Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 438 in window, 153495729 - 153495777, 49 bps 
B D                   Human  atta--ccccagtggcccgtgcctca-ccccacgcccaccccatc-----------acctcat
B D                   Chimp  atta--ccccagtggcccgtgcctca-ccccatgcccaccctatc-----------acctcat
B D                 Gorilla  atta--ccccagtggcccgtgcctca-ccccacgcccaccctatc-----------acctcat
B D               Orangutan  atta--ccccagtggcccgtgcctca-ccccacgcccaccccatc-----------acctcat
B D                  Gibbon  atta--ccccagtgccccttgcctca-cccca-gcccaccccatc-----------acctcat
B D                  Rhesus  atta--ccccagtggcctgtgcctca-gcccacactcaccccatc-----------acctcat
B D     Crab-eating macaque  atta--ccccagtggcctgtgcctca-gcccacactcaccccatc-----------acctcat
B D                  Baboon  atta--ccccagtggcctgtgcctca-gcccacactcaccccatc-----------acctcat
B D            Green monkey  atta--ccccagtggcctgtgtctca-gcccacactcaccccatc-----------acctcat
B D                Bushbaby  atcg--ccccagcgtcctaagcctca-cctcacatccaccccatc-----------atttcct
         Chinese tree shrew  acta--tcgcagggtcccatgcccca-ctctacacccacac-atc-----------gcctcct
B D                Squirrel  atta--ccccagtggcctgggcatca-gcccacaggcaccccatg-----------gcctcct
             Golden hamster  attt--ccccagc-atccatgtgtca-tgcaacaacccacacatc-----------acttctg
B D                   Mouse  attt--ccccagt-atctatgtgtca-cccaacaacccacccatc-----------atctctg
B D                     Rat  attt--ccctagt-atccatgtgtca-cccaacaacctacccatc-----------acatctg
B D                  Rabbit  attg----------ctctgtgcctcg-cccctcgcccacaccctc-----------tccccct
B D                  Alpaca  atta--cctcgctggcccgtgcctcaccccgtctcccattccatc-----------actt-ct
             Bactrian camel  atta--ccttgctggcccgtgcctcacccccactcccattccatc-----------acct-ct
B D                 Dolphin  attg--cccccatggccggtgcttcacccctatctgccttccatc-----------acctcct
               Killer whale  attg--cccccatggccggtgcttcacccctatctgccttccatc-----------acctcct
           Tibetan antelope  atta--cccgcatggcctgtgcttcacccctacctaccttccatc-----------accccct
B D                     Cow  atta--cccgcacggccggagcttcacccctacctaccttccatc-----------accccct
B D                   Sheep  atta--cccgcacggccgatgcttc-cccccacctaccttccatc-----------accccct
              Domestic goat  atta--cccgcacggccggtgcttc-cccccacctaccttgcatc-----------accccct
B D                   Horse  atta---ctcagtggcctgtgcctcacccccacccccatt-catc-----------ac--tct
B D        White rhinoceros  atta--ccccagtagcctgtgcctcacccccaccccaattccatc-----------aca-gct
B D                     Cat  atta--ccccagtggcccatgcctcacccctaccctcattccatc-----------ac--ctt
           Black flying-fox  atcaccccccagtggcctgtgcttcacccccacccccattccatc-----------acctcct
B D                 Megabat  atcaccccccagtggcctgtgcttcacccccgcccccattccatc-----------acctcct
              Big brown bat  gtta--ccccaataacctgtgcttca-tcccaaccccatttcttc-----------acctcct
B D                Microbat  gtca--ccccaataacctgtgcttca-tcccaaccccatttcgtc-----------atctcct
            Star-nosed mole  -tga--caccagcagcccaaaccccatctcagctcccattccatc-----------acatcct
B D                Elephant  atga--ccttagcaacccatgcctca------ccttcac-ccatc-----------atctcct
B D                 Manatee  atga--ccttggtgactcgtacctca------ccatcacaccatc-----------acctcct
                   Aardvark  atga--ccctagtgactcatgcctcg------ccctctttccatc-----------acctcct
B D               Armadillo  acta--ctccaatggccc-tgcctcc------catccaccccagctgaggccaggagtctcct
              Prairie vole  ===============================================================
    Lesser Egyptian jerboa  ===============================================================
              Weddell seal  ===============================================================
B D                Hedgehog  ===============================================================
B D                     Pig  ===============================================================
          Cape golden mole  ===============================================================
       Cape elephant shrew  ===============================================================
B D         Chinese hamster  ===============================================================
            Pacific walrus  ===============================================================
B D                   Panda  ===============================================================
      David's myotis (bat)  ===============================================================
B D         Squirrel monkey  ===============================================================
B D                Marmoset  ===============================================================

Inserts between block 1 and 2 in window
B D                    Cat 4bp

Alignment block 2 of 438 in window, 153495778 - 153495788, 11 bps 
B D                   Human  cct------a-ca---ac---ctc--
B D                   Chimp  cct------a-ca---ac---ctc--
B D                 Gorilla  cct------a-ca---ac---ctc--
B D               Orangutan  cct------a-cg---ac---ctc--
B D                  Gibbon  cct------a-ca---ac---ctc--
B D                  Rhesus  cct------a-ca---ac---ctc--
B D     Crab-eating macaque  cct------a-ca---ac---ctc--
B D                  Baboon  cct------a-ca---ac---ctc--
B D            Green monkey  cct------a-ca---ac---ctc--
B D                Bushbaby  cct------g-t-----c---atg--
         Chinese tree shrew  cct------a-ta---tc---ctc--
B D                Squirrel  cc-------actg---aa---ggt--
             Golden hamster  ct-------a-tg---cc---ctc--
B D                   Mouse  cc-------a-tg---tc---ctc--
B D                     Rat  ct-------a-tg---cc---ctc--
B D                  Rabbit  cc---------tgtatcc---ctc--
B D                  Alpaca  cct------g-ta---tc---ctt--
             Bactrian camel  cct------g-ta---tc---ctt--
B D                 Dolphin  cct------g-ta---tc---ctt--
               Killer whale  cct------g-ta---tc---ctt--
           Tibetan antelope  cct------g-tg---tc---ctt--
B D                     Cow  cct------g-ta---tc---ctt--
B D                   Sheep  gct------g-tg---tc---ctt--
              Domestic goat  cct------g-tg---tc---ctt--
B D                   Horse  cct------a-ta---tc---ccc--
B D        White rhinoceros  cct------c-ta---tc---ctc--
           Black flying-fox  ccg------a-ca---tc---ctc--
B D                 Megabat  cca------a-ca---tc---ctc--
              Big brown bat  cat------a-ta---tc---ctc--
B D                Microbat  ctt------a-ta---tc---ctc--
            Star-nosed mole  tct------a-ta---tt---ttt--
B D                Elephant  --t------a-ta---ca---ccatg
B D                 Manatee  --t------a-ta---ca---ccatg
                   Aardvark  --t------a-ta---ca---ccggg
B D               Armadillo  --tccaacag-ca---cagaccccca
              Prairie vole  ==========================
    Lesser Egyptian jerboa  ==========================
              Weddell seal  ==========================
B D                Hedgehog  ==========================
B D                     Pig  ==========================
          Cape golden mole  ==========================
       Cape elephant shrew  ==========================
B D         Chinese hamster  ==========================
B D                     Cat  ==========================
            Pacific walrus  ==========================
B D                   Panda  ==========================
      David's myotis (bat)  ==========================
B D         Squirrel monkey  ==========================
B D                Marmoset  ==========================

Inserts between block 2 and 3 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
           Star-nosed mole 1bp

Alignment block 3 of 438 in window, 153495789 - 153495796, 8 bps 
B D                   Human  tgggctcc
B D                   Chimp  tgggctcc
B D                 Gorilla  tgggctcc
B D               Orangutan  tgggctcc
B D                  Gibbon  tgggctcc
B D                  Rhesus  tgggctcc
B D     Crab-eating macaque  tgggctcc
B D                  Baboon  tgggctcc
B D            Green monkey  ggggctcc
B D                Bushbaby  tgggcttc
         Chinese tree shrew  cggactcc
B D                Squirrel  gaagcacc
             Golden hamster  tgggctct
B D                   Mouse  tgagctct
B D                     Rat  tgtgctct
B D                  Rabbit  tgggct--
B D                  Alpaca  tgggcccc
             Bactrian camel  tgggcccc
B D                 Dolphin  tgggctcc
               Killer whale  tgggctcc
           Tibetan antelope  taggttcc
B D                     Cow  tacattcc
B D                   Sheep  taggttcc
              Domestic goat  taggtttc
B D                   Horse  tgggctcc
B D        White rhinoceros  tgggcttc
           Black flying-fox  tgggctcc
B D                 Megabat  tgggctcc
              Big brown bat  tgggctcc
       David's myotis (bat)  tgggctcc
B D                Microbat  tgggctcc
            Star-nosed mole  tgtgctcc
B D                Elephant  ctgactcc
B D                 Manatee  ctggctcc
                   Aardvark  ctggctcc
B D               Armadillo  ttaccttc
              Prairie vole  ========
    Lesser Egyptian jerboa  ========
              Weddell seal  ========
B D                Hedgehog  ========
B D                     Pig  ========
          Cape golden mole  ========
       Cape elephant shrew  ========
B D         Chinese hamster  ========
B D                     Cat  ========
            Pacific walrus  ========
B D                   Panda  ========
B D         Squirrel monkey  ========
B D                Marmoset  ========

Inserts between block 3 and 4 in window
B D               Squirrel 1bp

Alignment block 4 of 438 in window, 153495797 - 153495797, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
B D            Green monkey  c
B D                Bushbaby  c
         Chinese tree shrew  g
B D                Squirrel  c
B D         Chinese hamster  c
             Golden hamster  c
B D                   Mouse  c
B D                     Rat  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  c
B D                     Cow  t
B D                   Sheep  c
              Domestic goat  c
B D                   Horse  c
B D        White rhinoceros  c
           Black flying-fox  c
B D                 Megabat  c
              Big brown bat  t
       David's myotis (bat)  t
B D                Microbat  t
            Star-nosed mole  c
B D                Elephant  c
B D                 Manatee  g
                   Aardvark  c
B D               Armadillo  t
              Prairie vole  =
    Lesser Egyptian jerboa  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  =
B D                  Rabbit  -
          Cape golden mole  =
       Cape elephant shrew  =
B D                     Cat  =
            Pacific walrus  =
B D                   Panda  =
B D         Squirrel monkey  =
B D                Marmoset  =

Inserts between block 4 and 5 in window
           Star-nosed mole 669bp

Alignment block 5 of 438 in window, 153495798 - 153495810, 13 bps 
B D                   Human  caga---caacagcag
B D                   Chimp  caga---caacagcag
B D                 Gorilla  caga---caacagcag
B D               Orangutan  caga---caacagcag
B D                  Gibbon  caga---caacagcag
B D                  Rhesus  caga---caacagcag
B D     Crab-eating macaque  caga---caacagcag
B D                  Baboon  caga---caacagcag
B D            Green monkey  caga---caacagcag
B D                Bushbaby  cca-------------
         Chinese tree shrew  gaaa---caacaccat
B D                Squirrel  tgaaactcaacagtag
B D         Chinese hamster  caga---taacagggg
             Golden hamster  taaa---caacatcag
B D                   Mouse  taaa---cagcatcaa
B D                     Rat  taaa---caacatcaa
B D                  Rabbit  -------catgagcag
B D                  Alpaca  caga---caccgtcat
             Bactrian camel  caga---caccatcat
B D                 Dolphin  caga---caacatcat
               Killer whale  caga---caacatcat
           Tibetan antelope  caga---caacatcat
B D                     Cow  caga---caacaccat
B D                   Sheep  caga---caacatcat
              Domestic goat  caga---caccatcat
B D                   Horse  ccga---caacaccgt
B D        White rhinoceros  caga---catcatcat
           Black flying-fox  caga---caacatcgt
B D                 Megabat  caga---caacatcgt
              Big brown bat  caga---caacatcat
       David's myotis (bat)  cagg---caacatcat
B D                Microbat  caga---caacatcat
B D                Elephant  caga---tagcacagt
B D                 Manatee  caaa---cagcatagt
                   Aardvark  caaa---cagcatagt
B D               Armadillo  tcta---caacacaac
              Prairie vole  ================
    Lesser Egyptian jerboa  ================
              Weddell seal  ================
B D                Hedgehog  ================
B D                     Pig  ================
          Cape golden mole  ================
       Cape elephant shrew  ================
B D                     Cat  ================
           Star-nosed mole  ================
            Pacific walrus  ================
B D                   Panda  ================
B D         Squirrel monkey  ================
B D                Marmoset  ================

Inserts between block 5 and 6 in window
B D        Chinese hamster 1bp

Alignment block 6 of 438 in window, 153495811 - 153495815, 5 bps 
B D                   Human  gggt--g
B D                   Chimp  gggt--g
B D                 Gorilla  gggt--g
B D               Orangutan  gggc--g
B D                  Gibbon  gggc--g
B D                  Rhesus  ggacgag
B D     Crab-eating macaque  ggacgag
B D                  Baboon  gggcgag
B D            Green monkey  gggcgag
B D                Bushbaby  ------a
         Chinese tree shrew  gtac--c
B D         Chinese hamster  aggc--c
             Golden hamster  ggac--c
B D                   Mouse  gaac--c
B D                     Rat  ggac--c
B D                  Alpaca  ggac--c
             Bactrian camel  ggac--c
B D                 Dolphin  ggac--c
               Killer whale  ggac--c
           Tibetan antelope  ggac--t
B D                     Cow  ggac--t
B D                   Sheep  ggac--t
              Domestic goat  ggac--t
B D                   Horse  gggc--c
B D        White rhinoceros  ggac--c
           Black flying-fox  gcac--c
B D                 Megabat  gcac--c
              Big brown bat  ggac--c
       David's myotis (bat)  ggac--c
B D                Microbat  ggac--c
B D                Elephant  gggt--g
B D                 Manatee  gggt--g
                   Aardvark  gggt--g
B D               Armadillo  agct--g
              Prairie vole  =======
    Lesser Egyptian jerboa  =======
              Weddell seal  =======
B D                Hedgehog  =======
B D                     Pig  =======
B D                  Rabbit  -------
          Cape golden mole  =======
       Cape elephant shrew  =======
B D                     Cat  =======
           Star-nosed mole  =======
            Pacific walrus  =======
B D                   Panda  =======
B D                Squirrel  -------
B D         Squirrel monkey  =======
B D                Marmoset  =======

Inserts between block 6 and 7 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp

Alignment block 7 of 438 in window, 153495816 - 153495836, 21 bps 
B D                   Human  -acag----cacagg-----ccaag-g------cagat
B D                   Chimp  -acaa----cac-gg-----ccaag-g------cagat
B D                 Gorilla  -acaa----cacagg-----ccaag-g------cagat
B D               Orangutan  -acag----cacagg-----ccaag-g------cagat
B D                  Gibbon  -acag----cacagg-----ccaag-g------cagat
B D                  Rhesus  -acag----cacagg-----ccaag-g------cagat
B D     Crab-eating macaque  -acag----cacagg-----ccaag-g------cagat
B D                  Baboon  -acag----cacagg-----ccaag-g------cagat
B D            Green monkey  -acag----cacagg-----ccaag-g------cagat
B D                Bushbaby  -acag----ctcagg-----ccatg-g------caaac
         Chinese tree shrew  -agtg----cacaga-----ccaca-g------cagac
B D         Chinese hamster  -a--g----cataat-----gcctg-aacctttcagac
             Golden hamster  -aatg----aacaat-----ccatg-g------cagac
B D                   Mouse  -aatg----cacaga-----ccaca-g------cagat
B D                     Rat  -agtg----cacagg-----tcaca-g------cagat
B D                  Rabbit  ------------------------------------ac
B D                  Alpaca  -gtca----cacagg-----ccatg-g------cagac
             Bactrian camel  -gtca----cacagg-----ccatg-g------cagac
B D                 Dolphin  -gcca----cacagg-----ctatg-g------cagac
               Killer whale  -gcca----cacagg-----ctatg-g------cagac
           Tibetan antelope  -gcca----cacagg-----ccacg-c------cagac
B D                     Cow  -gcca----cacagg-----ccacg-g------cagac
B D                   Sheep  -gcca----cacagg-----ccagg-g------ctgac
              Domestic goat  -gcca----cacagg-----ccagg-g------ctgac
B D                   Horse  -gcca----cacagg-----ccatg-g------cagac
B D        White rhinoceros  -gcca----cacagg-----ccatg-g------caggc
           Black flying-fox  -gcc----------g-----ccagg-c------cagac
B D                 Megabat  -gcc----------g-----ccagg-c------cagac
              Big brown bat  -acca----cacagg-----ccaagtt------tagac
       David's myotis (bat)  -gcca----cacagg-----ccatg-g------taggc
B D                Microbat  -gcca----cacagg-----ccacg-g------taggc
            Star-nosed mole  -acca----cacggg-----tcgag-g------caa--
B D                Elephant  agccg----cacagg-----tcatg-g------tagac
B D                 Manatee  aaccgcacacacagg-----tcatg-g------cagac
                   Aardvark  agcca----cacagg-----tcatg-g------cagat
B D               Armadillo  agcgg----cccaggcagactcagg-g------aagct
              Prairie vole  ======================================
    Lesser Egyptian jerboa  ======================================
              Weddell seal  ======================================
B D                Hedgehog  ======================================
B D                     Pig  ======================================
          Cape golden mole  ======================================
       Cape elephant shrew  ======================================
B D                     Cat  ======================================
            Pacific walrus  ======================================
B D                   Panda  ======================================
B D                Squirrel  --------------------------------------
B D         Squirrel monkey  ======================================
B D                Marmoset  ======================================

Inserts between block 7 and 8 in window
                  Aardvark 109bp

Alignment block 8 of 438 in window, 153495837 - 153495863, 27 bps 
B D                   Human  gtgaac-actaggaa----------tctttag-caag------aa
B D                   Chimp  gtgaac-actaggaa----------tcttcag-caag------aa
B D                 Gorilla  gtgaac-actaggaa----------actt-ag-caag------aa
B D               Orangutan  gtgaac-actaggaa----------tcttcag-caag------aa
B D                  Gibbon  gtgaac-actaggaa----------acttcag-caag------aa
B D                  Rhesus  gtggac-acaaggaa----------tcttcag-caag------aa
B D     Crab-eating macaque  gtggac-acaaggaa----------tcttcag-caag------aa
B D                  Baboon  gtggac-acaaggaa----------tcttcag-caag------aa
B D            Green monkey  gtgaac-acaaggaa----------tcttcag-caag------aa
B D                Bushbaby  acagac-atcaggaattctggaggctcttcagccaag------ag
         Chinese tree shrew  acagac-atgaggaa----------cttcaag-caggcctctcag
B D         Chinese hamster  acagac-actaagaaccctcaaggatcctcac-tgaa------at
             Golden hamster  atggac-actacgaaccctcgaggatcctcac-caaa------ag
B D                   Mouse  acagac-actaa-gagccttaaagatcctcag-tgag------ac
B D                     Rat  acagac-actaaggagccttgaagatcctcag-cgag------ac
B D                  Rabbit  gcaggc-tctgggcagctttgggggacctcag-caag------a-
B D                  Alpaca  acagat-acaagggatctttgagggtcctcag-caag------ga
             Bactrian camel  acagat-acgagggatctttgagggtcctcag-caag------ga
B D                 Dolphin  acagat-actgggggtcttagagg-------g-taag------ag
               Killer whale  acagac-actgggggtcttagagg-------g-taag------ag
           Tibetan antelope  gcagat-actgggactcttagagggccctcag-caag------aa
B D                     Cow  gcagat-actgggaatcttagagggccctcag-caag------aa
B D                   Sheep  acagat-actgggactcttagagggccctcag-caag------aa
              Domestic goat  acagat-actgggactcttagagggccctcag-caag------aa
B D                   Horse  acagat-actagggatctttgagggtcctcag-caag------ag
B D        White rhinoceros  acagat-tctagggatctttgagggtccttag-caag------ag
           Black flying-fox  acagac-acctgagctttcc-agggtcctcgg-ctag------ag
B D                 Megabat  acagac-acctgagctttcc-agggtcctcgg-ctag------ag
              Big brown bat  acagataaccagggatttttgagggtcctcag-cctg------ag
       David's myotis (bat)  acagat-accagggatttttgaggatcctcag-cctg------ag
B D                Microbat  acagat-accagggatttttgagggtcctcag-cctg------ag
            Star-nosed mole  --agat-actagtgatctttgaggatcctcat-caag------ag
B D                Elephant  ------------------atgagga-----ag-cag---------
B D                 Manatee  ------------------acgagga-----ag-cag---------
B D               Armadillo  ------------------gtgaaggtcctcag-cag---------
              Prairie vole  =============================================
    Lesser Egyptian jerboa  =============================================
              Weddell seal  =============================================
B D                Hedgehog  =============================================
B D                     Pig  =============================================
          Cape golden mole  =============================================
                  Aardvark  =============================================
       Cape elephant shrew  =============================================
B D                     Cat  =============================================
            Pacific walrus  =============================================
B D                   Panda  =============================================
B D                Squirrel  ---------------------------------------------
B D         Squirrel monkey  =============================================
B D                Marmoset  =============================================

Inserts between block 8 and 9 in window
B D                 Alpaca 6bp
            Bactrian camel 6bp
          Tibetan antelope 1091bp
B D                    Cow 1398bp
B D                  Sheep 1104bp
             Domestic goat 1105bp

Alignment block 9 of 438 in window, 153495864 - 153495940, 77 bps 
B D                   Human  ctaaggccccaaacccagctcagacgatcc--aagcct-------cggag-cac--tctggagcggggaa
B D                   Chimp  ctaaggccccaaacccagctcagacgatcc--aagcct-------cagag-cac--tctggagcggggaa
B D                 Gorilla  ctaaggccccaaacccagctcagacgatcc--ttggatcatcgtccagag-cac--tctggaacggggaa
B D               Orangutan  ctaaggccccaaacccagctcagaggatcc--aagcct-------cggag-cac--tctggaacggggaa
B D                  Gibbon  ctaaggccccaaacccagctcagaggatcc--aagcct-------cagag-cac--tctggagcggggaa
B D                  Rhesus  ctaaggccccaaacccagctcagaggatcc--aagcct-------cagag-cac--tctggagcagggaa
B D     Crab-eating macaque  ctaaggccccaaacccagctcagaggatcc--aagcct-------cagag-cac--tctggagcagggaa
B D                  Baboon  ctaaggccccaaacccagctcagaggatcc--aagcct-------cagag-cac--tctggagcagggaa
B D            Green monkey  ctaaggccccaaacccaactcagaggatcc--aagcct-------aggag-cac--tctggagcagggaa
B D                Bushbaby  ccaaggacccaaatccagctctgccgacccagagacct-------cacagccat--ttgggggcagtaaa
         Chinese tree shrew  caagagtcaaaaatccagcccagatgatctagagacct-------cagag-cag--tcaggattgttcaa
B D         Chinese hamster  cagggaaccccaacccagcgtggaggatcc--agccctct-----caaag-cag--tttggagcagtaaa
             Golden hamster  cagggaaccccaccccagcttggaggaagc--agacatct-----caaag-cag--tttggagcagtaaa
B D                   Mouse  tggg--------atccatcttggagaagcc--agccactg-----caaagccactgtttggagcagtaga
B D                     Rat  tggg--------atccatcttggagaagcc--agtcaccg-----caaag-cac--tttggaacagtaaa
B D                  Rabbit  --gg--------acccag------------------------------ag-ccc----------------
B D                  Alpaca  ctgaggttccagatccaactcagggaatcatgagactt-------ccaag-cac--tttggggtgcttag
             Bactrian camel  ctgaggttccagatccaacttggggaatcatgagactt-------ccaag-cac--tttggggtgcttag
B D                 Dolphin  ccaacattccaaatccagctcggaggatccagagacct-------caaag-tgg--tgtgggatgggtag
               Killer whale  ccaacattccaaatccagctcggaggatccagagacct-------caaag-tgg--tgtgggatgggtag
B D                   Horse  ccaacaccccaaatccagcttggaggatccagagacct-------cagag-cag--tttgagggggttaa
B D        White rhinoceros  ccaatgccccaaatccagcttggaggatccagagacct-------ctgag-cag--tctgaggtggttaa
           Black flying-fox  ccaacaccccagatccagctgggaggatccaaagacct-------ccaaa-tgg--tttg-cggggttgg
B D                 Megabat  ccaacaccccagatccagctgggaggatccaaagacct-------ccaaa-cgg--tttg-cggggttgg
              Big brown bat  cccacaccccaaatccagctcagaggatccaaaaactt-------caaaa-ctg--tttg-ggtggttag
       David's myotis (bat)  ccaacaccccaaatccagctcagaggatccaaaaactt-------caaaa-gag--tttg-ggtggttag
B D                Microbat  ccaacgccccaaatccagctcagaggatcc-aaaactt-------c-aaa-gag--tttg-ggtggttag
            Star-nosed mole  ccaacaccccaagttcagtttggag---------agct-------cagag-cag--ttgggggcagttaa
B D                Elephant  atca---------------------------------c-------cgg----------------------
B D                 Manatee  atca---------------------------------c-------caga---------------------
B D               Armadillo  cccaggacccaagcccagctcagaggatccagagaccc-------cagag-aag--tttggggtgacaca
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
       Cape elephant shrew  ======================================================================
B D                     Cat  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  gctctgagaggccaccagg
                      Chimp  gctctgagaggccaccagg
                    Gorilla  gctctgagaggccaccagg
                  Orangutan  gctctgagagaccaccagg
                     Gibbon  gctctgagaggccaccagg
                     Rhesus  gctctgagagaccaccagg
        Crab-eating macaque  gctctgagagaccaccagg
                     Baboon  gctctgagagaccaccagg
               Green monkey  gctctgagagaccaccagg
                   Bushbaby  gtttagagaggccagcagg
         Chinese tree shrew  tttctgagagggcagcagg
            Chinese hamster  gttctgagaggactccagg
             Golden hamster  gttctgagaggccttcagg
                      Mouse  gttctgacagaccttcagg
                        Rat  gctctgagtggccttcagg
                     Rabbit  --tctgagaggccagcagg
                     Alpaca  gttctgagaggccagaagg
             Bactrian camel  gttctgagaggctagaagg
                    Dolphin  gttctgagaggccggtaga
               Killer whale  gttctgagaggccagtaga
                      Horse  gttctcagaggtcaggagg
           White rhinoceros  gttctcagaggtccgtagg
           Black flying-fox  gttctgagaggccaggagg
                    Megabat  gttctaagaggccaggagg
              Big brown bat  gttctgagaggccagtagg
       David's myotis (bat)  gttctgagaggccaatagg
                   Microbat  attctgagaggccagtagg
            Star-nosed mole  ggacggagagcccattagg
                   Elephant  -------------------
                    Manatee  -------------------
                  Armadillo  gttctggaagaccaggagg
               Prairie vole  ===================
     Lesser Egyptian jerboa  ===================
               Weddell seal  ===================
                   Hedgehog  ===================
                        Pig  ===================
           Cape golden mole  ===================
                   Aardvark  ===================
        Cape elephant shrew  ===================
                        Cat  ===================
              Domestic goat  ===================
                      Sheep  ===================
           Tibetan antelope  ===================
             Pacific walrus  ===================
                      Panda  ===================
                   Squirrel  -------------------
            Squirrel monkey  ===================
                   Marmoset  ===================
                        Cow  ===================

Inserts between block 9 and 10 in window
B D                Manatee 83bp

Alignment block 10 of 438 in window, 153495941 - 153495945, 5 bps 
B D                   Human  gaagg
B D                   Chimp  gaagg
B D                 Gorilla  gaagg
B D               Orangutan  gaagg
B D                  Gibbon  gaagg
B D                  Rhesus  gacgg
B D     Crab-eating macaque  gacgg
B D                  Baboon  gacgg
B D            Green monkey  gacgg
B D                Bushbaby  gaggg
         Chinese tree shrew  gaagg
B D         Chinese hamster  gaagg
             Golden hamster  gaagg
B D                   Mouse  gaaga
B D                     Rat  gaaga
B D                  Rabbit  gtggg
B D                  Alpaca  gacag
             Bactrian camel  aacgg
B D                 Dolphin  gaaag
               Killer whale  gaaag
B D                   Horse  gaaga
B D        White rhinoceros  ggagg
           Black flying-fox  gaagg
B D                 Megabat  ggagg
              Big brown bat  gaaag
       David's myotis (bat)  gaagg
B D                Microbat  gaggg
            Star-nosed mole  aagag
B D               Armadillo  gaagg
              Prairie vole  =====
    Lesser Egyptian jerboa  =====
              Weddell seal  =====
B D                Hedgehog  =====
B D                     Pig  =====
          Cape golden mole  =====
                  Aardvark  =====
       Cape elephant shrew  =====
B D                 Manatee  =====
B D                Elephant  -----
B D                     Cat  =====
             Domestic goat  =====
B D                   Sheep  =====
          Tibetan antelope  =====
            Pacific walrus  =====
B D                   Panda  =====
B D                Squirrel  -----
B D         Squirrel monkey  =====
B D                Marmoset  =====
B D                     Cow  =====

Inserts between block 10 and 11 in window
B D               Microbat 1425bp
           Star-nosed mole 1bp

Alignment block 11 of 438 in window, 153495946 - 153495946, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  t
B D                  Baboon  g
B D            Green monkey  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D         Chinese hamster  g
             Golden hamster  g
B D                   Mouse  g
B D                     Rat  g
B D                  Rabbit  g
B D                  Alpaca  g
             Bactrian camel  g
B D                 Dolphin  g
               Killer whale  g
B D                   Horse  a
B D        White rhinoceros  g
           Black flying-fox  g
B D                 Megabat  g
              Big brown bat  g
       David's myotis (bat)  g
B D               Armadillo  g
              Prairie vole  =
    Lesser Egyptian jerboa  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  =
          Cape golden mole  =
                  Aardvark  =
       Cape elephant shrew  =
B D                 Manatee  =
B D                Elephant  -
B D                     Cat  =
           Star-nosed mole  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Pacific walrus  =
B D                   Panda  =
B D                Squirrel  -
B D                Microbat  =
B D         Squirrel monkey  =
B D                Marmoset  =
B D                     Cow  =

Inserts between block 11 and 12 in window
B D        Chinese hamster 1bp
            Golden hamster 1bp
B D                  Mouse 1bp
B D                    Rat 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp

Alignment block 12 of 438 in window, 153495947 - 153495965, 19 bps 
B D                   Human  gcaaca-ctccagccaactc
B D                   Chimp  gcaaca-ctccagccaactc
B D                 Gorilla  gcaaca-ctccagtcaactc
B D               Orangutan  gcaaca-ctccagccaactt
B D                  Gibbon  gcaaca-ctccagccaactc
B D                  Rhesus  ccaaga-ctccagccaactc
B D     Crab-eating macaque  ccaaga-ctccagccaactc
B D                  Baboon  ccaaga-ctccagccaactc
B D            Green monkey  ccaaga-ctccagccaactc
B D                Bushbaby  cccaggtctccacccaattc
         Chinese tree shrew  cccagt-ctccagccaactc
B D         Chinese hamster  tcaagt-cctcagctaaccc
             Golden hamster  ccaagt-cctcagctagccc
B D                   Mouse  ccaagt-ccttggctaactt
B D                     Rat  ccaagt-cctcagctaaccc
B D                  Alpaca  ctaagt-ctccagccaactc
             Bactrian camel  ctaagt-ctccagccaactc
B D                 Dolphin  ctaagt-ctccagccaatgc
               Killer whale  ctaagt-ctccagccaatgc
B D                   Horse  cgcaat-ctccagccaattc
B D        White rhinoceros  ccaagt-ctctagccaattc
           Black flying-fox  ccaagt-ctccagccagctc
B D                 Megabat  ccaagt-ctccagccagctc
              Big brown bat  ccaagt-ctcctgcacactc
            Star-nosed mole  ccgtgt-ccccagcaactt-
B D               Armadillo  -----t-ctcctgccagctc
              Prairie vole  ====================
    Lesser Egyptian jerboa  ====================
              Weddell seal  ====================
B D                Hedgehog  ====================
B D                     Pig  ====================
B D                  Rabbit  --------------------
          Cape golden mole  ====================
                  Aardvark  ====================
       Cape elephant shrew  ====================
B D                 Manatee  ====================
B D                Elephant  --------------------
B D                     Cat  ====================
             Domestic goat  ====================
B D                   Sheep  ====================
          Tibetan antelope  ====================
            Pacific walrus  ====================
B D                   Panda  ====================
B D                Squirrel  --------------------
      David's myotis (bat)  --------------------
B D                Microbat  ====================
B D         Squirrel monkey  ====================
B D                Marmoset  ====================
B D                     Cow  ====================

Inserts between block 12 and 13 in window
             Big brown bat 593bp

Alignment block 13 of 438 in window, 153495966 - 153496141, 176 bps 
B D                   Human  agat--gaggtgaagcccacctc--tgcctcccttgcccccaaat--gcttctctcccagg----gtcta
B D                   Chimp  agat--gaggtgaagcccaccta--tgcctcccttgcccccaaat--gcttctctcccagg----gtcta
B D                 Gorilla  agat--gaggtgaagcccatctc--tgcctcccttgcccccaaat--gcttctctcccagg----gtcta
B D               Orangutan  ggat--gaggtgaagcccacctc--tgcctcccttgcccccaaat--gcttctctcccagg----gtcta
B D                  Gibbon  ggat--gaggtgaagcccacctc--tgcctcccttgcccccaaat--gcttctctctcagg----gtcta
B D                  Rhesus  ggat--gaggtgaagcccacctc--tgcctcccttgcccccaaat--gtttctctcccagg----gtcta
B D     Crab-eating macaque  ggat--gaggtgaagcccacctc--tgcctcccttgcccccaaat--gtttctctcccagg----gtcta
B D                  Baboon  agat--gaggtgaagcccacctc--tgcctcccttgcccccaaat--gtttctctcccagg----gtcta
B D            Green monkey  ggat--gaggtgaagcccacctc--tgcctctcttgcccccaaat--gtttatctcccaga----gttta
B D                Bushbaby  aggt--tgggggg---ctgtccc--cgcctccctcttctgccagg--caccttctctccgg----gactg
         Chinese tree shrew  aggt--gaggccacacccagct---tacctttcttccacccaaag--gcacctcgccaagg----gtctg
B D         Chinese hamster  agac--aagattaga-acgcctt--ttcctccctttctctcaaag-gcctcctctcccagg------ctg
             Golden hamster  agac--aaggttaga-tcaccttcacacctccttgtttctcaaag-----cctctcccagg------ctg
B D                   Mouse  aggc--gtgactggg-acacctt--tgcctcccttccccctaagg--cctcctctcccagg------ctg
B D                     Rat  aagc--aagatcagg-acacctt--tgcctcccttccccctaagg--cctcctctccctgg------ctt
B D                  Rabbit  -----------------------------tcccttccccacatgg-----ttcctcccagt------ctg
B D                  Alpaca  agatcagagttaggacccaatcc--tgcctctcttctctcccaaatgccccctctcccagg----gtctg
             Bactrian camel  agatcggagttgagacccatccc--tgcctctcttctctcccaaatgcctcctctcccagg----gtctg
B D                 Dolphin  agatcagagttgagacgcatcac--tgcctcccttctctcccaaatgcctcctctccca-g----gtctg
               Killer whale  agatcagagttgagacgcatcac--tgcctcccttctctcccaaatgcctcctctccca-g----gtctg
B D                   Horse  aggtcagagttgaggcccatcgc--tgcctcccttctctcgcaaacacctcc-ctcccagg----gtctg
B D        White rhinoceros  agatcagagttgaggcccatcac--tgcctccctcct----------------cccccaga----gtctg
           Black flying-fox  aggtcagagctgaggcccatcac--tgcctcccttct----------------ctcccgaa----tgcc-
B D                 Megabat  aggtcagagctgaggcccatcac--ggcctcccttct----------------ctcccgaa----tgcc-
            Star-nosed mole  ggatcagagcggtggcccgcctc--tgcctccctc------------------ccccgagg----gcctg
B D                Elephant  -----------------------------------------------------------------accct
B D               Armadillo  aggtcagggttgggccccccctc--tgcctctcttttctcaaatg--cctcctctcctgggcgcaaacct
              Prairie vole  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                     Cat  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  tcttcct---gcattcaatccattcagcacc-t-gct-gggg-ccaggctgccctgggcactggaa----
                      Chimp  tcttcct---gcattcaatccacttagcacc-t-gct-gggg-ccaggctgccctgggcactggaa----
                    Gorilla  tcttcct---gcattcaatccacttagcacc-t-gct-gggg-ccaggcttccctgggcactggaa----
                  Orangutan  tcttcct---gcattcaatccacttagcacc-t-gct-gggg-ccaggctgccctgggcactggaa----
                     Gibbon  tcttcct---gc-----atccacttagcacc-t-gct-gggg-ccaggcttccctgggcactggaa----
                     Rhesus  tcttcct---acattcaatccacttagcacc-t-gcc-gggg-ccaggctgccctaggcaccggaa----
        Crab-eating macaque  tcttcct---acattcaatccacttagcacc-t-gcc-gggg-ccaggctgccctaggcaccggaa----
                     Baboon  tcttcct---acattcaatccacttagcacc-t-gcc-gggg-ccaggctgccctgggcactggaa----
               Green monkey  tcttcct---acattcaatccacttagcacc-t-gct-gggg-ccaggctgccctaggcaccggaa----
                   Bushbaby  tcttcct-------------------gaacc-t-gc--aggg-ccaggctgcct--ggccctggga----
         Chinese tree shrew  tctcccc---acaaacaacactcttagcacc-t-attggggg-tcaggctgccctgggcact---a----
            Chinese hamster  tcctccagctgcacttgattcactcagtacc-t-tct-gggc-----------------actggag----
             Golden hamster  tcctccaactgtgctcgattcactaagtacc-t-tct-gggcac-----tgccccaagaactggag----
                      Mouse  tcctccg---gcactcaatccactcagcacc-t-gtt-gggcacccggcttccctgagcattggag----
                        Rat  ccctcca---gcactcaattcattcagtacc-t-gct-ggacaccagggtgccctgaacattggag----
                     Rabbit  --ctcca---ggactcaactcacttagcacc-t-gct-gggggc-------------------gag----
                     Alpaca  tcttcct---gtgttcaatttacttagcctctt-gcc-cagggctgggctgcactgggcgctggaa----
             Bactrian camel  tcttcct---gtgttcaatttacttagcccctt-ccc-cagggccgggctgccctgggccctggaa----
                    Dolphin  tcttcct---gcattcaattcacttagcacc-t-gct-gggggccaggctgccctgggctctggag----
               Killer whale  tcttcct---gcattcaattcacttagcacc-t-gct-gggggccaggctgccctgggctctggag----
                      Horse  ---tccc---gcattcaactcacttagcacc-c-gct-gggggccgggctgccctgggcactggag----
           White rhinoceros  tcttccc---tcattcaattcactcagcccc-ctgct-ggggg-caggctgccctgggcacttgag----
           Black flying-fox  ---cccc---acatccgactcactgagcacc-c-gcc-gggggccagcccgccctgggcactggaggagg
                    Megabat  ---cccc---acatccgactcacggagcacc-c-gcc-gggggccagcccgccctgggcactggaggagg
            Star-nosed mole  tcttcct---gtgt-caactcacttagcac--t-gcc-tggcaccggg----------------------
                   Elephant  tcttctg---tggcatca------------c-t-ggt-tgggttcaaaccacc-----------------
                  Armadillo  cctcccg---ctgcaccattcacttagcacc-t-gct-gggggtgaggctgccctgggggc---------
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                        Pig  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
        Cape elephant shrew  ======================================================================
                    Manatee  ======================================================================
                        Cat  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
                   Squirrel  ----------------------------------------------------------------------
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                        Cow  ======================================================================

                      Human  --aaacaa--agat----aagac-agaca-----ggat-tctt-g--cc-------ctgttagagctgat
                      Chimp  --aaacaa--agat----aagac-agaca-----ggat-tctt-g--cc-------ctgttagagctgat
                    Gorilla  --aaacaa--agat----aagac-agaca-----ggat-tctt-g--cc-------ctgttagagctgat
                  Orangutan  --aaacaa--agat----aagac-agaca-----ggat-tctt-g--cc-------ctgttagagctgat
                     Gibbon  --aaacaa--agat----aagac-agaca-----gaat-tctt-g--gc-------ctcttagagatgat
                     Rhesus  --agacaa--agataaacaagac-agaca-----ggat-tctt-g--cc-------ctcttagagttgac
        Crab-eating macaque  --agacaa--agataaacaagac-agaca-----ggat-tctt-g--cc-------ctcttagagttgac
                     Baboon  --agacaa--agataaacaagac-agaca-----ggat-tctt-g--cc-------ctcttagagttgat
               Green monkey  --agacaa--agataaacaagac-agaca-----ggat-tctt-gctcc-------ctcttagagttgat
                   Bushbaby  --aaac----agaccaacaggcc-agact-----agag-tctc-a--cc-------ctctccaagctttt
         Chinese tree shrew  --aaacag--gaag----atgactacaca-----agat-ttct-g--cc-------cagtgagagctta-
            Chinese hamster  --aaggga--agacaagcaagac-agcta-----agatctctcta--tcgatctatctatctgat--tgt
             Golden hamster  --aaggga--agagaagcaagac-aggtatctccatatctctcta--tc------tctctctgat--tat
                      Mouse  --aaggga--aaatac---agag-acaca-----aaat-tctc-a--cc-------ctctctgag--tat
                        Rat  --aaggga--aaatacacaagat-ggata-----agat-tctc-a--cc-----------ctgag--tat
                     Rabbit  --aagaag--caa------agac-agcca-----ggat-tctc-a--tc-------ctctcggag-ttat
                     Alpaca  --aaagaaagac------agcgc-agaaa-----cgat-gctc-g--tc-------cttccagaggtcgc
             Bactrian camel  --aaagaaagac------agcac-agaca-----ggat-gctt-g--cc-------cttccagagtttgc
                    Dolphin  --aaacaa--tc------aaaac-aagca-----ggat-cctt-g--cc-------ctcccagagttcga
               Killer whale  --aaacaa--tc------aaaac-aagca-----ggat-cctt-g--cc-------ctcccagagttcga
                      Horse  --agacaa--ag------tcagc-agacg-----ggat-tctt-g--cc-------ctcccagagtttgc
           White rhinoceros  --agacaa--ag------ataac-agaca-----cgat-tctt-g--cc-------ctgccagagtttgc
           Black flying-fox  acagacaa--ca------cagac-agaca-----ggct-cttt-g--cc-------ctcccggagtttgc
                    Megabat  acagacaa--cg------cagac-agaca-----ggct-cttt-g--cc-------ctcccggagtttgc
            Star-nosed mole  --aaacaa-----------aggt-aaacg-----aaa-----------------------cagagct-gc
                   Elephant  ----------------------------a---------------g--cc-------ct------------
                  Armadillo  --agctaa--ac------aagac-gg--a---------------g--cc-------ctgacagagcttat
               Prairie vole  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                        Pig  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
        Cape elephant shrew  ======================================================================
                    Manatee  ======================================================================
                        Cat  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
                   Squirrel  ----------------------------------------------------------------------
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                        Cow  ======================================================================

                      Human  ggtctga------------------gaatt
                      Chimp  ggtctga------------------gaatt
                    Gorilla  ggtctga------------------gaatt
                  Orangutan  ggtctga------------------gaatt
                     Gibbon  ggtctgc------------------gaatt
                     Rhesus  ggtctga------------------gaact
        Crab-eating macaque  ggtctga------------------gaact
                     Baboon  ggtctga------------------gaact
               Green monkey  ggtctga------------------gaact
                   Bushbaby  agtaaga------------------gaatt
         Chinese tree shrew  agtctga------------------gaatt
            Chinese hamster  agtctga------------------gaatt
             Golden hamster  agtctga------------------gaatt
                      Mouse  agtctga------------------gaatt
                        Rat  agtctga------------------gaatt
                     Rabbit  agtccga------------------ggatg
                     Alpaca  cagctg------------------------
             Bactrian camel  cagctga------------------gattt
                    Dolphin  agtctga------------------gatgc
               Killer whale  agtctga------------------gatgc
                      Horse  agtcaga------------------aaatt
           White rhinoceros  agtctga------------------gaatt
           Black flying-fox  agtctga------------------aattt
                    Megabat  agtctga------------------aattt
            Star-nosed mole  agcctga------------------gaatt
                   Elephant  -------------------------aagtt
                  Armadillo  --tctagtcttcagatgaacacaagaaatt
               Prairie vole  ==============================
     Lesser Egyptian jerboa  ==============================
               Weddell seal  ==============================
                   Hedgehog  ==============================
                        Pig  ==============================
           Cape golden mole  ==============================
                   Aardvark  ==============================
        Cape elephant shrew  ==============================
                    Manatee  ==============================
                        Cat  ==============================
              Domestic goat  ==============================
                      Sheep  ==============================
           Tibetan antelope  ==============================
             Pacific walrus  ==============================
                      Panda  ==============================
                   Squirrel  ------------------------------
       David's myotis (bat)  ------------------------------
              Big brown bat  ==============================
                   Microbat  ==============================
            Squirrel monkey  ==============================
                   Marmoset  ==============================
                        Cow  ==============================

Inserts between block 13 and 14 in window
B D        Chinese hamster 1659bp
            Golden hamster 1bp
B D                  Mouse 3173bp
B D                    Rat 442bp

Alignment block 14 of 438 in window, 153496142 - 153496152, 11 bps 
B D                   Human  aagaagtcg-tt-
B D                   Chimp  aagaagtca-tt-
B D                 Gorilla  aagaagtcg-tt-
B D               Orangutan  aagaaatca-tt-
B D                  Gibbon  aagaagtca----
B D                  Rhesus  aagaagtca-tt-
B D     Crab-eating macaque  aagaagtca-tt-
B D                  Baboon  aagaagtca-tt-
B D            Green monkey  aagaattca-tt-
B D                Bushbaby  aaaaagtcg-tt-
         Chinese tree shrew  aggaagtca-tt-
               Prairie vole  aagatgtca-at-
B D         Chinese hamster  aagatgtca-at-
             Golden hamster  agggggtta-tg-
B D                   Mouse  aagaagtca-tt-
B D                     Rat  aagatgcca-tt-
B D                  Rabbit  aggaagtca--t-
B D                  Alpaca  -agaagcca-tt-
             Bactrian camel  aagaagtca-tt-
B D                 Dolphin  aagcagtca-tt-
               Killer whale  aagcagtca-t--
B D                   Horse  a-----tca-tt-
B D        White rhinoceros  aag---tcattt-
           Black flying-fox  aagaaatca-tt-
B D                 Megabat  aagaaatca-tt-
            Star-nosed mole  g-----tca-tt-
B D                Elephant  -aggagtca----
B D               Armadillo  -aggaaacc-att
    Lesser Egyptian jerboa  =============
              Weddell seal  =============
B D                Hedgehog  =============
B D                     Pig  =============
          Cape golden mole  =============
                  Aardvark  =============
       Cape elephant shrew  =============
B D                 Manatee  =============
B D                     Cat  =============
             Domestic goat  =============
B D                   Sheep  =============
          Tibetan antelope  =============
            Pacific walrus  =============
B D                   Panda  =============
B D                Squirrel  -------------
      David's myotis (bat)  -------------
             Big brown bat  =============
B D                Microbat  =============
B D         Squirrel monkey  =============
B D                Marmoset  =============
B D                     Cow  =============

Inserts between block 14 and 15 in window
B D               Bushbaby 585bp

Alignment block 15 of 438 in window, 153496153 - 153496155, 3 bps 
B D                   Human  gtt
B D                   Chimp  gtt
B D                 Gorilla  gtt
B D               Orangutan  gtt
B D                  Gibbon  -tt
B D                  Rhesus  gtt
B D     Crab-eating macaque  gtt
B D                  Baboon  gtt
B D            Green monkey  gtt
         Chinese tree shrew  -tt
               Prairie vole  ttc
B D         Chinese hamster  ttt
             Golden hamster  ttt
B D                   Mouse  ttt
B D                     Rat  ttt
B D                  Rabbit  ctc
B D                  Alpaca  ctt
             Bactrian camel  ctt
B D                 Dolphin  ctt
B D                   Horse  ttt
B D        White rhinoceros  ttt
           Black flying-fox  ttt
B D                 Megabat  ttt
            Star-nosed mole  ttt
B D               Armadillo  ctt
    Lesser Egyptian jerboa  ===
              Weddell seal  ===
B D                Hedgehog  ===
B D                     Pig  ===
          Cape golden mole  ===
                  Aardvark  ===
       Cape elephant shrew  ===
B D                 Manatee  ===
B D                Elephant  ---
B D                     Cat  ===
B D                Bushbaby  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ---
B D                Squirrel  ---
      David's myotis (bat)  ---
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ===
B D                Marmoset  ===
B D                     Cow  ===

Alignment block 16 of 438 in window, 153496156 - 153496158, 3 bps 
B D                   Human  aat
B D                   Chimp  aat
B D                 Gorilla  aat
B D               Orangutan  aat
B D                  Gibbon  aat
B D                  Rhesus  aat
B D     Crab-eating macaque  aat
B D                  Baboon  aat
B D            Green monkey  aat
         Chinese tree shrew  tat
               Prairie vole  aac
B D         Chinese hamster  aat
             Golden hamster  --t
B D                   Mouse  aac
B D                     Rat  aac
B D                  Rabbit  aat
B D                  Alpaca  tat
             Bactrian camel  tat
               Killer whale  --t
B D                   Horse  aat
B D        White rhinoceros  aat
           Black flying-fox  tat
B D                 Megabat  tat
            Star-nosed mole  aat
B D               Armadillo  aac
    Lesser Egyptian jerboa  ===
              Weddell seal  ===
B D                Hedgehog  ===
B D                     Pig  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Dolphin  ===
       Cape elephant shrew  ===
B D                 Manatee  ===
B D                Elephant  ---
B D                     Cat  ===
B D                Bushbaby  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Pacific walrus  ===
B D                   Panda  ===
B D                Squirrel  ---
      David's myotis (bat)  ---
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ===
B D                Marmoset  ===
B D                     Cow  ===

Alignment block 17 of 438 in window, 153496159 - 153496160, 2 bps 
B D                   Human  tt
B D                   Chimp  tt
B D                 Gorilla  tt
B D               Orangutan  tt
B D                  Gibbon  tt
B D                  Rhesus  tt
B D     Crab-eating macaque  tt
B D                  Baboon  tt
B D            Green monkey  tt
         Chinese tree shrew  tt
               Prairie vole  tt
B D         Chinese hamster  tt
             Golden hamster  ta
B D                   Mouse  tt
B D                     Rat  tt
B D                  Rabbit  tt
B D                  Alpaca  tt
             Bactrian camel  tt
B D                 Dolphin  ct
               Killer whale  cg
B D                   Horse  tt
B D        White rhinoceros  tt
           Black flying-fox  tt
B D                 Megabat  tt
B D               Armadillo  at
    Lesser Egyptian jerboa  ==
              Weddell seal  ==
B D                Hedgehog  ==
B D                     Pig  ==
          Cape golden mole  ==
                  Aardvark  ==
       Cape elephant shrew  ==
B D                 Manatee  ==
B D                Elephant  --
B D                     Cat  ==
B D                Bushbaby  ==
           Star-nosed mole  --
             Domestic goat  ==
B D                   Sheep  ==
          Tibetan antelope  ==
            Pacific walrus  ==
B D                   Panda  ==
B D                Squirrel  --
      David's myotis (bat)  --
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  ==
B D                Marmoset  ==
B D                     Cow  ==

Inserts between block 17 and 18 in window
B D                 Rabbit 8814bp

Alignment block 18 of 438 in window, 153496161 - 153496187, 27 bps 
B D                   Human  ttc-tttttcttatcttattttcattt-a
B D                   Chimp  ttc-tttttcttatcttattttcattt-a
B D                 Gorilla  ttc-tttttcttatcttattttcattt-a
B D               Orangutan  ttc-tttctcttatcttattttcattt-a
B D                  Gibbon  ttc-tttttcttatcttattttcattt-a
B D                  Rhesus  ttc-tttttcttatcttatttttattt-a
B D     Crab-eating macaque  ttc-tttttcttatcttatttttattt-a
B D                  Baboon  ttc-tttttcttatcttatttttattt-a
B D            Green monkey  ttc-tttttcttatcttattttcattt-a
         Chinese tree shrew  tta-tttttactaccttactc--------
               Prairie vole  att-ttttgtgcttttttttccctttt--
B D         Chinese hamster  ttc-ttttctgtgctttttttcccttt--
             Golden hamster  ttg-gcatatgtaattattatagatgta-
B D                   Mouse  ttc-gttatcatgcttttttctcttt---
B D                     Rat  ttc-tttttcacgcttttttctcttt---
B D                  Alpaca  tta-tttttcctatctt-ttttctttt-a
             Bactrian camel  tta-tttttcctatctt-ttttctttt-a
B D                 Dolphin  tta-tttttcctgtctt-ttctctttt-a
               Killer whale  tta-tttttcctgtctt-ttctctttt-a
B D                   Horse  ttc-ttttttctgtcttcttttctttt-a
B D        White rhinoceros  ttctttttttctatcttcttttctttt-a
           Black flying-fox  ttatttttatgtttccaatcttcctcc-a
B D                 Megabat  ttatttttatgtttccaatcttcctcc-a
            Star-nosed mole  ttt-tcttttccttctc-tcctttttt-a
B D               Armadillo  ---tttttacttatcttttttta------
    Lesser Egyptian jerboa  =============================
              Weddell seal  =============================
B D                Hedgehog  =============================
B D                     Pig  =============================
B D                  Rabbit  =============================
          Cape golden mole  =============================
                  Aardvark  =============================
       Cape elephant shrew  =============================
B D                 Manatee  =============================
B D                Elephant  -----------------------------
B D                     Cat  =============================
B D                Bushbaby  =============================
             Domestic goat  =============================
B D                   Sheep  =============================
          Tibetan antelope  =============================
            Pacific walrus  =============================
B D                   Panda  =============================
B D                Squirrel  -----------------------------
      David's myotis (bat)  -----------------------------
             Big brown bat  =============================
B D                Microbat  =============================
B D         Squirrel monkey  =============================
B D                Marmoset  =============================
B D                     Cow  =============================

Alignment block 19 of 438 in window, 153496188 - 153496199, 12 bps 
B D                   Human  ttaatgataaaa
B D                   Chimp  ttaatgataaaa
B D                 Gorilla  ttaatgataaaa
B D               Orangutan  ttaatgataaaa
B D                  Gibbon  ttaatgataaaa
B D                  Rhesus  ttaatgataaa-
B D     Crab-eating macaque  ttaatgataaa-
B D                  Baboon  ttaatgagaaa-
B D            Green monkey  ttaatgataaaa
B D                Bushbaby  tcaaaaaaaaaa
         Chinese tree shrew  ---attataaaa
               Prairie vole  tgaattataaaa
B D         Chinese hamster  tgaattacaaaa
             Golden hamster  ttaattataaaa
B D                   Mouse  tgaattgtaaa-
B D                     Rat  ggaattgtaaa-
B D                  Alpaca  ttaattaaaaaa
             Bactrian camel  ttaatcaaaaaa
B D                 Dolphin  ttaattataaaa
               Killer whale  ttaattataaaa
B D                   Horse  ttaattataaa-
B D        White rhinoceros  ttaattataaa-
           Black flying-fox  ctatttataaat
B D                 Megabat  ctatttataaat
            Star-nosed mole  -taatactaaaa
B D                Elephant  ------atcgaa
B D               Armadillo  ttaactattaaa
    Lesser Egyptian jerboa  ============
              Weddell seal  ============
B D                Hedgehog  ============
B D                     Pig  ============
B D                  Rabbit  ============
          Cape golden mole  ============
                  Aardvark  ============
       Cape elephant shrew  ============
B D                 Manatee  ============
B D                     Cat  ============
             Domestic goat  ============
B D                   Sheep  ============
          Tibetan antelope  ============
            Pacific walrus  ============
B D                   Panda  ============
B D                Squirrel  ------------
      David's myotis (bat)  ------------
             Big brown bat  ============
B D                Microbat  ============
B D         Squirrel monkey  ============
B D                Marmoset  ============
B D                     Cow  ============

Inserts between block 19 and 20 in window
            Golden hamster 7119bp

Alignment block 20 of 438 in window, 153496200 - 153496225, 26 bps 
B D                   Human  agtaacccatcctcattacagaaaac
B D                   Chimp  agtaatccatcctcattacagaaaat
B D                 Gorilla  agtaaaccatcctcattacagaaaat
B D               Orangutan  agtaatccatcctcattacagaaaat
B D                  Gibbon  agtaatccatcctcattacagaaaat
B D                  Rhesus  ---aatccatcttcattacagaaaat
B D     Crab-eating macaque  ---aatccatcttcattacagaaaat
B D                  Baboon  ---aatccatcttcgttacagaaaat
B D            Green monkey  a-taatccatcctcattacagaaaat
B D                Bushbaby  agtaacccatccccattacagaaaat
         Chinese tree shrew  agtagcaaatcctcattacaaaaaat
               Prairie vole  -gtgactcatcctcatcacaggaaag
B D         Chinese hamster  -gcaatgcatcctcgttacagaacag
B D                   Mouse  agtgacctatcctcattacagaaaag
B D                     Rat  agtgacccatcctctttacagaaagg
B D                  Alpaca  agcaatttgtcctcattgcaggaaac
             Bactrian camel  agcaatctgtcctcattgcagaaaac
B D                 Dolphin  aataatccatcctcattacagaaaac
               Killer whale  aataatccatcctcattacagaaaac
B D                   Horse  agtcacccatcttcatcacagaaaat
B D        White rhinoceros  agtaacccatcttcattacagaaaat
           Black flying-fox  agtaatc---cttcattacggaaaat
B D                 Megabat  agtaatc---cttcattacagaaaat
            Star-nosed mole  tataattgaccctcactacagaaaat
B D                Elephant  aaccacctg----caccaccc-----
B D               Armadillo  agtaacccgtggtcatcacacaaaat
            Golden hamster  ==========================
    Lesser Egyptian jerboa  ==========================
              Weddell seal  ==========================
B D                Hedgehog  ==========================
B D                     Pig  ==========================
B D                  Rabbit  ==========================
          Cape golden mole  ==========================
                  Aardvark  ==========================
       Cape elephant shrew  ==========================
B D                 Manatee  ==========================
B D                     Cat  ==========================
             Domestic goat  ==========================
B D                   Sheep  ==========================
          Tibetan antelope  ==========================
            Pacific walrus  ==========================
B D                   Panda  ==========================
B D                Squirrel  --------------------------
      David's myotis (bat)  --------------------------
             Big brown bat  ==========================
B D                Microbat  ==========================
B D         Squirrel monkey  ==========================
B D                Marmoset  ==========================
B D                     Cow  ==========================

Inserts between block 20 and 21 in window
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D               Elephant 1bp

Alignment block 21 of 438 in window, 153496226 - 153496230, 5 bps 
B D                   Human  gcaga
B D                   Chimp  gcgga
B D                 Gorilla  gcgga
B D               Orangutan  gtgaa
B D                  Gibbon  gtgga
B D                  Rhesus  gtgga
B D     Crab-eating macaque  gtgga
B D                  Baboon  gtgga
B D            Green monkey  gtgga
B D                Bushbaby  gtaga
         Chinese tree shrew  ctgaa
B D                  Alpaca  ttgga
             Bactrian camel  ttgga
B D                 Dolphin  ttgga
               Killer whale  ttgga
B D                   Horse  ctgga
B D        White rhinoceros  ttgga
           Black flying-fox  ctgga
B D                 Megabat  ctgga
            Star-nosed mole  ttgga
B D                Elephant  -ggga
B D                 Manatee  -ggga
B D               Armadillo  ttgga
B D                     Rat  -----
              Prairie vole  -----
            Golden hamster  =====
B D                   Mouse  -----
    Lesser Egyptian jerboa  =====
              Weddell seal  =====
B D                Hedgehog  =====
B D                     Pig  =====
B D                  Rabbit  =====
          Cape golden mole  =====
                  Aardvark  =====
       Cape elephant shrew  =====
B D         Chinese hamster  -----
B D                     Cat  =====
             Domestic goat  =====
B D                   Sheep  =====
          Tibetan antelope  =====
            Pacific walrus  =====
B D                   Panda  =====
B D                Squirrel  -----
      David's myotis (bat)  -----
             Big brown bat  =====
B D                Microbat  =====
B D         Squirrel monkey  =====
B D                Marmoset  =====
B D                     Cow  =====

Inserts between block 21 and 22 in window
B D               Elephant 1bp
B D                Manatee 1bp

Alignment block 22 of 438 in window, 153496231 - 153496253, 23 bps 
B D                   Human  ctatac----gaaagc------atgtaaattag
B D                   Chimp  ctatac----aaaagc------atgtaaattag
B D                 Gorilla  ctatac----aaaagc------atgtaaattag
B D               Orangutan  ctatac----aaaagc------atgtaaattag
B D                  Gibbon  ctatac----aaaagc------atgtaaattag
B D                  Rhesus  ctatac----aaaagc------atgtaaattag
B D     Crab-eating macaque  ctatac----aaaagc------atgtaaattag
B D                  Baboon  ctatac----aaaagc------atgtaaattag
B D            Green monkey  ctatac----aaaagc------atgtaaattag
B D                Bushbaby  ctatat----gaaagt------acataaattag
         Chinese tree shrew  ccataccaaaaaaaaa------acataaactag
B D                  Alpaca  ctatac----aaaagc------acataaaacag
             Bactrian camel  ctatac----aaaagc------acataaaacag
B D                 Dolphin  ttatac----aaaagc------acataaaatag
               Killer whale  ttatac----aaaagc------acataaaatag
B D                   Horse  ctatgc----aaaagc------acataaaatag
B D        White rhinoceros  aaatgc----aaaagc------acataaaatag
           Black flying-fox  cgatac----gaaagc------acacaaattag
B D                 Megabat  cgatac----gaaagc------acacaaattag
            Star-nosed mole  taatac----aaaagcttttttatatgaactag
B D                Elephant  ctatgc----agaagc------atctaaattag
B D                 Manatee  ctacac----agaaat------atataaattag
           Cape golden mole  ctttac----agaaat------aaataaattag
                   Aardvark  ccacac----agaaac------atataaattag
B D               Armadillo  ccccag----aggagc------acataaattag
B D                     Rat  ---------------------------------
              Prairie vole  ---------------------------------
            Golden hamster  =================================
B D                   Mouse  ---------------------------------
    Lesser Egyptian jerboa  =================================
              Weddell seal  =================================
B D                Hedgehog  =================================
B D                     Pig  =================================
B D                  Rabbit  =================================
       Cape elephant shrew  =================================
B D         Chinese hamster  ---------------------------------
B D                     Cat  =================================
             Domestic goat  =================================
B D                   Sheep  =================================
          Tibetan antelope  =================================
            Pacific walrus  =================================
B D                   Panda  =================================
B D                Squirrel  ---------------------------------
      David's myotis (bat)  ---------------------------------
             Big brown bat  =================================
B D                Microbat  =================================
B D         Squirrel monkey  =================================
B D                Marmoset  =================================
B D                     Cow  =================================

Inserts between block 22 and 23 in window
B D               Bushbaby 2344bp

Alignment block 23 of 438 in window, 153496254 - 153496280, 27 bps 
B D                   Human  aaaataagaactatccattatgttcca
B D                   Chimp  aaaataagaactatccattatgttcca
B D                 Gorilla  aaaataagaactatccattatgttcca
B D               Orangutan  aaaataagaactatccattatgttcca
B D                  Gibbon  aaaataagaactatccattatgttcca
B D                  Rhesus  aaaataagaactatccattatgttcca
B D     Crab-eating macaque  aaaataagaagtatccattatgttcca
B D                  Baboon  aaaataagaactatccattatgttcca
B D            Green monkey  aaaataagaactatccgttatgttcca
         Chinese tree shrew  -aaaaaagaatcgttcattatgttaca
               Prairie vole  gaaatgtga--ccgccatt--------
B D         Chinese hamster  gaaatgtga--caaccattatgctgca
B D                   Mouse  aaaatgtga--cagtcattatgctgta
B D                     Rat  taaatgtga--cagccatcatgccaca
B D                  Alpaca  aaaagaagaatcattcag---gttaca
             Bactrian camel  aaaagaagaatcattcag---gttaca
B D                 Dolphin  aaaataagaaccattcac---gttaca
               Killer whale  aaaataagaaccattcac---gttaca
B D                   Horse  aaaataagaaccattcgt---gttaca
B D        White rhinoceros  aaaataagaagcactcat---attaca
           Black flying-fox  aaaataagaaccattcac---gttaca
B D                 Megabat  aaaataagaaccattcgc---gttaca
            Star-nosed mole  aaaacaagaactgttcat---attaca
B D                Elephant  aaaattagaaccatcc---acgttaca
B D                 Manatee  aaaattagaaccatccgtaatgttaca
           Cape golden mole  agaattagagtcatccataatgttaca
                   Aardvark  aaaattagagccatccataatgctaca
B D               Armadillo  aaaatgagaat-acccataatgttaca
            Golden hamster  ===========================
    Lesser Egyptian jerboa  ===========================
              Weddell seal  ===========================
B D                Hedgehog  ===========================
B D                     Pig  ===========================
B D                  Rabbit  ===========================
       Cape elephant shrew  ===========================
B D                     Cat  ===========================
B D                Bushbaby  ===========================
             Domestic goat  ===========================
B D                   Sheep  ===========================
          Tibetan antelope  ===========================
            Pacific walrus  ===========================
B D                   Panda  ===========================
B D                Squirrel  ---------------------------
      David's myotis (bat)  ---------------------------
             Big brown bat  ===========================
B D                Microbat  ===========================
B D         Squirrel monkey  ===========================
B D                Marmoset  ===========================
B D                     Cow  ===========================

Alignment block 24 of 438 in window, 153496281 - 153496295, 15 bps 
B D                   Human  aattattttgtt-ttt--
B D                   Chimp  aattattttgtt-ttt--
B D                 Gorilla  aattattttgtt-ttt--
B D               Orangutan  aattattttgtt-ttt--
B D                  Gibbon  aattattttgtt-ttt--
B D                  Rhesus  aattat----tt-ttc--
B D     Crab-eating macaque  aatt-t----tt-ttt--
B D                  Baboon  aattat----tt-ttt--
B D            Green monkey  aattat----tt-ttt--
         Chinese tree shrew  aatgacttttac-ttt--
               Prairie vole  -atgatttat-c-ctt--
B D         Chinese hamster  aatgatttctat-ttt--
B D                   Mouse  aatagtttttac-ttc--
B D                     Rat  aataaattttgc-ttc--
B D                  Alpaca  agcgattttcactttt--
             Bactrian camel  agcgattttcactttt--
B D                 Dolphin  agtgagttttac--tt--
               Killer whale  agtgagttttac-ttt--
B D                   Horse  aatgattgttac-ttc--
B D        White rhinoceros  aattatttttac-ttt--
           Black flying-fox  aatgatttttac-ttt--
B D                 Megabat  aacgatttttac-ttt--
            Star-nosed mole  aatggtttttac--ct--
B D                Elephant  aatgattttact-gtttt
B D                 Manatee  aatgattttacg-gtttt
                   Aardvark  gatgatttgact-gcttt
B D               Armadillo  aatga-------------
            Golden hamster  ==================
    Lesser Egyptian jerboa  ==================
              Weddell seal  ==================
B D                Hedgehog  ==================
B D                     Pig  ==================
B D                  Rabbit  ==================
          Cape golden mole  ==================
       Cape elephant shrew  ==================
B D                     Cat  ==================
B D                Bushbaby  ==================
             Domestic goat  ==================
B D                   Sheep  ==================
          Tibetan antelope  ==================
            Pacific walrus  ==================
B D                   Panda  ==================
B D                Squirrel  ------------------
      David's myotis (bat)  ------------------
             Big brown bat  ==================
B D                Microbat  ==================
B D         Squirrel monkey  ==================
B D                Marmoset  ==================
B D                     Cow  ==================

Inserts between block 24 and 25 in window
        Chinese tree shrew 2229bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                Dolphin 2bp
              Killer whale 2bp
B D                  Horse 2bp
B D       White rhinoceros 2bp
          Black flying-fox 2bp
B D                Megabat 2bp
           Star-nosed mole 2bp

Alignment block 25 of 438 in window, 153496296 - 153496361, 66 bps 
B D                   Human  tatgttataat-gcatcttcc-attat--ttttatatttttatctaattaacgcatgtacata-gctttt
B D                   Chimp  tatgttataat-gcatcttcc-attat--ttttatatttttatctaattaatacatgtacata-gctttt
B D                 Gorilla  tatgttataat-gcatcttcc-attat--ttttatatttttatctaattaatgcatgtacata-gctttt
B D               Orangutan  tatgttataat-gcatcttcc-attat--ttttatatttttatctaattaatgcatgtacata-gctttt
B D                  Gibbon  tatgttataat-gcatcttcc-attat--ttttatatttttatctaattaatgcatgtacata-gctttt
B D                  Rhesus  tatgttataat-gcatcttcc-attat--ttttatatttttatctaattaatgcatgtacata-gctttt
B D     Crab-eating macaque  tatgttataat-gcatcttcc-attat--ttttatatttttatctaattaatgcatgtacata-gctttt
B D                  Baboon  tatgttataat-gcatcttcc-attat--ttttatatttttatctaattaatgcatgtacata-gctttt
B D            Green monkey  tatgttataat-ccatcttcc-attat--ttttatatttttatctaattaatgcatgtacata-gctttt
               Prairie vole  tctttggtact-atttcttcc--ttccttttttat-tttttagcaaacc-atacatgcatatgccctttt
B D         Chinese hamster  tcttcgttagt-ggctctgcc--ttcc--ttttat-tttttatcaaaccaatgcatgcatatg-cctttt
B D                   Mouse  actttgttagt-gaattttcc--ttac--ttttatattttcatcaaaccaatgcttgcatatg-cctttt
B D                     Rat  actttgttagt-gagttttcc--ttac--ttttatattttcatcaaaccagtgcttgcatatg-cctttt
B D                  Alpaca  cattttctagt-gctgcctcc-tttct-tttctgtattttaatcaaactgagacatgcaccta-gctttt
             Bactrian camel  cattttctagtggctccctcc-tttct-tttctgtattttaatcaaactgagacatgcaccta-gctttt
B D                 Dolphin  tattttctaat-gcttcctc-----ct-tttttatatattcatccaattaatgcatgcgccta-gctttt
               Killer whale  tattttctaat-gcttcctc-----ct-tttttatatattcatccaattaatgcatgcgccta-gctttt
B D                   Horse  tattgtatagt-gcttcttcc-tttat-ttcttatattttcatcgaactaatacaggcaccca-gctttt
B D        White rhinoceros  tattttgtagt-tcttcttcc-tttat-tttttatatgttcatggaactaactcatccaccta-gctttt
           Black flying-fox  tattttatcat-gct--ttcc-ttt------ttatctgtgcaccaaactaacacaggcaccta-gctttt
B D                 Megabat  tattttatcat-gct--ttcc-ttt------ttatctgtgtaccaaactaacacaggcaccta-gctttt
            Star-nosed mole  tattttgtggt-gttttttcc-ttt--------------tcaccaaactaatgtatgcaccta-ac-ttt
B D                Elephant  tattttatact-gttccttcc-tttat--tttcatatgttcatgaaactaacgtacgcacata-gctttt
B D                 Manatee  cgttttatact-gcttcttcc-tttat--ttttatatgctcaggaaactaatgcctgcaccta-gctttc
                   Aardvark  tattttatact-gcttcttcc-tttac--ttttacatgttcatgaaactaatgcatacatgta-gctttt
B D               Armadillo  --ttttgtgat-gcttcttccattttt--atatatattttcatcacactaatgcatgcagaga-gctttt
            Golden hamster  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  t
                      Chimp  a
                    Gorilla  t
                  Orangutan  t
                     Gibbon  t
                     Rhesus  t
        Crab-eating macaque  t
                     Baboon  t
               Green monkey  t
               Prairie vole  t
            Chinese hamster  t
                      Mouse  t
                        Rat  t
                     Alpaca  t
             Bactrian camel  t
                    Dolphin  t
               Killer whale  t
                      Horse  t
           White rhinoceros  t
           Black flying-fox  t
                    Megabat  t
            Star-nosed mole  t
                   Elephant  t
                    Manatee  t
                   Aardvark  t
                  Armadillo  t
             Golden hamster  =
     Lesser Egyptian jerboa  =
               Weddell seal  =
                   Hedgehog  =
                        Pig  =
                     Rabbit  =
           Cape golden mole  =
        Cape elephant shrew  =
         Chinese tree shrew  =
                        Cat  =
                   Bushbaby  =
              Domestic goat  =
                      Sheep  =
           Tibetan antelope  =
             Pacific walrus  =
                      Panda  =
                   Squirrel  -
       David's myotis (bat)  -
              Big brown bat  =
                   Microbat  =
            Squirrel monkey  =
                   Marmoset  =
                        Cow  =

Inserts between block 25 and 26 in window
B D                    Rat 518bp

Alignment block 26 of 438 in window, 153496362 - 153496377, 16 bps 
B D                   Human  -taaagtcaaatagttc
B D                   Chimp  -taaagtcaaatagttc
B D                 Gorilla  -taaagtcaaatagttc
B D               Orangutan  -taaagtcaaatagttc
B D                  Gibbon  -taaagtcaaatagttc
B D                  Rhesus  -taaagtcaaatagttc
B D     Crab-eating macaque  -taaagtcaaatagttc
B D                  Baboon  -taaagtcaaatagttc
B D            Green monkey  -taaagtcaaatagttc
               Prairie vole  -taaagttaagtaattt
B D         Chinese hamster  -aaaagttaaatcattc
B D                   Mouse  -taaagataaataattc
B D                  Alpaca  -aacagttaaatagttc
             Bactrian camel  -aacagttaaatagttc
B D                 Dolphin  -aaaagttaaatcgttc
               Killer whale  -aaaagttaaatcgttc
B D                   Horse  -gaaagttcaatagttc
B D        White rhinoceros  -aaaagttcaatagttc
           Black flying-fox  -aaaagctggagagttc
B D                 Megabat  -aaaagctggagagttc
            Star-nosed mole  -aaaagttaaatagttc
B D                Elephant  aaaaaatgaaatagttc
B D                 Manatee  aaaaaatgaaatagctc
                   Aardvark  taaaaatgaaatagttc
B D               Armadillo  aacaact-aaatagtta
B D                     Rat  =================
            Golden hamster  =================
    Lesser Egyptian jerboa  =================
              Weddell seal  =================
B D                Hedgehog  =================
B D                     Pig  =================
B D                  Rabbit  =================
          Cape golden mole  =================
       Cape elephant shrew  =================
        Chinese tree shrew  =================
B D                     Cat  =================
B D                Bushbaby  =================
             Domestic goat  =================
B D                   Sheep  =================
          Tibetan antelope  =================
            Pacific walrus  =================
B D                   Panda  =================
B D                Squirrel  -----------------
      David's myotis (bat)  -----------------
             Big brown bat  =================
B D                Microbat  =================
B D         Squirrel monkey  =================
B D                Marmoset  =================
B D                     Cow  =================

Inserts between block 26 and 27 in window
           Star-nosed mole 930bp

Alignment block 27 of 438 in window, 153496378 - 153496378, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  a
               Killer whale  a
B D                   Horse  a
B D        White rhinoceros  a
           Black flying-fox  a
B D                 Megabat  a
B D                Elephant  a
B D                 Manatee  a
                   Aardvark  a
B D               Armadillo  g
B D                     Rat  =
              Prairie vole  -
            Golden hamster  =
B D                   Mouse  -
    Lesser Egyptian jerboa  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  =
B D                  Rabbit  =
          Cape golden mole  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D         Chinese hamster  -
B D                     Cat  =
B D                Bushbaby  =
           Star-nosed mole  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Pacific walrus  =
B D                   Panda  =
B D                Squirrel  -
      David's myotis (bat)  -
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  =
B D                Marmoset  =
B D                     Cow  =

Inserts between block 27 and 28 in window
B D       White rhinoceros 882bp

Alignment block 28 of 438 in window, 153496379 - 153496398, 20 bps 
B D                   Human  aaaaaa-tttataataaaaaa
B D                   Chimp  aaaaaa-tttataataaaaaa
B D                 Gorilla  aaaaaa-tttataataaaaaa
B D               Orangutan  aaaaaagtttataataaaaaa
B D                  Gibbon  aaaaag-tttataataaaaaa
B D                  Rhesus  aaaaag-tttataataagaaa
B D     Crab-eating macaque  aaaaag-tttataataagaaa
B D                  Baboon  aaaaag-tttataataagaaa
B D            Green monkey  aaaaag-tttataataagaaa
               Prairie vole  -agatg-tttatactacaaaa
B D         Chinese hamster  -agatg-tttgtactacaaaa
B D                   Mouse  -agatg-tttatactacaaaa
B D                  Alpaca  gaaaag-cttattattaaaaa
             Bactrian camel  gaaaag-cttattattaaaaa
B D                 Dolphin  gaaaag-cttataataataaa
               Killer whale  gaaaag-cttataataataaa
B D                   Horse  gagaag-cttataatagaaaa
           Black flying-fox  gaaacg-atcgtaatgaacaa
B D                 Megabat  gaaacg-atcgtaatgaacaa
B D                Elephant  gaaaaagcttatgataaaaaa
B D                 Manatee  gaaaaa-cttataataaaaaa
                   Aardvark  taaaag-cttataataaaaaa
B D               Armadillo  gaaaag-ctgatcctgagaaa
B D                     Rat  =====================
            Golden hamster  =====================
    Lesser Egyptian jerboa  =====================
              Weddell seal  =====================
B D                Hedgehog  =====================
B D                     Pig  =====================
B D                  Rabbit  =====================
          Cape golden mole  =====================
       Cape elephant shrew  =====================
        Chinese tree shrew  =====================
B D                     Cat  =====================
B D                Bushbaby  =====================
           Star-nosed mole  =====================
             Domestic goat  =====================
B D                   Sheep  =====================
          Tibetan antelope  =====================
            Pacific walrus  =====================
B D                   Panda  =====================
B D        White rhinoceros  =====================
B D                Squirrel  ---------------------
      David's myotis (bat)  ---------------------
             Big brown bat  =====================
B D                Microbat  =====================
B D         Squirrel monkey  =====================
B D                Marmoset  =====================
B D                     Cow  =====================

Inserts between block 28 and 29 in window
              Prairie vole 1bp
B D        Chinese hamster 532bp
B D                 Alpaca 898bp
            Bactrian camel 883bp
              Killer whale 8bp
B D               Elephant 1953bp
B D                Manatee 2100bp
                  Aardvark 1bp

Alignment block 29 of 438 in window, 153496399 - 153496401, 3 bps 
B D                   Human  ttg-
B D                   Chimp  ttg-
B D                 Gorilla  ttg-
B D               Orangutan  ttg-
B D                  Gibbon  tta-
B D                  Rhesus  tta-
B D     Crab-eating macaque  tta-
B D                  Baboon  tta-
B D            Green monkey  tta-
               Prairie vole  ttg-
               Killer whale  -tg-
B D                   Horse  -ta-
           Black flying-fox  -ta-
B D                 Megabat  -ta-
                   Aardvark  -taa
B D               Armadillo  -taa
B D                     Rat  ====
            Golden hamster  ====
B D                   Mouse  ----
    Lesser Egyptian jerboa  ====
              Weddell seal  ====
B D                Hedgehog  ====
B D                     Pig  ====
B D                  Rabbit  ====
          Cape golden mole  ====
B D                 Dolphin  ====
       Cape elephant shrew  ====
        Chinese tree shrew  ====
B D                 Manatee  ====
B D                Elephant  ====
B D         Chinese hamster  ====
B D                     Cat  ====
B D                Bushbaby  ====
           Star-nosed mole  ====
             Domestic goat  ====
B D                   Sheep  ====
          Tibetan antelope  ====
            Bactrian camel  ====
B D                  Alpaca  ====
            Pacific walrus  ====
B D                   Panda  ====
B D        White rhinoceros  ====
B D                Squirrel  ----
      David's myotis (bat)  ----
             Big brown bat  ====
B D                Microbat  ====
B D         Squirrel monkey  ====
B D                Marmoset  ====
B D                     Cow  ====

Inserts between block 29 and 30 in window
              Killer whale 1bp
B D                  Horse 1bp
          Black flying-fox 1bp
B D                Megabat 1bp

Alignment block 30 of 438 in window, 153496402 - 153496409, 8 bps 
B D                   Human  gtattccc
B D                   Chimp  gtattccc
B D                 Gorilla  gtattccc
B D               Orangutan  gtattccc
B D                  Gibbon  gtattccc
B D                  Rhesus  gtattccc
B D     Crab-eating macaque  gtattccc
B D                  Baboon  gtattccc
B D            Green monkey  gtattccc
               Prairie vole  ccctgtcc
B D                   Mouse  gcatctcc
               Killer whale  acattccc
           Black flying-fox  gcattccc
B D                 Megabat  gcattccc
                   Aardvark  gtgttccc
B D               Armadillo  gagtttcc
B D                     Rat  ========
            Golden hamster  ========
    Lesser Egyptian jerboa  ========
              Weddell seal  ========
B D                Hedgehog  ========
B D                     Pig  ========
B D                  Rabbit  ========
          Cape golden mole  ========
B D                 Dolphin  ========
       Cape elephant shrew  ========
        Chinese tree shrew  ========
B D                 Manatee  ========
B D                Elephant  ========
B D         Chinese hamster  ========
B D                     Cat  ========
B D                Bushbaby  ========
           Star-nosed mole  ========
             Domestic goat  ========
B D                   Sheep  ========
          Tibetan antelope  ========
            Bactrian camel  ========
B D                  Alpaca  ========
            Pacific walrus  ========
B D                   Panda  ========
B D        White rhinoceros  ========
B D                   Horse  ========
B D                Squirrel  --------
      David's myotis (bat)  --------
             Big brown bat  ========
B D                Microbat  ========
B D         Squirrel monkey  ========
B D                Marmoset  ========
B D                     Cow  ========

Inserts between block 30 and 31 in window
              Killer whale 667bp
          Black flying-fox 287bp
B D                Megabat 1137bp
B D              Armadillo 680bp

Alignment block 31 of 438 in window, 153496410 - 153496420, 11 bps 
B D                   Human  --actatgcagcc
B D                   Chimp  --actatgcaggc
B D                 Gorilla  --actatgcaggc
B D               Orangutan  --actatgcagcc
B D                  Gibbon  --actatgcagcc
B D                  Rhesus  --actatgcagcc
B D     Crab-eating macaque  --actatgcagcc
B D                  Baboon  --gctatgcagcc
B D            Green monkey  --actatgcagcc
               Prairie vole  --tcactgcagtc
B D                   Mouse  --ctggggtggcc
                   Aardvark  tgac--tgcagtc
B D                     Rat  =============
            Golden hamster  =============
    Lesser Egyptian jerboa  =============
              Weddell seal  =============
B D                Hedgehog  =============
B D                     Pig  =============
B D                  Rabbit  =============
          Cape golden mole  =============
B D                 Megabat  =============
B D                 Dolphin  =============
       Cape elephant shrew  =============
        Chinese tree shrew  =============
B D                 Manatee  =============
B D                Elephant  =============
B D         Chinese hamster  =============
B D                     Cat  =============
B D                Bushbaby  =============
           Star-nosed mole  =============
             Domestic goat  =============
B D                   Sheep  =============
          Tibetan antelope  =============
            Bactrian camel  =============
B D                  Alpaca  =============
            Pacific walrus  =============
B D                   Panda  =============
              Killer whale  =============
          Black flying-fox  =============
B D        White rhinoceros  =============
B D                   Horse  =============
B D                Squirrel  -------------
B D               Armadillo  =============
      David's myotis (bat)  -------------
             Big brown bat  =============
B D                Microbat  =============
B D         Squirrel monkey  =============
B D                Marmoset  =============
B D                     Cow  =============

Inserts between block 31 and 32 in window
              Prairie vole 1800bp

Alignment block 32 of 438 in window, 153496421 - 153496422, 2 bps 
B D                   Human  at
B D                   Chimp  at
B D                 Gorilla  at
B D               Orangutan  at
B D                  Gibbon  at
B D                  Rhesus  at
B D     Crab-eating macaque  at
B D                  Baboon  at
B D            Green monkey  at
B D                   Mouse  at
                   Aardvark  ct
B D                     Rat  ==
              Prairie vole  ==
            Golden hamster  ==
    Lesser Egyptian jerboa  ==
              Weddell seal  ==
B D                Hedgehog  ==
B D                     Pig  ==
B D                  Rabbit  ==
          Cape golden mole  ==
B D                 Megabat  ==
B D                 Dolphin  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                 Manatee  ==
B D                Elephant  ==
B D         Chinese hamster  ==
B D                     Cat  ==
B D                Bushbaby  ==
           Star-nosed mole  ==
             Domestic goat  ==
B D                   Sheep  ==
          Tibetan antelope  ==
            Bactrian camel  ==
B D                  Alpaca  ==
            Pacific walrus  ==
B D                   Panda  ==
              Killer whale  ==
          Black flying-fox  ==
B D        White rhinoceros  ==
B D                   Horse  ==
B D                Squirrel  --
B D               Armadillo  ==
      David's myotis (bat)  --
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  ==
B D                Marmoset  ==
B D                     Cow  ==

Inserts between block 32 and 33 in window
B D                  Mouse 1539bp

Alignment block 33 of 438 in window, 153496423 - 153496423, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
                   Aardvark  a
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  =
B D                  Rabbit  =
          Cape golden mole  =
B D                 Megabat  =
B D                 Dolphin  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                 Manatee  =
B D                Elephant  =
B D         Chinese hamster  =
B D                     Cat  =
B D                Bushbaby  =
           Star-nosed mole  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  =
B D                  Alpaca  =
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
          Black flying-fox  =
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  -
B D               Armadillo  =
      David's myotis (bat)  -
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  =
B D                Marmoset  =
B D                     Cow  =

Inserts between block 33 and 34 in window
                  Aardvark 11423bp

Alignment block 34 of 438 in window, 153496424 - 153496438, 15 bps 
B D                   Human  aaaaggaatgagttc
B D                   Chimp  aaaaagaatgagttc
B D                 Gorilla  aaaaagaatgagttc
B D               Orangutan  aaaaataatgagttc
B D                  Gibbon  aaaaagaatgagttc
B D                  Rhesus  aaaaagaatgagttc
B D     Crab-eating macaque  aaaaagaatgagttc
B D                  Baboon  aaaaagaatgagttc
B D            Green monkey  aaaaagaatgagttc
B D                     Rat  ===============
              Prairie vole  ===============
            Golden hamster  ===============
B D                   Mouse  ===============
    Lesser Egyptian jerboa  ===============
              Weddell seal  ===============
B D                Hedgehog  ===============
B D                     Pig  ===============
B D                  Rabbit  ===============
          Cape golden mole  ===============
                  Aardvark  ===============
B D                 Megabat  ===============
B D                 Dolphin  ===============
       Cape elephant shrew  ===============
        Chinese tree shrew  ===============
B D                 Manatee  ===============
B D                Elephant  ===============
B D         Chinese hamster  ===============
B D                     Cat  ===============
B D                Bushbaby  ===============
           Star-nosed mole  ===============
             Domestic goat  ===============
B D                   Sheep  ===============
          Tibetan antelope  ===============
            Bactrian camel  ===============
B D                  Alpaca  ===============
            Pacific walrus  ===============
B D                   Panda  ===============
              Killer whale  ===============
          Black flying-fox  ===============
B D        White rhinoceros  ===============
B D                   Horse  ===============
B D                Squirrel  ---------------
B D               Armadillo  ===============
      David's myotis (bat)  ---------------
             Big brown bat  ===============
B D                Microbat  ===============
B D         Squirrel monkey  ===============
B D                Marmoset  ===============
B D                     Cow  ===============

Inserts between block 34 and 35 in window
B D                 Baboon 1419bp

Alignment block 35 of 438 in window, 153496439 - 153496759, 321 bps 
B D                   Human  atgt-ctctgcagggacatggatgaagctggaagccatcaatctcagcaagctaacacaggaatggaaaa
B D                   Chimp  atgt-ctttgcagggacatggatgaagccggaagccatcaatctcagcaagctaacacaggaatggaaaa
B D                 Gorilla  atgt-ctttgcagggacatggatgaagctggaagccatcaatctcagcaagctaacacaggaatggaaaa
B D               Orangutan  atgtcctttgcagggacgtggatgaagctggaagccatcaatctcagcaaactaacacaggaatggaaaa
B D                  Gibbon  atgtcctttgcagggacatggatgaagctggaagccatcaatctcatgaaactaacacaggaatggaaaa
B D                  Rhesus  atgtcctttgcagggacatggatgaagctggaagccattgttctcagcaaactaacacaggaacagaaaa
B D     Crab-eating macaque  atgtcctttgcagggacatggatgaagctggaagccattgttctcagcaaactaacacaggaacagaaaa
B D            Green monkey  atgtcctttgcagggacatggatgaagctggaagccattgttctcagcaaactaacacaggaacagaaaa
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                  Baboon  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  ccaaacactgcatgttttcactcataaatgggagtcgaacaatgagaacacatggacacagggaggggaa
                      Chimp  ccaaacactgcatgttttcactcataaatgggagtcgaacaacgagaacacatggacacagggaggggaa
                    Gorilla  ccaaacactgcatgttttcactcataaatgggagtcgaacaatgagaacacatggacacagggaggggaa
                  Orangutan  ccaaacaccgcatgttttcactcataaatgggagtcgaacaatgagaacacatggacacatggaggggaa
                     Gibbon  ccaaacactgcatgttttcactcataaatgggagtcgaacaatgagaacacatggacacagggaggggaa
                     Rhesus  ccaaacactgcatgttctcactcataaataggagtccaacaatgagaacacatggacacagggaggggaa
        Crab-eating macaque  ccaaacactgcatgttctcactcataaatgggagtccaacaatgagaacacatggacacagggaggggaa
               Green monkey  ccaaacactgcatgttctcactcataaatgggtgtcgaacaatgagaacacatggacacagggaggggaa
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                     Baboon  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Megabat  ======================================================================
                    Dolphin  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ----------------------------------------------------------------------
                  Armadillo  ======================================================================
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                        Cow  ======================================================================

                      Human  catcacaaacccgggccagtcagagggtaggggacaagggcagggagagcattaggacaaatacctaata
                      Chimp  catcacacacccgggccagtcagagggtaggggacaagggcagggagagcattaggacaaatacctaata
                    Gorilla  catcacacacccgggccagtcagagggtagaggacaagggcagggagagcattaggacaaatacctaata
                  Orangutan  catcacacacctgggccagtcggagggtaggggacaaggggagggagagcattaggacaaatacctaata
                     Gibbon  catcacacacccgggccagttggagggtaggggacaaggggagggagagcattaggacaaatacctaata
                     Rhesus  catcacacacccgggcctgttggggggtaggggacaaggggagggagagctttaggacaaatacctaat-
        Crab-eating macaque  catcacacacccgggcctgtcggggggtaggggacaaggggagggagagctttaggacaaatacctaat-
               Green monkey  caccacacacccgggcctgtcgggggataggggacaaggggagggagagctttaggacaaatacctaat-
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                     Baboon  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Megabat  ======================================================================
                    Dolphin  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ----------------------------------------------------------------------
                  Armadillo  ======================================================================
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                        Cow  ======================================================================

                      Human  gcatgtggggcttaaaacctagatgacaggttgataggtgcagcaaaccaccatggcacatgtacacc--
                      Chimp  gcatgtggggcttaaaacctagatgacaggttgatgggtgcagcaaaccaccatggcacatgtacacc--
                    Gorilla  gcatgtggggcttaaaacctagatgacaggttgataggtgcagcaaaccaccatggcacatgtacacc--
                  Orangutan  gcatgtggggcttaaaacctagatgacaggttgataggtgcagcaaaccaccatggcacatgtacacc--
                     Gibbon  gcatgtggggcttaaaacctagatgacaggttgatacgtgcagcaaactaccatggcacatgtacacc--
                     Rhesus  gcatgtggggcttaaaacctagatgacaggttgataggtgcagcaaaccaccatggcacaggtataccta
        Crab-eating macaque  gcatgtggggcttaaaacctagatgacaggttgataggtgcagcaaaccaccatggcacaggtatacc--
               Green monkey  gcatgtggggcttaaaacctagatgacaggttgataggtgcagcaaaccaccatggcacatgtataccta
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                     Baboon  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Megabat  ======================================================================
                    Dolphin  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
            Star-nosed mole  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
           Black flying-fox  ======================================================================
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
                   Squirrel  ----------------------------------------------------------------------
                  Armadillo  ======================================================================
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                        Cow  ======================================================================

                      Human  ---------tatgtaacaaacctgcacactctgcacaggtatcccagaactta
                      Chimp  ---------tatgtaacaaacctgcacactctgcacaggtatcccagaactta
                    Gorilla  ---------tatgtaacaaacctgcacactctgcacaggtatcccagaactta
                  Orangutan  ---------tatgtaacaaacctgcacgctctgcacaggtatcccagaactta
                     Gibbon  ---------tatgtaacaaacctgcacactctgcacaggtatcccagaactta
                     Rhesus  tgttatacttatgtaacaaacctgcacactctgcacatgtatcccagaactta
        Crab-eating macaque  tgttatacttatgtaacaaacctgcacactctgcacatgtatcccagaactta
               Green monkey  tgttatacttatgtaacaaacctgcacagtctgcacatgtatcccagaactta
                        Rat  =====================================================
               Prairie vole  =====================================================
             Golden hamster  =====================================================
                      Mouse  =====================================================
     Lesser Egyptian jerboa  =====================================================
               Weddell seal  =====================================================
                   Hedgehog  =====================================================
                     Baboon  =====================================================
                        Pig  =====================================================
                     Rabbit  =====================================================
           Cape golden mole  =====================================================
                   Aardvark  =====================================================
                    Megabat  =====================================================
                    Dolphin  =====================================================
        Cape elephant shrew  =====================================================
         Chinese tree shrew  =====================================================
                    Manatee  =====================================================
                   Elephant  =====================================================
            Chinese hamster  =====================================================
                        Cat  =====================================================
                   Bushbaby  =====================================================
            Star-nosed mole  =====================================================
              Domestic goat  =====================================================
                      Sheep  =====================================================
           Tibetan antelope  =====================================================
             Bactrian camel  =====================================================
                     Alpaca  =====================================================
             Pacific walrus  =====================================================
                      Panda  =====================================================
               Killer whale  =====================================================
           Black flying-fox  =====================================================
           White rhinoceros  =====================================================
                      Horse  =====================================================
                   Squirrel  -----------------------------------------------------
                  Armadillo  =====================================================
       David's myotis (bat)  -----------------------------------------------------
              Big brown bat  =====================================================
                   Microbat  =====================================================
            Squirrel monkey  =====================================================
                   Marmoset  =====================================================
                        Cow  =====================================================

Alignment block 36 of 438 in window, 153496760 - 153496827, 68 bps 
B D                   Human  aagtaaaataaaaaata--aaaataataaataataataataacaattaaaaaataaaa------------
B D                   Chimp  aagtaaaataaaaaata--aaaataataaataataataataacaattaaaaaataaaa------------
B D                 Gorilla  aagtaaaataaaaaata--aaaacaataaataataataat---aattaaaaaataaaa------------
B D               Orangutan  aagtaaaataaaaaata--aaaataataaataataatcataacaattaaaaaataaaa------------
B D                  Gibbon  aagtaaaataaaaaaca--aaagtgataaataataataataacaatttaaaaataaaa------------
B D                  Rhesus  aagtaaaataaa---------------aaataataataataacaatt-aaaaataaaa------------
B D     Crab-eating macaque  aagtaaaataaa---------------aaataataataataacaatt-aaaaataaaa------------
B D            Green monkey  aagttaaataaa---------------aaataataataataacaatt-aaaaatgaaa------------
            Star-nosed mole  aaacaaaataataattcataaaagtataaataataatgat-----tttaaaagttatatcattcagacaa
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                  Baboon  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  ----ataat-aaaatta-
                      Chimp  ----ataat-aaaatta-
                    Gorilla  ----ataat-aaaatta-
                  Orangutan  ----atagt-agaatta-
                     Gibbon  ----ataat-aaaatta-
                     Rhesus  ----ataat-aaaatta-
        Crab-eating macaque  ----ataat-aaaatta-
               Green monkey  ----ataat-aaaatta-
            Star-nosed mole  gcttataataaaaagtaa
                        Rat  ==================
               Prairie vole  ==================
             Golden hamster  ==================
                      Mouse  ==================
     Lesser Egyptian jerboa  ==================
               Weddell seal  ==================
                   Hedgehog  ==================
                     Baboon  ==================
                        Pig  ==================
                     Rabbit  ==================
           Cape golden mole  ==================
                   Aardvark  ==================
                    Megabat  ==================
                    Dolphin  ==================
        Cape elephant shrew  ==================
         Chinese tree shrew  ==================
                    Manatee  ==================
                   Elephant  ==================
            Chinese hamster  ==================
                        Cat  ==================
                   Bushbaby  ==================
              Domestic goat  ==================
                      Sheep  ==================
           Tibetan antelope  ==================
             Bactrian camel  ==================
                     Alpaca  ==================
             Pacific walrus  ==================
                      Panda  ==================
               Killer whale  ==================
           Black flying-fox  ==================
           White rhinoceros  ==================
                      Horse  ==================
                   Squirrel  ------------------
                  Armadillo  ==================
       David's myotis (bat)  ------------------
              Big brown bat  ==================
                   Microbat  ==================
            Squirrel monkey  ==================
                   Marmoset  ==================
                        Cow  ==================

Alignment block 37 of 438 in window, 153496828 - 153496878, 51 bps 
B D                   Human  gtattccctgccttacctgcagtccctctcctcaaaaggaatcaatcgttt
B D                   Chimp  gtattccctgccttacctgcagtccctctcctcaaaaggaatcaatcgttt
B D                 Gorilla  gtattccctgccctacctgcagtccctctcctcaaaaggaatcaatcgttt
B D               Orangutan  gtattccctgccctacctgcagtccctctcctcaaaaggaatcaatcattt
B D                  Gibbon  gtattccctgccctacctgcagtccctctcctcaaaaggaatcaatcattt
B D                  Rhesus  gtgttccctgtcctacctgcagtccctcttctcaaaa-gaatcaatcattt
B D     Crab-eating macaque  gtattccctgtcctacctgcagtccctcttctcaaaa-gaatcaatcattt
B D            Green monkey  gtattccctgtcctacctgcagtccctcttctcaaaa-gaatcaatcattt
B D                   Horse  gcgtcacctgccctgcctgcagcccctctcctca----aatgcagtcattt
            Star-nosed mole  gcgctccctgcccagcctgcaggccgtcccctgg----gaagcaatggctg
B D                     Rat  ===================================================
              Prairie vole  ===================================================
            Golden hamster  ===================================================
B D                   Mouse  ===================================================
    Lesser Egyptian jerboa  ===================================================
              Weddell seal  ===================================================
B D                Hedgehog  ===================================================
B D                  Baboon  ===================================================
B D                     Pig  ===================================================
B D                  Rabbit  ===================================================
          Cape golden mole  ===================================================
                  Aardvark  ===================================================
B D                 Megabat  ===================================================
B D                 Dolphin  ===================================================
       Cape elephant shrew  ===================================================
        Chinese tree shrew  ===================================================
B D                 Manatee  ===================================================
B D                Elephant  ===================================================
B D         Chinese hamster  ===================================================
B D                     Cat  ===================================================
B D                Bushbaby  ===================================================
             Domestic goat  ===================================================
B D                   Sheep  ===================================================
          Tibetan antelope  ===================================================
            Bactrian camel  ===================================================
B D                  Alpaca  ===================================================
            Pacific walrus  ===================================================
B D                   Panda  ===================================================
              Killer whale  ===================================================
          Black flying-fox  ===================================================
B D        White rhinoceros  ===================================================
B D                Squirrel  ---------------------------------------------------
B D               Armadillo  ===================================================
      David's myotis (bat)  ---------------------------------------------------
             Big brown bat  ===================================================
B D                Microbat  ===================================================
B D         Squirrel monkey  ===================================================
B D                Marmoset  ===================================================
B D                     Cow  ===================================================

Alignment block 38 of 438 in window, 153496879 - 153497043, 165 bps 
B D                   Human  taacaatttctca-tcacttattgagtg-----------tactcccatcattctaataacgtggcttacg
B D                   Chimp  taacaatttctca-tcacttattgagtg-----------tactcccatcattctaataacgtggcttatg
B D                 Gorilla  taacaatttctcattcacttattgagtg-----------tactcccatcattctaataacgtggcttaca
B D               Orangutan  taacaatttctccttcacttattgggtg-----------tactcccatcattctagtaacgtggcttacg
B D                  Gibbon  taacaatttctcgttcacttactgggtg-----------tactcccatcattctaataatgtggcttacg
B D                  Rhesus  taacaatttctcgttcacttatttggtg-----------tactcccatcactctaataatgtggcttatg
B D     Crab-eating macaque  taacaatttctcgttcacttatttggtg-----------tactcccatcactctaataatgtggcttatg
B D            Green monkey  taacaatttctcgttcacttatttggtg-----------tactcccatcactctaataatgtggcttatg
B D                   Horse  taacgacttctcttgctcttgttctgcactcagtctgtttaccaccatcattcgaacactgtggcttatg
B D        White rhinoceros  taacaatttctctttcacttattctgtgctcaatctctctaccaccgtcattctcatagtgtggcttatg
            Star-nosed mole  tcagggtttcgctttcacttatcctgtgccc----------ccgccaccagcgctaaagccaggctccgg
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                  Baboon  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  tttctattacttaatgcattgcctttaaacattatctgcggaatgcctacaatgaaagatagggatataa
                      Chimp  tttctattacttaatgcattgcctttaaacattatctgcggaatgcctacaatgaaagatagggatataa
                    Gorilla  tttctattacttaatgcattgcctttagacattatctgtggaatgcctacaatgaaagatagggatataa
                  Orangutan  tttctattacttaatgcattgcctttagacattatctgcggaatgcctacaacgaaagagagggatgtaa
                     Gibbon  tttctattacttaatgcattgcctttagacattatctgcggaatgcctacaatgaaagatagggatgtaa
                     Rhesus  tttctattacttaatgcattgtctttagacattatctgcggaatgcctacaatggaagatagggatgtaa
        Crab-eating macaque  tttctattacttaatgcgttgtctttagacattatctgcggaatgcctacaatggaagatagggatgtaa
               Green monkey  tttctattatttaatgcattgtctttagacattatctgcggaatgcctacaatgaaagatagggatgtaa
                      Horse  ttcctattactttgtgtgttgacttgagacattatctgctgaatgccgaccgtgaaagacaaagatgtca
           White rhinoceros  cttcta-------------tgacttgagacattatctgctgacttcctaccatgaaagataaatatttaa
            Star-nosed mole  tttcct-tacttcggct--tgagtttggaccgcacgtgtttaaagcctatgatgagcgagaaaagctcag
                        Rat  ======================================================================
               Prairie vole  ======================================================================
             Golden hamster  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
               Weddell seal  ======================================================================
                   Hedgehog  ======================================================================
                     Baboon  ======================================================================
                        Pig  ======================================================================
                     Rabbit  ======================================================================
           Cape golden mole  ======================================================================
                   Aardvark  ======================================================================
                    Megabat  ======================================================================
                    Dolphin  ======================================================================
        Cape elephant shrew  ======================================================================
         Chinese tree shrew  ======================================================================
                    Manatee  ======================================================================
                   Elephant  ======================================================================
            Chinese hamster  ======================================================================
                        Cat  ======================================================================
                   Bushbaby  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ======================================================================
             Bactrian camel  ======================================================================
                     Alpaca  ======================================================================
             Pacific walrus  ======================================================================
                      Panda  ======================================================================
               Killer whale  ======================================================================
           Black flying-fox  ======================================================================
                   Squirrel  ----------------------------------------------------------------------
                  Armadillo  ======================================================================
       David's myotis (bat)  ----------------------------------------------------------------------
              Big brown bat  ======================================================================
                   Microbat  ======================================================================
            Squirrel monkey  ======================================================================
                   Marmoset  ======================================================================
                        Cow  ======================================================================

                      Human  ctctcttttgttctacttcccaactcttct--ctattct
                      Chimp  ctctcttttgttctacttcccaactcttca--ctgttct
                    Gorilla  ctctcttttgttctacttcccaactcttct--ctattct
                  Orangutan  ctctcttttgttctacttcccaactcttct--ctattct
                     Gibbon  ctcccttttgttctacttcccaactcttct--ctattct
                     Rhesus  ctctcttttgttctacttcccaactctgct--ctattct
        Crab-eating macaque  ctctcttttgttctacttcccaactctgct--ctattct
               Green monkey  ctctcttttgttctacttcccaa--ctgct--ctattct
                      Horse  ctcgcc-ttgaactatttcccaactcctctgcctatctt
           White rhinoceros  ctcgcctttgtactgtttcccaa---ctctccctatctt
            Star-nosed mole  tgtgcc-ttgttc---tccccaactcctctgcctcgctt
                        Rat  =======================================
               Prairie vole  =======================================
             Golden hamster  =======================================
                      Mouse  =======================================
     Lesser Egyptian jerboa  =======================================
               Weddell seal  =======================================
                   Hedgehog  =======================================
                     Baboon  =======================================
                        Pig  =======================================
                     Rabbit  =======================================
           Cape golden mole  =======================================
                   Aardvark  =======================================
                    Megabat  =======================================
                    Dolphin  =======================================
        Cape elephant shrew  =======================================
         Chinese tree shrew  =======================================
                    Manatee  =======================================
                   Elephant  =======================================
            Chinese hamster  =======================================
                        Cat  =======================================
                   Bushbaby  =======================================
              Domestic goat  =======================================
                      Sheep  =======================================
           Tibetan antelope  =======================================
             Bactrian camel  =======================================
                     Alpaca  =======================================
             Pacific walrus  =======================================
                      Panda  =======================================
               Killer whale  =======================================
           Black flying-fox  =======================================
                   Squirrel  ---------------------------------------
                  Armadillo  =======================================
       David's myotis (bat)  ---------------------------------------
              Big brown bat  =======================================
                   Microbat  =======================================
            Squirrel monkey  =======================================
                   Marmoset  =======================================
                        Cow  =======================================

Alignment block 39 of 438 in window, 153497044 - 153497079, 36 bps 
B D                   Human  cctccccagttttgatagttatattataattttagt
B D                   Chimp  cctccccagttttgatagttatattataattttagc
B D                 Gorilla  cctctccagttttgatagttatattataattttagt
B D               Orangutan  cctccccagttttgatagttatattataattttact
B D                  Gibbon  cctccccagttttgatag-----ttataattttagt
B D                  Rhesus  cctccgcagttttgatagttatattataattttagt
B D     Crab-eating macaque  cctccgcagttttgatagttatattataattttagt
B D            Green monkey  cctccccagttttgatagttatattataattttagt
         Chinese tree shrew  cctcccaagttttgatgg-----ctgttattttagt
B D                   Horse  cctcc-gagtgttgatagctatattattattttagc
B D        White rhinoceros  cctcctgagttctgatagttatattattattttagc
            Star-nosed mole  cttcc-cagt-ttga-ggttgtgttattgttttagc
B D                     Rat  ====================================
              Prairie vole  ====================================
            Golden hamster  ====================================
B D                   Mouse  ====================================
    Lesser Egyptian jerboa  ====================================
              Weddell seal  ====================================
B D                Hedgehog  ====================================
B D                  Baboon  ====================================
B D                     Pig  ====================================
B D                  Rabbit  ====================================
          Cape golden mole  ====================================
                  Aardvark  ====================================
B D                 Megabat  ====================================
B D                 Dolphin  ====================================
       Cape elephant shrew  ====================================
B D                 Manatee  ====================================
B D                Elephant  ====================================
B D         Chinese hamster  ====================================
B D                     Cat  ====================================
B D                Bushbaby  ====================================
             Domestic goat  ====================================
B D                   Sheep  ====================================
          Tibetan antelope  ====================================
            Bactrian camel  ====================================
B D                  Alpaca  ====================================
            Pacific walrus  ====================================
B D                   Panda  ====================================
              Killer whale  ====================================
          Black flying-fox  ====================================
B D                Squirrel  ------------------------------------
B D               Armadillo  ====================================
      David's myotis (bat)  ------------------------------------
             Big brown bat  ====================================
B D                Microbat  ====================================
B D         Squirrel monkey  ====================================
B D                Marmoset  ====================================
B D                     Cow  ====================================

Alignment block 40 of 438 in window, 153497080 - 153497178, 99 bps 
B D                   Human  tcttctcttgactacctttgtaacttttaataataagcctaagcctccctttgt-ttt-----cagacag
B D                   Chimp  tcttctcttgactacctttgtaacttttaataataagcctaagcctccctttgt-ttt-----cagacag
B D                 Gorilla  tcttctcttgactacctttataacttttaataataagcctaagcctccctttgt-ttt-----cagacag
B D               Orangutan  tattctcttgactacctttgtaatttttaataataagcctaagcctccctttgt-ttt-----cagacag
B D                  Gibbon  tcttctcttgactacctttgtaacttttaataataagcctaagcctccttttgt-ttt-----cagacag
B D                  Rhesus  tcttctcttgactacctttgtaacttttaataataagtctaagcctccctttgt-ttt-----cagacag
B D     Crab-eating macaque  tcttctcttgactacctttgtaacttttaataataagtctaagcctccctttgt-ttt-----cagacag
B D            Green monkey  tcttctcttgactacctttgtaacttttaataataagtctaagcctccctttgt-ttt-----cagacag
         Chinese tree shrew  tcttctcttgactacctttgtaac-tttaataataaaactaagcctccctgtgt---------------g
B D         Chinese hamster  tctctccatgcccatcttagtgactcctaatcatagccctaagcc----tgtgtgctt-----caggctg
B D                   Horse  tcttctcttgactgcctgtgtaacttctcataagaaacctaaacctcgcgtggt-ttc-atctcagccag
B D        White rhinoceros  tcttctcttgactac------aacttctcataagaaatctaaacctctcttggt-ttc-gtttcagccag
            Star-nosed mole  t-ttcccttgactcc----------------------ctgaaaccgctctttgt-ttctgtct---ccaa
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                  Baboon  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D                Squirrel  ----------------------------------------------------------------------
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  tgcctctgaactccccacactagaag---agga-tatgt
                      Chimp  tgcctctgaactccccaccctagaag---agga-tatgt
                    Gorilla  tgcctctgaactccccacactagaag---agga-tatgt
                  Orangutan  tgcctctgaactccccacactagaag---agga-tatgt
                     Gibbon  tgcctctgaactccccacactagaag---agga-tatgt
                     Rhesus  tgcctctgaactccccacactagaag---agga-tatgt
        Crab-eating macaque  tgcctctgaactccccacactagaag---agga-tatgt
               Green monkey  tgcctctgaactccccacactagaag---agga-tatgt
         Chinese tree shrew  atgttcttagttgcccattctataagataagga-cacgt
            Chinese hamster  tccctctgcactcctgactctaagat---ggaa------
                      Horse  ggcctctcccctccctactctgttag---atgaggatgt
           White rhinoceros  ggcctctcacctccccattctgtaag---atgaagatgt
            Star-nosed mole  agcctctcagttcccca-tgtataaa---ggggggctgc
                        Rat  =======================================
               Prairie vole  =======================================
             Golden hamster  =======================================
                      Mouse  =======================================
     Lesser Egyptian jerboa  =======================================
               Weddell seal  =======================================
                   Hedgehog  =======================================
                     Baboon  =======================================
                        Pig  =======================================
                     Rabbit  =======================================
           Cape golden mole  =======================================
                   Aardvark  =======================================
                    Megabat  =======================================
                    Dolphin  =======================================
        Cape elephant shrew  =======================================
                    Manatee  =======================================
                   Elephant  =======================================
                        Cat  =======================================
                   Bushbaby  =======================================
              Domestic goat  =======================================
                      Sheep  =======================================
           Tibetan antelope  =======================================
             Bactrian camel  =======================================
                     Alpaca  =======================================
             Pacific walrus  =======================================
                      Panda  =======================================
               Killer whale  =======================================
           Black flying-fox  =======================================
                   Squirrel  ---------------------------------------
                  Armadillo  =======================================
       David's myotis (bat)  ---------------------------------------
              Big brown bat  =======================================
                   Microbat  =======================================
            Squirrel monkey  =======================================
                   Marmoset  =======================================
                        Cow  =======================================

Alignment block 41 of 438 in window, 153497179 - 153497313, 135 bps 
B D                   Human  gtgtctccccgcttccctccaacctccctcctcaccttcctcctcccaccttctgtcagttacaacttta
B D                   Chimp  gtgtctccccgcttccctccaacctccctcctcaccttcctcctcccaccttctgtcagttacaacttta
B D                 Gorilla  gtgtctccccgcttccctccaacctccctcctcaccttcctcctcccaccttctgtcagttacaacttta
B D               Orangutan  gtgtctccccgcttccctccaacctccctcctcaccttcttcctcccaccttctgtcagttacaacttta
B D                  Gibbon  gtgtctcccggcttccctccaacctccctcctcaccttcctcctcccaccttctgtcagttacaacttta
B D                  Rhesus  gtgtctccccgtttccctccaacctccctcctcaccttcctcctctcaccttctgtcagttacaagttta
B D     Crab-eating macaque  gtgtctccccatttccctccaacctccctcctcaccttcctcctctcaccttctgtcagttacaagttta
B D            Green monkey  gtgtctccccctttccctccaacctccctcctcaccttcctcctctcaccttctgtcagttacaagttta
         Chinese tree shrew  ccaccccaacccctccctccaacttccctcctcacctttttcctcccaccttctgtcag-----atcttg
B D                Squirrel  gtgcacccctaccccccctccagctcccgcc-caccttctcc----cacctct-----gctaacccttta
B D         Chinese hamster  gtgtgtccccaccctcctctaggctcccaca-cacctttctccaggcacttcc-----ctcagacccttg
B D                   Horse  gcacgcccgccctttgctctgactgcctccc-aaccctcctcctcccaccggctctcagttacacctt--
B D        White rhinoceros  gcc-------------ctctaactgcttccc-caccctcctcctcccaccttctgtcagttacacctt--
            Star-nosed mole  atgcacccttcccctcctcccactgccctcc-caccttcctctccccac---ctgtccgtcacatcttta
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                  Baboon  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  cttgtcatgtaaacactgtcatgtaaaacactgacattctgttctggaatcataattaagtcttt
                      Chimp  cttgtcatgtaaacactgtcatgtaaaacactgacattctgttctggaatcataattaagtcttt
                    Gorilla  cttgtcatgtaaacactgtcatgtaaaacactgacattctgttctggaatcataattaagtcttt
                  Orangutan  cttgtcatgtaaacactgtcatgtaaaacactgacattctgctctggaatcataattaagtcttt
                     Gibbon  cttgtcatgtaaacactgtcatgtaaaacactgacattctgttctggaatcataattaagtcttt
                     Rhesus  cgtgtcatgtaaacactgtcatgtaaaacactgatattctgttctggaatcataattaagtcttt
        Crab-eating macaque  cgtgtcatgtaaacactgtcatgtaaaacactgacattctgttctggaatcataattaagtcttt
               Green monkey  cgtgtcatgtaaacactgtcatgtaaaacactgacattctgttctggaatcataattaagtcttt
         Chinese tree shrew  ctttt-------acatcagcaagtaaagcagtggtatcttgtcctggaaccagaagtaaatatgt
                   Squirrel  ctttt-------acattatcaggtgaagcgctgacacgcggttctggaaccacgattagatcttc
            Chinese hamster  ccttt-------acatcttcaaacaaatcac---cacacagttctggacccacagttacagcttc
                      Horse  ------------gta----------aaacactaacatccggttctggaatcacaattaactcttc
           White rhinoceros  ------------gta----------aaacaccgacatacggttctggaatcataattaaatcttc
            Star-nosed mole  gggcc-------atattgtcctgt-aaatactaacatttgattctggaatcctagttaaatccct
                        Rat  =================================================================
               Prairie vole  =================================================================
             Golden hamster  =================================================================
                      Mouse  =================================================================
     Lesser Egyptian jerboa  =================================================================
               Weddell seal  =================================================================
                   Hedgehog  =================================================================
                     Baboon  =================================================================
                        Pig  =================================================================
                     Rabbit  =================================================================
           Cape golden mole  =================================================================
                   Aardvark  =================================================================
                    Megabat  =================================================================
                    Dolphin  =================================================================
        Cape elephant shrew  =================================================================
                    Manatee  =================================================================
                   Elephant  =================================================================
                        Cat  =================================================================
                   Bushbaby  =================================================================
              Domestic goat  =================================================================
                      Sheep  =================================================================
           Tibetan antelope  =================================================================
             Bactrian camel  =================================================================
                     Alpaca  =================================================================
             Pacific walrus  =================================================================
                      Panda  =================================================================
               Killer whale  =================================================================
           Black flying-fox  =================================================================
                  Armadillo  =================================================================
       David's myotis (bat)  -----------------------------------------------------------------
              Big brown bat  =================================================================
                   Microbat  =================================================================
            Squirrel monkey  =================================================================
                   Marmoset  =================================================================
                        Cow  =================================================================

Inserts between block 41 and 42 in window
B D                 Rhesus 228bp
B D    Crab-eating macaque 228bp

Alignment block 42 of 438 in window, 153497314 - 153497324, 11 bps 
B D                   Human  gggctttgttt
B D                   Chimp  gggctttgttt
B D                 Gorilla  gggctttgttt
B D               Orangutan  gggctttgttt
B D                  Gibbon  gggctttgttt
B D                  Rhesus  gggctttgttt
B D     Crab-eating macaque  gggctttgttt
B D                  Baboon  gggctttgttt
B D            Green monkey  gggctttgttt
         Chinese tree shrew  agactttgttt
B D                Squirrel  aggctttgttt
B D         Chinese hamster  agactttgttt
B D                   Horse  aggctttgttt
B D        White rhinoceros  aggctttgttt
            Star-nosed mole  agattttgttt
B D                     Rat  ===========
              Prairie vole  ===========
            Golden hamster  ===========
B D                   Mouse  ===========
    Lesser Egyptian jerboa  ===========
              Weddell seal  ===========
B D                Hedgehog  ===========
B D                     Pig  ===========
B D                  Rabbit  ===========
          Cape golden mole  ===========
                  Aardvark  ===========
B D                 Megabat  ===========
B D                 Dolphin  ===========
       Cape elephant shrew  ===========
B D                 Manatee  ===========
B D                Elephant  ===========
B D                     Cat  ===========
B D                Bushbaby  ===========
             Domestic goat  ===========
B D                   Sheep  ===========
          Tibetan antelope  ===========
            Bactrian camel  ===========
B D                  Alpaca  ===========
            Pacific walrus  ===========
B D                   Panda  ===========
              Killer whale  ===========
          Black flying-fox  ===========
B D               Armadillo  ===========
      David's myotis (bat)  -----------
             Big brown bat  ===========
B D                Microbat  ===========
B D         Squirrel monkey  ===========
B D                Marmoset  ===========
B D                     Cow  ===========

Inserts between block 42 and 43 in window
B D           Green monkey 760bp

Alignment block 43 of 438 in window, 153497325 - 153497403, 79 bps 
B D                   Human  atagatctgttaaaaataatcaaaaaccag------------aaaatagtgtttacattat---------
B D                   Chimp  atagatctgttaaaaataatcaaaaaccag------------aaaatagtgtttacattat---------
B D                 Gorilla  atagatctgttaaaaataatcaaaaaccag------------aaaatagtgtttacattat---------
B D               Orangutan  atagatctgttaaaaataatcaaaaaccag------------aaaatagtgtttacattat---------
B D                  Gibbon  atagatctgttaaaaataatcaaaaaccag------------aaaatagtgtttacattat---------
B D                  Rhesus  atagacctgttaaaaatcatcaaaaaccgg------------aaagtagtgtttacattat---------
B D     Crab-eating macaque  atagacctgttaaaaatcatcaaaaaccgg------------aaagtagtgtttacattat---------
B D                  Baboon  atagacctgttaaaaatcatcaaaaaccgg------------aaagtagtgtttacattat---------
         Chinese tree shrew  acaggttgattctaaatcactgcaagccaa------------aacacagggtttgcatttt---------
B D                Squirrel  acggattcattagagacagccgaaagcgga------------ggcgcagggttggcagagtggcgtaatt
B D         Chinese hamster  -taggtttattatacacaactggaagc-ca------------aacacaccatgtatgggatggtagagct
B D                   Horse  ataggtttattataaataactggaaacaaa------------aaaacagggtttgcattat---------
B D        White rhinoceros  ataggtttattataaataatcagtaacaaa------------aaaacagggttagcattat---------
            Star-nosed mole  ctacgttgatta-aaaaattgagagtcaaaagagaaactgtcaaaattgagtcataattat---------
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
B D            Green monkey  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  ----tat--ggcaacattattattgtttattacaaa-------------
                      Chimp  ----tat--ggcaacattattattgtttattacaaa-------------
                    Gorilla  ----tat--ggcaacattattattgtttattacaaa-------------
                  Orangutan  ----tat--ggcaatattattattgtttattacaaa-------------
                     Gibbon  ----tat--ggcaatattattattgtttattacaaa-------------
                     Rhesus  ----tat--ga-aacattgttattgtttactacaaa-------------
        Crab-eating macaque  ----tat--ga-aacattgttattgtttactacaaa-------------
                     Baboon  ----tat--ga-aacattgttgttgtttactacaaa-------------
         Chinese tree shrew  ----tat--ggcaacttaattgttgtttactacacagccagaa---gtg
                   Squirrel  acaggat--ggcaacccgatcattgtttactacgcagcacaaa---gtt
            Chinese hamster  aca-aat--tgcagcatcattaccacttgccacacaggcagaa---att
                      Horse  ----tat--ggcaacataattattgtttactctgtagccagac---att
           White rhinoceros  ----tat--ggcaacataattattgtttactccacagccagaccttgtt
            Star-nosed mole  ----gattaagcaacacaattccggtttactcagtagccagaa------
                        Rat  =================================================
               Prairie vole  =================================================
             Golden hamster  =================================================
                      Mouse  =================================================
     Lesser Egyptian jerboa  =================================================
               Weddell seal  =================================================
                   Hedgehog  =================================================
                        Pig  =================================================
                     Rabbit  =================================================
           Cape golden mole  =================================================
                   Aardvark  =================================================
                    Megabat  =================================================
                    Dolphin  =================================================
               Green monkey  =================================================
        Cape elephant shrew  =================================================
                    Manatee  =================================================
                   Elephant  =================================================
                        Cat  =================================================
                   Bushbaby  =================================================
              Domestic goat  =================================================
                      Sheep  =================================================
           Tibetan antelope  =================================================
             Bactrian camel  =================================================
                     Alpaca  =================================================
             Pacific walrus  =================================================
                      Panda  =================================================
               Killer whale  =================================================
           Black flying-fox  =================================================
                  Armadillo  =================================================
       David's myotis (bat)  -------------------------------------------------
              Big brown bat  =================================================
                   Microbat  =================================================
            Squirrel monkey  =================================================
                   Marmoset  =================================================
                        Cow  =================================================

Alignment block 44 of 438 in window, 153497404 - 153497404, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
         Chinese tree shrew  g
B D                Squirrel  g
B D         Chinese hamster  g
B D                   Horse  g
B D        White rhinoceros  g
            Star-nosed mole  g
                   Aardvark  g
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  =
B D                  Rabbit  =
          Cape golden mole  =
B D                 Megabat  =
B D                 Dolphin  =
B D            Green monkey  =
       Cape elephant shrew  =
B D                 Manatee  =
B D                Elephant  =
B D                     Cat  =
B D                Bushbaby  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  =
B D                  Alpaca  =
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
          Black flying-fox  =
B D               Armadillo  =
      David's myotis (bat)  -
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  =
B D                Marmoset  =
B D                     Cow  =

Alignment block 45 of 438 in window, 153497405 - 153497503, 99 bps 
B D                   Human  ctaagatgacact----tctttctgtaatgatccagagttacaacctcttg-tctcttacagaataatat
B D                   Chimp  ctaagatgacact----tctttctgtaatgatccagagttacaacctcttg-tctcttacagaataatat
B D                 Gorilla  ctaagatgacact----tctttctgtaatgatccagagttacaacctcttg-tctcttacagaataatat
B D               Orangutan  ctaagatgacact----tgtttctgtaatgatccagagttacaacctcttg-tctcttacagaataatat
B D                  Gibbon  ctaagatgacact----tctttctgtaatgatccagagttacaa-cgcttg-tctcttacagaataatat
B D                  Rhesus  ctaaaatgacact----tctttctgtaatgatccagagttacaacctcttg-tctcttgcagaataatat
B D     Crab-eating macaque  ctaaaatgacact----tctttctgtaatgatccagagttacaacctcttg-tctcttgcagaataatat
B D                  Baboon  ctaagatgacact----tctttctgtaatgatccagagttacaacctcttg-tctcttgcagaataatat
         Chinese tree shrew  ctgagatgatact----tcttact-caatgctccagggtcacaacctctga-tgtctaactggacaatat
B D                Squirrel  ctaagatgacatt----cctttgtctaatggttccaagtcacaatctctgg-tctctttcaggatgatta
B D         Chinese hamster  cacagttaactcttcactccttgtctagtgatctatgatctcaaccttgga----ctttcatggt--tta
B D                   Horse  ctaagatgacact----gctttatttaatggtccagggtcacgc-ttctgg-tctcctacaggagagacc
B D        White rhinoceros  ctaagatgacagt----gctttatttaatggtccagagtcacac--tctgg-tttcttacaggagagacc
            Star-nosed mole  ctaagctg---ga----gctggagctccgggcccagggtcccaa-ctccggatctcttgcaggggaagcc
B D                Elephant  ctaacatgacgtt----tctttatctaatggtccagagtctcaacctctag-tcttttaatggaaaatat
                   Aardvark  ctaagatgacatt----tctttatcaaat-gtccacagtcacatgctctgg-tctcttaaacgacaatat
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
B D            Green monkey  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  tcctagc-at----gtcaataaaa-------ttc-tttttttctttt
                      Chimp  tcctagc-at----gtcaataaaa-------ttc-tttttttctttt
                    Gorilla  tcctagc-at----gtcaataaaa-------ttc-tttttttctttt
                  Orangutan  tcctagc-at----gtcaataaaa-------ttc-tttttttctttt
                     Gibbon  tcctaac-at----gtcaataaaa-------ttc-tttttttctttt
                     Rhesus  tactagc-at----gtcaataaaa-------ctc-tttttttctttt
        Crab-eating macaque  tactagc-at----gtcaataaaa-------ctc-tttttttctttt
                     Baboon  tactagc-at----gtcaataaaa-------ttcttttttttctttt
         Chinese tree shrew  tcccagc-at-aaagtcaaataaa-------ttcaattttttctctt
                   Squirrel  tccagg--------gtcaagaccaaacatattct-tttcattctttt
            Chinese hamster  agcaaa--------gtaaacgc---------ttt-ttcccttcattt
                      Horse  taccatcaaa----gtcaagtaaa-------ttc-tttttttctttt
           White rhinoceros  tagcatcaaa----gtcaaataaa-------ttc-ttcctttctttt
            Star-nosed mole  tagcatc-at----gtcacagaaa-------ttc-ttcttttctaaa
                   Elephant  tcccagc-attaaagtcaaataat-------ttt-tttttttt----
                   Aardvark  tcccagc-atcaaagtcaaataag-------ttc-cttttgtg----
                        Rat  ===============================================
               Prairie vole  ===============================================
             Golden hamster  ===============================================
                      Mouse  ===============================================
     Lesser Egyptian jerboa  ===============================================
               Weddell seal  ===============================================
                   Hedgehog  ===============================================
                        Pig  ===============================================
                     Rabbit  ===============================================
           Cape golden mole  ===============================================
                    Megabat  ===============================================
                    Dolphin  ===============================================
               Green monkey  ===============================================
        Cape elephant shrew  ===============================================
                    Manatee  ===============================================
                        Cat  ===============================================
                   Bushbaby  ===============================================
              Domestic goat  ===============================================
                      Sheep  ===============================================
           Tibetan antelope  ===============================================
             Bactrian camel  ===============================================
                     Alpaca  ===============================================
             Pacific walrus  ===============================================
                      Panda  ===============================================
               Killer whale  ===============================================
           Black flying-fox  ===============================================
                  Armadillo  ===============================================
       David's myotis (bat)  -----------------------------------------------
              Big brown bat  ===============================================
                   Microbat  ===============================================
            Squirrel monkey  ===============================================
                   Marmoset  ===============================================
                        Cow  ===============================================

Inserts between block 45 and 46 in window
B D                  Horse 3bp
B D       White rhinoceros 10bp
                  Aardvark 13bp

Alignment block 46 of 438 in window, 153497504 - 153497504, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
         Chinese tree shrew  t
B D                Squirrel  t
B D         Chinese hamster  c
            Star-nosed mole  t
B D                Elephant  t
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  =
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D                 Dolphin  =
B D            Green monkey  =
       Cape elephant shrew  =
B D                 Manatee  =
B D                     Cat  =
B D                Bushbaby  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  =
B D                  Alpaca  =
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
          Black flying-fox  =
B D        White rhinoceros  =
B D                   Horse  =
B D               Armadillo  =
      David's myotis (bat)  -
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  =
B D                Marmoset  =
B D                     Cow  =

Inserts between block 46 and 47 in window
B D               Elephant 18bp

Alignment block 47 of 438 in window, 153497505 - 153497510, 6 bps 
B D                   Human  gctata
B D                   Chimp  gctata
B D                 Gorilla  gctata
B D               Orangutan  gctata
B D                  Gibbon  gctata
B D                  Rhesus  gctata
B D     Crab-eating macaque  gctata
B D                  Baboon  gctata
         Chinese tree shrew  aatata
B D                Squirrel  gctaca
B D         Chinese hamster  gctata
            Star-nosed mole  cctata
B D                     Rat  ======
              Prairie vole  ======
            Golden hamster  ======
B D                   Mouse  ======
    Lesser Egyptian jerboa  ======
              Weddell seal  ======
B D                Hedgehog  ======
B D                     Pig  ======
B D                  Rabbit  ======
          Cape golden mole  ======
                  Aardvark  ======
B D                 Megabat  ======
B D                 Dolphin  ======
B D            Green monkey  ======
       Cape elephant shrew  ======
B D                 Manatee  ======
B D                Elephant  ======
B D                     Cat  ======
B D                Bushbaby  ======
             Domestic goat  ======
B D                   Sheep  ======
          Tibetan antelope  ======
            Bactrian camel  ======
B D                  Alpaca  ======
            Pacific walrus  ======
B D                   Panda  ======
              Killer whale  ======
          Black flying-fox  ======
B D        White rhinoceros  ======
B D                   Horse  ======
B D               Armadillo  ======
      David's myotis (bat)  ------
             Big brown bat  ======
B D                Microbat  ======
B D         Squirrel monkey  ======
B D                Marmoset  ======
B D                     Cow  ======

Inserts between block 47 and 48 in window
           Star-nosed mole 88bp

Alignment block 48 of 438 in window, 153497511 - 153497636, 126 bps 
B D                   Human  gactgaatgtttgtgcc-ccca---------gtattcatatatggaaacctaatccccaatatgatagta
B D                   Chimp  gactgaatgtttgtgcc-ccca---------atattcatatatggaaacctaatccccaatatgatagta
B D                 Gorilla  gactgaatgtttgtgcc-ccca---------atattcatatatggaaacctaatccccaatatgatagca
B D               Orangutan  gactgaatgtttttgcc-ccca---------atattcatatatggaaacctaatccccaatatgatagta
B D                  Gibbon  gactgaatgtttgtgcc-tcca---------atattcatatatggaaacctaatccccaatatgatagta
B D                  Rhesus  gactgagtgtttgtgcc-ccca---------atattcatatattgaaaactaatccccaatatgatcgta
B D     Crab-eating macaque  gactgagtgtttgtgcc-ccca---------atattcatatattgaaaactaatccccaatatgatcgta
B D                  Baboon  gactgaatgtttgtgcc-ccca---------atattcatatattgaaaactaatccccaatatgatagta
         Chinese tree shrew  gactgaacacttgtgctgtcca---------agattcagatgttgaaacctaatttccaaaatgctgata
B D                Squirrel  ggttgaatatttgggct-ccctctaa-----aaattcacatgtcaaa-cctaacccccaatag-----ta
B D         Chinese hamster  gaccg-ctgtctatgcc-acccacagcccccaattccatatgtcaaagcttagcccccagtat-----ta
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
B D            Green monkey  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  tttgtaggtgcggtctctgggaggtgattaggtcatgaaggtgaagccctcatgaatgggattggt
                      Chimp  tttgtaggtgcggtctctgggaggtgattacgtcatgaaggtgaagccctcatgaatggaattggt
                    Gorilla  tttgtaggtgcggtctctgggaggtgattagttcatgaaggtgaagccctcatgaatgggattggt
                  Orangutan  tttgtaggtgcggtctccgggaggtgattaggtcatgaaggtgaagccctcacgaatgggattggt
                     Gibbon  tttgtaggtgcggtctctgggaggtgattaggtcatgaaggtgaagccctcatgaatgggattggt
                     Rhesus  tttgtaggtgcggtctctgggaggtgattaggtcatgaaggtaaagccctcatgaatgggattggt
        Crab-eating macaque  tttgtaggtgcggtctctgggaggtgattaggtcatgaaggtaaagccctcatgaatgggattggt
                     Baboon  tttgtaggtgcggtctctgggaggtgattaggtcatgatggtaaagccctcatgaatgggattagt
         Chinese tree shrew  tttataggtaaggtctttgg-----gattagatcacgaaggtggagcccccatgaatggaattagc
                   Squirrel  tctgtag-----------tgcttgtgatgagatcgt-tggaaagggattcagtcac--acagtaga
            Chinese hamster  ctgg-------------------gcaattaggctgtgcaggtacagaccctatgact-gaattagt
                        Rat  ==================================================================
               Prairie vole  ==================================================================
             Golden hamster  ==================================================================
                      Mouse  ==================================================================
     Lesser Egyptian jerboa  ==================================================================
               Weddell seal  ==================================================================
                   Hedgehog  ==================================================================
                        Pig  ==================================================================
                     Rabbit  ==================================================================
           Cape golden mole  ==================================================================
                   Aardvark  ==================================================================
                    Megabat  ==================================================================
                    Dolphin  ==================================================================
               Green monkey  ==================================================================
        Cape elephant shrew  ==================================================================
                    Manatee  ==================================================================
                   Elephant  ==================================================================
                        Cat  ==================================================================
                   Bushbaby  ==================================================================
            Star-nosed mole  ==================================================================
              Domestic goat  ==================================================================
                      Sheep  ==================================================================
           Tibetan antelope  ==================================================================
             Bactrian camel  ==================================================================
                     Alpaca  ==================================================================
             Pacific walrus  ==================================================================
                      Panda  ==================================================================
               Killer whale  ==================================================================
           Black flying-fox  ==================================================================
           White rhinoceros  ==================================================================
                      Horse  ==================================================================
                  Armadillo  ==================================================================
       David's myotis (bat)  ------------------------------------------------------------------
              Big brown bat  ==================================================================
                   Microbat  ==================================================================
            Squirrel monkey  ==================================================================
                   Marmoset  ==================================================================
                        Cow  ==================================================================

Inserts between block 48 and 49 in window
        Chinese tree shrew 227bp

Alignment block 49 of 438 in window, 153497637 - 153497716, 80 bps 
B D                   Human  gtcca----------------------------------------------taaaaagacattgcagaga
B D                   Chimp  gtcca----------------------------------------------taaaaagacattgcagaga
B D                 Gorilla  gtcca----------------------------------------------taaaaagacattgcagaga
B D               Orangutan  gtcca----------------------------------------------taaaaagacattgcagaga
B D                  Gibbon  gtcca----------------------------------------------taaaaagacattgcagaga
B D                  Rhesus  gtcct----------------------------------------------tataaagacactgcagcga
B D     Crab-eating macaque  gtcct----------------------------------------------tataaagacactgcagcga
B D                  Baboon  gtcct----------------------------------------------tataaagacactgcagcga
         Chinese tree shrew  gtccagcgatgtaaacatgacgccatctgcgggtcccaagattattactcttacacagagaactcagaga
B D                Squirrel  ----------------------------------------------------------gacctaaagg-a
B D         Chinese hamster  ----------------------------------------------------------gaaccccagt--
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
B D            Green monkey  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  gcccctttactccttccac--tttgaggacacag-tgaaaagact---gccatctatgaacc
                      Chimp  gcccctttactccttccac--tttgaggacacag-tgaaaagact---gccatctatgaacc
                    Gorilla  gcccctttactccttccac--tttgaggacacag-tgaaaagact---gctatctatgaacc
                  Orangutan  gcccctttactccttccac--attgaggacacag-tgaaaagact---gccatctatgaacc
                     Gibbon  gcccctttactccttccac--tttggggacacag-tgaaaagact---gccatctatgaacc
                     Rhesus  gtccctttactccttccac--tctgaggacacag-tgaaaagact---gccatctacgaaca
        Crab-eating macaque  gtccctttactccttccac--tctgaggacacag-tgaaaagact---gccatctacgaacc
                     Baboon  gtccctttactccgtccac--tttgaggacacag-tgaaaagact---gccatctacgaaca
         Chinese tree shrew  gaccctttactcctttcactatgtgaggacccag-cagaagggca---gccgtctatgaacc
                   Squirrel  gcccctttacccctcccactacgggagagcccag-caaaaagaca---gccagccat-----
            Chinese hamster  gttccttca-tccttctgctatataaggacgcatccaaaaagacctcttccagacatgacct
                        Rat  ==============================================================
               Prairie vole  ==============================================================
             Golden hamster  ==============================================================
                      Mouse  ==============================================================
     Lesser Egyptian jerboa  ==============================================================
               Weddell seal  ==============================================================
                   Hedgehog  ==============================================================
                        Pig  ==============================================================
                     Rabbit  ==============================================================
           Cape golden mole  ==============================================================
                   Aardvark  ==============================================================
                    Megabat  ==============================================================
                    Dolphin  ==============================================================
               Green monkey  ==============================================================
        Cape elephant shrew  ==============================================================
                    Manatee  ==============================================================
                   Elephant  ==============================================================
                        Cat  ==============================================================
                   Bushbaby  ==============================================================
            Star-nosed mole  ==============================================================
              Domestic goat  ==============================================================
                      Sheep  ==============================================================
           Tibetan antelope  ==============================================================
             Bactrian camel  ==============================================================
                     Alpaca  ==============================================================
             Pacific walrus  ==============================================================
                      Panda  ==============================================================
               Killer whale  ==============================================================
           Black flying-fox  ==============================================================
           White rhinoceros  ==============================================================
                      Horse  ==============================================================
                  Armadillo  ==============================================================
       David's myotis (bat)  --------------------------------------------------------------
              Big brown bat  ==============================================================
                   Microbat  ==============================================================
            Squirrel monkey  ==============================================================
                   Marmoset  ==============================================================
                        Cow  ==============================================================

Inserts between block 49 and 50 in window
B D        Chinese hamster 538bp

Alignment block 50 of 438 in window, 153497717 - 153497757, 41 bps 
B D                   Human  aggaagccgactctcaccagacactgaatctgctggcacct
B D                   Chimp  aggaagccgactctcaccagacactgaatctgctggcacct
B D                 Gorilla  aggaagccgactctcaccagacactgaatctgctggcacct
B D               Orangutan  aggaagctgactctcaccagacactgaatctgctggcacct
B D                  Gibbon  aggaaggcgactctcaccagacactaaatctgctggcactt
B D                  Rhesus  agggagccgactctgaccagacactgaatctgctggcacct
B D     Crab-eating macaque  agggagccgactctgaccagacactgaatctgctggcacct
B D                  Baboon  agggagccgactctgaccagacactgaatctgctggcacct
         Chinese tree shrew  aggacaccagccgtcatcag-------agttgctggcacct
B D                Squirrel  ------ctggccctcaccggac-ccgaggctgctggcccct
B D                     Rat  =========================================
              Prairie vole  =========================================
            Golden hamster  =========================================
B D                   Mouse  =========================================
    Lesser Egyptian jerboa  =========================================
              Weddell seal  =========================================
B D                Hedgehog  =========================================
B D                     Pig  =========================================
B D                  Rabbit  =========================================
          Cape golden mole  =========================================
                  Aardvark  =========================================
B D                 Megabat  =========================================
B D                 Dolphin  =========================================
B D            Green monkey  =========================================
       Cape elephant shrew  =========================================
B D                 Manatee  =========================================
B D                Elephant  =========================================
B D         Chinese hamster  =========================================
B D                     Cat  =========================================
B D                Bushbaby  =========================================
           Star-nosed mole  =========================================
             Domestic goat  =========================================
B D                   Sheep  =========================================
          Tibetan antelope  =========================================
            Bactrian camel  =========================================
B D                  Alpaca  =========================================
            Pacific walrus  =========================================
B D                   Panda  =========================================
              Killer whale  =========================================
          Black flying-fox  =========================================
B D        White rhinoceros  =========================================
B D                   Horse  =========================================
B D               Armadillo  =========================================
      David's myotis (bat)  -----------------------------------------
             Big brown bat  =========================================
B D                Microbat  =========================================
B D         Squirrel monkey  =========================================
B D                Marmoset  =========================================
B D                     Cow  =========================================

Inserts between block 50 and 51 in window
B D               Squirrel 1024bp

Alignment block 51 of 438 in window, 153497758 - 153497830, 73 bps 
B D                   Human  tgatcttggact-tggagcatcaggagctgtgagaagtacatttctgttgttaagctacctagcttatgg
B D                   Chimp  tgatcttggact-tggagcatcaggagctgtgagaagtacatttctgttgttaagctacctagcttatgg
B D                 Gorilla  tgatcttggact-tggagcatcaggagctgtgagaagtacatttctgttgttaagctacctagcttatgg
B D               Orangutan  tgatcttggagt-tggagcatcaggagctgtgagaagtacatttctgttgttaagctacctagcttatgg
B D                  Gibbon  tgatcttggact-tggagcatcaggagctgtgagaagtacatttctgttgttaagctacctagcttatgg
B D                  Rhesus  tgatcttggatt-tggagcatcaggagctatgagaagtacatttctgctgttaagctatctagcttatgc
B D     Crab-eating macaque  tgatcttggatt-tggagcatcaggagctatgagaagtacatttctgctgttaagctatctagcttatgc
B D                  Baboon  tgatcttggatt-tggagcatcaggagctatgagaagtacatttctgctgttaagctatctagcttatgc
         Chinese tree shrew  tgatctgagactgcccagcctcaaagactgtgagaaataaattcctggt-ttaagctatccaatttatgg
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
B D            Green monkey  ======================================================================
       Cape elephant shrew  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ======================================================================
      David's myotis (bat)  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ======================================================================
B D                Marmoset  ======================================================================
B D                     Cow  ======================================================================

                      Human  tatt
                      Chimp  tatt
                    Gorilla  tatt
                  Orangutan  tatt
                     Gibbon  tatt
                     Rhesus  tatt
        Crab-eating macaque  tatt
                     Baboon  tatt
         Chinese tree shrew  tatt
                        Rat  ====
               Prairie vole  ====
             Golden hamster  ====
                      Mouse  ====
     Lesser Egyptian jerboa  ====
               Weddell seal  ====
                   Hedgehog  ====
                        Pig  ====
                     Rabbit  ====
           Cape golden mole  ====
                   Aardvark  ====
                    Megabat  ====
                    Dolphin  ====
               Green monkey  ====
        Cape elephant shrew  ====
                    Manatee  ====
                   Elephant  ====
            Chinese hamster  ====
                        Cat  ====
                   Bushbaby  ====
            Star-nosed mole  ====
              Domestic goat  ====
                      Sheep  ====
           Tibetan antelope  ====
             Bactrian camel  ====
                     Alpaca  ====
             Pacific walrus  ====
                      Panda  ====
               Killer whale  ====
           Black flying-fox  ====
           White rhinoceros  ====
                      Horse  ====
                   Squirrel  ====
                  Armadillo  ====
       David's myotis (bat)  ----
              Big brown bat  ====
                   Microbat  ====
            Squirrel monkey  ====
                   Marmoset  ====
                        Cow  ====

Inserts between block 51 and 52 in window
B D                 Rhesus 26bp
B D    Crab-eating macaque 26bp
B D                 Baboon 26bp

Alignment block 52 of 438 in window, 153497831 - 153497875, 45 bps 
B D                   Human  tttttatagcagcccgaatggactaaaagtgctaagacactttaa
B D                   Chimp  tttttatagcagcccgaatggactaaaagtgctaagacactttaa
B D                 Gorilla  tttttatagcagcccgaatggactaaaagtgctaagacactttaa
B D               Orangutan  ttgttatagcagcccgaacggactaaaagtgccttgactctttaa
B D                  Gibbon  ttgttatagcagcccaaatggactaaaagtgctaagacactttaa
         Chinese tree shrew  ttgttatatcagcccaaaccaactaaaagtgctcattcatttcaa
B D                     Rat  =============================================
              Prairie vole  =============================================
            Golden hamster  =============================================
B D                   Mouse  =============================================
    Lesser Egyptian jerboa  =============================================
              Weddell seal  =============================================
B D                Hedgehog  =============================================
B D                  Baboon  =============================================
B D                     Pig  =============================================
B D                  Rabbit  =============================================
          Cape golden mole  =============================================
                  Aardvark  =============================================
B D                 Megabat  =============================================
B D                 Dolphin  =============================================
B D            Green monkey  =============================================
B D     Crab-eating macaque  =============================================
B D                  Rhesus  =============================================
       Cape elephant shrew  =============================================
B D                 Manatee  =============================================
B D                Elephant  =============================================
B D         Chinese hamster  =============================================
B D                     Cat  =============================================
B D                Bushbaby  =============================================
           Star-nosed mole  =============================================
             Domestic goat  =============================================
B D                   Sheep  =============================================
          Tibetan antelope  =============================================
            Bactrian camel  =============================================
B D                  Alpaca  =============================================
            Pacific walrus  =============================================
B D                   Panda  =============================================
              Killer whale  =============================================
          Black flying-fox  =============================================
B D        White rhinoceros  =============================================
B D                   Horse  =============================================
B D                Squirrel  =============================================
B D               Armadillo  =============================================
      David's myotis (bat)  ---------------------------------------------
             Big brown bat  =============================================
B D                Microbat  =============================================
B D         Squirrel monkey  =============================================
B D                Marmoset  =============================================
B D                     Cow  =============================================

Alignment block 53 of 438 in window, 153497876 - 153497901, 26 bps 
B D                   Human  ctgtcaattgctcagtatcatgccac
B D                   Chimp  ctgtcaattgctcagtatcatgccac
B D                 Gorilla  ctgtcaattgctcagtatcatgccac
B D               Orangutan  ctgtcaattgttcagtatcatgccac
B D                  Gibbon  ctgtcaattgctcagtatcatgccac
         Chinese tree shrew  ctgtcgactgctcaaaatcatgccac
B D                   Horse  ctgtcaattgctcaaaatcatgccac
B D                     Rat  ==========================
              Prairie vole  ==========================
            Golden hamster  ==========================
B D                   Mouse  ==========================
    Lesser Egyptian jerboa  ==========================
              Weddell seal  ==========================
B D                Hedgehog  ==========================
B D                  Baboon  ==========================
B D                     Pig  ==========================
B D                  Rabbit  ==========================
          Cape golden mole  ==========================
                  Aardvark  ==========================
B D                 Megabat  ==========================
B D                 Dolphin  ==========================
B D            Green monkey  ==========================
B D     Crab-eating macaque  ==========================
B D                  Rhesus  ==========================
       Cape elephant shrew  ==========================
B D                 Manatee  ==========================
B D                Elephant  ==========================
B D         Chinese hamster  ==========================
B D                     Cat  ==========================
B D                Bushbaby  ==========================
           Star-nosed mole  ==========================
             Domestic goat  ==========================
B D                   Sheep  ==========================
          Tibetan antelope  ==========================
            Bactrian camel  ==========================
B D                  Alpaca  ==========================
            Pacific walrus  ==========================
B D                   Panda  ==========================
              Killer whale  ==========================
          Black flying-fox  ==========================
B D        White rhinoceros  ==========================
B D                Squirrel  ==========================
B D               Armadillo  ==========================
      David's myotis (bat)  --------------------------
             Big brown bat  ==========================
B D                Microbat  ==========================
B D         Squirrel monkey  ==========================
B D                Marmoset  ==========================
B D                     Cow  ==========================

Alignment block 54 of 438 in window, 153497902 - 153497924, 23 bps 
B D                   Human  ac---tttttttttttttttttttga
B D                   Chimp  ac----ttttttttttttttttttga
B D                 Gorilla  ac-tttttttttttttttttttttga
B D               Orangutan  ttttttttgtttgtttgtttttttga
B D                  Gibbon  aa-------tttttttttttttttga
B D                   Horse  ---attttagtctgctttgttctaga
B D                     Rat  ==========================
              Prairie vole  ==========================
            Golden hamster  ==========================
B D                   Mouse  ==========================
    Lesser Egyptian jerboa  ==========================
              Weddell seal  ==========================
B D                Hedgehog  ==========================
B D                  Baboon  ==========================
B D                     Pig  ==========================
B D                  Rabbit  ==========================
          Cape golden mole  ==========================
                  Aardvark  ==========================
B D                 Megabat  ==========================
B D                 Dolphin  ==========================
B D            Green monkey  ==========================
B D     Crab-eating macaque  ==========================
B D                  Rhesus  ==========================
       Cape elephant shrew  ==========================
        Chinese tree shrew  --------------------------
B D                 Manatee  ==========================
B D                Elephant  ==========================
B D         Chinese hamster  ==========================
B