Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 252 in window, 159891344 - 159891353, 10 bps 
B D                     Human  ttacgattaa
B D                     Chimp  ttacgattaa
B D                 Orangutan  ttacgattaa
B D                    Gibbon  ttacgattaa
B D                    Rhesus  ttacaattaa
B D       Crab-eating macaque  ttacaattaa
B D                    Baboon  ttacaattaa
B D              Green monkey  ttacaattaa
B D                  Marmoset  ttacaattaa
B D           Squirrel monkey  ttacaattaa
B D                  Bushbaby  taatgattaa
           Chinese tree shrew  taataattaa
B D                  Squirrel  taataatgaa
       Lesser Egyptian jerboa  taatgtgctt
                 Prairie vole  taatgaataa
B D           Chinese hamster  taatgattaa
               Golden hamster  taatgattaa
B D                     Mouse  taatgattag
B D                       Rat  taatgattaa
B D            Naked mole-rat  caatgataaa
B D                Guinea pig  tacaaataaa
             Brush-tailed rat  caaggataaa
B D                    Rabbit  taatgattaa
B D                      Pika  taataataag
B D                       Pig  taatgattca
B D                    Alpaca  taatgattca
               Bactrian camel  taatgattca
B D                   Dolphin  taatgattca
                 Killer whale  taatgattca
             Tibetan antelope  taattattca
B D                       Cow  ta---attca
B D                     Sheep  taattattaa
                Domestic goat  taattattca
B D                     Horse  taatgattca
B D          White rhinoceros  tgctgattaa
B D                       Cat  ttatgattaa
B D                       Dog  ttatgattaa
B D                   Ferret   ttatgattaa
B D                     Panda  ttatgattaa
               Pacific walrus  ttatgattaa
                 Weddell seal  ttatgattaa
             Black flying-fox  taatgattga
B D                   Megabat  taatgattga
                Big brown bat  taatgattag
         David's myotis (bat)  taatgattac
B D                  Microbat  taatgattag
              Star-nosed mole  taatgatcaa
B D                  Elephant  taatgattaa
          Cape elephant shrew  taattattaa
B D                   Manatee  taatgattaa
             Cape golden mole  tgataacaa-
B D                    Tenrec  taatgattaa
                     Aardvark  taatgattaa
B D                 Armadillo  taacgatcaa
B D                  Hedgehog  ==========
B D                     Shrew  ==========
B D             X. tropicalis  ==========
                 Spotted gar  ==========
      Yellowbelly pufferfish  ==========
  D              Mallard duck  ==========
          Tibetan ground jay  ==========
B D               Zebra finch  ----------
B D           Tasmanian devil  ==========
    Mexican tetra (cavefish)  ==========
  D            Painted turtle  ==========
  D           Green seaturtle  ==========
B D        American alligator  ==========
  D             Scarlet macaw  ==========
B D                   Opossum  ==========
  D               Rock pigeon  ==========
  D       Collared flycatcher  ==========
B D                    Lizard  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
                  Chinchilla  ==========
B D                  Platypus  ==========
B D                   Wallaby  ==========
  D  Chinese softshell turtle  ==========

Inserts between block 1 and 2 in window
B D                 Squirrel 39bp
      Lesser Egyptian jerboa 6bp
                Prairie vole 6bp
B D          Chinese hamster 31bp
              Golden hamster 1bp
B D                    Mouse 27bp
B D                      Rat 10bp
B D           Naked mole-rat 3bp
B D               Guinea pig 2bp
            Brush-tailed rat 2bp
B D                   Rabbit 5bp
B D                     Pika 5bp
B D                 Elephant 102bp
         Cape elephant shrew 184bp
B D                  Manatee 126bp
            Cape golden mole 11bp
B D                   Tenrec 25bp

Alignment block 2 of 252 in window, 159891354 - 159891356, 3 bps 
B D                     Human  att
B D                     Chimp  att
B D                 Orangutan  att
B D                    Gibbon  att
B D                    Rhesus  att
B D       Crab-eating macaque  att
B D                    Baboon  att
B D              Green monkey  att
B D                  Marmoset  att
B D           Squirrel monkey  att
B D                  Bushbaby  ttt
           Chinese tree shrew  ttc
B D                       Pig  ttt
B D                    Alpaca  ttt
               Bactrian camel  ttt
B D                   Dolphin  ttt
                 Killer whale  ttt
             Tibetan antelope  ttt
B D                       Cow  ttt
B D                     Sheep  ttt
                Domestic goat  ttt
B D                     Horse  ttt
B D          White rhinoceros  ttt
B D                       Cat  tat
B D                       Dog  ctt
B D                   Ferret   ttt
B D                     Panda  ttt
               Pacific walrus  ttt
                 Weddell seal  ttt
             Black flying-fox  ttt
B D                   Megabat  ttt
                Big brown bat  ttg
         David's myotis (bat)  ttt
B D                  Microbat  ttt
              Star-nosed mole  ttt
             Cape golden mole  aat
B D                    Tenrec  aca
                     Aardvark  cct
B D                 Armadillo  --t
B D                       Rat  ===
                Prairie vole  ===
              Golden hamster  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Guinea pig  ===
B D                    Rabbit  ===
B D             X. tropicalis  ===
                 Spotted gar  ===
      Yellowbelly pufferfish  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ---
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                   Opossum  ===
B D            Naked mole-rat  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
            Brush-tailed rat  ===
                  Chinchilla  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D           Chinese hamster  ===
  D  Chinese softshell turtle  ===
B D                  Squirrel  ===

Inserts between block 2 and 3 in window
            Cape golden mole 5bp
B D                   Tenrec 5bp
                    Aardvark 14bp
B D                Armadillo 2bp

Alignment block 3 of 252 in window, 159891357 - 159891357, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  t
           Chinese tree shrew  a
B D                       Pig  a
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
              Star-nosed mole  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                    Rabbit  =
B D             X. tropicalis  =
                 Spotted gar  =
      Yellowbelly pufferfish  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  -
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  =
  D  Chinese softshell turtle  =
B D                  Squirrel  =

Inserts between block 3 and 4 in window
B D                 Elephant 24bp
            Cape golden mole 11bp
B D                   Tenrec 11bp

Alignment block 4 of 252 in window, 159891358 - 159891414, 57 bps 
B D                     Human  cttta-----------------------------ac----------------c---cc----c-------
B D                     Chimp  cttta-----------------------------ac----------------c---cc----c-------
B D                 Orangutan  cttta-----------------------------ac----------------c---cc----c-------
B D                    Gibbon  cttta-----------------------------ac----------------c---cc----c-------
B D                    Rhesus  cttta-----------------------------ac----------------c---cc----c-------
B D       Crab-eating macaque  cttta-----------------------------at----------------c---cc----c-------
B D                    Baboon  cttta-----------------------------ac----------------c---cc----c-------
B D              Green monkey  cttta-----------------------------ac----------------c---cc----c-------
B D                  Marmoset  ctttaaaccaccaccatcaccacc-cccca--ccac----------------c---cc----c-------
B D           Squirrel monkey  ctttaaaccaccaccaccaccaccaccccaccccac----------------c---cc----c-------
B D                  Bushbaby  ctttg-----------------------------cg----------------c---tc----c-------
           Chinese tree shrew  ctttga----------------------------ac----------------a---ca----c-------
B D                  Squirrel  caaaa-----------------------------at----------------a---aa----t-------
       Lesser Egyptian jerboa  ---------------------------------------------------------c----t-------
                 Prairie vole  ---------------------------------------------------------t----t-------
B D           Chinese hamster  gagga-----------------------------ga----------------a---ca----g-------
               Golden hamster  ---------------------------------------------------------g----g-------
B D                     Mouse  ----------------------------------------------------------------------
B D                       Rat  ----------------------------------------------------------------------
B D            Naked mole-rat  ----------------------------------------------------------------------
B D                Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  caaag-----------------------------at----------------a---aa----t-------
             Brush-tailed rat  ----------------------------------------------------------------------
B D                    Rabbit  -ttga-----------------------------ac----------------c---tc----c-------
B D                      Pika  tttga-----------------------------at----------------c---tc----a-------
B D                       Pig  ctttg-----------------------------at----------------c---cc----tgcctccc
B D                    Alpaca  ctttg-----------------------------at----------------c---cc------------
               Bactrian camel  ctttg-----------------------------at----------------c---cc------------
B D                   Dolphin  ctttc-----------------------------at----------------c---cc----c-------
                 Killer whale  ctttc-----------------------------at----------------c---cc----c-------
             Tibetan antelope  ctttg-----------------------------at----------------t---cc----cacccacc
B D                       Cow  ctttg-----------------------------at----------------t---cc----cccccg--
B D                     Sheep  ctttg-----------------------------at----------------c---cg----cccccccc
                Domestic goat  ctttg-----------------------------at----------------t---cc----cccccccc
B D                     Horse  ctttg-----------------------------at----------------c---ct------------
B D          White rhinoceros  ctttg-----------------------------at----------------c---ct----c-------
B D                       Cat  cttgg-----------------------------actc---------cccc-c---cc----c-------
B D                       Dog  ctttg-----------------------------gtccaccccccgacccccc---cc----c-------
B D                   Ferret   ctttg-----------------------------gctc--------------c---cc----c-------
B D                     Panda  ctttg-----------------------------gtc---------------c---cc----c-------
               Pacific walrus  ctttg-----------------------------gtcc---------ccccgc---cc----c-------
                 Weddell seal  ctttg-----------------------------gccc---------ccccgc---cc----c-------
             Black flying-fox  ctttg-----------------------------atc---------------cccgcc----c-------
B D                   Megabat  ctttg-----------------------------atc---------------cccgcc----c-------
                Big brown bat  cgttg-----------------------------atc---------------c---cc----c-------
         David's myotis (bat)  ctttg-----------------------------atc---------------c---cc----c-------
B D                  Microbat  ctttg-----------------------------at----------------c---cc----c-------
              Star-nosed mole  ctttg-----------------------------attc--------------c---cc----cactcccc
B D                  Elephant  gtcag-----------------------------at----------------c---cc----c-------
          Cape elephant shrew  ----------------------------------ac----------------c---ca----t-------
B D                   Manatee  ctgag-----------------------------at----------------c---cc----c-------
             Cape golden mole  cccat-----------------------------tt----------------c---cc----c-------
B D                    Tenrec  cccac-----------------------------ct----------------c---cacacgc-------
                     Aardvark  --ctc-----------------------------cc----------------c---cc----c-------
B D                 Armadillo  ctttg-----------------------------at----------------t---ca----c-------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
      Yellowbelly pufferfish  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  -----aca--------------------a----a------------------------------aagcca
                        Chimp  -----aca--------------------a----a------------------------------aagcca
                    Orangutan  -----gca--------------------a----a------------------------------aagcca
                       Gibbon  -----gca--------------------a----a------------------------------aagcca
                       Rhesus  -----gca--------------------a----a------------------------------aagcca
          Crab-eating macaque  -----gca--------------------a----a------------------------------aagcca
                       Baboon  -----gca--------------------a----a------------------------------aagcca
                 Green monkey  -----gca--------------------a----a------------------------------aggcca
                     Marmoset  -----aca--------------------aaaaga------------------------------aagcca
              Squirrel monkey  -----aca--------------------aaaaga------------------------------aagcca
                     Bushbaby  -----caa--------------------a----a------------------------------aagcca
           Chinese tree shrew  -----aca------------------c-a----a------------------------------aagcca
                     Squirrel  -----aaa--------------------t----aaataa-------------------------aagcca
       Lesser Egyptian jerboa  -----caa--------------------a----a------------------------------aagaca
                 Prairie vole  -----aaa--------------------a----a------------------------------aagcca
              Chinese hamster  -----aga--------------------a----aaggagagagagagagagagagagtgagagcaagcca
               Golden hamster  -----aaa--------------------a----aagggggga----------------------aagcca
                        Mouse  ----------------------------------------------------------------aagcta
                          Rat  ----------------------------------------------------------------aagcca
               Naked mole-rat  -------t--------------------a----a------------------------------aagcca
                   Guinea pig  ------ta--------------------a----a------------------------------agactg
                   Chinchilla  -----ttt--------------------a----a------------------------------aagcca
             Brush-tailed rat  ------tt--------------------a----a------------------------------aagcca
                       Rabbit  -----caa--------------------a----a------------------------------ctgcca
                         Pika  -----aaa--------------------a----a------------------------------tacata
                          Pig  a----aaa--------------------a----a------------------------------aagcca
                       Alpaca  -----cca--------------------a----a------------------------------aagcca
               Bactrian camel  -----cca--------------------a----a------------------------------aagcca
                      Dolphin  -----caa--------------------a----a------------------------------aagcca
                 Killer whale  -----caa--------------------a----a------------------------------aagcca
             Tibetan antelope  ccc--aaa--------------------a----a------------------------------aagccc
                          Cow  -----aaa--------------------a----a------------------------------aagccc
                        Sheep  cccaaaaa--------------------a----a------------------------------aagccc
                Domestic goat  c----aaa--------------------a----a------------------------------aagccc
                        Horse  -----caa--------------------a----a------------------------------gagcct
             White rhinoceros  -----caa--------------------a----a------------------------------gagcct
                          Cat  -----aaa--------------------a----a------------------------------aaatca
                          Dog  -----ccc--------------------c----a------------------------------aaatca
                      Ferret   -----gaa--------------------a----a------------------------------aaatca
                        Panda  -----tga--------------------a----a------------------------------aaatca
               Pacific walrus  -----cga--------------------a----a------------------------------aaatca
                 Weddell seal  -----cga--------------------a----a------------------------------aaatca
             Black flying-fox  -----cca--------------------a----a------------------------------agccca
                      Megabat  -----cca--------------------a----a------------------------------agccca
                Big brown bat  -----aaa--------------------g----a------------------------------aagctg
         David's myotis (bat)  -----aaa--------------------g----a------------------------------aagcta
                     Microbat  -----aaa--------------------g----a------------------------------aagcta
              Star-nosed mole  a----caa--------------------a----g------------------------------aagcca
                     Elephant  -----caa--------------------a----a------------------------------gagcca
          Cape elephant shrew  -----aaa--------------------a----a------------------------------aagcta
                      Manatee  -----taa--------------------a----a------------------------------aagcca
             Cape golden mole  -----tca--------------------a----a------------------------------aaatca
                       Tenrec  -----aca--------------------c----a------------------------------aagtca
                     Aardvark  -----aga-ataaataaataaataaatta----a------------------------------aagcca
                    Armadillo  -----acacacacacacacacacacac-a----a------------------------------aagcct
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                X. tropicalis  ======================================================================
                  Spotted gar  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  -tattca----ggg--------------------agtta--------ga------aatc-gctaaa-tga
                        Chimp  -tattga----ggg--------------------agtta--------ga------aatt-gctaaa-tga
                    Orangutan  -tattga----ggg--------------------agtta--------ga------aatc-gctaaa-tga
                       Gibbon  -tactga----ggg--------------------agtta--------ga------aatc-gctaaa-tga
                       Rhesus  -tattga----ggg--------------------agata--------ga------aatt-gctaaa-tga
          Crab-eating macaque  -tattga----ggg--------------------agata--------ga------aatt-gctaaa-tga
                       Baboon  -tactga----ggg--------------------agata--------ga------aatc-gctaaa-tga
                 Green monkey  -tattga----ggg--------------------agata--------ga------aatc-gctaaa-tga
                     Marmoset  -tattga----ggg--------------------gatta--------ga------aata-gctaaa-tga
              Squirrel monkey  -tattga----ggg--------------------aatta--------ga------aata-gctaaa-tga
                     Bushbaby  -tattga----ggg--------------------agtta--------gg------gaca-actaaa-tca
           Chinese tree shrew  -tatgga----agg--------------------agtta--------ga------aatt-gctcca-cgg
                     Squirrel  -tactga----agg--------------------agtca--------ca------cata-actaat-tgg
       Lesser Egyptian jerboa  -tatcga----ggg--------------------agtaa--------ga------cata-gctaaa-tag
                 Prairie vole  -tattga----ggg--------------------agtta--------ga------cat--gctaag-tgg
              Chinese hamster  -tatgga----ggg--------------------agtta--------ga------cata-gctaag-ta-
               Golden hamster  -tgtgaa----gga--------------------agtaa--------ga------cata-gctaag-tgg
                        Mouse  -tatcaa----ggg--------------------agttg--------ga------cata-gctaag-tgg
                          Rat  ttatcag----ggg--------------------agtta--------ga------cata-gctaag-tgg
               Naked mole-rat  -tattga----ggg--------------------agtta--------ga------caca-gctaaa-tga
                   Guinea pig  -tattga----ggg--------------------agtta--------ga------cata-gctgaa-tga
                   Chinchilla  -tattga----ggg--------------------aatta--------ga------cata-gctaaa-tga
             Brush-tailed rat  -tattga----ggg--------------------agtta--------ga------tata-gctaaa-tga
                       Rabbit  -taatga----gag--------------------agtta--------ga------aaca-gataaa-tag
                         Pika  -taagca----cag--------------------gttca--------aaagttgcagct-gttcca-ctt
                          Pig  -tattaa----gga-----------------------------------------------------tgg
                       Alpaca  -tattga----gga--------------------ggcta--------ga------aata-gctcaa-tgg
               Bactrian camel  -tattga----gga--------------------ggcta--------ga------aata-gctcaa-tgg
                      Dolphin  -tatgga----gga--------------------attta--------ga------aata-gctaaatggc
                 Killer whale  -tatgga----gga--------------------attta--------ga------aata-gctaaatggc
             Tibetan antelope  -tatggg----gga--------------------agtta--------ga------aata--------tga
                          Cow  -tatggg----gta--------------------agtta--------ga------aata--------tgg
                        Sheep  -tatggg----gga--------------------agtta--------ga------aata--------tgg
                Domestic goat  -tatggg----gga--------------------agtta--------ga------aata--------tgg
                        Horse  -tattga----gag--------------------agtta--------ga------agtg-gctaaa-tgg
             White rhinoceros  -tcttga----ggg--------------------agtta--------ga------aatg-gctaaa-tgg
                          Cat  -tatgga----ggg--------------------agtta--------ga------aaca-gctaaa-ggg
                          Dog  -tacaga----gga--------------------ggtta--------ga---------------------
                      Ferret   -cctgga----gga--------------------tgtta--------ga------aatg-gccaa-----
                        Panda  -tatgga----gga--------------------ggtta--------ga------aatg-gccaaa-cgg
               Pacific walrus  -tatgga----gga--------------------ggtta--------ga------aatg-gccaaa-tgg
                 Weddell seal  -tatgga----gga--------------------ggtta--------ga------aatg-gccaaa-tgg
             Black flying-fox  -tttgga----ggg--------------------agtta--------ga------aatg-gctaaa-cag
                      Megabat  -tttgga----ggg--------------------agtta--------ga------aatg-gctaaa-cag
                Big brown bat  -tatggg----gcgggtgggggag-------agaagtta--------ga------aatg-gctaag-tgg
         David's myotis (bat)  -tatgggag--gggggcgggggag----------agtta--------ga------aatg-gctaaa-tgg
                     Microbat  -tatggggggcgggggtgggggggtggggagagaagtta--------ga------aatg-gct-aa-tgg
              Star-nosed mole  -tattga----ggg--------------------agtta--------ga------agtg-actgga-tgg
                     Elephant  -tatcga----ggg--------------------aattcgaaacagcta------aatg-gctaaa-cgg
          Cape elephant shrew  -tattga----gag--------------------aattttta-----ta------aatg-gttaaa-tgg
                      Manatee  -tattga----ggg--------------------aattc--------ga------aata-gctaaa-tgg
             Cape golden mole  -tattga----ggg--------------------gattt--------ga------aatg-gataaa-tga
                       Tenrec  ttattga----ggg--------------------gattt--------ga------aatg-g---------
                     Aardvark  -tcttga----ggg--------------------actct--------ga------aatgtggtaaa-tgg
                    Armadillo  -tcttga----ggg--------------------agcta--------ga------aatg-gctaaa-tga
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                X. tropicalis  ======================================================================
                  Spotted gar  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ----------------------------------------------------------------------
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  cct-gca-
                        Chimp  cct-gca-
                    Orangutan  cct-gca-
                       Gibbon  cct-gca-
                       Rhesus  cct-gca-
          Crab-eating macaque  cct-gca-
                       Baboon  cct-gca-
                 Green monkey  cct-gca-
                     Marmoset  ctt-gca-
              Squirrel monkey  cct-gca-
                     Bushbaby  cctggta-
           Chinese tree shrew  cct-gat-
                     Squirrel  cca-----
       Lesser Egyptian jerboa  tct-gta-
                 Prairie vole  cct-aac-
              Chinese hamster  --------
               Golden hamster  ccc-atc-
                        Mouse  cct-aac-
                          Rat  cct-aac-
               Naked mole-rat  ctt-cca-
                   Guinea pig  cct-cga-
                   Chinchilla  cct-cga-
             Brush-tailed rat  cct-cca-
                       Rabbit  ccc-aac-
                         Pika  ccc-atc-
                          Pig  -ct-ggt-
                       Alpaca  cct-ggt-
               Bactrian camel  cct-ggt-
                      Dolphin  cct-ggt-
                 Killer whale  cct-tgt-
             Tibetan antelope  cct-ggt-
                          Cow  ccc-ggt-
                        Sheep  cct-ggt-
                Domestic goat  cct-ggt-
                        Horse  cct-ggt-
             White rhinoceros  cct-ggt-
                          Cat  cct-ggt-
                          Dog  --------
                      Ferret   --------
                        Panda  cct-ggt-
               Pacific walrus  cct-ggt-
                 Weddell seal  cct-ggc-
             Black flying-fox  cct-ggt-
                      Megabat  cct-ggt-
                Big brown bat  cct-ggt-
         David's myotis (bat)  cct-ggt-
                     Microbat  cct-ggt-
              Star-nosed mole  ctt-ggt-
                     Elephant  cct-ggtg
          Cape elephant shrew  cct-agtg
                      Manatee  cct-ggtg
             Cape golden mole  tct-ggcg
                       Tenrec  --------
                     Aardvark  cct-ggtg
                    Armadillo  cct-aatg
                     Hedgehog  ========
                        Shrew  ========
                X. tropicalis  ========
                  Spotted gar  ========
       Yellowbelly pufferfish  ========
                 Mallard duck  ========
           Tibetan ground jay  ========
                  Zebra finch  --------
              Tasmanian devil  ========
     Mexican tetra (cavefish)  ========
               Painted turtle  ========
              Green seaturtle  ========
           American alligator  ========
                Scarlet macaw  ========
                      Opossum  ========
                  Rock pigeon  ========
          Collared flycatcher  ========
                       Lizard  ========
             Peregrine falcon  ========
                 Saker falcon  ========
                     Platypus  ========
                      Wallaby  ========
     Chinese softshell turtle  ========

Inserts between block 4 and 5 in window
      Lesser Egyptian jerboa 67bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
             Star-nosed mole 1bp

Alignment block 5 of 252 in window, 159891415 - 159891436, 22 bps 
B D                     Human  gag-gcct-a-------ccct-taagatct-------aa
B D                     Chimp  gag-gcct-a-------ccct-taagatct-------aa
B D                 Orangutan  gag-gcct-a-------ccct-taagatct-------aa
B D                    Gibbon  gag-gcct-a-------ccct-taagatct-------aa
B D                    Rhesus  gag-gcct-a-------ccct-taagatct-------at
B D       Crab-eating macaque  gag-gcct-a-------ccct-taagatct-------at
B D                    Baboon  gag-gcct-a-------ccct-taagatct-------at
B D              Green monkey  gag-gcct-a-------ccct-taagatct-------at
B D                  Marmoset  g-a-acct-a-------ccct-taagatct-------aa
B D           Squirrel monkey  gaa-acct-a-------ccct-taagatct-------aa
B D                  Bushbaby  gag-acct-g-------ccct-taaaattt-------aa
           Chinese tree shrew  aga-gact-g-------tcct-tacaacct-------a-
B D                  Squirrel  gag-acgc-g-------ctct-taaaatcc-------aa
                 Prairie vole  aag-aacctg-------cctt-taaaacct-------aa
B D           Chinese hamster  ---------g-------cctt-taaatctt--------a
               Golden hamster  agg-aacctg-------cctt-taaatcct--------a
B D                     Mouse  aag-aact-g-------cctt-aaaaatct-------aa
B D                       Rat  agg-aact-g-------cctt-taaaatct-------aa
B D            Naked mole-rat  gtt-atct-g-------tcct-taaaaggt-------gg
B D                Guinea pig  gtg-atct-g-------ccct-tgaa-------------
                   Chinchilla  gtg-atct-g-------tcct-taaaagct-------aa
             Brush-tailed rat  gca-atct-g-------tcct-taaaagcc-------aa
B D                    Rabbit  gag-tcct-g-------tcct-tcaaatct-------aa
B D                      Pika  gggttcct-gctaacgttcct-gggagaac-------aa
B D                       Pig  aag-acct-g-------ccct-taa-atct-------aa
B D                    Alpaca  gag-actt-g-------ctct-caa-atca-------aa
               Bactrian camel  gag-actt-g-------ctct-caa-atca-------aa
B D                   Dolphin  gag-acct-g-------ccct-taa-atct-------aa
                 Killer whale  gag-acct-g-------ccct-taa-atct-------aa
             Tibetan antelope  --g-atct-g-------ccct-taa-atct-------aa
B D                       Cow  --g-atct-g-------ccct-taa-atct-------aa
B D                     Sheep  --g-atct-g-------ccct-taa-atct-------aa
                Domestic goat  --g-atct-g-------ccct-taa-atct-------aa
B D                     Horse  gaa-acat-g-------ctct-taa-atct-------aa
B D          White rhinoceros  gaa-acct-g-------ccct-taa-atct-------aa
B D                       Cat  gag-acct-g-------ctct-tac-aact-------aa
B D                       Dog  --g-acct-g-------cctt-tac-atgg-------aa
B D                   Ferret   --------------------------atgg-------aa
B D                     Panda  gag-accc-a-------ccct-cac-atgg-------aa
               Pacific walrus  gag-acct-g-------ctct-tac-atgg-------aa
                 Weddell seal  gag-acct-g-------cttt-tac-atgg-------aa
             Black flying-fox  gag-acct-g-------ccct-taa-atct-------aa
B D                   Megabat  gag-acct-g-------ccct-taa-atct-------aa
                Big brown bat  gag-acct-g-------ccct-taa-atct-------aa
         David's myotis (bat)  gag-acct-g-------cctt-taa-atct-------aa
B D                  Microbat  gag-acct-g-------ccct-taa-atct-------aa
              Star-nosed mole  gcg-gtct-g-------ccct-taa-atct-------aa
B D                  Elephant  gag-acct-g-------tcct-taaaattt---------
          Cape elephant shrew  aag-acct-a-------tcctaaaaaatgt---------
B D                   Manatee  gag-acct-g-------tcct-taaaattt---------
             Cape golden mole  gag-actt-g-------tcct-taaattttaga------
B D                    Tenrec  ---------g-------tctt----attgaaca------
                     Aardvark  gag-aagt-g-------tcct-taaaattt---------
B D                 Armadillo  aag-actt-g-------ccct-taacattc---ttgt--
      Lesser Egyptian jerboa  =======================================
B D                  Hedgehog  =======================================
B D                     Shrew  =======================================
B D             X. tropicalis  =======================================
                 Spotted gar  =======================================
      Yellowbelly pufferfish  =======================================
  D              Mallard duck  =======================================
          Tibetan ground jay  =======================================
B D               Zebra finch  ---------------------------------------
B D           Tasmanian devil  =======================================
    Mexican tetra (cavefish)  =======================================
  D            Painted turtle  =======================================
  D           Green seaturtle  =======================================
B D        American alligator  =======================================
  D             Scarlet macaw  =======================================
B D                   Opossum  =======================================
  D               Rock pigeon  =======================================
  D       Collared flycatcher  =======================================
B D                    Lizard  =======================================
  D          Peregrine falcon  =======================================
  D              Saker falcon  =======================================
B D                  Platypus  =======================================
B D                   Wallaby  =======================================
  D  Chinese softshell turtle  =======================================

Inserts between block 5 and 6 in window
B D                 Bushbaby 46bp
B D           Naked mole-rat 110bp
                  Chinchilla 1bp
            Cape golden mole 170bp
B D                   Tenrec 1bp

Alignment block 6 of 252 in window, 159891437 - 159891438, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                    Rabbit  cg
B D                      Pika  tg
B D                       Rat  --
                Prairie vole  --
              Golden hamster  --
B D                     Mouse  --
      Lesser Egyptian jerboa  ==
                Weddell seal  --
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  --
B D                       Pig  --
            Cape golden mole  ==
                    Aardvark  --
B D                   Megabat  --
B D                   Dolphin  --
B D             X. tropicalis  ==
                 Spotted gar  ==
      Yellowbelly pufferfish  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  --
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                   Opossum  ==
B D            Naked mole-rat  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
            Brush-tailed rat  --
                  Chinchilla  ==
         Cape elephant shrew  --
          Chinese tree shrew  --
B D                  Platypus  ==
B D                   Wallaby  ==
B D                   Manatee  --
B D                  Elephant  --
B D           Chinese hamster  --
B D                    Tenrec  ==
B D                       Cat  --
B D                  Bushbaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   --
             Star-nosed mole  --
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
              Bactrian camel  --
B D                    Alpaca  --
              Pacific walrus  --
B D                     Panda  --
                Killer whale  --
B D                       Dog  --
            Black flying-fox  --
B D          White rhinoceros  --
B D                     Horse  --
B D                  Squirrel  --
B D                 Armadillo  --
        David's myotis (bat)  --
               Big brown bat  --
B D                  Microbat  --
B D                       Cow  --

Alignment block 7 of 252 in window, 159891439 - 159891441, 3 bps 
B D                     Human  gta
B D                     Chimp  gta
B D                 Orangutan  gca
B D                    Gibbon  gta
B D                    Rhesus  gta
B D       Crab-eating macaque  gta
B D                    Baboon  gta
B D              Green monkey  gta
B D                  Marmoset  gta
B D           Squirrel monkey  gta
B D                    Rabbit  tta
B D                      Pika  gaa
B D                       Pig  -t-
B D                    Alpaca  -t-
               Bactrian camel  -t-
B D                   Dolphin  -t-
                 Killer whale  -t-
             Tibetan antelope  -t-
B D                       Cow  -t-
B D                     Sheep  -t-
                Domestic goat  -t-
B D                     Horse  -c-
B D          White rhinoceros  -t-
B D                       Cat  -c-
B D                       Dog  -g-
B D                   Ferret   -t-
B D                     Panda  -t-
               Pacific walrus  -t-
                 Weddell seal  -t-
             Black flying-fox  -t-
B D                   Megabat  -t-
                Big brown bat  -c-
         David's myotis (bat)  -a-
B D                  Microbat  -c-
              Star-nosed mole  -t-
B D                       Rat  ---
                Prairie vole  ---
              Golden hamster  ---
B D                     Mouse  ---
      Lesser Egyptian jerboa  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Guinea pig  ---
            Cape golden mole  ===
                    Aardvark  ---
B D             X. tropicalis  ===
                 Spotted gar  ===
      Yellowbelly pufferfish  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ---
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                   Opossum  ===
B D            Naked mole-rat  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
            Brush-tailed rat  ---
                  Chinchilla  ===
         Cape elephant shrew  ---
          Chinese tree shrew  ---
B D                  Platypus  ===
B D                   Wallaby  ===
B D                   Manatee  ---
B D                  Elephant  ---
B D           Chinese hamster  ---
B D                    Tenrec  ===
B D                  Bushbaby  ===
  D  Chinese softshell turtle  ===
B D                  Squirrel  ---
B D                 Armadillo  ---

Inserts between block 7 and 8 in window
B D                   Rabbit 125bp
B D                     Pika 16bp

Alignment block 8 of 252 in window, 159891442 - 159891449, 8 bps 
B D                     Human  gctctctg
B D                     Chimp  gctctctg
B D                 Orangutan  gctctcta
B D                    Gibbon  gctctcta
B D                    Rhesus  gttctcta
B D       Crab-eating macaque  gttctcta
B D                    Baboon  gttctcta
B D              Green monkey  gttctcta
B D                  Marmoset  gttctcta
B D           Squirrel monkey  gttctcta
B D                    Tenrec  --tcattg
B D                       Rat  --------
                Prairie vole  --------
              Golden hamster  --------
B D                     Mouse  --------
      Lesser Egyptian jerboa  ========
B D                      Pika  ========
                Weddell seal  --------
B D                  Hedgehog  ========
B D                     Shrew  ========
B D                Guinea pig  --------
B D                       Pig  --------
B D                    Rabbit  ========
            Cape golden mole  ========
                    Aardvark  --------
B D                   Megabat  --------
B D                   Dolphin  --------
B D             X. tropicalis  ========
                 Spotted gar  ========
      Yellowbelly pufferfish  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  --------
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                   Opossum  ========
B D            Naked mole-rat  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
            Brush-tailed rat  --------
                  Chinchilla  ========
         Cape elephant shrew  --------
          Chinese tree shrew  --------
B D                  Platypus  ========
B D                   Wallaby  ========
B D                   Manatee  --------
B D                  Elephant  --------
B D           Chinese hamster  --------
B D                       Cat  --------
B D                  Bushbaby  ========
  D  Chinese softshell turtle  ========
B D                   Ferret   --------
             Star-nosed mole  --------
               Domestic goat  --------
B D                     Sheep  --------
            Tibetan antelope  --------
              Bactrian camel  --------
B D                    Alpaca  --------
              Pacific walrus  --------
B D                     Panda  --------
                Killer whale  --------
B D                       Dog  --------
            Black flying-fox  --------
B D          White rhinoceros  --------
B D                     Horse  --------
B D                  Squirrel  --------
B D                 Armadillo  --------
        David's myotis (bat)  --------
               Big brown bat  --------
B D                  Microbat  --------
B D                       Cow  --------

Alignment block 9 of 252 in window, 159891450 - 159891465, 16 bps 
B D                     Human  ccagctcattg--------------------------agttg------
B D                     Chimp  ccagctcattg--------------------------agttg------
B D                 Orangutan  ccagctcattg--------------------------agttg------
B D                    Gibbon  ccagctcattg--------------------------agttg------
B D                    Rhesus  ccagctcattg--------------------------agttg------
B D       Crab-eating macaque  ccagctcattg--------------------------agttg------
B D                    Baboon  ccagctcattg--------------------------agttg------
B D              Green monkey  ccagctcattg--------------------------agttg------
B D                  Marmoset  ccagatgattg--------------------------agctg------
B D           Squirrel monkey  ccagatgattg--------------------------agttg------
B D                  Bushbaby  ccagcacattgtaccccatgattccatttatgcacacagcta------
           Chinese tree shrew  ----------------------------------------ct------
B D                  Squirrel  ---gacg-----------------------------------------
                 Prairie vole  ---agtgtttg--------------------------ggcca------
B D           Chinese hamster  ---agtgtttg--------------------------ggcca------
               Golden hamster  ---agtgtttg--------------------------gacca------
B D                     Mouse  ---catcgttg--------------------------ggcca------
B D                       Rat  ---cgtcattg--------------------------ggtca------
B D                    Rabbit  -----ggtccc--------------------------tgcca------
B D                      Pika  -----ggtccc--------------------------tgcca------
B D                  Elephant  ---------------------------------------------tgg
          Cape elephant shrew  ---------------------------------------------tga
B D                   Manatee  ---------------------------------------------tgg
B D                    Tenrec  -------------------------------------gcctggtgggg
                     Aardvark  ----------------------------------------------tg
      Lesser Egyptian jerboa  ================================================
                Weddell seal  ------------------------------------------------
B D                  Hedgehog  ================================================
B D                     Shrew  ================================================
B D                Guinea pig  ------------------------------------------------
B D                       Pig  ------------------------------------------------
            Cape golden mole  ================================================
B D                   Megabat  ------------------------------------------------
B D                   Dolphin  ------------------------------------------------
B D             X. tropicalis  ================================================
                 Spotted gar  ================================================
      Yellowbelly pufferfish  ================================================
  D              Mallard duck  ================================================
          Tibetan ground jay  ================================================
B D               Zebra finch  ------------------------------------------------
B D           Tasmanian devil  ================================================
    Mexican tetra (cavefish)  ================================================
  D            Painted turtle  ================================================
  D           Green seaturtle  ================================================
B D        American alligator  ================================================
  D             Scarlet macaw  ================================================
B D                   Opossum  ================================================
B D            Naked mole-rat  ================================================
  D               Rock pigeon  ================================================
  D       Collared flycatcher  ================================================
B D                    Lizard  ================================================
  D          Peregrine falcon  ================================================
  D              Saker falcon  ================================================
            Brush-tailed rat  ------------------------------------------------
                  Chinchilla  ================================================
B D                  Platypus  ================================================
B D                   Wallaby  ================================================
B D                       Cat  ------------------------------------------------
  D  Chinese softshell turtle  ================================================
B D                   Ferret   ------------------------------------------------
             Star-nosed mole  ------------------------------------------------
               Domestic goat  ------------------------------------------------
B D                     Sheep  ------------------------------------------------
            Tibetan antelope  ------------------------------------------------
              Bactrian camel  ------------------------------------------------
B D                    Alpaca  ------------------------------------------------
              Pacific walrus  ------------------------------------------------
B D                     Panda  ------------------------------------------------
                Killer whale  ------------------------------------------------
B D                       Dog  ------------------------------------------------
            Black flying-fox  ------------------------------------------------
B D          White rhinoceros  ------------------------------------------------
B D                     Horse  ------------------------------------------------
B D                 Armadillo  ------------------------------------------------
        David's myotis (bat)  ------------------------------------------------
               Big brown bat  ------------------------------------------------
B D                  Microbat  ------------------------------------------------
B D                       Cow  ------------------------------------------------

Inserts between block 9 and 10 in window
                Prairie vole 57bp
B D          Chinese hamster 109bp
              Golden hamster 57bp
B D                    Mouse 105bp
B D                      Rat 104bp
B D                   Rabbit 155bp
B D                     Pika 28bp

Alignment block 10 of 252 in window, 159891466 - 159891469, 4 bps 
B D                     Human  gtgg
B D                     Chimp  gtgg
B D                 Orangutan  gtgg
B D                    Gibbon  gtgg
B D                    Rhesus  gtgc
B D       Crab-eating macaque  gtgc
B D                    Baboon  gtgc
B D              Green monkey  gtgc
B D                  Marmoset  gtgg
B D           Squirrel monkey  gtgc
B D                  Bushbaby  ttat
           Chinese tree shrew  gtgg
B D                  Squirrel  ---g
       Lesser Egyptian jerboa  gtgg
                 Prairie vole  ctag
B D           Chinese hamster  gtgg
               Golden hamster  ctag
B D                     Mouse  atga
B D                       Rat  gtgg
B D            Naked mole-rat  gtgg
                   Chinchilla  atgg
B D                    Rabbit  gtga
B D                      Pika  ctgg
B D                       Pig  gaag
B D                    Alpaca  gcag
               Bactrian camel  gcag
B D                   Dolphin  ggga
                 Killer whale  gggg
             Tibetan antelope  atga
B D                       Cow  atgg
B D                     Sheep  atga
                Domestic goat  atga
B D                     Horse  gtgg
B D          White rhinoceros  gtga
B D                       Cat  gtgg
B D                       Dog  gtgg
B D                   Ferret   gcgg
B D                     Panda  gtgg
               Pacific walrus  gtgg
                 Weddell seal  gtgg
             Black flying-fox  gtgg
B D                   Megabat  gtgg
                Big brown bat  ---g
         David's myotis (bat)  ---a
B D                  Microbat  ---g
              Star-nosed mole  gtgc
B D                  Elephant  gtgg
          Cape elephant shrew  ttga
B D                   Manatee  gtcg
B D                    Tenrec  atgg
                     Aardvark  atgg
B D                 Armadillo  gcag
B D                  Hedgehog  ====
B D                     Shrew  ====
B D                Guinea pig  ----
            Cape golden mole  ====
B D             X. tropicalis  ====
                 Spotted gar  ====
      Yellowbelly pufferfish  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ----
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                   Opossum  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
            Brush-tailed rat  ----
B D                  Platypus  ====
B D                   Wallaby  ====
  D  Chinese softshell turtle  ====

Inserts between block 10 and 11 in window
B D                     Pika 153bp

Alignment block 11 of 252 in window, 159891470 - 159891515, 46 bps 
B D                     Human  t----------------------g--aggaggtcagtgagttagaat-----------------------
B D                     Chimp  t----------------------g--aggaggtcagtgagttagaat-----------------------
B D                 Orangutan  t----------------------g--aggaggtcagtgagttagaac-----------------------
B D                    Gibbon  t----------------------g--aggaggtcagtgagttataat-----------------------
B D                    Rhesus  t---------------------------gaggtcagtgagttagaat-----------------------
B D       Crab-eating macaque  t---------------------------gaggtcagtgagttagaat-----------------------
B D                    Baboon  t---------------------------gaggtcagtgagttagaat-----------------------
B D              Green monkey  t---------------------------gaggtcagtgagttagaat-----------------------
B D                  Marmoset  t----------------------g--aggaggtcactgagttagaat-----------------------
B D           Squirrel monkey  t----------------------g--aagaggtcagtgagttagaat-----------------------
B D                  Bushbaby  tcaatgaaaaaaaaatttaatgtg--aggaagtcagtaagttagaat-----------------------
           Chinese tree shrew  t---------------------------gaggtca-----------------------------------
B D                  Squirrel  ----------------------tgaaaaaaaatcaaagagttagaat-----------------------
       Lesser Egyptian jerboa  ----------------------ta--aggaggttagcaagttagaat-----------------------
                 Prairie vole  ----------------------tg--tgaagccagcct----aggctacacagcaagactcttagcaaca
B D           Chinese hamster  ----------------------tt-aagaaggtcaccg----aggat-----------------------
               Golden hamster  ----------------------tt--tgaagccagcct----aggcta----------------------
B D                     Mouse  ----------------------tt-aaggagggcactcagttaggat-----------------------
B D                       Rat  ----------------------tt-aaggaggacactc----gggat-----------------------
B D            Naked mole-rat  ----------------------tg--aggag-ttagtgagttagaat-----------------------
B D                Guinea pig  ----------------------tg--cgaaa-tcagtgcgttagaag-----------------------
                   Chinchilla  ----------------------tg--agaag-tcagtgaattagatg-----------------------
B D                    Rabbit  ----------------------tg--aggctctcagtgaattagaat-----------------------
B D                      Pika  ----------------------tg--atgagatccgtggatttgaat-----------------------
B D                       Pig  ----------------------tg--tgaaaatcagtgagttagaat-----------------------
B D                    Alpaca  ----------------------tg--aggaagtcagtgaattagaat-----------------------
               Bactrian camel  ----------------------tg--aggaagtgagtgagttagaat-----------------------
B D                   Dolphin  ----------------------tg--agggagtcagtgaatcagatt-----------------------
                 Killer whale  ----------------------tg--agggagtcagtgaatcagatt-----------------------
             Tibetan antelope  ----------------------tg--aggcagtcagtgagttagaat-----------------------
B D                       Cow  ----------------------tg--aggcagtcagtgagttagaat-----------------------
B D                     Sheep  ----------------------tg--aggcagtcagtgagttagaat-----------------------
                Domestic goat  ----------------------tg--aggcagtcagtgagttagaat-----------------------
B D                     Horse  ----------------------tg--aggaagtcagtgagttagaat-----------------------
B D          White rhinoceros  ----------------------tg--agggagccagtgagttagaat-----------------------
B D                       Cat  ----------------------tg--agaaagtcagggagtcagaat-----------------------
B D                       Dog  ----------------------tg--tggaagtcctggagtcagagc-----------------------
B D                   Ferret   ----------------------tg--agcatgtcagggagtcagaat-----------------------
B D                     Panda  ----------------------tg--aggaagtcagggagtcagaat-----------------------
               Pacific walrus  ----------------------tg--agaaagtcagggagtcagaat-----------------------
                 Weddell seal  ----------------------tt--agaaagtcagggaatcagcat-----------------------
             Black flying-fox  ----------------------tg--agaaagtcaggaagttagaat-----------------------
B D                   Megabat  ----------------------tg--agaaagtcaggaagttagaat-----------------------
                Big brown bat  ----------------------tg--agaaagtcagagagttagaat-----------------------
         David's myotis (bat)  ----------------------tg--agaaagtcagaatgttagaat-----------------------
B D                  Microbat  ----------------------tg--agaaagtcagagagttagaat-----------------------
              Star-nosed mole  ----------------------cg--aggagg-cagggagttaaaat-----------------------
B D                  Elephant  ----------------------tg--agacggtcagtgagttagaat-----------------------
          Cape elephant shrew  ----------------------tg--gggcagtcaatgacttggaat-----------------------
B D                   Manatee  ----------------------tg--aggccatcagtgagttagaat-----------------------
B D                    Tenrec  ----------------------gg--aggcggtcagtgagttagaat-----------------------
                     Aardvark  ----------------------tg--aagcagtcagtgagttagaat-----------------------
B D                 Armadillo  ----------------------tg--agg----aagtgagttagaat-----------------------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
            Cape golden mole  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
      Yellowbelly pufferfish  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
            Brush-tailed rat  ----------------------------------------------------------------------
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ------------------------------tcagc----aagaa---cacaga-ct----a-act-g
                        Chimp  ------------------------------tcagc----aagaa---cacaga-ct----a-act-g
                    Orangutan  ------------------------------tcagc----aagaa---cacag----------act-g
                       Gibbon  ------------------------------tcagc----aagaa---cacaga-ct----a-gct-g
                       Rhesus  ------------------------------tcagc----aagaa---cacag----------act-g
          Crab-eating macaque  ------------------------------tcagc----aagaa---cacag----------act-g
                       Baboon  ------------------------------tcagc----aagaa---cacag----------act-g
                 Green monkey  ------------------------------tcagc----aagaa---cacag----------act-g
                     Marmoset  ------------------------------tcagc----aagaa---cacaga-ct----a-gtt-g
              Squirrel monkey  ------------------------------tcagc----aagaa---cacaaa-ct----a-gct-g
                     Bushbaby  ------------------------------tcagc----aaaaaaagtacaga-tt----accct-a
           Chinese tree shrew  -----------------------------------------------cacaga-tt----a-gat-a
                     Squirrel  ------------------------------ttagcaaaaattaa---tacaga-tt----a-gatta
       Lesser Egyptian jerboa  ------------------------------tcagt-ggagtcaa----gcaga----------at-g
                 Prairie vole  gaaaaatggttaaggagatcaccaaggat-tcagc-aaaatgag---cacaga-tc----g-ggt-g
              Chinese hamster  ------------------------------tctgc-aaaatgaa---cacaga-tc----a-ggt-g
               Golden hamster  -----------------cacagcaagactctcggc-aaaacaaa---tgt-gt-tt----a-agg-a
                        Mouse  ------------------------------tcggc-aatgtgaa---cacaga-tc----a-gat-g
                          Rat  ------------------------------tcagc-aaaatgaa---cacaga-tc----a-gat--
               Naked mole-rat  ------------------------------tcagc-acgatgaa---tacata-tt----a-cat-g
                   Guinea pig  ------------------------------tcagc-gtgacaaa---tatata-tc----a-cat-g
                   Chinchilla  ------------------------------tcagc-atgatgaa---aacacattt----a-ca---
                       Rabbit  ------------------------------tcagc-aagaagaa---tacaaa-at----a-gct-g
                         Pika  ------------------------------tcaac----aagaa---taggga-gt----a-cat-a
                          Pig  ------------------------------ttagc-aaggagaa---tacaaa-tt----a-gat-a
                       Alpaca  ------------------------------tcacc-aaggagaa---tacaga-tt----a-gat-a
               Bactrian camel  ------------------------------tcacc-aaggagaa---tacaga-tt----a-gat-a
                      Dolphin  ------------------------------tcagc-aaggcaaa---tacaaa-tt----a-gat-a
                 Killer whale  ------------------------------tcagc-aaggcaaa---tacaaa-tt----a-gat-a
             Tibetan antelope  ------------------------------ttagc-aaggaaaa---cacaaa-tt----a-gat-a
                          Cow  ------------------------------tcagc-aaagaaaa---cacaaa-tt----a-gat-a
                        Sheep  ------------------------------tcagc-aaggaaaa---cacaaa-tt----a-gac-a
                Domestic goat  ------------------------------tcagc-aaggaaaa---cacaaa-tt----a-gat-a
                        Horse  ------------------------------tcaac-aagaagaa---tacaga-tt----a-gat-a
             White rhinoceros  ------------------------------tcaac-aagaagaa---tacaga-tt----a-gat-a
                          Cat  ------------------------------t-----agcaagaa---tacata-tt----a-aat-g
                          Dog  ------------------------------t-----agcggtca---tgcata-tt----a-aat-g
                      Ferret   ------------------------------t-----agcaggaa---tacata-tt----a-aat-g
                        Panda  ------------------------------t-----agcaggaa---tacata-tt----a-aat-g
               Pacific walrus  ------------------------------t-----agcgggaa---tacata-tt----a-aat-g
                 Weddell seal  ------------------------------t-----agaaggca---tacata-tt----a-aat-g
             Black flying-fox  ------------------------------t---c-agcaagaa---tatgaa-tt----a-tgt-a
                      Megabat  ------------------------------t---c-agcaagaa---tatgaa-tt----a-tgt-a
                Big brown bat  ------------------------------t---c-agcaagaa---taccaa-tt----a-gat-a
         David's myotis (bat)  ------------------------------t---c-agcaagaa---tacaaa-tt----a-gat-a
                     Microbat  ------------------------------t---c-agcaagaa---tacaaa-tt----a-gat-a
              Star-nosed mole  ------------------------------tcagc-aagaatga---gacaga-tg----a-aat-a
                     Elephant  ------------------------------tcagc-aagaagag---tagaga-tt-----------
          Cape elephant shrew  ------------------------------tcagt-aagaaga-------aaa-tc-----------
                      Manatee  ------------------------------tcagc-aagaagag---tatggg-tt-----------
                       Tenrec  ------------------------------tctgc-aagagtat---agaaga-g------------
                     Aardvark  ------------------------------tcagc-aaggaaag---attagc-ta-----------
                    Armadillo  ------------------------------tcaac-aagaagag---tacaga-gagata-------
                     Hedgehog  ===================================================================
                        Shrew  ===================================================================
             Cape golden mole  ===================================================================
                X. tropicalis  ===================================================================
                  Spotted gar  ===================================================================
       Yellowbelly pufferfish  ===================================================================
                 Mallard duck  ===================================================================
           Tibetan ground jay  ===================================================================
                  Zebra finch  -------------------------------------------------------------------
              Tasmanian devil  ===================================================================
     Mexican tetra (cavefish)  ===================================================================
               Painted turtle  ===================================================================
              Green seaturtle  ===================================================================
           American alligator  ===================================================================
                Scarlet macaw  ===================================================================
                      Opossum  ===================================================================
                  Rock pigeon  ===================================================================
          Collared flycatcher  ===================================================================
                       Lizard  ===================================================================
             Peregrine falcon  ===================================================================
                 Saker falcon  ===================================================================
             Brush-tailed rat  -------------------------------------------------------------------
                     Platypus  ===================================================================
                      Wallaby  ===================================================================
     Chinese softshell turtle  ===================================================================

Inserts between block 11 and 12 in window
B D                 Elephant 5bp
         Cape elephant shrew 587bp
B D                  Manatee 5bp

Alignment block 12 of 252 in window, 159891516 - 159891519, 4 bps 
B D                     Human  tg----tg
B D                     Chimp  tg----tg
B D                 Orangutan  tg----tg
B D                    Gibbon  tg----tg
B D                    Rhesus  tg---ttt
B D       Crab-eating macaque  tg----tt
B D                    Baboon  tg----tt
B D              Green monkey  tg----tt
B D                  Marmoset  ta----tg
B D           Squirrel monkey  ta----tg
B D                  Bushbaby  tg----tg
           Chinese tree shrew  tg----tg
B D                  Squirrel  tg------
       Lesser Egyptian jerboa  tg------
                 Prairie vole  tg----tg
B D           Chinese hamster  tg----tg
               Golden hamster  tgtcgctg
B D                     Mouse  tg----tg
B D            Naked mole-rat  tg----tg
B D                Guinea pig  tg----tg
B D                    Rabbit  ta----cg
B D                      Pika  tg----tg
B D                       Pig  ta----cg
B D                    Alpaca  ta----tg
               Bactrian camel  ta----tg
B D                   Dolphin  ta----tg
                 Killer whale  ta----tg
             Tibetan antelope  ca----tg
B D                       Cow  ca----tg
B D                     Sheep  ca----tg
                Domestic goat  ca----tg
B D                     Horse  ta----tg
B D          White rhinoceros  ta----tg
B D                       Cat  ta----ag
B D                       Dog  ca----cg
B D                   Ferret   ca----tg
B D                     Panda  ca----tg
               Pacific walrus  ta----tg
                 Weddell seal  ta----tg
             Black flying-fox  ta----tc
B D                   Megabat  ta----tc
                Big brown bat  ta----ga
         David's myotis (bat)  tg----ta
B D                  Microbat  ta----t-
              Star-nosed mole  tg----ca
B D                  Elephant  tg----ta
B D                   Manatee  ta----ta
B D                    Tenrec  -a----ga
                     Aardvark  ta----ta
B D                 Armadillo  ta----ta
B D                       Rat  --------
B D                  Hedgehog  ========
B D                     Shrew  ========
            Cape golden mole  ========
B D             X. tropicalis  ========
                 Spotted gar  ========
      Yellowbelly pufferfish  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  --------
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                   Opossum  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
            Brush-tailed rat  --------
                  Chinchilla  --------
         Cape elephant shrew  ========
B D                  Platypus  ========
B D                   Wallaby  ========
  D  Chinese softshell turtle  ========

Inserts between block 12 and 13 in window
            Black flying-fox 2bp
B D                 Elephant 1bp
B D                  Manatee 9bp
B D                   Tenrec 4bp
                    Aardvark 1bp
B D                Armadillo 2bp

Alignment block 13 of 252 in window, 159891520 - 159891523, 4 bps 
B D                     Human  a--tt------------t
B D                     Chimp  a--tt------------t
B D                 Orangutan  a--tt------------t
B D                    Gibbon  a-ttt------------t
B D                    Rhesus  t--tt------------t
B D       Crab-eating macaque  t--tt------------t
B D                    Baboon  t--tt------------t
B D              Green monkey  t--tt------------t
B D                  Marmoset  a--t--------------
B D           Squirrel monkey  a--t--------------
B D                  Bushbaby  g--tt------------t
           Chinese tree shrew  a--tt------------g
       Lesser Egyptian jerboa  ---tt------------t
                 Prairie vole  a-----------------
B D           Chinese hamster  agctt------------t
               Golden hamster  agcat------------t
B D            Naked mole-rat  a-----------------
B D                Guinea pig  g-----------------
B D                    Rabbit  a-----------------
B D                      Pika  g-----------------
B D                       Pig  a--ct---------gg--
B D                    Alpaca  a-----------------
               Bactrian camel  a-----------------
B D                   Dolphin  a--gg-------------
                 Killer whale  a--gg-------------
             Tibetan antelope  a--gt-------------
B D                       Cow  g--gt-------------
B D                     Sheep  a--gt-------------
                Domestic goat  a--g--------------
B D                     Horse  a--tt-------------
B D          White rhinoceros  c--tt-------------
B D                       Cat  a--tt-------------
B D                       Dog  a--tt-------------
B D                   Ferret   t--tttgctttgtt----
B D                     Panda  a--tt-------------
               Pacific walrus  a--tt-------------
                 Weddell seal  a--tt-------------
             Black flying-fox  t--tt-------------
B D                   Megabat  t--tt-------------
                Big brown bat  t--ga-------------
         David's myotis (bat)  t--ga-------------
B D                  Microbat  ----a-------------
              Star-nosed mole  a--tt-----------t-
B D                  Elephant  -gttt-------------
          Cape elephant shrew  -tttt-------------
B D                   Manatee  -tttt-------------
B D                    Tenrec  -gttg-------------
                     Aardvark  -tttt-------------
B D                 Armadillo  -tttt-------------
B D                       Rat  ------------------
B D                     Mouse  ------------------
B D                  Hedgehog  ==================
B D                     Shrew  ==================
            Cape golden mole  ==================
B D             X. tropicalis  ==================
                 Spotted gar  ==================
      Yellowbelly pufferfish  ==================
  D              Mallard duck  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ------------------
B D           Tasmanian devil  ==================
    Mexican tetra (cavefish)  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
B D        American alligator  ==================
  D             Scarlet macaw  ==================
B D                   Opossum  ==================
  D               Rock pigeon  ==================
  D       Collared flycatcher  ==================
B D                    Lizard  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
            Brush-tailed rat  ------------------
                  Chinchilla  ------------------
B D                  Platypus  ==================
B D                   Wallaby  ==================
  D  Chinese softshell turtle  ==================
B D                  Squirrel  ------------------

Inserts between block 13 and 14 in window
B D                   Rhesus 8bp
B D      Crab-eating macaque 8bp
B D                   Baboon 8bp
B D             Green monkey 8bp
B D                 Bushbaby 3bp
      Lesser Egyptian jerboa 5bp
B D          Chinese hamster 5bp
              Golden hamster 5bp
B D           Naked mole-rat 2bp
B D                      Pig 18bp
             Star-nosed mole 10bp

Alignment block 14 of 252 in window, 159891524 - 159891524, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
       Lesser Egyptian jerboa  t
B D           Chinese hamster  t
               Golden hamster  t
B D            Naked mole-rat  t
B D                Guinea pig  g
B D                  Elephant  t
          Cape elephant shrew  a
B D                   Manatee  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                       Rat  -
                Prairie vole  -
B D                     Mouse  -
B D                      Pika  -
                Weddell seal  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                       Pig  =
B D                    Rabbit  -
            Cape golden mole  =
B D                   Megabat  -
B D                   Dolphin  -
B D             X. tropicalis  =
                 Spotted gar  =
      Yellowbelly pufferfish  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  -
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
            Brush-tailed rat  -
                  Chinchilla  -
          Chinese tree shrew  -
B D                  Platypus  =
B D                   Wallaby  =
B D                       Cat  -
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
B D                     Panda  -
                Killer whale  -
B D                       Dog  -
            Black flying-fox  -
B D          White rhinoceros  -
B D                     Horse  -
B D                  Squirrel  -
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D                       Cow  -

Alignment block 15 of 252 in window, 159891525 - 159891536, 12 bps 
B D                     Human  ttc--ttttt---t--tca
B D                     Chimp  ttc--ttttt---t--tca
B D                 Orangutan  ttc--ttttt---t--tca
B D                    Gibbon  ttc--ttttt---t--tca
B D                    Rhesus  ttt--tgttt---t--tca
B D       Crab-eating macaque  ttt--tgttt---t--tca
B D                    Baboon  ttt--tgttt---t--tca
B D              Green monkey  ttt--tgttt---t--tca
B D                  Marmoset  ttt--tttt--------ca
B D           Squirrel monkey  ttt--ttttt---t--cca
B D                  Bushbaby  ttt--ttttt---t--tca
B D                  Squirrel  --a--ttttt---t--taa
       Lesser Egyptian jerboa  gta--atgtt---t--tta
                 Prairie vole  -tg--gtttt---t--tca
B D           Chinese hamster  ttt--ttttt---t--tt-
               Golden hamster  gtg--acctt---t--tca
B D                     Mouse  --g--tgttt---t--tca
B D                       Rat  --g--ttttt---t--tca
B D            Naked mole-rat  ttt--ttttt---t--tta
B D                Guinea pig  gtt--ttttt---t--tta
B D                    Rabbit  -tt--ttctt---c--aca
B D                      Pika  -tc--ttctt---t--aca
B D                    Alpaca  -----tttttaaa------
               Bactrian camel  -----tttttaaa------
B D                   Dolphin  --t--tttttaaa------
                 Killer whale  --t--tttttaaa------
             Tibetan antelope  --t--ttttt---------
B D                       Cow  --t--ttttt---------
B D                     Sheep  --t--ttttt---------
                Domestic goat  --t--ttttt---------
B D                     Horse  -----t--ct---c--tca
B D          White rhinoceros  -----t---t---t--tca
B D                       Cat  -----ttttt---t--cca
B D                       Dog  -----ttttt---tcccca
B D                   Ferret   --ttgttttt---t--ccg
B D                     Panda  -----ttttt-------ca
               Pacific walrus  -----ttttt---c--cca
                 Weddell seal  -----ttttt---t--cca
             Black flying-fox  -----ttttt---t--tca
B D                   Megabat  -----ttttt---t--tca
                Big brown bat  -----ttttt---t--cca
         David's myotis (bat)  -----ttttt---t--tca
B D                  Microbat  -----ttttt---t--tca
B D                  Elephant  caa--ttttt---t--tcg
          Cape elephant shrew  ttt--atttt---t--tga
B D                   Manatee  ttt--ttttt---t--tct
B D                    Tenrec  caa--ggttt---t-----
                     Aardvark  caa--ttttc---t--tct
B D                 Armadillo  cca--atttt---------
B D                  Hedgehog  ===================
B D                     Shrew  ===================
B D                       Pig  ===================
            Cape golden mole  ===================
B D             X. tropicalis  ===================
                 Spotted gar  ===================
      Yellowbelly pufferfish  ===================
  D              Mallard duck  ===================
          Tibetan ground jay  ===================
B D               Zebra finch  -------------------
B D           Tasmanian devil  ===================
    Mexican tetra (cavefish)  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D        American alligator  ===================
  D             Scarlet macaw  ===================
B D                   Opossum  ===================
  D               Rock pigeon  ===================
  D       Collared flycatcher  ===================
B D                    Lizard  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
            Brush-tailed rat  -------------------
                  Chinchilla  -------------------
          Chinese tree shrew  -------------------
B D                  Platypus  ===================
B D                   Wallaby  ===================
  D  Chinese softshell turtle  ===================
             Star-nosed mole  ===================

Inserts between block 15 and 16 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp

Alignment block 16 of 252 in window, 159891537 - 159891540, 4 bps 
B D                     Human  --aa-------at
B D                     Chimp  --aa-------at
B D                 Orangutan  --aa-------at
B D                    Gibbon  --aa-------at
B D                    Rhesus  --aa-------at
B D       Crab-eating macaque  --aa-------at
B D                    Baboon  --aa-------at
B D              Green monkey  --aa-------at
B D                  Marmoset  --aa-------at
B D           Squirrel monkey  --ga-------at
B D                  Bushbaby  --aa-------at
           Chinese tree shrew  ------------t
B D                  Squirrel  --aa---------
       Lesser Egyptian jerboa  --aattttttt--
                 Prairie vole  --ga---tctt--
B D           Chinese hamster  -------tttt--
               Golden hamster  --ga---tttt--
B D                     Mouse  --ga-----tt--
B D                       Rat  --ga-----tt--
B D            Naked mole-rat  --at---------
B D                Guinea pig  --at---------
B D                    Rabbit  --at---------
B D                      Pika  --at---------
B D                       Pig  --at---------
B D                    Alpaca  --tg---------
               Bactrian camel  --tg---------
B D                   Dolphin  --at---------
                 Killer whale  --at---------
             Tibetan antelope  --ac---------
B D                       Cow  --ac---------
B D                     Sheep  --ac---------
                Domestic goat  --ac---------
B D                     Horse  --at---------
B D          White rhinoceros  --at---------
B D                       Cat  --at---------
B D                       Dog  --at---------
B D                   Ferret   --ac---------
B D                     Panda  --at---------
               Pacific walrus  --at---------
                 Weddell seal  --at---------
             Black flying-fox  --at---------
B D                   Megabat  --at---------
                Big brown bat  --at---------
         David's myotis (bat)  --ag---------
B D                  Microbat  --at---------
              Star-nosed mole  --at---------
B D                  Elephant  gcaa---------
          Cape elephant shrew  aaaa---------
B D                   Manatee  gcaa---------
                     Aardvark  ttaa---------
B D                  Hedgehog  =============
B D                     Shrew  =============
            Cape golden mole  =============
B D             X. tropicalis  =============
                 Spotted gar  =============
      Yellowbelly pufferfish  =============
  D              Mallard duck  =============
          Tibetan ground jay  =============
B D               Zebra finch  -------------
B D           Tasmanian devil  =============
    Mexican tetra (cavefish)  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D        American alligator  =============
  D             Scarlet macaw  =============
B D                   Opossum  =============
  D               Rock pigeon  =============
  D       Collared flycatcher  =============
B D                    Lizard  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
            Brush-tailed rat  -------------
                  Chinchilla  -------------
B D                  Platypus  =============
B D                   Wallaby  =============
B D                    Tenrec  -------------
  D  Chinese softshell turtle  =============
B D                 Armadillo  -------------

Alignment block 17 of 252 in window, 159891541 - 159891543, 3 bps 
B D                     Human  -tct
B D                     Chimp  -tct
B D                 Orangutan  -tct
B D                    Gibbon  -tcc
B D                    Rhesus  -tct
B D       Crab-eating macaque  -tct
B D                    Baboon  -tct
B D              Green monkey  -tct
B D                  Marmoset  -ttt
B D           Squirrel monkey  -ttt
B D                  Bushbaby  -tct
           Chinese tree shrew  -ttt
B D                  Squirrel  -ctt
       Lesser Egyptian jerboa  -ttt
                 Prairie vole  -ttt
B D           Chinese hamster  -ttc
               Golden hamster  -ttt
B D                     Mouse  -cgt
B D                       Rat  -ttt
B D            Naked mole-rat  -ttt
B D                Guinea pig  -ttc
             Brush-tailed rat  -cat
B D                    Rabbit  -ttt
B D                      Pika  -ttt
B D                       Pig  -ttt
B D                    Alpaca  -tat
               Bactrian camel  -tat
B D                   Dolphin  -gct
                 Killer whale  -gct
             Tibetan antelope  -ttt
B D                       Cow  -ttt
B D                     Sheep  -ttt
                Domestic goat  -ttt
B D                     Horse  -ttt
B D          White rhinoceros  -ttt
B D                       Cat  -gtt
B D                       Dog  -gtt
B D                   Ferret   -att
B D                     Panda  -act
               Pacific walrus  -att
                 Weddell seal  -att
             Black flying-fox  -ttt
B D                   Megabat  -ttt
                Big brown bat  -gtt
         David's myotis (bat)  -ttt
B D                  Microbat  -ttt
              Star-nosed mole  -gtt
B D                  Elephant  g---
          Cape elephant shrew  g---
B D                   Manatee  g---
                     Aardvark  g---
B D                  Hedgehog  ====
B D                     Shrew  ====
            Cape golden mole  ====
B D             X. tropicalis  ====
                 Spotted gar  ====
      Yellowbelly pufferfish  ====
  D              Mallard duck  ====
          Tibetan ground jay  ====
B D               Zebra finch  ----
B D           Tasmanian devil  ====
    Mexican tetra (cavefish)  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
  D             Scarlet macaw  ====
B D                   Opossum  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
                  Chinchilla  ----
B D                  Platypus  ====
B D                   Wallaby  ====
B D                    Tenrec  ----
  D  Chinese softshell turtle  ====
B D                 Armadillo  ----

Alignment block 18 of 252 in window, 159891544 - 159891552, 9 bps 
B D                     Human  c---------------------------------------------------------------------
B D                     Chimp  c---------------------------------------------------------------------
B D                 Orangutan  c---------------------------------------------------------------------
B D                    Gibbon  c---------------------------------------------------------------------
B D                    Rhesus  c---------------------------------------------------------------------
B D       Crab-eating macaque  c---------------------------------------------------------------------
B D                    Baboon  c---------------------------------------------------------------------
B D              Green monkey  c---------------------------------------------------------------------
B D                  Marmoset  c---------------------------------------------------------------------
B D           Squirrel monkey  c---------------------------------------------------------------------
B D                  Bushbaby  c---------------------------------------------------------------------
           Chinese tree shrew  g---------------------------------------------------------------------
B D                  Squirrel  c---------------------------------------------------------------------
       Lesser Egyptian jerboa  c---------------------------------------------------------------------
                 Prairie vole  c---------------------------------------------------------------------
B D           Chinese hamster  c---------------------------------------------------------------------
               Golden hamster  c---------------------------------------------------------------------
B D                     Mouse  c---------------------------------------------------------------------
B D                       Rat  c---------------------------------------------------------------------
B D            Naked mole-rat  c---------------------------------------------------------------------
B D                Guinea pig  c---------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  c---------------------------------------------------------------------
B D                    Rabbit  c---------------------------------------------------------------------
B D                      Pika  c---------------------------------------------------------------------
B D                       Pig  c---------------------------------------------------------------------
B D                    Alpaca  c---------------------------------------------------------------------
               Bactrian camel  c---------------------------------------------------------------------
B D                   Dolphin  c---------------------------------------------------------------------
                 Killer whale  c---------------------------------------------------------------------
             Tibetan antelope  c---------------------------------------------------------------------
B D                       Cow  c---------------------------------------------------------------------
B D                     Sheep  c---------------------------------------------------------------------
                Domestic goat  c---------------------------------------------------------------------
B D                     Horse  c---------------------------------------------------------------------
B D          White rhinoceros  c---------------------------------------------------------------------
B D                       Cat  c---------------------------------------------------------------------
B D                       Dog  c---------------------------------------------------------------------
B D                   Ferret   c---------------------------------------------------------------------
B D                     Panda  c---------------------------------------------------------------------
               Pacific walrus  c---------------------------------------------------------------------
                 Weddell seal  c---------------------------------------------------------------------
             Black flying-fox  c---------------------------------------------------------------------
B D                   Megabat  c---------------------------------------------------------------------
                Big brown bat  c---------------------------------------------------------------------
         David's myotis (bat)  ct--------------------------------------------------------------------
B D                  Microbat  ct--------------------------------------------------------------------
              Star-nosed mole  c---------------------------------------------------------------------
B D                  Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
B D                   Manatee  ----------------------------------------------------------------------
             Cape golden mole  -ccgaccttgaggttaggagcccaattcataaccactacactatagattagataaatatttcacttttgt
B D                    Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
B D                 Armadillo  ------------------------------------------------------------------ctga
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
      Yellowbelly pufferfish  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ---cgacc----ctg
                        Chimp  ---cgacc----ctg
                    Orangutan  ---cgacc----ctg
                       Gibbon  ---caacc----ctg
                       Rhesus  ---caa-c----ctg
          Crab-eating macaque  ---caa-c----ctg
                       Baboon  ---caa-c----ctg
                 Green monkey  ---caa-c----ctg
                     Marmoset  ---tgacc----gtg
              Squirrel monkey  ---tgacc----ctg
                     Bushbaby  ---tgatt----ttg
           Chinese tree shrew  ---aaacc----atg
                     Squirrel  ---tgact----gtg
       Lesser Egyptian jerboa  ---tgact----gta
                 Prairie vole  ---taact----gtg
              Chinese hamster  ---taaca----gtg
               Golden hamster  ---tgact----atg
                        Mouse  ---taacc----tca
                          Rat  ---taacc----tca
               Naked mole-rat  ---tggtc----atg
                   Guinea pig  ---tggcc----atg
                   Chinchilla  -------------tg
             Brush-tailed rat  ---cagcc----ttg
                       Rabbit  ---tgacc----aag
                         Pika  ---tgacc----gtg
                          Pig  ---tgacc----atg
                       Alpaca  ---tgata----gtg
               Bactrian camel  ---tgata----gtg
                      Dolphin  ---tgacc----atg
                 Killer whale  ---tgacc----atg
             Tibetan antelope  ---tgacc----atg
                          Cow  ---tgacc----atg
                        Sheep  ---tgacc----atg
                Domestic goat  ---tgacc----atg
                        Horse  ---tgacc----atg
             White rhinoceros  ---tgacc----atg
                          Cat  ---caacc----gtg
                          Dog  ---caacc----gtg
                      Ferret   ---cgaccttcattg
                        Panda  ---tgacc----gtg
               Pacific walrus  ---caacc----gtg
                 Weddell seal  ---caacc----atg
             Black flying-fox  ---tgacc----atg
                      Megabat  ---tgacc----atg
                Big brown bat  ---tgacc----gtg
         David's myotis (bat)  ---tgacc----ggg
                     Microbat  ---tgacc----gtg
              Star-nosed mole  ---tgact------g
                     Elephant  ---tg----------
          Cape elephant shrew  ---tg----------
                      Manatee  ---gg----------
             Cape golden mole  tccta----------
                       Tenrec  -cctg----------
                     Aardvark  ---tg----------
                    Armadillo  caagg----------
                     Hedgehog  ===============
                        Shrew  ===============
                X. tropicalis  ===============
                  Spotted gar  ===============
       Yellowbelly pufferfish  ===============
                 Mallard duck  ===============
           Tibetan ground jay  ===============
                  Zebra finch  ---------------
              Tasmanian devil  ===============
     Mexican tetra (cavefish)  ===============
               Painted turtle  ===============
              Green seaturtle  ===============
           American alligator  ===============
                Scarlet macaw  ===============
                      Opossum  ===============
                  Rock pigeon  ===============
          Collared flycatcher  ===============
                       Lizard  ===============
             Peregrine falcon  ===============
                 Saker falcon  ===============
                     Platypus  ===============
                      Wallaby  ===============
     Chinese softshell turtle  ===============

Inserts between block 18 and 19 in window
B D          Chinese hamster 1bp
              Golden hamster 1bp

Alignment block 19 of 252 in window, 159891553 - 159891567, 15 bps 
B D                     Human  aagga--gttag-ataa-c
B D                     Chimp  aagga--gttag-ataa-c
B D                 Orangutan  aagga--gttag-ataa-c
B D                    Gibbon  aagga--gttag-ataa-c
B D                    Rhesus  aagga--gttag-ataa-c
B D       Crab-eating macaque  aagga--gttag-ataa-c
B D                    Baboon  aagga--gttag-ataa-c
B D              Green monkey  aagga--gttag-ataa-c
B D                  Marmoset  aggga--gttag-ataa-c
B D           Squirrel monkey  aggga--gttag-ataa-c
B D                  Bushbaby  aaggcatattag-atta-c
           Chinese tree shrew  aaaga--gttag-atta-t
B D                  Squirrel  tcaga--atcag-ataa-c
       Lesser Egyptian jerboa  aaaga--gacag-aaaa-c
                 Prairie vole  aagga--gttat------c
B D           Chinese hamster  aaagg--gttat------c
               Golden hamster  aaaga--gttac------c
B D                     Mouse  gaagg--gttag------c
B D                       Rat  gaagg--gttag------c
B D            Naked mole-rat  cagaa--tttag-ata--a
B D                Guinea pig  aagaa--gttaa-aca--c
                   Chinchilla  aagaa--gttcg-ata--a
B D                    Rabbit  aagga--gttaagatga-a
B D                      Pika  aagga--gttaagagaa-c
B D                       Pig  aagaa--attag-ataa-t
B D                    Alpaca  aaggg--accag-ataa-t
               Bactrian camel  aaggg--accag-ataa-t
B D                   Dolphin  aagga--gtaac-atag-t
                 Killer whale  aagga--gtaac-atag-t
             Tibetan antelope  aagga--gttag-ataa-c
B D                       Cow  aagga--gttag-ataa-c
B D                     Sheep  aagga--gttag-ataa-c
                Domestic goat  aagga--gttag-ataa-c
B D                     Horse  aagga--gttgg-ataa-t
B D          White rhinoceros  aagga--attag-ataatt
B D                       Cat  aacga--gtctg-ataa-t
B D                       Dog  aagta--gtcaa-ataa-t
B D                   Ferret   aagga--gtcag-ataa-t
B D                     Panda  aagga--gtcag-ataa-t
               Pacific walrus  aaaga--gtaag-ataa-t
                 Weddell seal  aaaga--gtcag-gtaa-t
             Black flying-fox  agtta--gataa-a-----
B D                   Megabat  agtta--gataa-a-----
                Big brown bat  aagga--gttaa-t-----
         David's myotis (bat)  aagga--gttaa-t-----
B D                  Microbat  aagga--gttaa-t-----
              Star-nosed mole  caggg--cttag-ataa-t
B D                  Elephant  aagga--gttag-ctaa-c
          Cape elephant shrew  aaggc--ataag-ctat-t
B D                   Manatee  aaggc--attag-ctaa-c
             Cape golden mole  caagt--gactg-tgaa-c
B D                    Tenrec  tacgt--gaagg-gtaa-c
                     Aardvark  aagga--gttag-ctaa-c
B D                 Armadillo  aagga--gttag-cta---
B D                  Hedgehog  ===================
B D                     Shrew  ===================
B D             X. tropicalis  ===================
                 Spotted gar  ===================
      Yellowbelly pufferfish  ===================
  D              Mallard duck  ===================
          Tibetan ground jay  ===================
B D               Zebra finch  -------------------
B D           Tasmanian devil  ===================
    Mexican tetra (cavefish)  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
B D        American alligator  ===================
  D             Scarlet macaw  ===================
B D                   Opossum  ===================
  D               Rock pigeon  ===================
  D       Collared flycatcher  ===================
B D                    Lizard  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
            Brush-tailed rat  -------------------
B D                  Platypus  ===================
B D                   Wallaby  ===================
  D  Chinese softshell turtle  ===================

Inserts between block 19 and 20 in window
B D                      Cat 544bp

Alignment block 20 of 252 in window, 159891568 - 159891626, 59 bps 
B D                     Human  aat-taaatgaaa-----------tcac--------ctgtttcagaaaa-------------------tg
B D                     Chimp  aag-aaaatgaaa-----------tcac--------ctgtttcagaaaa-------------------tg
B D                 Orangutan  aag-aaaacgaaa-----------tcat--------ctgtttcagaaaa-------------------tg
B D                    Gibbon  aag-aaaatgaaa-----------tcac--------ctgtttcagaaaa-------------------tg
B D                    Rhesus  aag-aaaatgaaa-----------tcac--------ctgtttcagaaaa-------------------tg
B D       Crab-eating macaque  aag-aaaatgaaa-----------tcac--------ctgtttcagaaaa-------------------tg
B D                    Baboon  aag-aaaatgaaa-----------tcac--------ctgtttcagaaaa-------------------tg
B D              Green monkey  aag-aaaatgaaa-----------tcac--------ctctttcagaaaa-------------------tg
B D                  Marmoset  aag-aaaatgaaa-----------tccc--------ttgtttcagaaaa-------------------tg
B D           Squirrel monkey  agg-aaaatgaaa-----------tctc--------ttgtttcagaaaa-------------------tg
B D                  Bushbaby  aagaaaaatgaaa-----------tcac--------ttatttcagaaaa-------------------tg
           Chinese tree shrew  gag-aaaataaag-----------tcac--------ttctttcaggaga-------------------tt
B D                  Squirrel  aag-aaaatgc-------------------------ttattcctgggat-------------------tg
       Lesser Egyptian jerboa  aag-aaaatacaa-----------ccac--------atctgtcagggaa-------------------ct
                 Prairie vole  caa-aaagtacaa-----------tcac--------ccatttcagggaa-------------------tt
B D           Chinese hamster  aag-aaaatgcaa-----------ccaaaaaaagagaaaattaagaaaaagaaaatgcacccacccattt
               Golden hamster  aag-aaaatacaa-----------ccac--------ccatttcagggaa-------------------tt
B D                     Mouse  aag-aaaatacag-------------------------------------------------------tc
B D                       Rat  aag-aaaatacag-------------------------------------------------------tt
B D            Naked mole-rat  taa-gaaatgcaa-----------tcac--------ttatttcagagtc-------------------tg
B D                Guinea pig  caa-aaaatgcaa-----------tcac--------ttattttagagac-------------------gg
                   Chinchilla  taa-gaaaggcaa-----------tcac--------tcatttcagagac-------------------tc
B D                    Rabbit  aag-aaaatgaag-----------tcac--------ttatctcagggag-------------------tt
B D                      Pika  aag-aaaaagaag-----------ttac--------tcatttcagcaag-------------------ct
B D                       Pig  aag-aaaatgaaa-----------tcac--------ttgtttcaggaaa--------------------t
B D                    Alpaca  aag-aagatgaaa-----------tcgc--------ttgtttcagggaa--------------------t
               Bactrian camel  aag-aagatgaaa-----------tcac--------ttgtttcagggaa--------------------t
B D                   Dolphin  aag-aaaatgaaa-----------tcac--------t--tttcaggaaa--------------------t
                 Killer whale  aag-aaaatgaaa-----------tcac--------t--tttcaggaaa--------------------t
             Tibetan antelope  aag-aaaacaaaa-----------tcat--------ttgtttcagggaa--------------------t
B D                       Cow  aag-aaaaggaaa-----------tcat--------ttgtttcagggaa--------------------t
B D                     Sheep  aag-aacacaaaa-----------tcat--------ttgtttcagggaa--------------------t
                Domestic goat  aag-aaaacaaaa-----------tcat--------ttgtttcagggaa--------------------t
B D                     Horse  aaa-caaatgaaa-----------tggc--------ttacttcaggaaa-------------------gt
B D          White rhinoceros  aaa-agaatgaaa-----------ttac--------ttacttcaggaag-------------------cc
B D                       Cat  aat-aaaataaaa-----------gcac--------ttatttcaggaaa-------------------at
B D                       Dog  aag-aaaatgaaa-----------ccac--------ttgtttcaggaaa-------------------ac
B D                   Ferret   aag-aaaatgaaa-----------ccac--------ttatttcaggaaa-------------------at
B D                     Panda  aag-aaaatgaaa-----------ccac--------ttatttcaggaaa-------------------at
               Pacific walrus  aag-aaaatgaaa-----------gcac--------ttatttcaggaaa-------------------at
                 Weddell seal  aag-aaaatgaaa-----------gcac--------ttatttcaggaaa-------------------at
             Black flying-fox  aag-aaaataaaa------------------------catttcagaaaa-------------------tt
B D                   Megabat  aag-aaaataaaa------------------------catttcagaaaa-------------------tt
                Big brown bat  aag-aaaatgaaa-----------tcgc--------ttatttcaggaag-------------------tt
         David's myotis (bat)  aag-aaaatgaaa-----------tcgc--------ttatttcaggaag-------------------tg
B D                  Microbat  aag-aaaatgaaa-----------tcgc--------ttatttcaggaaa-------------------tg
              Star-nosed mole  aag-ataatgaaa-----------ccac--------ttatttcagaaac--------------------g
B D                  Elephant  ----aaaatgaaa-----------tcac--------ttatttcgggaaa-------------------at
          Cape elephant shrew  ----aaaaagaaaaaaaaatcaagtggt--------ccatttcagg-aa-------------------at
B D                   Manatee  aag-aaaatgaaa-----------tctc--------ttatttcaggaaa-------------------at
             Cape golden mole  gag-aaaatggaa-----------ttgc--------ttacttcaggaag-------------------ct
B D                    Tenrec  aagaaaaatgaag-----------tggc--------ctccttcaggaaa-------------------at
                     Aardvark  aag-aaaatgaaa-----------ttac--------ttatttcaggaaa-------------------ac
B D                 Armadillo  ----actatgaaa-----------tggc--------ttatttcaggaat-------------------tt
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
      Yellowbelly pufferfish  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ----------------------------------------------------------------------
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
            Brush-tailed rat  ----------------------------------------------------------------------
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  tctaaacacaggaaagg-----atgtgtcatta
                        Chimp  tctaaacacaggaaagg-----atgtgtcatta
                    Orangutan  tctaaacacaggaaagg-----atgtgtcatta
                       Gibbon  tctaaacacaggaaagg-----atgtgtcatta
                       Rhesus  tctaaacacaggaaagg-----atgtgtcatta
          Crab-eating macaque  tctaaacacaggaaagg-----atgtgtcatta
                       Baboon  tctaaacacaggaaagg-----atgtgtcatta
                 Green monkey  tctaaacacaggaaagg-----atgtgtcatta
                     Marmoset  tctaaacacaggaaaga-----atctgtcagta
              Squirrel monkey  tctaaacacaggaaaga-----atctgtcatta
                     Bushbaby  tctaaagatgggagagaattc-attcgttgtta
           Chinese tree shrew  tctgggcacagtgagaatttc-atttgttgtaa
                     Squirrel  acaaaacacaggagagaattc-atttgtcatta
       Lesser Egyptian jerboa  tctgaacacaggaa-gaatgc-atgtgccatac
                 Prairie vole  tctaaacacaggaa--aatgg-aggcgctataa
              Chinese hamster  tgtaaacacggtaa--aatat-aggtgctggaa
               Golden hamster  tctaaacacaggaa--aatgt-aggtgccataa
                        Mouse  tctaaacacatgaa--aatgt-aggcgccataa
                          Rat  tccaaatacaggaa--atttt-aggtgccacag
               Naked mole-rat  tctgaacacaggacagacttc-ctgcgtcct--
                   Guinea pig  tctacacacaagagaga-cct-ctgggtcct--
                   Chinchilla  tcttcacacaggagagagcat-ctatgtcct--
                       Rabbit  tctaaacacaggagaaaatttcgtttgtcctta
                         Pika  tctaagcacaggagaaaacgt-gtctgcccttt
                          Pig  tttgaacacaagagag----------------a
                       Alpaca  tttgaacacgggagagaatctcctttgtcagta
               Bactrian camel  tttgaacacgagagagaatctcctctgtcagta
                      Dolphin  tttgaacacaggagagaatttcatttgtcatga
                 Killer whale  tttgaacacaggagagaatttcatttgtcatga
             Tibetan antelope  tgtccacagaggagaggacttcatgtgtcatga
                          Cow  tgttaacacaggagaggatttcacttatcagga
                        Sheep  tgtccacagaggagaggacttcatgtgtcatga
                Domestic goat  tgtccacagaggagaggacttcatgtgtcatga
                        Horse  ttttaacacaggagggaatttcatttgtcgctg
             White rhinoceros  tttgaacacaggagagaatttcacttgtcatta
                          Cat  tttgagcacaggagagaatttcacttgtcccaa
                          Dog  attgaacacaggagagaatatgatttgttgtgg
                      Ferret   tctggacacaggagagaattttgtc--tcatga
                        Panda  gttgaacactggagagaatttcatttgtcatga
               Pacific walrus  tttgaacgcaggagagaatttcatttgtcatga
                 Weddell seal  tttgaacgcaggagagaatttcatttgtcatga
             Black flying-fox  tttgaacacaagagaa--tttcacttgtcatta
                      Megabat  tttgaacacaagagaa--tttcacttgtcatta
                Big brown bat  tttgaacaccggagaaatgttcattcaccatta
         David's myotis (bat)  tttgaacaccggagaaactgtcattcatcatta
                     Microbat  tttgaacaccggagaacttgtcattcatcatta
              Star-nosed mole  tttgaacacaagagaa--tttcatttgccatta
                     Elephant  gttaaacacagacgggaattttgtttgtcattg
          Cape elephant shrew  gttaaacactggcgggagt----tttgtcactg
                      Manatee  gttaaacacaga--aaaattttttttgtcattg
             Cape golden mole  gttaagcacaggaagaaattgtgtctgttatag
                       Tenrec  gtaaaacccggcaaggaattgtgtttgtcactg
                     Aardvark  gttaaacacaggagggaattttatttgtcactg
                    Armadillo  ttttaacacagc-aaaaattccatttgtcacta
                     Hedgehog  =================================
                        Shrew  =================================
                X. tropicalis  =================================
                  Spotted gar  =================================
       Yellowbelly pufferfish  =================================
                 Mallard duck  =================================
           Tibetan ground jay  =================================
                  Zebra finch  ---------------------------------
              Tasmanian devil  =================================
     Mexican tetra (cavefish)  =================================
               Painted turtle  =================================
              Green seaturtle  =================================
           American alligator  =================================
                Scarlet macaw  =================================
                      Opossum  =================================
                  Rock pigeon  =================================
          Collared flycatcher  =================================
                       Lizard  =================================
             Peregrine falcon  =================================
                 Saker falcon  =================================
             Brush-tailed rat  ---------------------------------
                     Platypus  =================================
                      Wallaby  =================================
     Chinese softshell turtle  =================================

Alignment block 21 of 252 in window, 159891627 - 159891666, 40 bps 
B D                     Human  atgcagcca----ctgtgctcctgaccagaggcag-ggg--------------------------gatgg
B D                     Chimp  atgcagcca----ctgtgctcctgaccagaggcag-ggg--------------------------gatgg
B D                 Orangutan  atgcagcca----ctgtgatcctgaccagaggcag-ggg--------------------------gatgg
B D                    Gibbon  atgcagcca----ctgtgatcctgaccagaggca--ggg--------------------------gatgg
B D                    Rhesus  atgcagcca----ctgtgatcctgaccagaggcag-ggg--------------------------gatgg
B D       Crab-eating macaque  atgcagcca----ctgtgatcctgaccggaggcag-ggg--------------------------gatgg
B D                    Baboon  atgcagcca----ctgtgatcctgaccagaggcag-ggg--------------------------g-tgg
B D              Green monkey  atgcagcca----ctgtgatcctgaccagaggcag-ggg--------------------------gatgg
B D                  Marmoset  atgcagcaa----ctgtgatcccgggcagaggcag-ggg--------------------------gatgg
B D           Squirrel monkey  atgcagcaa----ctgtgatcctgagcagaggcag-ggg--------------------------gacgg
B D                  Bushbaby  atgccataa----ctgtgctcctgacc--aggcag-gga--------------------------ggtga
           Chinese tree shrew  atgcagcca----c--tgatcccgactccgggcag-gac--------------------------g-ccg
B D                  Squirrel  gtgcatcaa----gtgggaccctgacgggcggcgg-gg---------------------------tgtgg
       Lesser Egyptian jerboa  atgcagtga----ctgggc-cctgcctggaggcca-ggcaagg----------------------ggtgg
                 Prairie vole  atgcagtaa----ctgaca-cctgcctggtgtcta-ggag-------------------------ggtgg
B D           Chinese hamster  atgcagtaa----ctgaca-cctgcccggtatctgaggggcaggaggtgggcg-----agggggaggtgg
               Golden hamster  atgtagtaa----ctgaca-cctgtctggtatctg-ggagtggggagtggggggtggcgggtgggggtgg
B D                     Mouse  acgcagtaa----cagaca-cctgcatggtgccca-ggg--------------------------ggtag
B D                       Rat  atgctgtag----ctgaca-cctgcatggcgtcca-ggg--------------------------ggtag
B D            Naked mole-rat  -tgcaaccc----ctgggactctggctggaggcag-ggg--------------------------tgtgg
B D                Guinea pig  -tgaagtca----ctgggaccctggctggaagcaa-gag--------------------------tgtgt
                   Chinchilla  -tgcagcta----cttggaccctggctggaggcag-ggt--------------------------tgtgt
B D                    Rabbit  atgcagtaa----ctgggaacccgcctggaagcag-ggg--------------------------gatgg
B D                      Pika  atgcagt-a----ccagggatctgcttggaggcag-gag--------------------------ga-gg
B D                       Pig  acgtagtat----ctgcgatcctgagtggaggcag-ggg--------------------------cgtgg
B D                    Alpaca  acgcaggag----ctgtgatcctgagtggaggccg-ggg--------------------------catgg
               Bactrian camel  acgcaggag----ctgtgatcctgagcagaggccg-ggg--------------------------catgg
B D                   Dolphin  atgcagtat----ctgtggtcctgagtagaggcag-ggg--------------------------catgg
                 Killer whale  acgcagtat----ctgtggtcctgagtagaggcag-ggg--------------------------catgg
             Tibetan antelope  acacagtgt----ctgcgatcctgagtgcaggcag-ggg--------------------------catgg
B D                       Cow  acacagtgt----ctgcgatcctgagtggaggccc-ggg--------------------------cacgg
B D                     Sheep  acacagtgt----ctgcgatcctgagtgcaggcag-ggg--------------------------catgg
                Domestic goat  acacagtgt----ctgcgatcctgagggcaggcag-ggg--------------------------catgg
B D                     Horse  atgccacaa----atctgatcctgagtggaggcag-g-g--------------------------ggcga
B D          White rhinoceros  atgtcgtga----ctgtgatcctgagtggaggcag-g-g--------------------------ggtgg
B D                       Cat  atgcagtaa----ctgtgatcccaagtggaggtag-gga--------------------------gatgg
B D                       Dog  aggcagcga----ccgtgaccccgggtggaagcag-g-g--------------------------ggagg
B D                   Ferret   aggcagtga----cggtgatcctgcgtggaggcca-gcg--------------------------gccgg
B D                     Panda  atgcagtga----ccatgatcccacgtggaggcct-g-a--------------------------gccgg
               Pacific walrus  aggcagcga----ccgtgatcct----------------------------------------------g
                 Weddell seal  aggcagcga----ccgtgatcct----------------------------------------------g
             Black flying-fox  aagcagtaa----ctgtgatcctgagt-------------------------------------------
B D                   Megabat  aagcagtaa----ctgtgatcctgagt-------------------------------------------
                Big brown bat  actcagtga----ctgtggtcctgagtggagggag-g-g--------------------------ggacc
         David's myotis (bat)  acgcagtga----ctgtggtcctgagtggaggcag-g-g--------------------------ggagc
B D                  Microbat  acgcagtga----ctgtggtcctgagtggaggcag-g-g--------------------------ggacc
              Star-nosed mole  aagcagtga----ctttgctcccgagtggggg--a-ggg--------------------------gctgg
B D                  Elephant  ataccgtaa----ctacactcctgactggaggcaa-ggg--------------------------gacag
          Cape elephant shrew  aggctgtaa----ctatgct-ctgagtggaagcgc-ggg--------------------------gacag
B D                   Manatee  atgctctaa----ctacacgcctgactggaggcaa-gcg--------------------------gacgg
             Cape golden mole  gtgctgtacctctctctactcctgactggaggcag-ggg--------------------------gacag
B D                    Tenrec  ctgctgtaa----ctatacaccttactggaggcag-ggg--------------------------gacag
                     Aardvark  atgctgtca----gtatgctcctgactggaggcag-ggg--------------------------catgg
B D                 Armadillo  ataccataa----ccgtgatcccaattgaacgtgg-agg--------------------------ggggg
B D           Tasmanian devil  atgctatag----atgtgcgactgtccagtagaga-gag--------------------------agttg
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
      Yellowbelly pufferfish  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
            Brush-tailed rat  ----------------------------------------------------------------------
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  c--------
                        Chimp  c--------
                    Orangutan  c--------
                       Gibbon  c--------
                       Rhesus  c--------
          Crab-eating macaque  c--------
                       Baboon  c--------
                 Green monkey  c--------
                     Marmoset  c--------
              Squirrel monkey  c--------
                     Bushbaby  c--------
           Chinese tree shrew  c--------
                     Squirrel  c--------
       Lesser Egyptian jerboa  c--------
                 Prairie vole  c--------
              Chinese hamster  c--------
               Golden hamster  c--------
                        Mouse  c--------
                          Rat  c--------
               Naked mole-rat  c--------
                   Guinea pig  c--------
                   Chinchilla  c--------
                       Rabbit  c--------
                         Pika  c--------
                          Pig  c--------
                       Alpaca  c--------
               Bactrian camel  c--------
                      Dolphin  c--------
                 Killer whale  c--------
             Tibetan antelope  c--------
                          Cow  c--------
                        Sheep  c--------
                Domestic goat  c--------
                        Horse  c--------
             White rhinoceros  c--------
                          Cat  c--------
                          Dog  c--------
                      Ferret   c--------
                        Panda  c--------
               Pacific walrus  c--------
                 Weddell seal  c--------
             Black flying-fox  ---------
                      Megabat  ---------
                Big brown bat  c--------
         David's myotis (bat)  c--------
                     Microbat  c--------
              Star-nosed mole  g--------
                     Elephant  c--------
          Cape elephant shrew  c--------
                      Manatee  c--------
             Cape golden mole  t--------
                       Tenrec  c--------
                     Aardvark  c--------
                    Armadillo  c--------
              Tasmanian devil  gatcagttt
                     Hedgehog  =========
                        Shrew  =========
                X. tropicalis  =========
                  Spotted gar  =========
       Yellowbelly pufferfish  =========
                 Mallard duck  =========
           Tibetan ground jay  =========
                  Zebra finch  ---------
     Mexican tetra (cavefish)  =========
               Painted turtle  =========
              Green seaturtle  =========
           American alligator  =========
                Scarlet macaw  =========
                      Opossum  =========
                  Rock pigeon  =========
          Collared flycatcher  =========
                       Lizard  =========
             Peregrine falcon  =========
                 Saker falcon  =========
             Brush-tailed rat  ---------
                     Platypus  =========
                      Wallaby  =========
     Chinese softshell turtle  =========

Inserts between block 21 and 22 in window
B D           Naked mole-rat 4bp
B D               Guinea pig 4bp
                  Chinchilla 4bp
B D                   Rabbit 4bp
B D                     Pika 4bp
B D                      Pig 29bp
B D                   Alpaca 12bp
              Bactrian camel 12bp
B D                  Dolphin 12bp
                Killer whale 12bp
            Tibetan antelope 11bp
B D                      Cow 12bp
B D                    Sheep 11bp
               Domestic goat 11bp
B D                    Horse 12bp
B D         White rhinoceros 12bp
B D                      Cat 12bp
B D                      Dog 12bp
B D                  Ferret  12bp
B D                    Panda 12bp
              Pacific walrus 12bp
                Weddell seal 12bp
            Black flying-fox 6bp
B D                  Megabat 6bp
               Big brown bat 12bp
        David's myotis (bat) 12bp
B D                 Microbat 12bp
             Star-nosed mole 12bp
B D                 Elephant 13bp
         Cape elephant shrew 13bp
B D                  Manatee 13bp
            Cape golden mole 13bp
B D                   Tenrec 33bp
                    Aardvark 13bp
B D                Armadillo 11bp

Alignment block 22 of 252 in window, 159891667 - 159891681, 15 bps 
B D                     Human  ---------cc---------ca-c--ttgt-cct-----------acc-
B D                     Chimp  ---------cc---------cg-c--ttgt-cct-----------acc-
B D                 Orangutan  ---------cc---------cg-c--ttgt-cct-----------acc-
B D                    Gibbon  ---------cc---------cg-c--ttgt-ccc-----------acc-
B D                    Rhesus  ---------cc---------cg-c--ttgt-cct-----------acc-
B D       Crab-eating macaque  ---------cc---------cg-c--ttgt-cct-----------acc-
B D                    Baboon  ---------cc---------ca-c--ttgt-cct-----------acc-
B D              Green monkey  ---------cc---------cg-c--ttgt-cct-----------acc-
B D                  Marmoset  ---------cc---------cg-c--ctgt-cct-----------acc-
B D           Squirrel monkey  ---------cc---------ct-c--ctgt-cct-----------acc-
B D                  Bushbaby  ---------ct---------c--c--tggc-ctg-----------gcc-
           Chinese tree shrew  ---------ct---------tg-c--ctgt-cct-----gaga--act-
B D                  Squirrel  -----------------------c--ttgc-cta-----tccta-aga-
       Lesser Egyptian jerboa  -----------------------c--ttgc-ttg-----tcctgaggt-
                 Prairie vole  -----------------------t--tgga-ct------------ggt-
B D           Chinese hamster  -----------------------t--ttga-ct------------aat-
               Golden hamster  -----------------------t--ttga-cg------------agg-
B D                     Mouse  -----------------------t--ttga-ct------------ggg-
B D                       Rat  -----------------------t--ttga-ct------------ggg-
B D            Naked mole-rat  ---------cc---------ta-c--ctga-gg------------cct-
B D                Guinea pig  ---------cc---------ta-c--ctga-gg------------gcg-
                   Chinchilla  ---------cc---------ta-c--ctga-gg------------gct-
             Brush-tailed rat  ---------cc---------ta-c--ctgc-ca------------gct-
B D                    Rabbit  ---------cc---------tgtc--ctga-ga------------act-
B D                      Pika  ---------cc---------taca--ctaa-ga------------atc-
B D                       Pig  ---------cc---------gt-c--ctgg-ctg-----gaga--atc-
B D                    Alpaca  ---------ct---------tt-g--ctgc-ctg-----gaaa--acc-
               Bactrian camel  ---------ct---------tt-g--ctgt-ctg-----gaaa--acc-
B D                   Dolphin  ---------cc---------tt-c--ctgt-ctg-----gaga--atc-
                 Killer whale  ---------cc---------tt-c--ctgt-ctg-----gaga--atc-
             Tibetan antelope  ---------cc---------tt-c--ctgt-ctg-----gaga--ccg-
B D                       Cow  ---------cc---------gt-c--ctgt-ctg-----gagg--ccg-
B D                     Sheep  ---------cc---------tt-c--ctgt-ctg-----gaga--ccg-
                Domestic goat  ---------cc---------tt-c--ctgt-ctg-----gaga--ccg-
B D                     Horse  ---------cc---------tt-c--ctgt-cct-----gaga--acc-
B D          White rhinoceros  ---------ac---------ct-c--ctgt-cct-----gaga--acc-
B D                       Cat  ---------cc---------tc-c--gggt-cct-----gagc------
B D                       Dog  ---------ca---------tc-ccttggt-ccg-----gagc------
B D                   Ferret   ---------cc---------tt-g--gggt-cct-----gagg------
B D                     Panda  ---------cc---------tt-c--tggt-gct-----gagc------
               Pacific walrus  ---------cg---------tt-c--gggt-cct-----gagc--gcc-
                 Weddell seal  ---------cgtgcaggtcctt-c--gggt-cct-----gagc--gcc-
             Black flying-fox  ---------cc---------ct-c--ttgt-cct-----gaga--act-
B D                   Megabat  ---------cc---------ct-c--ttgt-cct-----gaga--act-
                Big brown bat  ---------cc---------tt-c--ctggcccc-----gagg--acc-
         David's myotis (bat)  ---------cc---------tt-c--ctgg-ccc-----gagg--acc-
B D                  Microbat  ---------cc---------tt-c--ctgg-ccc-----gagg--atc-
              Star-nosed mole  ---------cc---------ca-c--tcgg-c-----------------
B D                  Elephant  ---------cc---------gt-c--ctgt-cct-----caga--acc-
          Cape elephant shrew  ---------cc---------at-t--ttgt-cct-----gaga--acc-
B D                   Manatee  ---------cc---------at-c--ctat-cct-----gaga--acc-
             Cape golden mole  ---------cc---------at-t--ctgt-ccc-----taga--acc-
B D                    Tenrec  ---------cc---------ac-c--cctt-cct-----gaga--acc-
                     Aardvark  ---------cc---------ct-c--cagt-cccatgaaaaga--aat-
B D                 Armadillo  -------------------------------act-------------c-
B D           Tasmanian devil  ctcaatggccc---------tc-c--cagg-cca-----taaa--aatc
B D                  Hedgehog  =================================================
B D                     Shrew  =================================================
B D             X. tropicalis  =================================================
                 Spotted gar  =================================================
      Yellowbelly pufferfish  =================================================
  D              Mallard duck  =================================================
          Tibetan ground jay  =================================================
B D               Zebra finch  -------------------------------------------------
    Mexican tetra (cavefish)  =================================================
  D            Painted turtle  =================================================
  D           Green seaturtle  =================================================
B D        American alligator  =================================================
  D             Scarlet macaw  =================================================
B D                   Opossum  =================================================
  D               Rock pigeon  =================================================
  D       Collared flycatcher  =================================================
B D                    Lizard  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
B D                  Platypus  =================================================
B D                   Wallaby  =================================================
  D  Chinese softshell turtle  =================================================

Inserts between block 22 and 23 in window
              Pacific walrus 4bp
                Weddell seal 4bp

Alignment block 23 of 252 in window, 159891682 - 159891707, 26 bps 
B D                     Human  t--------cactt----tgcacccac-agt-c---------ccct----gtg
B D                     Chimp  t--------cactt----tgcacccac-agt-c---------ccct----gtg
B D                 Orangutan  t--------cactt----tgtacccac-agt-c---------ccct----gtg
B D                    Gibbon  t--------cacat----tgcacccac-agt-c---------ccct----gtg
B D                    Rhesus  t--------cactt----tgcactcac-agt-c---------ccct----gtg
B D       Crab-eating macaque  t--------cactt----tgcactcac-agt-c---------ccct----gtg
B D                    Baboon  t--------cactt----tgcactcac-tgt-c---------ccct----gtg
B D              Green monkey  t--------cactt----tgcactcac-agt-c---------ccct----gtg
B D                  Marmoset  t--------cagtt----tgcacccac-agt-c---------ccct----gtg
B D           Squirrel monkey  t--------cactt----tgcacccac-agt-c---------ccct----gta
B D                  Bushbaby  tcagactgccactg----ggcacagcc-agg-c---------ccca----g--
           Chinese tree shrew  t--------cattt----ggcac-ggc-tgt-c---------cccc----c--
B D                  Squirrel  a--------ctttc----cacaca-----gt-c---------cc------gag
       Lesser Egyptian jerboa  t--------tactc----tgtact-----gt-c---------ccct----gag
                 Prairie vole  t--------cgctt----tgcact-----gt-c---------ccct----gag
B D           Chinese hamster  t--------cactt----tgcact-----gt-c---------ccctgagcgag
               Golden hamster  t--------cactt----tacact-----gt-c---------ccct----gag
B D                     Mouse  t--------cactttgtatgcact-----gt-c---------ccct----gag
B D                       Rat  t--------cactt----tacact-----gt-c---------ccct----gag
B D            Naked mole-rat  t--------ccctt----ggccct--c-tgt-c---------ctct----gag
B D                Guinea pig  t--------ccctt----ggccct----ggg-c---------ccct----aag
                   Chinchilla  t--------ccctt----gaccct--c-tgt-c---------ccct----gag
             Brush-tailed rat  t--------ccctt----gaccct--c-tgt-c---------ccct----gag
B D                    Rabbit  t--------cgc-----gtgcaca-----gt-c---------cccg----gag
B D                      Pika  t--------tgctttttgcacacg-----gt-c---------cccg----gag
B D                       Pig  t--------cactt----tgcacgtc--tgt-cccggtccgtcccg----gag
B D                    Alpaca  t--------cactt----tgcacgcc--tgt-c---------cccg----gag
               Bactrian camel  t--------cactt----tgcatgcc--tgt-c---------cccg----gag
B D                   Dolphin  c--------cgctt----tgcacacc--cgt-c---------cctg----gag
                 Killer whale  c--------cgctt----tgcacacc--cgt-c---------cctg----gag
             Tibetan antelope  g--------cactg----cgcacacc--cgt-t---------cccg----ggg
B D                       Cow  g--------ctctg----tgcacacc--cgt-t---------ccca----gaa
B D                     Sheep  g--------cactg----cgcacacc--cgt-t---------cccg----ggg
                Domestic goat  g--------cactg----cgcacacc--cgt-t---------cccg----ggg
B D                     Horse  t--------cactt----tg-acagac-tgt-----------ccca----gag
B D          White rhinoceros  t--------cactt----tg-atagac-cgt-----------gccg----gag
B D                       Cat  t--------cactt----tgcaggga--cgt-c---------cccg----ggg
B D                       Dog  t--------cactc----ggctc-gat-ggt-c---------ccca----gcg
B D                   Ferret   g--------ccctt----tgcacagag-cgt-c---------ccca----gag
B D                     Panda  t--------ccctt----ggcacggac-cgt-c---------ccca----gag
               Pacific walrus  g--------ccctt----tgcacagac-tgt-c---------ccca----gag
                 Weddell seal  g--------ccctt----tgcacagac-cgt-c---------ccca----gag
             Black flying-fox  t--------cactt----tg--caga--ggt-----------ccca----gag
B D                   Megabat  t--------cactt----tg--caga--ggt-----------ccca----gag
                Big brown bat  t--------cacac----tgcacaga--gg------------tccc----aac
         David's myotis (bat)  t--------cacag----ggcacaga--ggt-ccc-------tccc----gac
B D                  Microbat  t--------cacag----ggcacaga--ggt-ccc-------tccc----gac
              Star-nosed mole  t--------ccc----------cgcc--tgt-c---------c----------
B D                  Elephant  t--------cactt----tgcatagcc-agatc---------ccat----gag
          Cape elephant shrew  t--------catgg----tccagagcc-agttc---------ccct----gag
B D                   Manatee  t--------gactt----tgcatagcc-ggttc---------ccct----gag
             Cape golden mole  t--------cattt----agcgtagcc-agttc---------ccct----gat
B D                    Tenrec  t--------gcctt----tgcctagcc-agttc---------ccct----gag
                     Aardvark  t--------cactt----tgcaaagct-ggttc---------ccct----gag
B D                 Armadillo  t--------cactt----ggtatagat-ggttc---------ccct----gag
B D                   Opossum  t--------ctctc----tccaaatac--tt-t---------cgct----aag
B D           Tasmanian devil  t--------gactc----ttcaaatgctatt-t---------ctcc----aag
B D                  Hedgehog  =====================================================
B D                     Shrew  =====================================================
B D             X. tropicalis  =====================================================
                 Spotted gar  =====================================================
      Yellowbelly pufferfish  =====================================================
  D              Mallard duck  =====================================================
          Tibetan ground jay  =====================================================
B D               Zebra finch  -----------------------------------------------------
    Mexican tetra (cavefish)  =====================================================
  D            Painted turtle  =====================================================
  D           Green seaturtle  =====================================================
B D        American alligator  =====================================================
  D             Scarlet macaw  =====================================================
  D               Rock pigeon  =====================================================
  D       Collared flycatcher  =====================================================
B D                    Lizard  =====================================================
  D          Peregrine falcon  =====================================================
  D              Saker falcon  =====================================================
B D                  Platypus  =====================================================
B D                   Wallaby  =====================================================
  D  Chinese softshell turtle  =====================================================

Inserts between block 23 and 24 in window
B D                  Opossum 1bp
B D          Tasmanian devil 1bp

Alignment block 24 of 252 in window, 159891708 - 159891864, 157 bps 
B D                     Human  tgctgc--tgccacctggtgccca-tctctg--ctttc----acgtggg-cacaactcagtcgtgccaca
B D                     Chimp  tgctgc--tgccacctggtgccca-tctctg--ctttc----acgtggg-cacaactcagtcatgccaca
B D                 Orangutan  tgctgc--tgccacctggtgccca-tctctt--ctttc----acgtgtg-cacaactctgtcgtgccaca
B D                    Gibbon  tgctgc--tgccacctggtgccca-tctctg--ctttc----acgtggg-cacaactcagtcatgccaca
B D                    Rhesus  tgctgc--tgccacctggtgccca-tctctg--ctttc----acgtggg-cacaactcagtcatgccaca
B D       Crab-eating macaque  tgctgc--tgccacctggtgccca-tctctg--ctttc----acgtggg-cacaactcagtcatgccaca
B D                    Baboon  tgctac--tgccacctggtgccca-tctctg--ctttc----acgtggg-cacaactcagtcatgccaca
B D              Green monkey  tgctgc--tgccacctggtgccca-tctctg--ctttc----atgtggg-cacaactcagtcatgccaca
B D                  Marmoset  tgctgc--tgccacctggtgcctg-tctcta--ctttc----acgtggg-cacaactcagtcgtgccaca
B D           Squirrel monkey  tgctgc--tgccacctggtgcctg-tctcta--ctttc----acgtggg-cacaactcagtcatgccaca
B D                  Bushbaby  tgctgc--tgccacctgctgccca-tctctg--c-tcc----aagcggg-aacagct--gtcatgccaca
           Chinese tree shrew  cagtgc--tgccccctagtgttca-tctctg--cttca----gagccgg-cacacctcggccatgccaca
B D                  Squirrel  ccctgc--tgccacctggtgccca-tctcag--cttcc----aggcgag-caccactcggtcaagccaca
       Lesser Egyptian jerboa  tgctgc--tgccacctggtgccca-tcgctg--cttcc----agacaga-catgacttattcatgccaca
                 Prairie vole  cactgc--tgccacctgctgtcca-tctctg--cttcc----ggaaggg-cacgactcagtcacgccaca
B D           Chinese hamster  cgctgc--tgccacctgctgttca-tctctg--cttcc----ggaaggg-cacgactcagtcgtgccacg
               Golden hamster  cgctgc--tgccacctgctgttca-tctctg--cttcc----ggaaggg-cacaactcagtcatgccgtg
B D                     Mouse  cgctac--tgccacctggtgtttg-tttctg--cttct----agaaggg-cacaactcagcaatgctgcg
B D                       Rat  cgctac--tgccacctggtgttcg-tctctg--cttcc----acaaggg-cacatcgaagcaatgctgca
B D            Naked mole-rat  tgctgc--tgccacctgctgccca-tctcca--cctcc----aggcagg-caccactccggcacgccaca
B D                Guinea pig  tgctgc--tgccacctgctgccca-tctctg--cctcc----agtccaa-caccactcagccacgccaca
                   Chinchilla  cgctgc--tgccacctgctgccca-tctctg--cctcc----aggcaga-caccactcagtcacaccaca
             Brush-tailed rat  tgctgc--tgccacctgctgccca-tctctg--ccttc----aggcagc-caccactgagccacaccaca
B D                    Rabbit  tgctgc--tgccacctggtgccca-tccctg--cttcc----aagtggg-cacaactcagccatgccaca
B D                      Pika  tgctgc--tgccacctggtgccca-tcccgg--cttcc----aagtggg-cacagctcagtcatgtcaca
B D                       Pig  tgctac--tgccacctggtgccca-tctctg--cttcc----aagg-gg-cacaactcagtcaggccaca
B D                    Alpaca  tgctgc--tgccacctggtgccca-tctctg--cttcc----aagtggg-cacaactcagtcagcccaca
               Bactrian camel  tgctgc--tgccacctggtgccca-tctttg--cttcc----aagtggg-cacaactcggtcagcccaca
B D                   Dolphin  tgctgc--tgccacctggtgccca-tctctg--cttcg----aagt-gg-cacaactcagtcaggccaca
                 Killer whale  tgctgc--tgccacctggtgccca-cctctg--cttcc----aagt-gg-cacaactcagtcaggccaca
             Tibetan antelope  tgctgc--tgccgcctggcgcccg-tctctg--cttcc----aagt-gg-ctcaactcagtcaggtcaca
B D                       Cow  tgctgc--tgccacctggcgccca-tctctg--cctcc----cagc-gg-ctcaactcagtcaggtcaca
B D                     Sheep  tgctgc--tgccgcctggcgcccg-tctctg--cttcc----aagt-gg-ctcaactcagtcaggtcaca
                Domestic goat  tgctgc--tgccgcctggcgcccg-tctctg--cttcc----aagt-gg-ctcaactcagtcaggtcaca
B D                     Horse  tgctgc--tgccacctggtgccca-tctctg--cttct----aagcggg-caccacttggccacgaaaca
B D          White rhinoceros  tgctgc--tgccacctggtgccca-tctctg--cttcc----aagcggg-caccactcagtcatgccaca
B D                       Cat  tgctgc--tgccccctgctgccca---tctg--ccgcc----aagaggg-cgcaactcaggcgcgccgcg
B D                       Dog  tgctac--tgccacctggcgtcca---tctg--cttccagggggggggg-cgcgactcaggcgtgacaca
B D                   Ferret   cgctgc--tgccacctgctgtccg---tgtg--cttcc----aagagga-cgcgcct--ggggcgccaca
B D                     Panda  cgctgc--tgccaccttctgtcca---tctg--cttcc----aagaggg-cgcgactcaggcgcgccaca
               Pacific walrus  cgctac--taccacctgcag-cca---tctg--cttcc----gagaggg-cgcgactcaggcgcgccacg
                 Weddell seal  tgttat--caccagctgcagtcca---tctg--cttcc----gagaggg-cgtgactcaggcgcgccacg
             Black flying-fox  tgctgc--tgccacctggtgccta-tctctg--cttcc----aagtagg-cacaagtcagtcatgccaca
B D                   Megabat  tgctgc--tgccacctggtgccca-tctctg--cttcc----aagtagg-cacaagtcagtcatgccaca
                Big brown bat  tggtgc--tgccacctggtgccca-tctctg--cttcc----gagtggg-cat--gtcagtcataacaca
         David's myotis (bat)  tggtgc--tgccacctggtgccca-tctctg--cttcc----gaatggg-cat--gtcagtcatgccaca
B D                  Microbat  tagtgc--tgccacctggtgccca-tctctg--cttcc----gagtggg-cat--gtcagtcatgccaca
              Star-nosed mole  tgctgccgcgccacctgccgaccg-gcctgg--cggcg----ccacgga-tgcccct-agtcctgccaca
B D                  Elephant  tgttgc--tgccacctggcgcctggtctgtg--tgtcc----agacggg-cataacgtcgtcatgccaca
          Cape elephant shrew  tgctgc--tgccacctggtgcctggtcgatgcctggtc----aggcggg-catcacgccctgatgccaca
B D                   Manatee  tgctgc--tgccacctggtgcctggtctggg--cttcc----aggcggg-cacaacatcgtcatgtcaca
             Cape golden mole  tgctgc--tgccacctggtgcctggtctatg--cttcg----aggcggg-caccatgttgtggtgctaca
B D                    Tenrec  tgctgc--tgccacctggtgcccagtctccg--cttcc----tggcagg-cacagagtcgtgatgccaca
                     Aardvark  tgctgc--tgccacctggtgcctggtctctg--cttcc----gggcaga-cacaacatcctaatgccata
B D                 Armadillo  tgctgc--tgccacctggtgcccagcctgtg--cctcc----aagcggg-cacaactcc----tgccaca
B D                   Opossum  tgctac--tgccacctagtgcctggcctggg--cttct----gtgtgga-ta----tcgggcagactgca
B D           Tasmanian devil  tgctgc--tgccacctggtgcctggcctggg--cttct----gtgtgggtta----tcacacagactgca
B D                   Wallaby  tgctgc--tgccacctggtgcccagcctgga--cttct----gtgtgga-ta----tcagacagactgcg
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
      Yellowbelly pufferfish  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ggccacttctgccctctactgcc-catt---------------------gagagacttcc----------
                        Chimp  ggccacttctgccctctactgcc-catt---------------------gagagacttcc----------
                    Orangutan  ggccacttctgccctctactgcc-ggtt---------------------gagagacttcc----------
                       Gibbon  ggccacttctgccctctactgcc-catt---------------------gagagacttcc----------
                       Rhesus  ggccacttctgccctctactgcc-tgtt---------------------gagagacttcc----------
          Crab-eating macaque  ggccacttctgccctctactgcc-tgtt---------------------gagagacttcc----------
                       Baboon  ggccacttctgccctctactgcc-tgtt---------------------gagagacttcc----------
                 Green monkey  ggccacttctgccctctactgcc-tgtt---------------------gagagacttcc----------
                     Marmoset  ggccacttctgccctctactgcc-agtt---------------------gagagacttcc----------
              Squirrel monkey  ggccacttctgccctctactgcc-agtt---------------------gagagacttcc----------
                     Bushbaby  ggccacttctgccccctactggc-ggtt---------------------gagagactttc----------
           Chinese tree shrew  ggccactcctgccccctactgcc-gctt---------------------cagagacttcc----------
                     Squirrel  ggccacttctgccccctactgcc-cgct---------------------gagagacttcc----------
       Lesser Egyptian jerboa  ggccacttctgccccctactgcc-agtt-----------------------------tcc----------
                 Prairie vole  ggccacttctgccccctactgcc-cact-----------------------------tcc----------
              Chinese hamster  ggccacttctgccccctaccgcc-aact-----------------------------tcc----------
               Golden hamster  ggccacgtctgccccctaccgcc-aact-----------------------------tcc----------
                        Mouse  ggccacttctgccccctaccgct-aact-----------------------------tcc----------
                          Rat  ggccacttctgccccctaccgcc-aactgcctggactctcggttacccataaggccagcc----------
               Naked mole-rat  ggccacttctgccccctactgcc-cgct---------------------gaagaac-ttc----------
                   Guinea pig  agccacttctgccccctactgcc-agct---------------------gcagagc-ttc----------
                   Chinchilla  ggccacttctgccccctactgcc-agtt---------------------gaaggac-ttc----------
             Brush-tailed rat  ggccacttctgccccctactgcc-agtt---------------------gaagaac-ttc----------
                       Rabbit  ggccactcctgccccctactgct-ggct---------------------aggagacaccc----------
                         Pika  ggccacttctgccccctactgcc-gacc---------------------aagagacatcc----------
                          Pig  ggccacttctgccccctactgcc-ggct---------------------gagaaacttcc----------
                       Alpaca  ggccacttctgccccctgctgcc-gatt---------------------gagagacttct----------
               Bactrian camel  ggccacttctgccccctactgcc-gatt---------------------gagagacttcc----------
                      Dolphin  ggccacttctgcccccaattgccgggct---------------------gggagacttcc----------
                 Killer whale  ggccacttctgccccctactgccgggct---------------------gggagacttcc----------
             Tibetan antelope  ggccgcttctgccctctgctgct-ggct---------------------gggaggcttct----------
                          Cow  ggctgcttctgccctctgctgac-ggct---------------------gggaggcttcc----------
                        Sheep  ggccgcttctgccctctgctgcc-ggct---------------------gggaggcttcc----------
                Domestic goat  ggccgcttctgccctctgctgcc-ggct---------------------gggaggcttcc----------
                        Horse  ggccactcctgccccctactgcc-ggtt---------------------gagagactgc-----------
             White rhinoceros  ggtcacttctgccctctactgct-ggtt---------------------aacagactgcc----------
                          Cat  ggccgcgtctgccccctactgcc-ggct---------------------cagagacttct----------
                          Dog  ggccacttctgccccctgctgcc-ggct---------------------cagagactcca----------
                      Ferret   gaccgctcctgccccctgctgccggctt---------------------gagagacctca----------
                        Panda  gaccacttctgccccctaccgcc-ggct---------------------gagagacttct----------
               Pacific walrus  gaccgcttctgccccctgctgcc-gctt---------------------cagagacttct----------
                 Weddell seal  gaccgcttctgccccctgctgcc-gctt---------------------cagagacttcc----------
             Black flying-fox  ggctccttctgccccctactgtt-ggtt---------------------gagagagttcc----------
                      Megabat  ggctccttctgccccctactgtt-ggtt---------------------gagagagttcc----------
                Big brown bat  ggccccttctgccccctgctgct-ggtc---------------------gagagacttcc----------
         David's myotis (bat)  ggccccttctgccccctgctgct-ggtg---------------------gagagacttcc----------
                     Microbat  ggccccttctgccccctgctgct-ggtt---------------------gagagacttcc----------
              Star-nosed mole  ggcagcgcctgccccctgccgct-gg------------------------acagacgccc----------
                     Elephant  gggcacttctgccccctactgcc-agtt---------------------gagagtcttcc----------
          Cape elephant shrew  gggcacttctgccccctactgcc-gacc---------------------gacagccttcc----------
                      Manatee  -ggcacttccgccccctactgcc-agtt---------------------gagagccttcc----------
             Cape golden mole  gggcacgcctgccccctactgcc-ggct---------------------aacagccttcc----------
                       Tenrec  gggcacttctgccccctactgcc-g------------------------agagccctgcc----------
                     Aardvark  gggcacttctgccccctgttgcc-gata---------------------gggtgtcttcc----------
                    Armadillo  gggtactcctgccccctgctgcc-agct---------------------gagagtcttcc----------
                      Opossum  ggaaactcctgccacctactgcc-aaat---------------------cagggccttctgtggattcca
              Tasmanian devil  ggaaactcctgccacctactgcc-aaat---------------------cagggccttctatgcattaca
                      Wallaby  ggaaactcctgccacctaccgcc-aaat---------------------cagcgcct-------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                X. tropicalis  ======================================================================
                  Spotted gar  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ----------------------------------------------------------------------
     Mexican tetra (cavefish)  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ---tgaact---cttacccatca-at---gaggccaaag-----------------aa------------
                        Chimp  ---tgaact---cttacccatca-tt---gaggccaaag-----------------aa------------
                    Orangutan  ---tgaact---cttacccacca-at---gaggccaaag-----------------aa------------
                       Gibbon  ---tgaact---cttagccacca-at---gaggccaaag-----------------aa------------
                       Rhesus  ---tgaact---cttacccacca-at---gaggccaaag-----------------aa------------
          Crab-eating macaque  ---tgaact---cttacccacca-at---gaggccaaag-----------------aa------------
                       Baboon  ---tgaact---cttacccacca-at---gaggccaaag-----------------aa------------
                 Green monkey  ---tgaact---cttacccacca-at---gaggccaaag-----------------aa------------
                     Marmoset  ---tgaact---cttacccacca-at---aaatccaaag-----------------aa------------
              Squirrel monkey  ---tgaact---cttacccacca-at---aagtccaaag-----------------aa------------
                     Bushbaby  ---tagatt---cccacccaccc-ac---aaggccaaag-----------------aa------------
           Chinese tree shrew  ---tgga-g---ctcgcctagca-at---aaagccaaag-----------------aa------------
                     Squirrel  ---tggact---cccaccctccc--t---aaggccaaag-----------------aa------------
       Lesser Egyptian jerboa  ---tggact-----cgtccaccc-at---aaggctcacg-----------------aa------------
                 Prairie vole  ---tggact---ctcttctaccc-at---gaggccaaag-----------------aa------------
              Chinese hamster  ---tggact---ctcatctaccc-at---aaggccacag-----------------aa------------
               Golden hamster  ---tggact---cccatctaccc-at---aaggccacag-----------------aa------------
                        Mouse  ---tggact---ctcatttaccc-ag---aaggccaaag-----------------aa------------
                          Rat  ---tggact---ctcggttaccc-at---aaggccaaag-----------------aa------------
               Naked mole-rat  ---cagact-----cacccacac-ag---gaagccaaagaaaactggatggaatacca------------
                   Guinea pig  ---cagact-----cagccacac-ag---atg------------------------ca------------
                   Chinchilla  ---cagact-----cactcacat-gg---aag------------------------ca------------
             Brush-tailed rat  ---cagact-----tggccaca---g---aag------------------------ca------------
                       Rabbit  ---gggactct-ctcccccacca-gc---aaggccaagggcagt------------gagcttctgatcgc
                         Pika  ---caggctcc-ctcacccaccg-gt---gcggcccaagaaacg------------ga------------
                          Pig  ---g-gact---ctcccccagca-at---aacgccaaaa------------------g------------
                       Alpaca  ---ggggct---ctcacccagca-at---agggccacgg------------------a------------
               Bactrian camel  ---ggggct---ctcacacagca-at---agggccatgg------------------a------------
                      Dolphin  ---tggact---ctcacccagca-aa---aaggccaaag------------------a------------
                 Killer whale  ---gggact---ctcacccagca-aa---aaggccaaag------------------a------------
             Tibetan antelope  ---gagact---ctggtccaaca-at---aagcccagaa------------------g------------
                          Cow  ---gagact---ctggtccaaca-at---aagcccaaaa------------------g------------
                        Sheep  ---gagact---ctggtccaaca-at---aagcccagaa------------------g------------
                Domestic goat  ---gagact---ctggtccaaca-at---aagcccagaa------------------g------------
                        Horse  ------------ctcacccagca-at---aaggccaaag-----------------ga------------
             White rhinoceros  ---tggact---ctcacccagta-at---aaggccaaag-----------------ga------------
                          Cat  ---ga-------ctccccccccgcaa---gaggccaaag------------------a------------
                          Dog  ---gatgcccccccaccccagca-at---agggccaaag-------------------------------
                      Ferret   ---ga-------ctcccccagca-ag---gaggcccaag-------------------------------
                        Panda  ---ga-------ctcccccagca-ag---gagaccaagg-------------------------------
               Pacific walrus  ---g--------ctcccccagcg-ag---gaggccaaag------------------a------------
                 Weddell seal  ---g--------ctcccccagcg-ag---gaggccaaag-------------------------------
             Black flying-fox  ---tggact---ctcacccagca-gt---aaggccaaag-----------------aa------------
                      Megabat  ---tggact---ctcacccagca-gt---aaggccaaag-----------------aa------------
                Big brown bat  ---tgggct---ctcacccagca-at---aaggccaaag-----------------aa------------
         David's myotis (bat)  ---tggact---ctcacccagca-ag---agggcccaag-----------------aa------------
                     Microbat  ---tagact---ctcacccagca-ag---agggccaaag-----------------aa------------
              Star-nosed mole  ---tgcact---ctcctccggca-gg---agg--cggag------------------g------------
                     Elephant  ---tcaact---gtcacccagca-gt---aaggtcaaaa-----------------aa------------
          Cape elephant shrew  ---ttgact---gtcact---ac-tt---aaggtcaaag-----------------aa------------
                      Manatee  ---ttgatt---gtcacccagca-gt---aaggtcaaag-----------------aa------------
             Cape golden mole  ---tttact---g-------tca-at---aaggtcacag-----------------aa------------
                       Tenrec  ---ctgact---gaggcccagca-at---aaggtcaaag-----------------ag------------
                     Aardvark  ---tagact---gtcacccagca-at---cagatca----------------------------------
                    Armadillo  ---ttgact---ctcacccagca-ag---aacgtccaag-----------------aa------------
                      Opossum  atatgtttt---tccacccccag-tt--------caagg-----------------aa------------
              Tasmanian devil  acatgtttt---tccacctccag-gtactcagcccaaga-----------------aa------------
                      Wallaby  ---tgtttt---tccacccccag-gtatgcagcccaagg-----------------aa------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                X. tropicalis  ======================================================================
                  Spotted gar  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ----------------------------------------------------------------------
     Mexican tetra (cavefish)  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  --------actg-gacaaga-gacaagca---------------------tt------t----ttctga-
                        Chimp  --------actg-gacaaga-gacaagca---------------------tt------t----ttctga-
                    Orangutan  --------actg-gacaaga-gacaggca---------------------tt------t----ttctga-
                       Gibbon  --------actg-gacaaga-gacaagca---------------------tt------t----ttctga-
                       Rhesus  --------actg-ggcaagg-gacaagca---------------------tt------t----ttctga-
          Crab-eating macaque  --------actg-ggcaagg-gacaagca---------------------tt------t----ttctga-
                       Baboon  --------actg-ggcaagg-gacaagca---------------------tt------t----ttctga-
                 Green monkey  --------actg-gacaagg-gacaagca---------------------tt------t----ttctga-
                     Marmoset  --------actg-gacaagg-gacacgca---------------------tc------t----ttctga-
              Squirrel monkey  --------actg-gacaagg-gacacgta---------------------tt------t----ttctga-
                     Bushbaby  --------agtg-agccagg-gacaagca---------------------tt------c----ttctgg-
           Chinese tree shrew  --------actg-g------------gca---------------------ct------t----tactga-
                     Squirrel  --------actg--agatgg-ggtcagaatttttcctttttattagccagca------c----aactgc-
       Lesser Egyptian jerboa  --------act----------ggccagga---------------------cattcttct----gactga-
                 Prairie vole  --------ctt----cttgg-ggccaggg---------------------ca------c----gactgg-
              Chinese hamster  --------ctt--------g-ggc----------------------------------c----gacgaa-
               Golden hamster  --------ctt--------g-ggctagga---------------------ca------t----gacgaa-
                        Mouse  --------ctt--------g-ggccaaga---------------------ta------g----gattag-
                          Rat  --------ctt--------g-ggccagga---------------------aa------g----gactgg-
               Naked mole-rat  --------ttt----------tcctgatg---------------------cc------c----tttcgt-
                   Guinea pig  --------tct----------tcctgatg---------------------cc------c----ttctgt-
                   Chinchilla  --------ctt----------tcctgacg---------------------gc------c----ctctgt-
             Brush-tailed rat  --------ctt----------tgctgatg---------------------cc------c----ttctgt-
                       Rabbit  cctttgttgct----------ggccagag-----------------------------t----gactcc-
                         Pika  --------acc----------agccagca-----------------------------g----gactac-
                          Pig  --------acga----------------------------------------------------------
                       Alpaca  --------acgggggccagg-aacaggca---------------------tt------gatttctctgc-
               Bactrian camel  --------acgggggccagg-aacaggca---------------------tt------gatttctctgc-
                      Dolphin  --------acag--gccagg-aataggca---------------------tt------a----ctttgc-
                 Killer whale  --------acag--gccagg-aataggca---------------------tt------a----ctttgc-
             Tibetan antelope  --------actg-agccagg-aataggca---------------------gt------g----tgcca--
                          Cow  --------actg-aaccagg-aataggct---------------------gt------g----tgtcag-
                        Sheep  --------actg-agccagg-aataggca---------------------gc------g----tgcca--
                Domestic goat  --------tctg-agccagg-aataggca---------------------gt------g----tgcca--
                        Horse  --------acgg-ggcc-gg-aacaggcg---------------------tt------t----tcctgg-
             White rhinoceros  --------atgg-cgccagg-aacaggca---------------------tt------t----ttctga-
                          Cat  --------aatg-ggccagg-aacgggca---------------------tt------t----ttccca-
                          Dog  --------actc-gggcagg-aacagggg---------------------ca------t----ctccgc-
                      Ferret   -------------ggccagg-aaccggca---------------------ag------t----ctctga-
                        Panda  --------aaag-ggccagg-aacaggcg---------------------tt------t----ctctta-
               Pacific walrus  --------aaaa-ggccagg-aacaggca---------------------tt------t----ctttga-
                 Weddell seal  -------------ggcccgg-aacaggca---------------------tt------t----ctctga-
             Black flying-fox  --------aaag-ggccagg-agcaggca---------------------tt------t----ttctaa-
                      Megabat  --------aaag-gaccagg-agcaggca---------------------tt------t----ttctaa-
                Big brown bat  --------gcag-tgccagg-agcaggca---------------------ta------t----ttctgg-
         David's myotis (bat)  --------gcag-tgccagg--acaggcg---------------------ta------t----ttctgg-
                     Microbat  --------gcag-tgccagg-aacaggcg---------------------tg------t----ttctgg-
              Star-nosed mole  --------gaag-aagcagg-agcaggct---------------------tt------t----ttctgg-
                     Elephant  --------acgg-gaccagg-gactggca---------------------tt------t----tgctgc-
          Cape elephant shrew  --------acgg-aaccagg-aaggggca---------------------tt------g----tgctga-
                      Manatee  --------actg-gaccaag-gactggca---------------------tt-----------tgctgc-
             Cape golden mole  --------attg-gatcag--cattggca---------------------tt------t----tgttga-
                       Tenrec  --------aaca-ggcccggtaactggca---------------------tt------t----tgttga-
                     Aardvark  --------------------------gca---------------------tt------t----tgctga-
                    Armadillo  --------actg-gaccagg-gacaggca---------------------at------t----tgctga-
                      Opossum  --------ataa-accagaa-ggcaagac---------------------tt------t----ctcctta
              Tasmanian devil  --------agaa-aactgaa-ggcaaggc---------------------tt------t----ctcctga
                      Wallaby  --------atag-accagaa-ggcaaggc---------------------tt------t----ctccaga
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                X. tropicalis  ======================================================================
                  Spotted gar  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ----------------------------------------------------------------------
     Mexican tetra (cavefish)  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Platypus  ======================================================================
     Chinese softshell turtle  ======================================================================

Inserts between block 24 and 25 in window
          Chinese tree shrew 1bp
B D                Armadillo 3bp

Alignment block 25 of 252 in window, 159891865 - 159891867, 3 bps 
B D                     Human  tag
B D                     Chimp  tag
B D                 Orangutan  taa
B D                    Gibbon  tag
B D                    Rhesus  taa
B D       Crab-eating macaque  taa
B D                    Baboon  taa
B D              Green monkey  taa
B D                  Marmoset  tag
B D           Squirrel monkey  tag
B D                  Bushbaby  cca
           Chinese tree shrew  tgg
B D                  Squirrel  t--
       Lesser Egyptian jerboa  t--
                 Prairie vole  t--
B D           Chinese hamster  t--
               Golden hamster  t--
B D                     Mouse  tga
B D                       Rat  taa
B D            Naked mole-rat  cag
B D                Guinea pig  cag
                   Chinchilla  tag
             Brush-tailed rat  tgg
B D                    Rabbit  c--
B D                      Pika  t--
B D                    Alpaca  ctg
               Bactrian camel  ctg
B D                   Dolphin  ctg
                 Killer whale  ctg
             Tibetan antelope  ccg
B D                       Cow  ccg
B D                     Sheep  ccg
                Domestic goat  ccg
B D                     Horse  ctg
B D          White rhinoceros  ttg
B D                       Cat  ctg
B D                       Dog  ctg
B D                   Ferret   cgg
B D                     Panda  cgg
               Pacific walrus  ctg
                 Weddell seal  ctg
             Black flying-fox  ctg
B D                   Megabat  ctg
                Big brown bat  ctg
         David's myotis (bat)  ctg
B D                  Microbat  ctg
              Star-nosed mole  c--
B D                  Elephant  ctg
          Cape elephant shrew  ctg
B D                   Manatee  cgg
             Cape golden mole  ctg
B D                    Tenrec  ctg
                     Aardvark  ctg
B D                   Opossum  ttg
B D           Tasmanian devil  tta
B D                   Wallaby  ttg
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                       Pig  ---
B D             X. tropicalis  ===
                 Spotted gar  ===
      Yellowbelly pufferfish  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ---
    Mexican tetra (cavefish)  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                  Platypus  ===
  D  Chinese softshell turtle  ===
B D                 Armadillo  ===

Alignment block 26 of 252 in window, 159891868 - 159891923, 56 bps 
B D                     Human  c----ccccttttgcc-agccagcat-g---ac----ta-ctcc-tggagaact---------cag-cca
B D                     Chimp  c----ccccttttgcc-agccagcat-g---ac----ta-ctcc-tggagaact---------cag-cca
B D                 Orangutan  c----ccccttttgcc-agccagcat-g---ac----ta-ctcc-tggagaact---------cag-cca
B D                    Gibbon  c----ccccttttgcc-agccagcat-g---ac----ta-ctcc-tggagaact---------cag-cca
B D                    Rhesus  c----caccttttgcc-agccagcgt-g---ac----tg-ctcc-tggagaact---------cag-cca
B D       Crab-eating macaque  c----caccttttgcc-agccagcgt-g---ac----tg-ctcc-tggagaact---------cag-cca
B D                    Baboon  c----caccttttgcc-agccagcgt-g---ac----tg-ctcc-tggagaact---------cag-cca
B D              Green monkey  c----ccccttttgcc-agccagcgt-g---ac----tg-ctcc-tggagaact---------cag-cca
B D                  Marmoset  c----cccc-tttgcc-agccagcgt-g---ac----ta-ctcc-tggagaact---------cag-cca
B D           Squirrel monkey  c----cccc-tttgcc-agacagcat-g---ac----ta-ctcc-tggagaact---------cag-cca
B D                  Bushbaby  c----tgc--ttagct-agccagtgt-a---ac----tg-ctcc-tggagaatg---------ctg-cca
           Chinese tree shrew  c----cccctttggct-ggccagca----------------tcc-tg------------------g-cta
B D                  Squirrel  ------------------------------------------cc-tggagcact---------tgg-cca
       Lesser Egyptian jerboa  ------------------------------------------ct-t---------------------tca
                 Prairie vole  ------------------------------------------cc-aggagcact---------tgg-cca
B D           Chinese hamster  ------------------------------------------tcttgtagcact---------tgg-cca
               Golden hamster  ------------------------------------------ccttggagcact---------tgg-cca
B D                     Mouse  a----ca--------------agcag-a---a----------cc-tggagctct---------ggg-cca
B D                       Rat  a----ca--------------agcag-g---ac----ta-ttcc-tggagctct---------ggg-cca
B D            Naked mole-rat  t----ct-----------------------------------cc-tggcacact---------cct-gga
B D                Guinea pig  t----ct-----------------------------------cc-t-gcacact----------cc-cct
                   Chinchilla  t----ct-----------------------------------cc-tggcgcact---------ccc-cca
             Brush-tailed rat  c----ct-----------------------------------cc-tggcacgcccgccccccaccc-cca
B D                    Rabbit  ------------------------------------------ct-tggagcccc---------tgc-atg
B D                      Pika  ------------------------------------------cc-gagagtccc---------ag--aca
B D                       Pig  ----------------------------------------cgcc-tggagaacc---------agg-ccc
B D                    Alpaca  c----tcccttttgcg-agccagcag-g---ac----tacaacc-cggagaact---------ccg-cca
               Bactrian camel  c----tcccttttgcg-agccagcag-g---ac----tacaacc-tggagaact---------ccg-cca
B D                   Dolphin  c----acactcttgca-agtcagcaa-g---ac----ta-agct-tggagaact---------cgg-cca
                 Killer whale  c----acactcttgca-agtcagcaa-g---ac----ta-agtt-tggagaact---------cgg-cca
             Tibetan antelope  c----cccctttggca-agccggcag-g---ac----ta-aatc-tggagaagt---------ggg-cca
B D                       Cow  c----cctctctggca-agccggcag-g---ac----ta-aatc-tggagaagt---------ccg-cca
B D                     Sheep  c----cccctttggca-agccggcag-g---ac----ta-aatc-tggagaagc---------ggg-cca
                Domestic goat  c----cccctttggca-agccagcag-g---ac----ta-agtc-tggagaagt---------ggg-cca
B D                     Horse  c----ccacttttgctaagccaccag-g---ac----ta-ctcc-tggagaact---------cag-cca
B D          White rhinoceros  c----ccccctttgct-agccaccag-g---ac----ta-atcc-tggaaaact---------cag-cca
B D                       Cat  c----ccctcccg-ct-agccagctg-g---ac----ga-ctcc-tggagaagg---------cgg-ccc
B D                       Dog  c----ccct----------------g-g---gg----------c-tggagacct---------cgg-cca
B D                   Ferret   c----ccctcccg-ag-agcccgccg-g---acggcgga-cacc-tgaagaact---------tgg-cca
B D                     Panda  c----ccctccca-gg-agccggctg-g---ag----ga-ctcc-tggagaact---------ctg-cca
               Pacific walrus  c----ccctcccgctg-tcccagctg-g---at----gg-cccc-tggagaact---------cgg-cca
                 Weddell seal  c----ccctccggctg-tcccagctg-g---ac----ga-ctcc-tggagaact---------cgg-cca
             Black flying-fox  c----tccttttg-ct-a----------------------ttcc-tggagaa-t---------cag-cca
B D                   Megabat  c----tccttttg-ct-a----------------------ttcc-tggagaa-t---------cag-cca
                Big brown bat  c----cccttctg-ct-gggcagcag-g---ac-------tact-cagcgaact---------ccg-cca
         David's myotis (bat)  c----cccttctg-ct-gggcagcag-c---ac-------tact-cagcgaact---------cag-cca
B D                  Microbat  c----cccttctg-ct-gggcagcag-c---ac-------tact-cagcgaact---------cag-cca
              Star-nosed mole  c----tgtcttttgct-tggcagcag-g---ac----tg-tttc-tgcggccct--------gcgt-cca
B D                  Elephant  c----cccctttttct-agccagcag-g---ac----ta-cttg-tgaagacct---------tgg-cca
          Cape elephant shrew  -----tctcttttggt-agctcatat-g---at----ta-ctca-tgaggacct---------tga-tca
B D                   Manatee  c----ccccttttgct-agccagcat-g---ac----ta-ctca-tgaagacct---------tgg-cca
             Cape golden mole  c----ccccttttgct-agccatcat-g---ac----ta-cttg-tgaagacct---------tga-cca
B D                    Tenrec  cctatcccctttggct-agccagcat-g---gc----aa-cccg-tgaagaccg---------ggg-cca
                     Aardvark  c----ccctttttgca-agccagcat-g----------a-ctca-tgaagacct---------tgg-cca
B D                 Armadillo  c----tcccttttgct-agccagcat-gatgac----ta-ctcc-tggagaact---------tgg-cca
B D                   Opossum  -----ttccattctct-taccagaagag---at----ta-ttcg-ctgaggact---------tag-cca
B D           Tasmanian devil  -----ttcctttccct-taccagaagag---at----tg-ttca-ctggacgct---------taaccca
B D                   Wallaby  -----atccattctct-taccaggagaa---ac----tg-ttca-tcgaagact---------tag-cca
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D             X. tropicalis  ======================================================================
                 Spotted gar  ======================================================================
      Yellowbelly pufferfish  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ----------------------------------------------------------------------
    Mexican tetra (cavefish)  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Platypus  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  at-------------tccaaatct
                        Chimp  at-------------tccaaatct
                    Orangutan  at-------------tccaaatct
                       Gibbon  at-------------tccaaatct
                       Rhesus  at-------------tccaaatct
          Crab-eating macaque  at-------------tccaaatct
                       Baboon  at-------------tccaaatct
                 Green monkey  at-------------tccaaatct
                     Marmoset  at-------------tccacatct
              Squirrel monkey  at-------------tccacatct
                     Bushbaby  tt-------------tccaagtct
           Chinese tree shrew  tt-------------tccaaacct
                     Squirrel  ct-------------tccacacct
       Lesser Egyptian jerboa  tt-------------tctttcctt
                 Prairie vole  tt-------------tcccaccct
              Chinese hamster  tt-------------tcccaccct
               Golden hamster  tt-------------tcccaccct
                        Mouse  tt-------------ccccaccct
                          Rat  ct-------------ccccaccct
               Naked mole-rat  tt-------------tccaaacct
                   Guinea pig  tt-------------cccagacct
                   Chinchilla  ct-------------tccaaacct
             Brush-tailed rat  gc-------------cccagacct
                       Rabbit  tt-------------gccacatct
                         Pika  tt-------------tccagctct
                          Pig  tt-------------tccaaatct
                       Alpaca  tc-------------tccaaatct
               Bactrian camel  tc-------------tccaaatct
                      Dolphin  tt-------------tccaaatct
                 Killer whale  tt-------------tccaaatct
             Tibetan antelope  tt-------------tccaaacct
                          Cow  tt-------------tccaaacct
                        Sheep  tt-------------tccaaacct
                Domestic goat  tt-------------tccaaacct
                        Horse  tt-------------tccagatct
             White rhinoceros  tt-------------tccagatct
                          Cat  tt-------------tccaaacct
                          Dog  tc-------------tcccgacct
                      Ferret   cccctggggcccaaatcagaacct
                        Panda  tt-------------tccaaacct
               Pacific walrus  tt-------------tccaaaccc
                 Weddell seal  tt-------------tccaaaccc
             Black flying-fox  tt-------------tcccagtct
                      Megabat  tt-------------tcccagtct
                Big brown bat  tt-------------tcccaatct
         David's myotis (bat)  tt-------------tccaaatct
                     Microbat  tt-------------tctaaatct
              Star-nosed mole  tt-------------tccacatct
                     Elephant  ct-------------tccaaagct
          Cape elephant shrew  ct-------------ttcaaatct
                      Manatee  tt-------------tccaaagct
             Cape golden mole  tt-------------tcctaagct
                       Tenrec  ac-------------gccaaagcg
                     Aardvark  tt-------------tccaaggct
                    Armadillo  tt-------------tccaaatct
                      Opossum  gg-------------tctagactt
              Tasmanian devil  tg-------------tccagacct
                      Wallaby  ca-------------tccaggcct
                     Hedgehog  ========================
                        Shrew  ========================
                X. tropicalis  ========================
                  Spotted gar  ========================
       Yellowbelly pufferfish  ========================
                 Mallard duck  ========================
           Tibetan ground jay  ========================
                  Zebra finch  ------------------------
     Mexican tetra (cavefish)  ========================
               Painted turtle  ========================
              Green seaturtle  ========================
           American alligator  ========================
                Scarlet macaw  ========================
                  Rock pigeon  ========================
          Collared flycatcher  ========================
                       Lizard  ========================
             Peregrine falcon  ========================
                 Saker falcon  ========================
                     Platypus  ========================
     Chinese softshell turtle  ========================

Inserts between block 26 and 27 in window
B D                    Horse 2bp
B D         White rhinoceros 3bp
B D                  Ferret  28bp
B D                    Panda 583bp
B D                  Opossum 3bp
B D          Tasmanian devil 3bp
B D                  Wallaby 62bp

Alignment block 27 of 252 in window, 159891924 - 159891935, 12 bps 
B D                     Human  -----ctcttt-gctttg
B D                     Chimp  -----ctcttt-gctttg
B D                 Orangutan  -----ctcttt-gctttg
B D                    Gibbon  -----ctcttt-gctttg
B D                    Rhesus  -----ctcttt-gctttg
B D       Crab-eating macaque  -----ctcttt-gctttg
B D                    Baboon  -----ctcttt-gctttg
B D              Green monkey  -----ctcttt-gctttg
B D                  Marmoset  -----ctctct-gctttg
B D           Squirrel monkey  -----ctcttt-gctttg
B D                  Bushbaby  -----ctcttt-gctttg
           Chinese tree shrew  -----ctcttt-gctttt
B D                  Squirrel  -----ctcttt-gctatt
       Lesser Egyptian jerboa  -----tttttt-------
                 Prairie vole  -----cct-tt-g-----
B D           Chinese hamster  -----cgtttt-g-----
               Golden hamster  -----cctctt-g-----
B D                     Mouse  -----cctttt-a-----
B D                       Rat  -----ccttttgg-----
B D            Naked mole-rat  -------cttc-gagctg
B D                Guinea pig  -----ctcttc-tcttta
                   Chinchilla  -----ctcttc-tctttg
             Brush-tailed rat  -----cccttc-acttgg
B D                    Rabbit  -----ctcttt-gctttg
B D                      Pika  -----ctcttg-ccttgg
B D                       Pig  -----agcttc-------
B D                    Alpaca  -----gtcctc-tccttg
               Bactrian camel  -----gtcctc-tccttg
B D                   Dolphin  -----atcttc-agttta
                 Killer whale  -----atcttc-aattta
             Tibetan antelope  -----gtcttc-acttta
B D                       Cow  -----gtcttc-acttta
B D                     Sheep  -----gtcttc-acttta
                Domestic goat  -----gtcttc-acttta
B D                     Horse  -----ttcac----tttg
B D          White rhinoceros  -----ttcac----tttg
B D                       Cat  -----atcttc-gctgca
B D                       Dog  ------tcatc-tctgtc
B D                   Ferret   -----ttcct--------
               Pacific walrus  -----ttcat--------
                 Weddell seal  -----ttcat--------
             Black flying-fox  -----atcttt-gctttg
B D                   Megabat  -----atcttt-gctttg
                Big brown bat  -----atcttt-gctttg
         David's myotis (bat)  -----gtcttt-gctttg
B D                  Microbat  -----gtcttt-gcttcg
              Star-nosed mole  -----atcttt-gctttg
B D                  Elephant  -----gtcttt-gctttg
          Cape elephant shrew  -----gtctct-gctttg
B D                   Manatee  -----atcttt-gctttg
             Cape golden mole  -----accttt-gctttg
B D                    Tenrec  -----atcttt-gcttta
                     Aardvark  -----atcttt-g-----
B D                 Armadillo  -----atcttt-gctttg
B D                   Opossum  caagtcccatt-g-----
B D           Tasmanian devil  caagttccact-g-----
B D                  Hedgehog  ==================
B D                     Shrew  ==================
B D             X. tropicalis  ==================
                 Spotted gar  ==================
      Yellowbelly pufferfish  ==================
  D              Mallard duck  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ------------------
    Mexican tetra (cavefish)  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
B D        American alligator  ==================
  D             Scarlet macaw  ==================
  D               Rock pigeon  ==================
  D       Collared flycatcher  ==================
B D                    Lizard  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
B D                  Platypus  ==================
B D                   Wallaby  ==================
  D  Chinese softshell turtle  ==================
B D                     Panda  ==================

Inserts between block 27 and 28 in window
                    Aardvark 46bp

Alignment block 28 of 252 in window, 159891936 - 159891942, 7 bps 
B D                     Human  actagaa
B D                     Chimp  actagaa
B D                 Orangutan  actagaa
B D                    Gibbon  actagaa
B D                    Rhesus  actagaa
B D       Crab-eating macaque  actagaa
B D                    Baboon  actagaa
B D              Green monkey  actagaa
B D                  Marmoset  actagaa
B D           Squirrel monkey  actagaa
B D                  Bushbaby  gtgagaa
           Chinese tree shrew  gccggaa
B D                  Squirrel  actagaa
                 Prairie vole  actagaa
B D           Chinese hamster  actagaa
               Golden hamster  actagaa
B D                     Mouse  accagaa
B D                       Rat  aatagaa
B D            Naked mole-rat  actagaa
B D                Guinea pig  attagaa
                   Chinchilla  actagaa
             Brush-tailed rat  attagaa
B D                    Rabbit  actggaa
B D                      Pika  actagaa
B D                    Alpaca  actagaa
               Bactrian camel  actagaa
B D                   Dolphin  actagaa
                 Killer whale  actagaa
             Tibetan antelope  gctagaa
B D                       Cow  gctagaa
B D                     Sheep  gctagaa
                Domestic goat  gctagaa
B D                     Horse  actagaa
B D          White rhinoceros  actagaa
B D                       Cat  actagga
B D                       Dog  cctggaa
             Black flying-fox  actaaaa
B D                   Megabat  actaaaa
                Big brown bat  actgaaa
         David's myotis (bat)  actggaa
B D                  Microbat  actggaa
              Star-nosed mole  cctggaa
B D                  Elephant  attagaa
          Cape elephant shrew  actagaa
B D                   Manatee  actagaa
             Cape golden mole  actagaa
B D                    Tenrec  accggaa
B D                 Armadillo  actagaa
B D                   Opossum  ---ggca
B D           Tasmanian devil  ---agaa
      Lesser Egyptian jerboa  -------
                Weddell seal  -------
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                       Pig  -------
                    Aardvark  =======
B D             X. tropicalis  =======
                 Spotted gar  =======
      Yellowbelly pufferfish  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  -------
    Mexican tetra (cavefish)  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
  D             Scarlet macaw  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D                    Lizard  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
B D                  Platypus  =======
B D                   Wallaby  =======
  D  Chinese softshell turtle  =======
B D                   Ferret   -------
              Pacific walrus  -------
B D                     Panda  =======

Inserts between block 28 and 29 in window
            Black flying-fox 328bp
B D                  Megabat 8bp

Alignment block 29 of 252 in window, 159891943 - 159891948, 6 bps 
B D                     Human  aactcc
B D                     Chimp  aactcc
B D                 Orangutan  aactcc
B D                    Gibbon  aactcc
B D                    Rhesus  aactcc
B D       Crab-eating macaque  aactcc
B D                    Baboon  aactcc
B D              Green monkey  aactcc
B D                  Marmoset  aactcc
B D           Squirrel monkey  aactcc
B D                  Bushbaby  aactcc
           Chinese tree shrew  aactcc
B D                  Squirrel  aactcc
       Lesser Egyptian jerboa  -tttt-
                 Prairie vole  acttcc
B D           Chinese hamster  atttcc
               Golden hamster  atttcc
B D                     Mouse  aattcc
B D                       Rat  aactcc
B D            Naked mole-rat  aactcc
B D                Guinea pig  aa---c
                   Chinchilla  aacttc
             Brush-tailed rat  aatttc
B D                    Rabbit  aactac
B D                      Pika  cactcc
B D                   Dolphin  gactcc
                 Killer whale  gactcc
             Tibetan antelope  gagtcc
B D                       Cow  gagtcc
B D                     Sheep  gagtcc
                Domestic goat  gagtcc
B D                     Horse  gactcc
B D          White rhinoceros  gacttc
B D                       Cat  aacccc
B D                       Dog  gacact
B D                   Ferret   --tccc
               Pacific walrus  --cacc
                 Weddell seal  --cacc
                Big brown bat  gactcc
         David's myotis (bat)  gagtcc
B D                  Microbat  gagtcc
              Star-nosed mole  aatact
B D                  Elephant  aacttt
          Cape elephant shrew  cacttc
B D                   Manatee  aacttt
             Cape golden mole  aacctc
B D                    Tenrec  cacctc
B D                 Armadillo  aacttc
B D                   Opossum  aagacc
B D           Tasmanian devil  tagccc
B D                  Hedgehog  ======
B D                     Shrew  ======
B D                       Pig  ------
                    Aardvark  ======
B D                   Megabat  ======
B D             X. tropicalis  ======
                 Spotted gar  ======
      Yellowbelly pufferfish  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ------
    Mexican tetra (cavefish)  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                  Platypus  ======
B D                   Wallaby  ======
  D  Chinese softshell turtle  ======
              Bactrian camel  ------
B D                    Alpaca  ------
B D                     Panda  ======
            Black flying-fox  ======

Inserts between block 29 and 30 in window
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
              Pacific walrus 1bp
                Weddell seal 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
             Star-nosed mole 1bp

Alignment block 30 of 252 in window, 159891949 - 159891949, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  g
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  a
                 Prairie vole  g
B D           Chinese hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                   Opossum  a
B D           Tasmanian devil  a
              Golden hamster  -
      Lesser Egyptian jerboa  -
                Weddell seal  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                       Pig  -
            Cape golden mole  -
                    Aardvark  =
B D                   Megabat  =
B D                   Dolphin  =
B D             X. tropicalis  =
                 Spotted gar  =
      Yellowbelly pufferfish  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  -
    Mexican tetra (cavefish)  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
         Cape elephant shrew  -
B D                  Platypus  =
B D                   Wallaby  =
B D                   Manatee  -
B D                  Elephant  -
B D                    Tenrec  -
B D                       Cat  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  =
B D                     Panda  =
                Killer whale  =
B D                       Dog  =
            Black flying-fox  =
B D          White rhinoceros  =
B D                     Horse  =
B D                 Armadillo  -
        David's myotis (bat)  =
               Big brown bat  =
B D                  Microbat  =
B D                       Cow  =

Inserts between block 30 and 31 in window
B D          Chinese hamster 2bp
B D          Tasmanian devil 583bp

Alignment block 31 of 252 in window, 159891950 - 159891955, 6 bps 
B D                     Human  c------------------atgta
B D                     Chimp  c------------------atgta
B D                 Orangutan  c------------------atgta
B D                    Gibbon  c------------------atgta
B D                    Rhesus  c------------------atgta
B D       Crab-eating macaque  c------------------atgta
B D                    Baboon  c------------------atgta
B D              Green monkey  c------------------atgta
B D                  Marmoset  c------------------gtgca
B D           Squirrel monkey  c------------------atgta
B D                  Bushbaby  c------------------atggg
           Chinese tree shrew  c------------------atgga
B D                  Squirrel  t------------------atggg
                 Prairie vole  t------------------gagga
B D                     Mouse  t------------------gagga
B D                       Rat  t------------------gagga
B D            Naked mole-rat  a------------------gtggg
B D                Guinea pig  c------------------ctggg
                   Chinchilla  c------------------atggg
             Brush-tailed rat  t------------------gtggg
B D                    Rabbit  t------------------gtgga
B D                      Pika  c------------------atgga
B D                       Pig  ---------------------gga
B D                    Alpaca  ---------------------gga
               Bactrian camel  ---------------------gga
B D                   Dolphin  c------------------atgga
                 Killer whale  c------------------acgta
             Tibetan antelope  c------------------atgga
B D                       Cow  c------------------atgga
B D                     Sheep  c------------------atgga
                Domestic goat  c------------------atgga
B D                     Horse  t------------------gtgga
B D          White rhinoceros  c------------------atgaa
B D                       Cat  c------------------aaggg
B D                       Dog  c------------------acggg
B D                   Ferret   atcgatagaaaagtcgcagatggg
               Pacific walrus  t------------------gcggg
                 Weddell seal  c------------------acggg
                Big brown bat  c------------------acgga
         David's myotis (bat)  c------------------atgcg
B D                  Microbat  c------------------atgct
              Star-nosed mole  t------------------gtgga
B D                  Elephant  c------------------ttgga
          Cape elephant shrew  c------------------atgga
B D                   Manatee  c------------------atgga
             Cape golden mole  c------------------atgaa
B D                    Tenrec  t------------------gtgga
B D                 Armadillo  ct-----------------attga
B D                   Opossum  ------------------ggtgta
              Golden hamster  ------------------------
      Lesser Egyptian jerboa  ------------------------
B D                  Hedgehog  ========================
B D                     Shrew  ========================
                    Aardvark  ========================
B D                   Megabat  ========================
B D             X. tropicalis  ========================
                 Spotted gar  ========================
      Yellowbelly pufferfish  ========================
  D              Mallard duck  ========================
          Tibetan ground jay  ========================
B D               Zebra finch  ------------------------
B D           Tasmanian devil  ========================
    Mexican tetra (cavefish)  ========================
  D            Painted turtle  ========================
  D           Green seaturtle  ========================
B D        American alligator  ========================
  D             Scarlet macaw  ========================
  D               Rock pigeon  ========================
  D       Collared flycatcher  ========================
B D                    Lizard  ========================
  D          Peregrine falcon  ========================
  D              Saker falcon  ========================
B D                  Platypus  ========================
B D                   Wallaby  ========================
B D           Chinese hamster  ========================
  D  Chinese softshell turtle  ========================
B D                     Panda  ========================
            Black flying-fox  ========================

Inserts between block 31 and 32 in window
B D                  Opossum 1090bp

Alignment block 32 of 252 in window, 159891956 - 159891957, 2 bps 
B D                     Human  c----c
B D                     Chimp  c----c
B D                 Orangutan  c----c
B D                    Gibbon  c----c
B D                    Rhesus  c----c
B D       Crab-eating macaque  c----c
B D                    Baboon  c----c
B D              Green monkey  c----c
B D                  Marmoset  t----c
B D           Squirrel monkey  c----c
B D                  Bushbaby  c----a
           Chinese tree shrew  c----t
B D                  Squirrel  c----c
                 Prairie vole  c----c
B D                     Mouse  c----c
B D                       Rat  c----c
B D            Naked mole-rat  c----c
B D                Guinea pig  c----c
                   Chinchilla  c----c
             Brush-tailed rat  c----c
B D                    Rabbit  t----c
B D                      Pika  t----c
B D                       Pig  c----c
B D                    Alpaca  c----c
               Bactrian camel  c----c
B D                   Dolphin  c----t
                 Killer whale  c----t
             Tibetan antelope  c----t
B D                       Cow  c----t
B D                     Sheep  c----t
                Domestic goat  c----t
B D                     Horse  c----c
B D          White rhinoceros  c----c
B D                       Cat  c----c
B D                       Dog  c----c
B D                   Ferret   ctcttc
               Pacific walrus  c----c
                 Weddell seal  c----c
                Big brown bat  c----c
         David's myotis (bat)  c----c
B D                  Microbat  c----c
              Star-nosed mole  c----c
B D                  Elephant  c----c
          Cape elephant shrew  c----c
B D                   Manatee  c----c
             Cape golden mole  c----c
B D                    Tenrec  c----c
B D                 Armadillo  c----g
              Golden hamster  ------
      Lesser Egyptian jerboa  ------
B D                  Hedgehog  ======
B D                     Shrew  ======
                    Aardvark  ======
B D                   Megabat  ======
B D             X. tropicalis  ======
                 Spotted gar  ======
      Yellowbelly pufferfish  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ------
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                   Opossum  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D           Chinese hamster  ======
  D  Chinese softshell turtle  ======
B D                     Panda  ======
            Black flying-fox  ======

Inserts between block 32 and 33 in window
                Prairie vole 8bp
B D                      Rat 8bp

Alignment block 33 of 252 in window, 159891958 - 159891958, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  t
B D                  Squirrel  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   t
               Pacific walrus  c
                 Weddell seal  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  t
B D                 Armadillo  c
B D                       Rat  =
                Prairie vole  =
              Golden hamster  -
B D                     Mouse  -
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
B D                     Shrew  =
                    Aardvark  =
B D                   Megabat  =
B D             X. tropicalis  =
                 Spotted gar  =
      Yellowbelly pufferfish  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  -
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                  Platypus  =
B D                   Wallaby  =
B D           Chinese hamster  =
  D  Chinese softshell turtle  =
B D                     Panda  =
            Black flying-fox  =

Inserts between block 33 and 34 in window
B D           Naked mole-rat 7bp
                  Chinchilla 24bp

Alignment block 34 of 252 in window, 159891959 - 159891962, 4 bps 
B D                     Human  a----aaa
B D                     Chimp  a----aaa
B D                 Orangutan  a----aaa
B D                    Gibbon  a----aaa
B D                    Rhesus  a----caa
B D       Crab-eating macaque  a----caa
B D                    Baboon  a----caa
B D              Green monkey  a----caa
B D                  Marmoset  aaaacaaa
B D           Squirrel monkey  a----aaa
B D                  Bushbaby  a----aaa
           Chinese tree shrew  c----agg
B D                       Pig  a----aaa
B D                    Alpaca  a----aag
               Bactrian camel  a----aag
B D                   Dolphin  a----aaa
                 Killer whale  a----aaa
             Tibetan antelope  a----aga
B D                       Cow  a----aga
B D                     Sheep  a----aga
                Domestic goat  a----aga
B D                     Horse  a----aaa
B D          White rhinoceros  a----aaa
B D                       Cat  c----aaa
B D                       Dog  a----aa-
B D                   Ferret   a----aat
               Pacific walrus  a----aaa
                 Weddell seal  a----aaa
                Big brown bat  -----aaa
         David's myotis (bat)  c----aaa
B D                  Microbat  a----aaa
              Star-nosed mole  c----aaa
B D                  Elephant  a----aaa
          Cape elephant shrew  a----aat
B D                   Manatee  a----aaa
B D                    Tenrec  c----aag
B D                 Armadillo  a----cac
B D                       Rat  ========
                Prairie vole  ========
              Golden hamster  --------
B D                     Mouse  --------
      Lesser Egyptian jerboa  --------
B D                      Pika  --------
B D                  Hedgehog  ========
B D                     Shrew  ========
B D                Guinea pig  --------
B D                    Rabbit  --------
            Cape golden mole  --------
                    Aardvark  ========
B D                   Megabat  ========
B D             X. tropicalis  ========
                 Spotted gar  ========
      Yellowbelly pufferfish  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  --------
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                   Opossum  ========
B D            Naked mole-rat  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
            Brush-tailed rat  --------
                  Chinchilla  ========
B D                  Platypus  ========
B D                   Wallaby  ========
B D           Chinese hamster  ========
  D  Chinese softshell turtle  ========
B D                     Panda  ========
            Black flying-fox  ========
B D                  Squirrel  --------

Inserts between block 34 and 35 in window
B D                      Pig 3bp
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B