B D        American alligator  =====================================
  D             Scarlet macaw  =====================================
B D                Budgerigar  =====================================
B D                   Opossum  =====================================
  D               Rock pigeon  =====================================
  D       Collared flycatcher  =====================================
B D       Medium ground finch  =====================================
B D                    Lizard  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
  D                    Parrot  =====================================
B D                   Wallaby  =====================================
B D           Chinese hamster  =====================================
  D  Chinese softshell turtle  =====================================
B D                 Armadillo  =====================================

Inserts between block 26 and 27 in window
            Brush-tailed rat 30bp

Alignment block 27 of 520 in window, 59239406 - 59239409, 4 bps 
B D                     Human  atat
B D                     Chimp  atat
B D                   Gorilla  atat
B D                 Orangutan  atat
B D                    Gibbon  atat
B D                    Rhesus  atat
B D       Crab-eating macaque  atat
B D                    Baboon  atat
B D              Green monkey  atat
B D                  Marmoset  atat
B D           Squirrel monkey  atat
B D                  Bushbaby  atgt
           Chinese tree shrew  atgt
B D                  Squirrel  atgt
       Lesser Egyptian jerboa  atgt
                 Prairie vole  aagt
B D                       Rat  gagt
B D            Naked mole-rat  ttat
B D                Guinea pig  cagc
                   Chinchilla  ctgt
B D                    Rabbit  -agg
B D                      Pika  -aag
B D                       Pig  atgc
B D                    Alpaca  atgt
               Bactrian camel  atgt
B D                   Dolphin  atgt
                 Killer whale  atgt
             Tibetan antelope  atgt
B D                       Cow  atgt
B D                     Sheep  atgt
                Domestic goat  atgt
B D                     Horse  atgt
B D          White rhinoceros  atgc
B D                       Cat  atgc
B D                       Dog  atgc
B D                   Ferret   -tgt
B D                     Panda  -tgc
               Pacific walrus  -tgc
                 Weddell seal  -tgc
             Black flying-fox  atgt
B D                   Megabat  atgt
                Big brown bat  ctgt
         David's myotis (bat)  ctgt
B D                  Microbat  ctgt
B D                  Hedgehog  atat
B D                     Shrew  ctgt
              Star-nosed mole  atat
B D                  Elephant  atgt
          Cape elephant shrew  atgc
B D                   Manatee  atgt
B D                    Tenrec  atgc
                     Aardvark  atgt
              Golden hamster  ====
B D                     Mouse  ----
            Cape golden mole  ====
B D                Coelacanth  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
            Brush-tailed rat  ====
B D                   Wallaby  ====
B D           Chinese hamster  ====
  D  Chinese softshell turtle  ====
B D                 Armadillo  ====

Inserts between block 27 and 28 in window
                Prairie vole 55bp
B D                   Rabbit 2bp
B D                     Pika 1bp

Alignment block 28 of 520 in window, 59239410 - 59239410, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  t
B D                  Bushbaby  a
           Chinese tree shrew  t
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
B D                    Tenrec  a
                     Aardvark  a
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  -
B D                     Shrew  -
            Cape golden mole  =
B D                Coelacanth  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
B D                   Wallaby  =
B D           Chinese hamster  =
  D  Chinese softshell turtle  =
B D                 Armadillo  =

Inserts between block 28 and 29 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
B D                      Rat 30bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp

Alignment block 29 of 520 in window, 59239411 - 59239418, 8 bps 
B D                     Human  a-aaattat
B D                     Chimp  a-aaattat
B D                   Gorilla  a-aaattat
B D                 Orangutan  a-aaattat
B D                    Gibbon  a-aatttat
B D                    Rhesus  a-aaattat
B D       Crab-eating macaque  a-aaattat
B D                    Baboon  a-aaattat
B D              Green monkey  a-aaattac
B D                  Marmoset  a-aaattgt
B D           Squirrel monkey  a-aaattgt
B D                  Bushbaby  ataaattgt
           Chinese tree shrew  acaaattat
B D                  Squirrel  -taagttat
       Lesser Egyptian jerboa  -taagttat
B D            Naked mole-rat  -taagctat
B D                Guinea pig  -taagctat
                   Chinchilla  -taagctat
B D                    Rabbit  -taagttgc
B D                      Pika  -taacttgg
B D                       Pig  gaaaattgt
B D                    Alpaca  ataaactgt
               Bactrian camel  attaactgt
B D                   Dolphin  ataaattgt
                 Killer whale  ataaattgt
             Tibetan antelope  acagatgat
B D                       Cow  atagatgat
B D                     Sheep  atagatgat
                Domestic goat  atagatgat
B D                     Horse  ataaattgt
B D          White rhinoceros  ataaattgt
B D                       Cat  atagattgc
B D                       Dog  atagattgc
B D                   Ferret   atatgttgc
B D                     Panda  ataggttgt
               Pacific walrus  atagattgt
                 Weddell seal  atagattgt
             Black flying-fox  ataaattgt
B D                   Megabat  ataaattgt
                Big brown bat  ataaattgt
         David's myotis (bat)  ataaattgt
B D                  Microbat  ataaattgt
B D                  Hedgehog  atgtattgt
B D                     Shrew  ---aatttc
              Star-nosed mole  acaaactgg
B D                  Elephant  ataaattat
          Cape elephant shrew  ataaaatat
B D                   Manatee  ataaattat
B D                    Tenrec  ataaattat
                     Aardvark  ataaatcat
B D                       Rat  =========
                Prairie vole  =========
              Golden hamster  =========
B D                     Mouse  ---------
            Cape golden mole  =========
B D                Coelacanth  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D              Mallard duck  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
  D    White-throated sparrow  =========
B D           Tasmanian devil  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D        American alligator  =========
  D             Scarlet macaw  =========
B D                Budgerigar  =========
B D                   Opossum  =========
  D               Rock pigeon  =========
  D       Collared flycatcher  =========
B D       Medium ground finch  =========
B D                    Lizard  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D                    Parrot  =========
            Brush-tailed rat  =========
B D                   Wallaby  =========
B D           Chinese hamster  =========
  D  Chinese softshell turtle  =========
B D                 Armadillo  =========

Alignment block 30 of 520 in window, 59239419 - 59239428, 10 bps 
B D                     Human  aatcagacac
B D                     Chimp  aatcagacac
B D                   Gorilla  aatcagacac
B D                 Orangutan  aatcagacac
B D                    Gibbon  aatcagacac
B D                    Rhesus  aatcagacac
B D       Crab-eating macaque  aatcagacac
B D                    Baboon  aatcagacac
B D              Green monkey  aatcagacac
B D                  Marmoset  aaacagacac
B D           Squirrel monkey  aatcagacac
B D                  Bushbaby  attcaaatac
           Chinese tree shrew  aaccaaagat
B D                  Squirrel  aaccaaagac
B D            Naked mole-rat  caccaaagat
B D                Guinea pig  caccaaagac
                   Chinchilla  caccaaagac
B D                    Rabbit  -----aa---
B D                      Pika  -----aa---
B D                       Pig  aaccaaaggc
B D                    Alpaca  aacaaaagac
               Bactrian camel  aacaaaagac
B D                   Dolphin  aacaaaagac
                 Killer whale  aacaaaagac
             Tibetan antelope  aatcaaagac
B D                       Cow  aaccaaagac
B D                     Sheep  aatcaaagac
                Domestic goat  aatcaaagac
B D                     Horse  aaccaaagac
B D          White rhinoceros  aaccaaagac
B D                       Cat  aaccaaagac
B D                       Dog  aactgaagac
B D                   Ferret   aaccaaagac
B D                     Panda  aaccaaa-at
               Pacific walrus  aaccaaagac
                 Weddell seal  aacaaaaaac
             Black flying-fox  aaccaaaaac
B D                   Megabat  aaccaaaaac
                Big brown bat  aaccaaagag
         David's myotis (bat)  aaccagagag
B D                  Microbat  aaccagagag
B D                  Hedgehog  atccaaagat
B D                     Shrew  aattaataac
              Star-nosed mole  aatcaaagac
B D                  Elephant  aaccatagac
          Cape elephant shrew  aaccaaagac
B D                   Manatee  aaccatagac
B D                    Tenrec  aaaaatagac
                     Aardvark  aaccatagaa
B D                       Rat  ==========
                Prairie vole  ==========
              Golden hamster  ==========
B D                     Mouse  ----------
      Lesser Egyptian jerboa  ----------
            Cape golden mole  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
B D                   Chicken  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ==========
  D    White-throated sparrow  ==========
B D           Tasmanian devil  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D        American alligator  ==========
  D             Scarlet macaw  ==========
B D                Budgerigar  ==========
B D                   Opossum  ==========
  D               Rock pigeon  ==========
  D       Collared flycatcher  ==========
B D       Medium ground finch  ==========
B D                    Lizard  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D                    Parrot  ==========
            Brush-tailed rat  ==========
B D                   Wallaby  ==========
B D           Chinese hamster  ==========
  D  Chinese softshell turtle  ==========
B D                 Armadillo  ==========

Alignment block 31 of 520 in window, 59239429 - 59239430, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D                  Marmoset  ta
B D           Squirrel monkey  ta
B D                  Bushbaby  ta
           Chinese tree shrew  ta
B D                  Squirrel  ta
B D            Naked mole-rat  ta
B D                Guinea pig  ta
B D                    Rabbit  ca
B D                      Pika  ca
B D                       Pig  aa
B D                    Alpaca  ta
               Bactrian camel  ta
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  aa
B D          White rhinoceros  aa
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   tg
B D                     Panda  ta
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  ta
B D                   Megabat  ta
                Big brown bat  ta
         David's myotis (bat)  ta
B D                  Microbat  tt
B D                  Hedgehog  aa
B D                     Shrew  ta
              Star-nosed mole  ta
B D                  Elephant  ca
          Cape elephant shrew  ca
B D                   Manatee  ga
B D                    Tenrec  ca
                     Aardvark  ca
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  --
      Lesser Egyptian jerboa  --
            Cape golden mole  ==
B D                Coelacanth  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  --
B D                   Wallaby  ==
B D           Chinese hamster  ==
  D  Chinese softshell turtle  ==
B D                 Armadillo  ==

Alignment block 32 of 520 in window, 59239431 - 59239432, 2 bps 
B D                     Human  a------------a
B D                     Chimp  a------------a
B D                   Gorilla  a------------a
B D                 Orangutan  a------------a
B D                    Rhesus  a------------a
B D       Crab-eating macaque  a------------a
B D              Green monkey  a------------a
B D                  Marmoset  a------------a
B D                  Bushbaby  c------------a
           Chinese tree shrew  a------------a
B D            Naked mole-rat  a------------a
B D                Guinea pig  a------------a
B D                    Rabbit  -------------a
B D                      Pika  -------------a
B D                       Pig  a------------a
B D                    Alpaca  a------------a
               Bactrian camel  a------------a
B D                   Dolphin  a------------a
                 Killer whale  a------------a
             Tibetan antelope  a------------a
B D                       Cow  a------------a
B D                     Sheep  c------------a
                Domestic goat  c------------a
B D                     Horse  a------------a
B D          White rhinoceros  a------------a
B D                       Cat  a------------a
B D                       Dog  a------------a
B D                   Ferret   a------------a
B D                     Panda  a------------a
               Pacific walrus  a------------a
                 Weddell seal  a------------a
             Black flying-fox  a------------a
B D                   Megabat  a------------a
                Big brown bat  a------------a
         David's myotis (bat)  a------------a
B D                  Microbat  a------------a
B D                  Hedgehog  a-------------
B D                     Shrew  a-------------
              Star-nosed mole  acctgtacctctaa
B D                  Elephant  a------------a
          Cape elephant shrew  a------------a
B D                   Manatee  a------------a
B D                    Tenrec  a------------a
                     Aardvark  a------------a
B D                       Rat  ==============
                Prairie vole  ==============
              Golden hamster  ==============
B D                     Mouse  --------------
      Lesser Egyptian jerboa  --------------
B D                    Baboon  --------------
            Cape golden mole  ==============
B D                Coelacanth  ==============
B D                    Gibbon  --------------
B D                    Turkey  ==============
B D                   Chicken  ==============
  D              Mallard duck  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
  D    White-throated sparrow  ==============
B D           Tasmanian devil  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D        American alligator  ==============
  D             Scarlet macaw  ==============
B D                Budgerigar  ==============
B D                   Opossum  ==============
  D               Rock pigeon  ==============
  D       Collared flycatcher  ==============
B D       Medium ground finch  ==============
B D                    Lizard  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D                    Parrot  ==============
            Brush-tailed rat  ==============
                  Chinchilla  --------------
B D                   Wallaby  ==============
B D           Chinese hamster  ==============
  D  Chinese softshell turtle  ==============
B D                  Squirrel  --------------
B D                 Armadillo  ==============
B D           Squirrel monkey  --------------

Inserts between block 32 and 33 in window
B D                   Rabbit 1bp
B D                     Pika 1bp

Alignment block 33 of 520 in window, 59239433 - 59239436, 4 bps 
B D                     Human  gtta
B D                     Chimp  gtta
B D                   Gorilla  gtta
B D                 Orangutan  gtta
B D                    Gibbon  ---a
B D                    Rhesus  gt-a
B D       Crab-eating macaque  gt-a
B D                    Baboon  ---a
B D              Green monkey  gt-a
B D                  Marmoset  tt-a
B D           Squirrel monkey  ---a
B D                  Bushbaby  at-a
           Chinese tree shrew  tt-a
B D                     Mouse  ---a
B D            Naked mole-rat  ataa
B D                    Rabbit  acta
B D                      Pika  gcta
B D                    Alpaca  gt-a
               Bactrian camel  gt-a
B D                   Dolphin  at-a
                 Killer whale  at-a
             Tibetan antelope  gt-a
B D                       Cow  at-a
B D                     Sheep  gt-a
                Domestic goat  gt-a
B D                     Horse  at-a
B D          White rhinoceros  gt-a
B D                       Cat  at-a
B D                       Dog  at-a
B D                   Ferret   at-a
B D                     Panda  at-a
               Pacific walrus  at-a
                 Weddell seal  at-a
             Black flying-fox  at-a
B D                   Megabat  at-a
                Big brown bat  gt-a
         David's myotis (bat)  gt-a
B D                  Microbat  gt-a
B D                  Hedgehog  at-a
B D                     Shrew  ---a
              Star-nosed mole  at-c
B D                  Elephant  at-a
          Cape elephant shrew  aa-t
B D                   Manatee  at-a
B D                    Tenrec  at-a
                     Aardvark  at-a
B D                       Rat  ====
                Prairie vole  ====
              Golden hamster  ====
      Lesser Egyptian jerboa  ----
B D                Guinea pig  ----
B D                       Pig  ----
            Cape golden mole  ====
B D                Coelacanth  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
  D    White-throated sparrow  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Opossum  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
            Brush-tailed rat  ====
                  Chinchilla  ----
B D                   Wallaby  ====
B D           Chinese hamster  ====
  D  Chinese softshell turtle  ====
B D                  Squirrel  ----
B D                 Armadillo  ====

Alignment block 34 of 520 in window, 59239437 - 59239526, 90 bps 
B D                     Human  agtatctatgagttcata-----------ctgat----------------ataaaggaatac--------
B D                     Chimp  agtatctatgagttcata-----------ctgat----------------ataaaggaataa--------
B D                   Gorilla  agtatctatgagttcata-----------ctgat----------------ataaaggaataa--------
B D                 Orangutan  agtatctatgagttcatg-----------ctgat----------------ataaaggaataa--------
B D                    Gibbon  agtatctatgagttcata-----------ctgat----------------acaaagtaataa--------
B D                    Rhesus  agtatctatgagttcata-----------ctgat----------------ataaatgaataa--------
B D       Crab-eating macaque  agtatctatgagttcata-----------ctgat----------------ataaatgaataa--------
B D                    Baboon  agtatctatgagttcata-----------ctgat----------------ataaatgaataa--------
B D              Green monkey  agtatctatgagttcata-----------ctgat----------------ataaatgaataa--------
B D                  Marmoset  agtatctatgagtttata-----------ctgat----------------ataaatgaataa--------
B D           Squirrel monkey  agtatctatgagtttata-----------ctaat----------------ataaatgaataa--------
B D                  Bushbaby  agtatc--cgagttcata-----------ctgat----------------gtaaatgaatga--------
           Chinese tree shrew  attgtcaatttgttcata-----------ctgac----------------atacatagacgg--------
B D                     Mouse  ----------agtattaa-----------gtcat----------------gtcaaa--------------
B D                    Rabbit  aaaa--aatgagtttgca-----------ctgat----------------ataaatgaatga--------
B D                      Pika  agagacaatgagtttata-----------gtgat----------------acaggtgaatga--------
B D                       Pig  -----taatgagttcata-----------ctgat----------------attaataaatga--------