Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 94 in window, 57695599 - 57695616, 18 bps 
B D                     Human  catcaggaaaccagaagc
B D                     Chimp  catcaggaaaccagaagc
B D                   Gorilla  catcaggaaaccagaagc
B D                 Orangutan  catcaggaaacaagaagc
B D                    Gibbon  catcaggaaaccagaagc
B D                    Rhesus  tatcagaaaaccagaagc
B D       Crab-eating macaque  tatcagaaaaccagaagc
B D                    Baboon  tatcagaaaaccagaagc
B D              Green monkey  catcaggaaaccagaaga
B D                  Marmoset  tatcaggaaaacagaagc
B D           Squirrel monkey  tatcaggaaaccagaagc
B D                  Bushbaby  aatcaggaaatcaaaagt
           Chinese tree shrew  aatcagaagattagaatc
B D                  Squirrel  aatcaggaattcagaagc
       Lesser Egyptian jerboa  aatcaggaaatcagaagc
                 Prairie vole  attcaggaaatcaaaagt
B D                       Rat  actcaggaaatcagaagt
B D            Naked mole-rat  aataaggacttcagaagc
B D                Guinea pig  aatcaggacctcagaagc
                   Chinchilla  gctcaggacctcagaagt
             Brush-tailed rat  actcaggacctcagaagc
B D                  Elephant  aatcaggaaatcaaaagc
B D                   Manatee  aatcagaaactcagaagc
             Cape golden mole  aaccaggaaatcagaagc
                     Aardvark  gctcaggaaatcagaagc
B D                    Tenrec  ==================
B D                     Mouse  ==================
              Golden hamster  ==================
B D           Chinese hamster  ==================
            Tibetan antelope  ==================
         Cape elephant shrew  ==================
B D                     Shrew  ==================
        David's myotis (bat)  ==================
B D                     Horse  ==================
               Domestic goat  ==================
B D                     Sheep  ==================
B D                       Cow  ==================
B D                    Alpaca  ==================
             Star-nosed mole  ==================
B D                      Pika  ==================
B D                    Rabbit  ==================
B D                 Armadillo  ==================
B D          White rhinoceros  ==================
              Pacific walrus  ==================
B D                       Dog  ==================
B D                       Cat  ==================
B D                  Microbat  ==================
               Big brown bat  ==================
                Killer whale  ==================
              Bactrian camel  ==================
B D                     Panda  ==================
            Black flying-fox  ==================
B D                   Ferret   ==================
B D                   Dolphin  ==================
                Weddell seal  ==================
B D                Coelacanth  ==================
B D                    Turkey  ==================
                 Spotted gar  ==================
  D              Mallard duck  ==================
  D             Scarlet macaw  ==================
B D                Budgerigar  ==================
B D                   Wallaby  ==================
B D                    Lizard  ==================
    Mexican tetra (cavefish)  ==================
  D          Peregrine falcon  ==================
B D                 Zebrafish  ==================
  D               Rock pigeon  ==================
  D            Painted turtle  ==================
B D                   Chicken  ==================
B D                  Platypus  ==================
  D       Collared flycatcher  ==================
  D  Chinese softshell turtle  ==================
B D               Zebra finch  ==================
  D              Saker falcon  ==================
B D             X. tropicalis  ==================
  D           Green seaturtle  ==================
B D       Medium ground finch  ==================
B D        American alligator  ==================
  D    White-throated sparrow  ==================
          Tibetan ground jay  ==================
B D                   Megabat  ==================
B D                       Pig  ==================
B D           Tasmanian devil  ==================

Inserts between block 1 and 2 in window
            Cape golden mole 1826bp

Alignment block 2 of 94 in window, 57695617 - 57695672, 56 bps 
B D                     Human  -agagctctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D                     Chimp  -agagctctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D                   Gorilla  -agagctctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D                 Orangutan  -agaactctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D                    Gibbon  -agagatgtc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D                    Rhesus  -agagctctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D       Crab-eating macaque  -agagctctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D                    Baboon  -agagctctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D              Green monkey  -agagctctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D                  Marmoset  -agagctctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D           Squirrel monkey  -agagctctc-----tgtgaacagagataaa-------------ttaac-----ataaggac--------
B D                  Bushbaby  -agagtta-------tgtgaacagagagaaa-------------ttaat-----acatagga--------
           Chinese tree shrew  --gagttatt-------tgaacagagatgaa-------------ttaat-----ataaggaa--------
B D                  Squirrel  -agactca-------tgtgaacaaagagaag-------------ttact-----gtgagaaactggagtt
       Lesser Egyptian jerboa  -aacctca-------tgtgattaataataaataatttccagaagtcatc-----atgagaca--------
                 Prairie vole  -aagcaaa-------catgaacagagataaa-------------ttaac-----gtgaggaa--------
B D                       Rat  -aaattca-------caagaattgggacaaa-------------ttaac-----atgaggaa--------
B D            Naked mole-rat  -agactta-------catgaacagagataaa-------------ttaat-----gtgaggaa--------
B D                Guinea pig  -agacata-------tgtgagtggagataaa-------------ttaat-----gtgaggaa--------
                   Chinchilla  -agaccta-------tgtgaatggagataaa-------------ttaatgtatggagataaa--------
             Brush-tailed rat  -agacctg-------tgtgaatggagataaa-------------ttaat-----gggaggaa--------
B D                  Elephant  caagcccactggttatgtgaatagagataaa-------------ttaat-----acaaagaa--------
B D                   Manatee  cacacccactggttatgtgaatagagataac-------------ttaat-----attaagat--------
                     Aardvark  cacacgcattggttatgtggatagagagaaa-------------ttaat-----aaagagaa--------
B D                    Tenrec  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
            Tibetan antelope  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
        David's myotis (bat)  ======================================================================
B D                     Horse  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
B D                    Alpaca  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                 Armadillo  ======================================================================
B D          White rhinoceros  ======================================================================
              Pacific walrus  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
B D                  Microbat  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D                     Panda  ======================================================================
            Black flying-fox  ======================================================================
B D                   Ferret   ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
                Weddell seal  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ggctttgtgattaagcacccttggattcccagcgtgcgggcacacacacacacacacacacacacttgag
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                       Tenrec  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
             Tibetan antelope  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
         David's myotis (bat)  ======================================================================
                        Horse  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
                       Alpaca  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                    Armadillo  ======================================================================
             White rhinoceros  ======================================================================
               Pacific walrus  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
                     Microbat  ======================================================================
                Big brown bat  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                        Panda  ======================================================================
             Black flying-fox  ======================================================================
                      Ferret   ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
                 Weddell seal  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
               Painted turtle  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ---tcgatta------------------------------------------aaaacctctga
                        Chimp  ---tcgatta------------------------------------------aaaacctctga
                      Gorilla  ---ttgatta------------------------------------------aaaacctctga
                    Orangutan  ---ttgatta------------------------------------------aaaacctgtga
                       Gibbon  ---ttgatta------------------------------------------aaaacctctga
                       Rhesus  ---ttgatta------------------------------------------aaaacctctga
          Crab-eating macaque  ---ttgatta------------------------------------------aaaacctctga
                       Baboon  ---ttgatta------------------------------------------aaaacctctga
                 Green monkey  ---ttgatta------------------------------------------aaaacctctga
                     Marmoset  ---ttggtta------------------------------------------aaaacttctga
              Squirrel monkey  ---ttggtta------------------------------------------aaaacctctga
                     Bushbaby  ---ttggcta------------------------------------------aaaacctcata
           Chinese tree shrew  ---ctgggta------------------------------------------aaaagctctga
                     Squirrel  aaattggttg------------------------------------------agaacttcgga
       Lesser Egyptian jerboa  agcttagtct------------------------------------------attataacaaa
                 Prairie vole  ---ccggtta------------------------------------------accatttc---
                          Rat  ---ctggtct------------------------------------------acaaattc---
               Naked mole-rat  ---ttcgcta------------------------------------------aaaacttcgaa
                   Guinea pig  ---ttcacta------------------------------------------aaaacttggaa
                   Chinchilla  ---ttaatgaatggagataaattaatgtataaaacattaataaattaatgataaaacttttaa
             Brush-tailed rat  ---ttcatga------------------------------------------aaaattttgaa
                     Elephant  ---ttggtta------------------------------------------taaacctctga
                      Manatee  ---ttggtta------------------------------------------taaacctctga
                     Aardvark  ---ttggtta------------------------------------------tacacttctga
                       Tenrec  ===============================================================
                        Mouse  ===============================================================
               Golden hamster  ===============================================================
              Chinese hamster  ===============================================================
             Tibetan antelope  ===============================================================
          Cape elephant shrew  ===============================================================
                        Shrew  ===============================================================
         David's myotis (bat)  ===============================================================
                        Horse  ===============================================================
                Domestic goat  ===============================================================
                        Sheep  ===============================================================
                          Cow  ===============================================================
                       Alpaca  ===============================================================
              Star-nosed mole  ===============================================================
                         Pika  ===============================================================
                       Rabbit  ===============================================================
                    Armadillo  ===============================================================
             White rhinoceros  ===============================================================
               Pacific walrus  ===============================================================
                          Dog  ===============================================================
                          Cat  ===============================================================
                     Microbat  ===============================================================
                Big brown bat  ===============================================================
                 Killer whale  ===============================================================
               Bactrian camel  ===============================================================
                        Panda  ===============================================================
             Black flying-fox  ===============================================================
                      Ferret   ===============================================================
             Cape golden mole  ===============================================================
                      Dolphin  ===============================================================
                 Weddell seal  ===============================================================
                   Coelacanth  ===============================================================
                       Turkey  ===============================================================
                  Spotted gar  ===============================================================
                 Mallard duck  ===============================================================
                Scarlet macaw  ===============================================================
                   Budgerigar  ===============================================================
                      Wallaby  ===============================================================
                       Lizard  ===============================================================
     Mexican tetra (cavefish)  ===============================================================
             Peregrine falcon  ===============================================================
                    Zebrafish  ===============================================================
                  Rock pigeon  ===============================================================
               Painted turtle  ===============================================================
                      Chicken  ===============================================================
                     Platypus  ===============================================================
          Collared flycatcher  ===============================================================
     Chinese softshell turtle  ===============================================================
                  Zebra finch  ===============================================================
                 Saker falcon  ===============================================================
                X. tropicalis  ===============================================================
              Green seaturtle  ===============================================================
          Medium ground finch  ===============================================================
           American alligator  ===============================================================
       White-throated sparrow  ===============================================================
           Tibetan ground jay  ===============================================================
                      Megabat  ===============================================================
                          Pig  ===============================================================
              Tasmanian devil  ===============================================================

Inserts between block 2 and 3 in window
B D                   Gibbon 1bp
B D                   Rhesus 1bp
B D      Crab-eating macaque 1bp
B D                   Baboon 1bp
B D             Green monkey 1bp
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
B D                 Bushbaby 1bp
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 245bp
                Prairie vole 4bp
B D                      Rat 4bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 3 of 94 in window, 57695673 - 57695675, 3 bps 
B D                     Human  gg-g
B D                     Chimp  gg-g
B D                   Gorilla  gg-g
B D                 Orangutan  gg-g
B D                    Gibbon  gg-g
B D                    Rhesus  gg-a
B D       Crab-eating macaque  gg-a
B D                    Baboon  gg-g
B D              Green monkey  gg-g
B D                  Marmoset  gg-g
B D           Squirrel monkey  gg-g
B D                  Bushbaby  gg-g
           Chinese tree shrew  gg-a
B D                  Squirrel  gg-g
                 Prairie vole  gg-t
B D                       Rat  agtt
B D            Naked mole-rat  ga-g
B D                Guinea pig  gg-g
                   Chinchilla  gg-g
             Brush-tailed rat  aa-a
B D                  Elephant  ga-g
B D                   Manatee  ga-g
                     Aardvark  gg-g
B D                    Tenrec  ====
B D                     Mouse  ====
              Golden hamster  ====
B D           Chinese hamster  ====
            Tibetan antelope  ====
         Cape elephant shrew  ====
B D                     Shrew  ====
        David's myotis (bat)  ====
B D                     Horse  ====
               Domestic goat  ====
B D                     Sheep  ====
B D                       Cow  ====
B D                    Alpaca  ====
             Star-nosed mole  ====
B D                      Pika  ====
B D                    Rabbit  ====
B D                 Armadillo  ====
      Lesser Egyptian jerboa  ====
B D          White rhinoceros  ====
              Pacific walrus  ====
B D                       Dog  ====
B D                       Cat  ====
B D                  Microbat  ====
               Big brown bat  ====
                Killer whale  ====
              Bactrian camel  ====
B D                     Panda  ====
            Black flying-fox  ====
B D                   Ferret   ====
            Cape golden mole  ====
B D                   Dolphin  ====
                Weddell seal  ====
B D                Coelacanth  ====
B D                    Turkey  ====
                 Spotted gar  ====
  D              Mallard duck  ====
  D             Scarlet macaw  ====
B D                Budgerigar  ====
B D                   Wallaby  ====
B D                    Lizard  ====
    Mexican tetra (cavefish)  ====
  D          Peregrine falcon  ====
B D                 Zebrafish  ====
  D               Rock pigeon  ====
  D            Painted turtle  ====
B D                   Chicken  ====
B D                  Platypus  ====
  D       Collared flycatcher  ====
  D  Chinese softshell turtle  ====
B D               Zebra finch  ====
  D              Saker falcon  ====
B D             X. tropicalis  ====
  D           Green seaturtle  ====
B D       Medium ground finch  ====
B D        American alligator  ====
  D    White-throated sparrow  ====
          Tibetan ground jay  ====
B D                   Megabat  ====
B D                       Pig  ====
B D           Tasmanian devil  ====

Inserts between block 3 and 4 in window
B D                 Elephant 1bp
B D                  Manatee 1bp
                    Aardvark 344bp

Alignment block 4 of 94 in window, 57695676 - 57695692, 17 bps 
B D                     Human  catcacaagggtgattc
B D                     Chimp  catcacaagggtgattc
B D                   Gorilla  catcacaagggtgattc
B D                 Orangutan  catcacaagggtgattc
B D                    Gibbon  catcacaagggtgattc
B D                    Rhesus  catcacaagggtgattc
B D       Crab-eating macaque  catcacaagggtgattc
B D                    Baboon  catcaccagggtgattc
B D              Green monkey  catcacaggggtgattc
B D                  Marmoset  catcataaggatgattc
B D           Squirrel monkey  catcataaggatgattc
B D                  Bushbaby  gattctgagagaaattt
           Chinese tree shrew  catcatgggcaagattc
B D                  Squirrel  cctcatgagaatgattt
                 Prairie vole  cttcatgaga-----tc
B D                       Rat  cctcatgagg-----tc
B D            Naked mole-rat  tatcttgagaatgatcc
B D                Guinea pig  catcttgaaaatgattc
                   Chinchilla  catcttaaaaatgattc
             Brush-tailed rat  cactttgaaaacgattc
B D                  Elephant  catcatgagaatgattc
B D                   Manatee  cattgttagaatgattc
B D                    Tenrec  =================
B D                     Mouse  =================
              Golden hamster  =================
B D           Chinese hamster  =================
            Tibetan antelope  =================
         Cape elephant shrew  =================
B D                     Shrew  =================
        David's myotis (bat)  =================
B D                     Horse  =================
               Domestic goat  =================
B D                     Sheep  =================
B D                       Cow  =================
B D                    Alpaca  =================
             Star-nosed mole  =================
B D                      Pika  =================
B D                    Rabbit  =================
B D                 Armadillo  =================
      Lesser Egyptian jerboa  =================
B D          White rhinoceros  =================
              Pacific walrus  =================
B D                       Dog  =================
B D                       Cat  =================
B D                  Microbat  =================
               Big brown bat  =================
                Killer whale  =================
              Bactrian camel  =================
B D                     Panda  =================
            Black flying-fox  =================
B D                   Ferret   =================
            Cape golden mole  =================
B D                   Dolphin  =================
                Weddell seal  =================
                    Aardvark  =================
B D                Coelacanth  =================
B D                    Turkey  =================
                 Spotted gar  =================
  D              Mallard duck  =================
  D             Scarlet macaw  =================
B D                Budgerigar  =================
B D                   Wallaby  =================
B D                    Lizard  =================
    Mexican tetra (cavefish)  =================
  D          Peregrine falcon  =================
B D                 Zebrafish  =================
  D               Rock pigeon  =================
  D            Painted turtle  =================
B D                   Chicken  =================
B D                  Platypus  =================
  D       Collared flycatcher  =================
  D  Chinese softshell turtle  =================
B D               Zebra finch  =================
  D              Saker falcon  =================
B D             X. tropicalis  =================
  D           Green seaturtle  =================
B D       Medium ground finch  =================
B D        American alligator  =================
  D    White-throated sparrow  =================
          Tibetan ground jay  =================
B D                   Megabat  =================
B D                       Pig  =================
B D           Tasmanian devil  =================

Inserts between block 4 and 5 in window
B D                 Elephant 3912bp

Alignment block 5 of 94 in window, 57695693 - 57695697, 5 bps 
B D                     Human  ta-ggg
B D                     Chimp  ta-ggg
B D                   Gorilla  ta-ggg
B D                 Orangutan  ta-gag
B D                    Gibbon  ca-ggg
B D                    Rhesus  ta-agg
B D       Crab-eating macaque  ta-agg
B D                    Baboon  ta-agg
B D              Green monkey  ta-agg
B D                  Marmoset  ta-ggg
B D           Squirrel monkey  ta-ggg
B D                  Bushbaby  gg-gag
           Chinese tree shrew  ta-g--
B D                  Squirrel  gg-ggg
                 Prairie vole  tg-gga
B D                       Rat  tg-gaa
B D            Naked mole-rat  tg-ggg
B D                Guinea pig  ta-ggg
                   Chinchilla  tg-ggg
             Brush-tailed rat  ggtggg
B D                   Manatee  tt-ggg
B D                    Tenrec  ======
B D                     Mouse  ======
              Golden hamster  ======
B D           Chinese hamster  ======
B D                  Elephant  ======
            Tibetan antelope  ======
         Cape elephant shrew  ======
B D                     Shrew  ======
        David's myotis (bat)  ======
B D                     Horse  ======
               Domestic goat  ======
B D                     Sheep  ======
B D                       Cow  ======
B D                    Alpaca  ======
             Star-nosed mole  ======
B D                      Pika  ======
B D                    Rabbit  ======
B D                 Armadillo  ======
      Lesser Egyptian jerboa  ======
B D          White rhinoceros  ======
              Pacific walrus  ======
B D                       Dog  ======
B D                       Cat  ======
B D                  Microbat  ======
               Big brown bat  ======
                Killer whale  ======
              Bactrian camel  ======
B D                     Panda  ======
            Black flying-fox  ======
B D                   Ferret   ======
            Cape golden mole  ======
B D                   Dolphin  ======
                Weddell seal  ======
                    Aardvark  ======
B D                Coelacanth  ======
B D                    Turkey  ======
                 Spotted gar  ======
  D              Mallard duck  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Wallaby  ======
B D                    Lizard  ======
    Mexican tetra (cavefish)  ======
  D          Peregrine falcon  ======
B D                 Zebrafish  ======
  D               Rock pigeon  ======
  D            Painted turtle  ======
B D                   Chicken  ======
B D                  Platypus  ======
  D       Collared flycatcher  ======
  D  Chinese softshell turtle  ======
B D               Zebra finch  ======
  D              Saker falcon  ======
B D             X. tropicalis  ======
  D           Green seaturtle  ======
B D       Medium ground finch  ======
B D        American alligator  ======
  D    White-throated sparrow  ======
          Tibetan ground jay  ======
B D                   Megabat  ======
B D                       Pig  ======
B D           Tasmanian devil  ======

Inserts between block 5 and 6 in window
B D                  Manatee 1362bp

Alignment block 6 of 94 in window, 57695698 - 57695742, 45 bps 
B D                     Human  ataccccctatatt-agtctgctgtggtt-gccataacaaaatacca
B D                     Chimp  ataccccctatatt-agtctgctgtggtt-gccataacaaaatacca
B D                   Gorilla  ataccccctatatt-agtctgctgtggtt-gccgtgacaaaatacca
B D                 Orangutan  ataccccctatatt-agtctgctgtggtt-gccataacaaaatacca
B D                    Gibbon  ataccccctatatt-agtctgctgtggtt-gccataacaaaatacca
B D                    Rhesus  atacccactatgtt-agtctgttgtggtt-tccataacaaaatacca
B D       Crab-eating macaque  atacccactatgtt-agtctgttgtggtt-tccataacaaaatacca
B D                    Baboon  ataccccctatgtt-agtctgttgtggtt-gccataacaaaatacca
B D              Green monkey  ataccccctatgtt-agtctgttgtggtt-tccataacaaaatacca
B D                  Marmoset  atactccccatatt-agtctgctgtgggc-gctgtaacaaaatacca
B D           Squirrel monkey  atactccctatgtt-agtctgctgtgggt-gctataacaaaatacca
B D                  Bushbaby  agacgctttgtatt-ag------------------------------
           Chinese tree shrew  ----cccttgcatt-agtctgtacaagct-atgacaacaaaatacca
B D                  Squirrel  atactccctgcatgaagtcttcttggatt-gttatgacaaaatagca
                 Prairie vole  agactccctgagtt-agtctgcttaggccatttgtaataaagtatca
B D                       Rat  acactccctgagtt-agtctgtttaggct-cttataagaaagtatca
B D            Naked mole-rat  atatt--ctgtgtt-aggctgcttgggct-gtcgtaacaaaatagca
B D                Guinea pig  atatt--ctgtata-aggctgcttggg---gtcctaacaaaatactg
                   Chinchilla  atagt--ctgtatt-aggttgcttgggcc-gtcataacaaactacca
             Brush-tailed rat  atact--cagtgtt-aggctgctggggct-gttataacaaaatacca
B D                    Tenrec  ===============================================
B D                     Mouse  ===============================================
              Golden hamster  ===============================================
B D           Chinese hamster  ===============================================
B D                  Elephant  ===============================================
            Tibetan antelope  ===============================================
         Cape elephant shrew  ===============================================
B D                     Shrew  ===============================================
        David's myotis (bat)  ===============================================
B D                     Horse  ===============================================
               Domestic goat  ===============================================
B D                     Sheep  ===============================================
B D                       Cow  ===============================================
B D                    Alpaca  ===============================================
             Star-nosed mole  ===============================================
B D                      Pika  ===============================================
B D                    Rabbit  ===============================================
B D                 Armadillo  ===============================================
B D                   Manatee  ===============================================
      Lesser Egyptian jerboa  ===============================================
B D          White rhinoceros  ===============================================
              Pacific walrus  ===============================================
B D                       Dog  ===============================================
B D                       Cat  ===============================================
B D                  Microbat  ===============================================
               Big brown bat  ===============================================
                Killer whale  ===============================================
              Bactrian camel  ===============================================
B D                     Panda  ===============================================
            Black flying-fox  ===============================================
B D                   Ferret   ===============================================
            Cape golden mole  ===============================================
B D                   Dolphin  ===============================================
                Weddell seal  ===============================================
                    Aardvark  ===============================================
B D                Coelacanth  ===============================================
B D                    Turkey  ===============================================
                 Spotted gar  ===============================================
  D              Mallard duck  ===============================================
  D             Scarlet macaw  ===============================================
B D                Budgerigar  ===============================================
B D                   Wallaby  ===============================================
B D                    Lizard  ===============================================
    Mexican tetra (cavefish)  ===============================================
  D          Peregrine falcon  ===============================================
B D                 Zebrafish  ===============================================
  D               Rock pigeon  ===============================================
  D            Painted turtle  ===============================================
B D                   Chicken  ===============================================
B D                  Platypus  ===============================================
  D       Collared flycatcher  ===============================================
  D  Chinese softshell turtle  ===============================================
B D               Zebra finch  ===============================================
  D              Saker falcon  ===============================================
B D             X. tropicalis  ===============================================
  D           Green seaturtle  ===============================================
B D       Medium ground finch  ===============================================
B D        American alligator  ===============================================
  D    White-throated sparrow  ===============================================
          Tibetan ground jay  ===============================================
B D                   Megabat  ===============================================
B D                       Pig  ===============================================
B D           Tasmanian devil  ===============================================

Inserts between block 6 and 7 in window
                Prairie vole 2254bp
B D                      Rat 2042bp

Alignment block 7 of 94 in window, 57695743 - 57695752, 10 bps 
B D                     Human  tatactgggt
B D                     Chimp  tatactgggt
B D                   Gorilla  tacactgggt
B D                 Orangutan  tacactgggt
B D                    Gibbon  tacactgggt
B D                    Rhesus  taccctgggt
B D       Crab-eating macaque  taccctgggt
B D                    Baboon  taccctgggt
B D              Green monkey  taccctgggt
B D                  Marmoset  tacactgggt
B D           Squirrel monkey  tacactgggt
B D                  Bushbaby  ----cttgga
           Chinese tree shrew  tggat--ggt
B D                  Squirrel  cagcctgggg
B D            Naked mole-rat  tcaactggtt
B D                Guinea pig  aaaactggtt
                   Chinchilla  taaactggtt
             Brush-tailed rat  taaactggtt
B D                    Tenrec  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
              Golden hamster  ==========
B D           Chinese hamster  ==========
                Prairie vole  ==========
B D                  Elephant  ==========
            Tibetan antelope  ==========
         Cape elephant shrew  ==========
B D                     Shrew  ==========
        David's myotis (bat)  ==========
B D                     Horse  ==========
               Domestic goat  ==========
B D                     Sheep  ==========
B D                       Cow  ==========
B D                    Alpaca  ==========
             Star-nosed mole  ==========
B D                      Pika  ==========
B D                    Rabbit  ==========
B D                 Armadillo  ==========
B D                   Manatee  ==========
      Lesser Egyptian jerboa  ==========
B D          White rhinoceros  ==========
              Pacific walrus  ==========
B D                       Dog  ==========
B D                       Cat  ==========
B D                  Microbat  ==========
               Big brown bat  ==========
                Killer whale  ==========
              Bactrian camel  ==========
B D                     Panda  ==========
            Black flying-fox  ==========
B D                   Ferret   ==========
            Cape golden mole  ==========
B D                   Dolphin  ==========
                Weddell seal  ==========
                    Aardvark  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D             Scarlet macaw  ==========
B D                Budgerigar  ==========
B D                   Wallaby  ==========
B D                    Lizard  ==========
    Mexican tetra (cavefish)  ==========
  D          Peregrine falcon  ==========
B D                 Zebrafish  ==========
  D               Rock pigeon  ==========
  D            Painted turtle  ==========
B D                   Chicken  ==========
B D                  Platypus  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
B D               Zebra finch  ==========
  D              Saker falcon  ==========
B D             X. tropicalis  ==========
  D           Green seaturtle  ==========
B D       Medium ground finch  ==========
B D        American alligator  ==========
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========
B D                   Megabat  ==========
B D                       Pig  ==========
B D           Tasmanian devil  ==========

Alignment block 8 of 94 in window, 57695753 - 57695765, 13 bps 
B D                     Human  ggcttaaacaaca
B D                     Chimp  ggcttaaacaaca
B D                   Gorilla  ggcttaaacaaca
B D                 Orangutan  ggcttaaacaaca
B D                    Gibbon  ggcttaaacaaca
B D                    Rhesus  ggcctaaacaaca
B D       Crab-eating macaque  ggcctaaacaaca
B D                    Baboon  ggcctaaacaaca
B D              Green monkey  ggcctaaacaaca
B D                  Marmoset  ggcttccacaaca
B D           Squirrel monkey  ggcttccacaaca
B D                  Bushbaby  ggctta---aaca
           Chinese tree shrew  ggcttaaaccaaa
B D                  Squirrel  gaattaaacatca
       Lesser Egyptian jerboa  gccctaaaccaca
B D            Naked mole-rat  ggattaaacaata
B D                Guinea pig  ggatgaagcaaca
                   Chinchilla  ggattaaacaaca
             Brush-tailed rat  ggattaaatacca
B D                    Tenrec  =============
B D                       Rat  =============
B D                     Mouse  =============
              Golden hamster  =============
B D           Chinese hamster  =============
                Prairie vole  =============
B D                  Elephant  =============
            Tibetan antelope  =============
         Cape elephant shrew  =============
B D                     Shrew  =============
        David's myotis (bat)  =============
B D                     Horse  =============
               Domestic goat  =============
B D                     Sheep  =============
B D                       Cow  =============
B D                    Alpaca  =============
             Star-nosed mole  =============
B D                      Pika  =============
B D                    Rabbit  =============
B D                 Armadillo  =============
B D                   Manatee  =============
B D          White rhinoceros  =============
              Pacific walrus  =============
B D                       Dog  =============
B D                       Cat  =============
B D                  Microbat  =============
               Big brown bat  =============
                Killer whale  =============
              Bactrian camel  =============
B D                     Panda  =============
            Black flying-fox  =============
B D                   Ferret   =============
            Cape golden mole  =============
B D                   Dolphin  =============
                Weddell seal  =============
                    Aardvark  =============
B D                Coelacanth  =============
B D                    Turkey  =============
                 Spotted gar  =============
  D              Mallard duck  =============
  D             Scarlet macaw  =============
B D                Budgerigar  =============
B D                   Wallaby  =============
B D                    Lizard  =============
    Mexican tetra (cavefish)  =============
  D          Peregrine falcon  =============
B D                 Zebrafish  =============
  D               Rock pigeon  =============
  D            Painted turtle  =============
B D                   Chicken  =============
B D                  Platypus  =============
  D       Collared flycatcher  =============
  D  Chinese softshell turtle  =============
B D               Zebra finch  =============
  D              Saker falcon  =============
B D             X. tropicalis  =============
  D           Green seaturtle  =============
B D       Medium ground finch  =============
B D        American alligator  =============
  D    White-throated sparrow  =============
          Tibetan ground jay  =============
B D                   Megabat  =============
B D                       Pig  =============
B D           Tasmanian devil  =============

Inserts between block 8 and 9 in window
B D               Guinea pig 290bp

Alignment block 9 of 94 in window, 57695766 - 57695799, 34 bps 
B D                     Human  gacatttattttctcatagttctagaaac--tggaa
B D                     Chimp  gacatttattttctcatagttctagaaac--tggaa
B D                   Gorilla  gacatttattttctcgtagttctagaaac--tggaa
B D                 Orangutan  gacatttagtttcttatagttctagaaac--tggaa
B D                    Gibbon  ggcatttcttttctcatagttctagaaac--tggta
B D                    Rhesus  gacagttattttctcatagttctagaaaa--tggaa
B D       Crab-eating macaque  gacagttattttctcatagttctagaaaa--tggaa
B D                    Baboon  cacagttattttctcatagttctagaaaa--tggaa
B D              Green monkey  gacagttattttctcatagttctagaaaa--tggaa
B D                  Marmoset  gacatttattttctcatagttctagagac--tggaa
B D           Squirrel monkey  gacatttattttctcatagttctagagac--tggaa
B D                  Bushbaby  gacttgtattatcttatagtttcagagac--tagaa
           Chinese tree shrew  gacgtctgttttctcacagttc-agagac--tggaa
B D                  Squirrel  gacatttacttttccatagttccggatat--tggaa
       Lesser Egyptian jerboa  aacatatattttctcatagttctagagac--cagaa
B D            Naked mole-rat  gacatttat----------ttctggagactgtggaa
                   Chinchilla  gacattaat----------ttctaaagac--cggaa
             Brush-tailed rat  gacatttat----------ttctaaagat--tggaa
B D                    Tenrec  ====================================
B D                Guinea pig  ====================================
B D                       Rat  ====================================
B D                     Mouse  ====================================
              Golden hamster  ====================================
B D           Chinese hamster  ====================================
                Prairie vole  ====================================
B D                  Elephant  ====================================
            Tibetan antelope  ====================================
         Cape elephant shrew  ====================================
B D                     Shrew  ====================================
        David's myotis (bat)  ====================================
B D                     Horse  ====================================
               Domestic goat  ====================================
B D                     Sheep  ====================================
B D                       Cow  ====================================
B D                    Alpaca  ====================================
             Star-nosed mole  ====================================
B D                      Pika  ====================================
B D                    Rabbit  ====================================
B D                 Armadillo  ====================================
B D                   Manatee  ====================================
B D          White rhinoceros  ====================================
              Pacific walrus  ====================================
B D                       Dog  ====================================
B D                       Cat  ====================================
B D                  Microbat  ====================================
               Big brown bat  ====================================
                Killer whale  ====================================
              Bactrian camel  ====================================
B D                     Panda  ====================================
            Black flying-fox  ====================================
B D                   Ferret   ====================================
            Cape golden mole  ====================================
B D                   Dolphin  ====================================
                Weddell seal  ====================================
                    Aardvark  ====================================
B D                Coelacanth  ====================================
B D                    Turkey  ====================================
                 Spotted gar  ====================================
  D              Mallard duck  ====================================
  D             Scarlet macaw  ====================================
B D                Budgerigar  ====================================
B D                   Wallaby  ====================================
B D                    Lizard  ====================================
    Mexican tetra (cavefish)  ====================================
  D          Peregrine falcon  ====================================
B D                 Zebrafish  ====================================
  D               Rock pigeon  ====================================
  D            Painted turtle  ====================================
B D                   Chicken  ====================================
B D                  Platypus  ====================================
  D       Collared flycatcher  ====================================
  D  Chinese softshell turtle  ====================================
B D               Zebra finch  ====================================
  D              Saker falcon  ====================================
B D             X. tropicalis  ====================================
  D           Green seaturtle  ====================================
B D       Medium ground finch  ====================================
B D        American alligator  ====================================
  D    White-throated sparrow  ====================================
          Tibetan ground jay  ====================================
B D                   Megabat  ====================================
B D                       Pig  ====================================
B D           Tasmanian devil  ====================================

Inserts between block 9 and 10 in window
            Brush-tailed rat 608bp

Alignment block 10 of 94 in window, 57695800 - 57695861, 62 bps 
B D                     Human  gtccaagatcagggcgctgactgttctggcttctggtgacggctctcttcctggcttgtaga
B D                     Chimp  gtccaagatcagggcgctgactgttctggcttctggtgcgggctctcttcctggcttgtaga
B D                   Gorilla  gtccaagatcagggcgctgactgatctggcttctggtgagggctctcttcctggcttgtaga
B D                 Orangutan  gtccaagatcaggacactgactgatctggcttctggtgagggctctcttcctggcttgtaga
B D                    Gibbon  gtccaaggtcagggcactgactgatctggcttctggtgagggctcccttcctggcttgtaga
B D                    Rhesus  gtccaagatcagggcgctgactgatctggcttctggtgagggctgtcttcctggcttgtaga
B D       Crab-eating macaque  gtccaagatcagggcgctgactgatctggcttctggtgagggctgtcttcctggcttgtaga
B D                    Baboon  gtccaagatcagggcgctgactgatctggcttctggtgagggctgtcttcctggcttgtaga
B D              Green monkey  gtccaagatcagggcgctgactgatctggcttctggtgagggctctcttcctggcttgtaga
B D                  Marmoset  gtccaagatcaggttgctgactgatctggtttctggtgagggctctcttcctggcttgcaga
B D           Squirrel monkey  gtccaagatcagcttgctgactgatctggtttctggtgagggctctcttcctggcttgtagg
B D                  Bushbaby  gtccaagaccaaggtgctggctgatttggtttctggtaagggctctcttcctggtttacagg
           Chinese tree shrew  gaccaagatcaaggtgccggctgattcattttctggt-agggcgctctcactggcttgtaga
B D                  Squirrel  gttcaagatcaaggtgctggctcactggg-tataggtaacaggtcgtttcttggctgataga
       Lesser Egyptian jerboa  ct------tcaaggtgctatctgcttgg------gatgagggctctcttcttggctggtaga
B D            Naked mole-rat  gttcaagctcacggtgcttgctggctga--tttgagtactggtgaggatctcggcttgtaga
                   Chinchilla  gttcaagatcaaggtgcttgctggctga--catgggtactggcgtggatctcagcttgtaga
B D                    Tenrec  ==============================================================
B D                Guinea pig  ==============================================================
B D                       Rat  ==============================================================
B D                     Mouse  ==============================================================
              Golden hamster  ==============================================================
B D           Chinese hamster  ==============================================================
                Prairie vole  ==============================================================
B D                  Elephant  ==============================================================
            Tibetan antelope  ==============================================================
         Cape elephant shrew  ==============================================================
B D                     Shrew  ==============================================================
        David's myotis (bat)  ==============================================================
B D                     Horse  ==============================================================
               Domestic goat  ==============================================================
B D                     Sheep  ==============================================================
B D                       Cow  ==============================================================
B D                    Alpaca  ==============================================================
             Star-nosed mole  ==============================================================
B D                      Pika  ==============================================================
B D                    Rabbit  ==============================================================
B D                 Armadillo  ==============================================================
B D                   Manatee  ==============================================================
B D          White rhinoceros  ==============================================================
            Brush-tailed rat  ==============================================================
              Pacific walrus  ==============================================================
B D                       Dog  ==============================================================
B D                       Cat  ==============================================================
B D                  Microbat  ==============================================================
               Big brown bat  ==============================================================
                Killer whale  ==============================================================
              Bactrian camel  ==============================================================
B D                     Panda  ==============================================================
            Black flying-fox  ==============================================================
B D                   Ferret   ==============================================================
            Cape golden mole  ==============================================================
B D                   Dolphin  ==============================================================
                Weddell seal  ==============================================================
                    Aardvark  ==============================================================
B D                Coelacanth  ==============================================================
B D                    Turkey  ==============================================================
                 Spotted gar  ==============================================================
  D              Mallard duck  ==============================================================
  D             Scarlet macaw  ==============================================================
B D                Budgerigar  ==============================================================
B D                   Wallaby  ==============================================================
B D                    Lizard  ==============================================================
    Mexican tetra (cavefish)  ==============================================================
  D          Peregrine falcon  ==============================================================
B D                 Zebrafish  ==============================================================
  D               Rock pigeon  ==============================================================
  D            Painted turtle  ==============================================================
B D                   Chicken  ==============================================================
B D                  Platypus  ==============================================================
  D       Collared flycatcher  ==============================================================
  D  Chinese softshell turtle  ==============================================================
B D               Zebra finch  ==============================================================
  D              Saker falcon  ==============================================================
B D             X. tropicalis  ==============================================================
  D           Green seaturtle  ==============================================================
B D       Medium ground finch  ==============================================================
B D        American alligator  ==============================================================
  D    White-throated sparrow  ==============================================================
          Tibetan ground jay  ==============================================================
B D                   Megabat  ==============================================================
B D                       Pig  ==============================================================
B D           Tasmanian devil  ==============================================================

Inserts between block 10 and 11 in window
                  Chinchilla 35bp

Alignment block 11 of 94 in window, 57695862 - 57695930, 69 bps 
B D                     Human  tgaccaccttttccactgtttcctcacac-ggcctctcctcac--------tgtgcgtgtgtgtg-----
B D                     Chimp  tgaccaccttttccactgtttcctcacac-ggcctctcctcac--------tgtgcgtgtgtgtg-----
B D                   Gorilla  tgaccacctttgccactgtttcctcacac-ggcctctcctcac--------tgtgcgtgtgtgtg-----
B D                 Orangutan  tgagcaccttgtccactgtttcctcacac-agcctctcctcac--------tgtgcgtgtgtgtg-----
B D                    Gibbon  tgaccatcttttccactgtttcctcacacgggcctctcctcac--------tgtgcgtgtgtgtg-----
B D                    Rhesus  tgagcatcttttccactgtttcctcacat-gacctctcctcac--------tgtgtgtgtgtgtgta---
B D       Crab-eating macaque  tgagcatcttttccactgtttcctcacat-gacctctcctcac--------tgtgtgtgtgtgtgta---
B D                    Baboon  tgagcaccttttccactgtttcctcacat-ggcctctcctcac--------tgtgtgtgtgtgtg-----
B D              Green monkey  tgaccaccttttccactgtttcctcacat-gacctctcctcac--------tgtgtgtgtgtgtg-----
B D                  Marmoset  tgaccactttttccactgtttcctcacac-agcttctcctcactctgtatgtgtgcgtgtgtgtgtgtgt
B D           Squirrel monkey  tgaccactgtttccactgtttcctcacac-agcttctcctcactt------tgtgtgtgtgtgtgtgtgt
B D                  Bushbaby  cggccacctcct-cactacttcctcacat-ggcttctctcctc---------atgcctggg---------
           Chinese tree shrew  tggcta-ctttcccaccgtgtccccacat-aatctctctt-ac--------tgtgagaaagtg-------
B D                  Squirrel  tggtcacc-----tcctggatcatcttgg-ggcctcttctcac--------tgtgcatgcataga-----
       Lesser Egyptian jerboa  tagatagc-----cacagggtcctcacaa-ggcctctcctgac--------tgtggtcatgtgaa-----
B D            Naked mole-rat  ----------------aggct---------ggcgtcttcccac--------ttcgtgcacacaca-----
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
B D                  Elephant  ======================================================================
            Tibetan antelope  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
        David's myotis (bat)  ======================================================================
B D                     Horse  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
B D                    Alpaca  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
                  Chinchilla  ======================================================================
B D          White rhinoceros  ======================================================================
            Brush-tailed rat  ======================================================================
              Pacific walrus  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
B D                  Microbat  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D                     Panda  ======================================================================
            Black flying-fox  ======================================================================
B D                   Ferret   ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
                Weddell seal  ======================================================================
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ----------gtgagagagagag----
                        Chimp  ----------gtgagagagagag----
                      Gorilla  ----------gtgagagagagct----
                    Orangutan  ----------gtgagagagagag----
                       Gibbon  ----------gtgagagagagag----
                       Rhesus  ----------atgagagagagag----
          Crab-eating macaque  ----------atgagagagagag----
                       Baboon  ----------atgagagagagag----
                 Green monkey  ----------atgagagagagag----
                     Marmoset  gtgtgtgtgtgtgtgagagagag----
              Squirrel monkey  gtgtgtgtgtgtgtgagagagag----
                     Bushbaby  ---------------------------
           Chinese tree shrew  ---------------------------
                     Squirrel  ----------------gagaaag-gtg
       Lesser Egyptian jerboa  ----------------gagaaagtttg
               Naked mole-rat  ----------------gagaatg--ct
                       Tenrec  ===========================
                   Guinea pig  ===========================
                          Rat  ===========================
                        Mouse  ===========================
               Golden hamster  ===========================
              Chinese hamster  ===========================
                 Prairie vole  ===========================
                     Elephant  ===========================
             Tibetan antelope  ===========================
          Cape elephant shrew  ===========================
                        Shrew  ===========================
         David's myotis (bat)  ===========================
                        Horse  ===========================
                Domestic goat  ===========================
                        Sheep  ===========================
                          Cow  ===========================
                       Alpaca  ===========================
              Star-nosed mole  ===========================
                         Pika  ===========================
                       Rabbit  ===========================
                    Armadillo  ===========================
                      Manatee  ===========================
                   Chinchilla  ===========================
             White rhinoceros  ===========================
             Brush-tailed rat  ===========================
               Pacific walrus  ===========================
                          Dog  ===========================
                          Cat  ===========================
                     Microbat  ===========================
                Big brown bat  ===========================
                 Killer whale  ===========================
               Bactrian camel  ===========================
                        Panda  ===========================
             Black flying-fox  ===========================
                      Ferret   ===========================
             Cape golden mole  ===========================
                      Dolphin  ===========================
                 Weddell seal  ===========================
                     Aardvark  ===========================
                   Coelacanth  ===========================
                       Turkey  ===========================
                  Spotted gar  ===========================
                 Mallard duck  ===========================
                Scarlet macaw  ===========================
                   Budgerigar  ===========================
                      Wallaby  ===========================
                       Lizard  ===========================
     Mexican tetra (cavefish)  ===========================
             Peregrine falcon  ===========================
                    Zebrafish  ===========================
                  Rock pigeon  ===========================
               Painted turtle  ===========================
                      Chicken  ===========================
                     Platypus  ===========================
          Collared flycatcher  ===========================
     Chinese softshell turtle  ===========================
                  Zebra finch  ===========================
                 Saker falcon  ===========================
                X. tropicalis  ===========================
              Green seaturtle  ===========================
          Medium ground finch  ===========================
           American alligator  ===========================
       White-throated sparrow  ===========================
           Tibetan ground jay  ===========================
                      Megabat  ===========================
                          Pig  ===========================
              Tasmanian devil  ===========================

Inserts between block 11 and 12 in window
B D                 Marmoset 14bp
B D          Squirrel monkey 229bp

Alignment block 12 of 94 in window, 57695931 - 57695968, 38 bps 
B D                     Human  agctctctggtgtccc-ttcttataggaa----cactaatcct
B D                     Chimp  agctttctggtgtccc-ttcttataggaa----cactaatcct
B D                   Gorilla  cgctctctggtggccc-ttcttataggaatactcactaatcct
B D                 Orangutan  agctctctggtgtccc-ttcttataggaa----cactaatcct
B D                    Gibbon  agctctctggtgtccctttcttataggaa----cactaatcct
B D                    Rhesus  agctctctggt------gtcttataggaa----cactaatctt
B D       Crab-eating macaque  agctctctggt------gtcttataggaa----cactaatctt
B D                    Baboon  agctctctggt------gtcttataggaa----cactaatctt
B D              Green monkey  agctctctggt------gtcttataggaa----cactaatctt
B D                  Marmoset  aactctctggtgtccc-ttcttataggaa----cagtaatcct
B D           Squirrel monkey  agttctctggtgtttc-ttcttataggaa----cactaatcct
B D                  Bushbaby  agcaatctggtatctt-ttcttagaagaa----cactaaccct
           Chinese tree shrew  agttctctggcatctc-ttcttataagga----caccaatcct
B D                  Squirrel  agttctctagcatctc-ttctgagaaaga----cattaatcct
       Lesser Egyptian jerboa  agcactttggagactc-ttcttacaaagg----cactcatcct
B D            Naked mole-rat  agctgtctggtgtctc-ttcttataaaga----cattaatcct
B D                    Tenrec  ===========================================
B D                Guinea pig  ===========================================
B D                       Rat  ===========================================
B D                     Mouse  ===========================================
              Golden hamster  ===========================================
B D           Chinese hamster  ===========================================
                Prairie vole  ===========================================
B D                  Elephant  ===========================================
            Tibetan antelope  ===========================================
         Cape elephant shrew  ===========================================
B D                     Shrew  ===========================================
        David's myotis (bat)  ===========================================
B D                     Horse  ===========================================
               Domestic goat  ===========================================
B D                     Sheep  ===========================================
B D                       Cow  ===========================================
B D                    Alpaca  ===========================================
             Star-nosed mole  ===========================================
B D                      Pika  ===========================================
B D                    Rabbit  ===========================================
B D                 Armadillo  ===========================================
B D                   Manatee  ===========================================
                  Chinchilla  ===========================================
B D          White rhinoceros  ===========================================
            Brush-tailed rat  ===========================================
              Pacific walrus  ===========================================
B D                       Dog  ===========================================
B D                       Cat  ===========================================
B D                  Microbat  ===========================================
               Big brown bat  ===========================================
                Killer whale  ===========================================
              Bactrian camel  ===========================================
B D                     Panda  ===========================================
            Black flying-fox  ===========================================
B D                   Ferret   ===========================================
            Cape golden mole  ===========================================
B D                   Dolphin  ===========================================
                Weddell seal  ===========================================
                    Aardvark  ===========================================
B D                Coelacanth  ===========================================
B D                    Turkey  ===========================================
                 Spotted gar  ===========================================
  D              Mallard duck  ===========================================
  D             Scarlet macaw  ===========================================
B D                Budgerigar  ===========================================
B D                   Wallaby  ===========================================
B D                    Lizard  ===========================================
    Mexican tetra (cavefish)  ===========================================
  D          Peregrine falcon  ===========================================
B D                 Zebrafish  ===========================================
  D               Rock pigeon  ===========================================
  D            Painted turtle  ===========================================
B D                   Chicken  ===========================================
B D                  Platypus  ===========================================
  D       Collared flycatcher  ===========================================
  D  Chinese softshell turtle  ===========================================
B D               Zebra finch  ===========================================
  D              Saker falcon  ===========================================
B D             X. tropicalis  ===========================================
  D           Green seaturtle  ===========================================
B D       Medium ground finch  ===========================================
B D        American alligator  ===========================================
  D    White-throated sparrow  ===========================================
          Tibetan ground jay  ===========================================
B D                   Megabat  ===========================================
B D                       Pig  ===========================================
B D           Tasmanian devil  ===========================================

Inserts between block 12 and 13 in window
B D                 Squirrel 200bp

Alignment block 13 of 94 in window, 57695969 - 57696029, 61 bps 
B D                     Human  atcggatcatggtcccactcttatgacctca-ttaaccttagttacttccttggaggcttca
B D                     Chimp  atcggatcacggtcccactcttatgacctca-ttaaccttagttacttccttggaggcttca
B D                   Gorilla  atcggatcacgg-cccactcttatgacctca-ttaaccttagttacttccttggaggcttca
B D                 Orangutan  atcggatcagggtcccactcttacgacctca-ttaaccttagttacttccttggaggcttca
B D                    Gibbon  atcggatcagggtcccactcttgcgacctca-ttgaccttagttacttccttggaggcttca
B D                    Rhesus  attggatcagggtcccacccttacgacctca-ttaaccttagcttcttccctggaggcttca
B D       Crab-eating macaque  attggatcagggtcccacccttacgacctca-ttaaccttagtttcttccttggaggcttca
B D                    Baboon  attggatcagggtcccacccttacgacctca-ttaaccttagcttcttccttggaggcttca
B D              Green monkey  attggatcagggtcccacccttacgacctca-ttaaccttagtttcttccttggaggcttca
B D                  Marmoset  gtcggatcagggtcccacccttacgacctca-ttaaccttaattacttccttagagtcttca
B D           Squirrel monkey  gtcggatcagggtcccacccttatgacctca-agaaccttagttacttccttagaggcttca
B D                  Bushbaby  attgggtcagggcctcacccttatgacctcatttaaccttaattacttcctcagagtcctga
           Chinese tree shrew  atcagattagggcctcacccatatgacttca-----ctttaattatttctttaaaggcacca
B D                  Squirrel  atctgatcagtgtcccactcttaggatctcatttaaccttaattattcttttagaggatcca
       Lesser Egyptian jerboa  cttagatcagggccccacacatatgaccttatctatccttaattatttcctcagaggcccca
B D            Naked mole-rat  atcagatcagggccccacccttactatctcatttaaccttaattacttccttaaattcccca
B D                    Tenrec  ==============================================================
B D                Guinea pig  ==============================================================
B D                       Rat  ==============================================================
B D                     Mouse  ==============================================================
              Golden hamster  ==============================================================
B D           Chinese hamster  ==============================================================
                Prairie vole  ==============================================================
B D                  Elephant  ==============================================================
            Tibetan antelope  ==============================================================
         Cape elephant shrew  ==============================================================
B D                     Shrew  ==============================================================
        David's myotis (bat)  ==============================================================
B D                     Horse  ==============================================================
               Domestic goat  ==============================================================
B D                     Sheep  ==============================================================
B D                       Cow  ==============================================================
B D                    Alpaca  ==============================================================
             Star-nosed mole  ==============================================================
B D                      Pika  ==============================================================
B D                    Rabbit  ==============================================================
B D                 Armadillo  ==============================================================
B D                   Manatee  ==============================================================
                  Chinchilla  ==============================================================
B D          White rhinoceros  ==============================================================
            Brush-tailed rat  ==============================================================
              Pacific walrus  ==============================================================
B D                       Dog  ==============================================================
B D                       Cat  ==============================================================
B D                  Microbat  ==============================================================
               Big brown bat  ==============================================================
                Killer whale  ==============================================================
              Bactrian camel  ==============================================================
B D                     Panda  ==============================================================
            Black flying-fox  ==============================================================
B D                   Ferret   ==============================================================
            Cape golden mole  ==============================================================
B D                   Dolphin  ==============================================================
                Weddell seal  ==============================================================
                    Aardvark  ==============================================================
B D                Coelacanth  ==============================================================
B D                    Turkey  ==============================================================
                 Spotted gar  ==============================================================
  D              Mallard duck  ==============================================================
  D             Scarlet macaw  ==============================================================
B D                Budgerigar  ==============================================================
B D                   Wallaby  ==============================================================
B D                    Lizard  ==============================================================
    Mexican tetra (cavefish)  ==============================================================
  D          Peregrine falcon  ==============================================================
B D                 Zebrafish  ==============================================================
  D               Rock pigeon  ==============================================================
  D            Painted turtle  ==============================================================
B D                   Chicken  ==============================================================
B D                  Platypus  ==============================================================
  D       Collared flycatcher  ==============================================================
  D  Chinese softshell turtle  ==============================================================
B D               Zebra finch  ==============================================================
  D              Saker falcon  ==============================================================
B D             X. tropicalis  ==============================================================
  D           Green seaturtle  ==============================================================
B D       Medium ground finch  ==============================================================
B D        American alligator  ==============================================================
  D    White-throated sparrow  ==============================================================
          Tibetan ground jay  ==============================================================
B D                   Megabat  ==============================================================
B D                       Pig  ==============================================================
B D           Tasmanian devil  ==============================================================

Alignment block 14 of 94 in window, 57696030 - 57696057, 28 bps 
B D                     Human  cct--------------ccagatacagc-----------cacactgggggtta
B D                     Chimp  cct--------------ccagatacagc-----------cacactgggggtta
B D                   Gorilla  cct--------------ccagatacagc-----------cacactgggggtta
B D                 Orangutan  cct--------------ccaaatacagc-----------cacactgggggtta
B D                    Gibbon  cct--------------ccaaatacagc-----------cacaatgggggtta
B D                    Rhesus  cct--------------ccaaatacagc-----------cacactgggggtta
B D       Crab-eating macaque  cct--------------ccaaatacagc-----------cacactgggggtta
B D                    Baboon  cct--------------ccaaatacagc-----------cacactgggggtta
B D              Green monkey  cct--------------ccaaatacagc-----------cacactggggatta
B D                  Marmoset  cct--------------ccaaatacagc-----------cacactgggggtca
B D           Squirrel monkey  cct--------------ccaaatacagc-----------cacactgagggttg
B D                  Bushbaby  tct--------------cca-atatagc-----------cacacggggggtta
           Chinese tree shrew  cat--------------ccaaatacaac-----------tgtaccaggggtta
B D                  Squirrel  tct--------------c------tagc-----------tacactagagatta
       Lesser Egyptian jerboa  cct--------------ctcaatatggc-----------tacattcaggagtt
B D            Naked mole-rat  tct--------------ctaaatagagc-----------cacactaggagcta
B D                Guinea pig  tctccacaaacagtgagctaaataaacctttcctcccttcattttgggtgttg
B D                    Tenrec  =====================================================
B D                       Rat  =====================================================
B D                     Mouse  =====================================================
              Golden hamster  =====================================================
B D           Chinese hamster  =====================================================
                Prairie vole  =====================================================
B D                  Elephant  =====================================================
            Tibetan antelope  =====================================================
         Cape elephant shrew  =====================================================
B D                     Shrew  =====================================================
        David's myotis (bat)  =====================================================
B D                     Horse  =====================================================
               Domestic goat  =====================================================
B D                     Sheep  =====================================================
B D                       Cow  =====================================================
B D                    Alpaca  =====================================================
             Star-nosed mole  =====================================================
B D                      Pika  =====================================================
B D                    Rabbit  =====================================================
B D                 Armadillo  =====================================================
B D                   Manatee  =====================================================
                  Chinchilla  =====================================================
B D          White rhinoceros  =====================================================
            Brush-tailed rat  =====================================================
              Pacific walrus  =====================================================
B D                       Dog  =====================================================
B D                       Cat  =====================================================
B D                  Microbat  =====================================================
               Big brown bat  =====================================================
                Killer whale  =====================================================
              Bactrian camel  =====================================================
B D                     Panda  =====================================================
            Black flying-fox  =====================================================
B D                   Ferret   =====================================================
            Cape golden mole  =====================================================
B D                   Dolphin  =====================================================
                Weddell seal  =====================================================
                    Aardvark  =====================================================
B D                Coelacanth  =====================================================
B D                    Turkey  =====================================================
                 Spotted gar  =====================================================
  D              Mallard duck  =====================================================
  D             Scarlet macaw  =====================================================
B D                Budgerigar  =====================================================
B D                   Wallaby  =====================================================
B D                    Lizard  =====================================================
    Mexican tetra (cavefish)  =====================================================
  D          Peregrine falcon  =====================================================
B D                 Zebrafish  =====================================================
  D               Rock pigeon  =====================================================
  D            Painted turtle  =====================================================
B D                   Chicken  =====================================================
B D                  Platypus  =====================================================
  D       Collared flycatcher  =====================================================
  D  Chinese softshell turtle  =====================================================
B D               Zebra finch  =====================================================
  D              Saker falcon  =====================================================
B D             X. tropicalis  =====================================================
  D           Green seaturtle  =====================================================
B D       Medium ground finch  =====================================================
B D        American alligator  =====================================================
  D    White-throated sparrow  =====================================================
          Tibetan ground jay  =====================================================
B D                   Megabat  =====================================================
B D                       Pig  =====================================================
B D           Tasmanian devil  =====================================================

Inserts between block 14 and 15 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 2bp
B D               Guinea pig 1bp

Alignment block 15 of 94 in window, 57696058 - 57696132, 75 bps 
B D                     Human  gggtttcaaaataggaatttgg-g----------g----agacatgaata-tt-----------cggttc
B D                     Chimp  gggtttcaaaataggaatttgg-g----------g----agacatgaata-tt-----------cggttc
B D                   Gorilla  gggtttcaacataggaatttgg-g----------g----agacatgaata-tt-----------cagttc
B D                 Orangutan  gggtttcaaaataggaatttgg-g----------g----agacatgagca-tt-----------cggttc
B D                    Gibbon  gggtttcaacattggaatttgg-g----------g----agacatgaaca-tt-----------cagttc
B D                    Rhesus  gggtttcaacacaggaatttgg-g----------g----agacatgaaca-tt-----------cagttc
B D       Crab-eating macaque  gggtttcaacacaggaatttgg-g----------g----agacatgaaca-tt-----------cagttc
B D                    Baboon  gggtttcaacacaggaatttgg-g----------g----agacatgaaca-tt-----------cagttc
B D              Green monkey  gggtttcaacacaggaatttgg-g----------g----agacatgaaca-tt-----------cagttc
B D                  Marmoset  gggtttcaacagaggaatctgg-g----------gagacagaca--aaca-tt-----------cagttc
B D           Squirrel monkey  gggtttcaacacaggaatttag-g----------g----agaca--aacg-tt-----------cagttc
B D                  Bushbaby  atgattcaacatatgaat---------------------------------tt-----------taattc
           Chinese tree shrew  gaactt-aacgtataaacttggag----------g----agacacaaact-tt-----------cagtcc
B D                  Squirrel  -ggctttagcctttgaatgagg-g----------g----agacataaaac-ttcaatccaaatactgctt
       Lesser Egyptian jerboa  tggcttcaacatgtgaatta---a----------a----aaaaatagcac-ct-----------cctcct
B D            Naked mole-rat  gggcttcaacatatgaatgaag-g----------g----agacacaaaca-gt-----------ccataa
B D                Guinea pig  gtgttttgtcccaccaacgaga-aaaaagtaactg----agacaaatagatat-----------ttattt
             Brush-tailed rat  gggcttcagcatatgaatg---------------g----agacaaagata-gt-----------tcataa
B D                    Tenrec  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
B D                  Elephant  ======================================================================
            Tibetan antelope  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
        David's myotis (bat)  ======================================================================
B D                     Horse  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
B D                    Alpaca  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
                  Chinchilla  ======================================================================
B D          White rhinoceros  ======================================================================
              Pacific walrus  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
B D                  Microbat  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D                     Panda  ======================================================================
            Black flying-fox  ======================================================================
B D                   Ferret   ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
                Weddell seal  ======================================================================
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ctaacac-------ccccccaaaaaag-------------------------------------------
                        Chimp  ctaacac-------ccccccaaacaag-------------------------------------------
                      Gorilla  ctaacac-------cccccaaaaaaag-------------------------------------------
                    Orangutan  ctaacac-------ccccctaaaaaag-------------------------------------------
                       Gibbon  ctaacac-------ccccctaaaaaag-------------------------------------------
                       Rhesus  ctaacac-------ccccctaaaaaag-------------------------------------------
          Crab-eating macaque  ctaacac-------ccccctaaaaaag-------------------------------------------
                       Baboon  ctaaca--------ccccctaaaaaag-------------------------------------------
                 Green monkey  ctaacac-------tcccctaaaaaag-------------------------------------------
                     Marmoset  ctaacac-------ccccctaaa-aag-------------------------------------------
              Squirrel monkey  ctaacac-------ccccataag-aag-------------------------------------------
                     Bushbaby  atgatac-------ctttcaaacaagt-------------------------------------------
           Chinese tree shrew  aaaacaccagcccaccccccaaaaaag-------------------------------------------
                     Squirrel  c-------------atcccaaataaaaaggc---------------------------------------
       Lesser Egyptian jerboa  c-------------ctctcacaaaaaaaaaaaaaagaaagaaagaaagaaagaaagaaagaaagaaagaa
               Naked mole-rat  c--acgc-------cccccaa-------------------------------------------------
                   Guinea pig  ctaaaga-------agttcaagattaaa------------------------------------------
             Brush-tailed rat  c--acgg-------cgcccaaa------------------------------------------------
                       Tenrec  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Elephant  ======================================================================
             Tibetan antelope  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
         David's myotis (bat)  ======================================================================
                        Horse  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
                       Alpaca  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                    Armadillo  ======================================================================
                      Manatee  ======================================================================
                   Chinchilla  ======================================================================
             White rhinoceros  ======================================================================
               Pacific walrus  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
                     Microbat  ======================================================================
                Big brown bat  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                        Panda  ======================================================================
             Black flying-fox  ======================================================================
                      Ferret   ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
                 Weddell seal  ======================================================================
                     Aardvark  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
               Painted turtle  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ------------ctggaaactgga
                        Chimp  ------------ctggaaactgga
                      Gorilla  ------------ctggaaactgga
                    Orangutan  ------------ctggaaactgga
                       Gibbon  ------------ctggaaactgga
                       Rhesus  ------------ctagagactaga
          Crab-eating macaque  ------------ctagagactgga
                       Baboon  ------------ctggagactgga
                 Green monkey  ------------ctggagactgga
                     Marmoset  ------------ct--------ga
              Squirrel monkey  ------------ctggagactgga
                     Bushbaby  ------------tgggagacctaa
           Chinese tree shrew  ------------ctagagactaga
                     Squirrel  ------------ccagagactgga
       Lesser Egyptian jerboa  agaaagaaaaagctggaggctgga
               Naked mole-rat  ------------------------
                   Guinea pig  ------------------------
             Brush-tailed rat  ------------------------
                       Tenrec  ========================
                          Rat  ========================
                        Mouse  ========================
               Golden hamster  ========================
              Chinese hamster  ========================
                 Prairie vole  ========================
                     Elephant  ========================
             Tibetan antelope  ========================
          Cape elephant shrew  ========================
                        Shrew  ========================
         David's myotis (bat)  ========================
                        Horse  ========================
                Domestic goat  ========================
                        Sheep  ========================
                          Cow  ========================
                       Alpaca  ========================
              Star-nosed mole  ========================
                         Pika  ========================
                       Rabbit  ========================
                    Armadillo  ========================
                      Manatee  ========================
                   Chinchilla  ========================
             White rhinoceros  ========================
               Pacific walrus  ========================
                          Dog  ========================
                          Cat  ========================
                     Microbat  ========================
                Big brown bat  ========================
                 Killer whale  ========================
               Bactrian camel  ========================
                        Panda  ========================
             Black flying-fox  ========================
                      Ferret   ========================
             Cape golden mole  ========================
                      Dolphin  ========================
                 Weddell seal  ========================
                     Aardvark  ========================
                   Coelacanth  ========================
                       Turkey  ========================
                  Spotted gar  ========================
                 Mallard duck  ========================
                Scarlet macaw  ========================
                   Budgerigar  ========================
                      Wallaby  ========================
                       Lizard  ========================
     Mexican tetra (cavefish)  ========================
             Peregrine falcon  ========================
                    Zebrafish  ========================
                  Rock pigeon  ========================
               Painted turtle  ========================
                      Chicken  ========================
                     Platypus  ========================
          Collared flycatcher  ========================
     Chinese softshell turtle  ========================
                  Zebra finch  ========================
                 Saker falcon  ========================
                X. tropicalis  ========================
              Green seaturtle  ========================
          Medium ground finch  ========================
           American alligator  ========================
       White-throated sparrow  ========================
           Tibetan ground jay  ========================
                      Megabat  ========================
                          Pig  ========================
              Tasmanian devil  ========================

Inserts between block 15 and 16 in window
B D               Guinea pig 223bp

Alignment block 16 of 94 in window, 57696133 - 57696192, 60 bps 
B D                     Human  acctattgtcactactaggtgaagacccactgctgaggcatgctgcctggagc-agt----aagt
B D                     Chimp  acctattgtcactactaggtgaagacccactgctaaggcatgctgcctggagc-agt----aagt
B D                   Gorilla  acctattgtcactactaggtgaagacccactgctgaggcatgctgcctggagc-agt----aagt
B D                 Orangutan  acctattgtcactactaggtgaagacccactgctgaggcatgctgcctggaac-agt----aagt
B D                    Gibbon  acctattgtcactactaggtggagacccactgctgaggcatgctgcctggaac-agc----aagt
B D                    Rhesus  acctattatcgctactaggtgaagacccactgctgaggcatgctgcctggaac-agt----aagt
B D       Crab-eating macaque  acctattatcgctactaggtgaagacccactgctgaggcatgctgcctggaac-agt----aagt
B D                    Baboon  acctattattgctactaggtgaagacccactgctgaggcatgctgcctggagc-agt----aagt
B D              Green monkey  acctattatcgctactaggtgaagacccactgctgaggcatgctgcctggaac-agt----aagt
B D                  Marmoset  tcctattgccgttactaggtgaagcctccctgctgaggcatgctgcctgaaac-agg----aggc
B D           Squirrel monkey  acctattgcagatactaggtgaagcccccttgctgaggcatgctgcctggaac-agg----aagc
B D                  Bushbaby  acctattgctgctgccaggtggtgacacagtgctgaggcaagccacttggaac-agg----aaac
           Chinese tree shrew  acctattgctgctaccaggagaagacccattattgaggcaatatggctggaac-agg----aagc
B D                  Squirrel  acccattgctgctaac------------------------agctggctggaac-agg----aagc
       Lesser Egyptian jerboa  agccattgctgtttccgggtaaagacccattactgaggcaagctggttggaac--------aagc
B D            Naked mole-rat  ----attgctgctactcaaggaagacccactgctgaggcaagttggctggacccaga----agcc
             Brush-tailed rat  -----ctgttgccaccagaggaaggctcagcggtgaggcaagctggctggacccagactccgacc
B D                    Tenrec  =================================================================
B D                Guinea pig  =================================================================
B D                       Rat  =================================================================
B D                     Mouse  =================================================================
              Golden hamster  =================================================================
B D           Chinese hamster  =================================================================
                Prairie vole  =================================================================
B D                  Elephant  =================================================================
            Tibetan antelope  =================================================================
         Cape elephant shrew  =================================================================
B D                     Shrew  =================================================================
        David's myotis (bat)  =================================================================
B D                     Horse  =================================================================
               Domestic goat  =================================================================
B D                     Sheep  =================================================================
B D                       Cow  =================================================================
B D                    Alpaca  =================================================================
             Star-nosed mole  =================================================================
B D                      Pika  =================================================================
B D                    Rabbit  =================================================================
B D                 Armadillo  =================================================================
B D                   Manatee  =================================================================
                  Chinchilla  =================================================================
B D          White rhinoceros  =================================================================
              Pacific walrus  =================================================================
B D                       Dog  =================================================================
B D                       Cat  =================================================================
B D                  Microbat  =================================================================
               Big brown bat  =================================================================
                Killer whale  =================================================================
              Bactrian camel  =================================================================
B D                     Panda  =================================================================
            Black flying-fox  =================================================================
B D                   Ferret   =================================================================
            Cape golden mole  =================================================================
B D                   Dolphin  =================================================================
                Weddell seal  =================================================================
                    Aardvark  =================================================================
B D                Coelacanth  =================================================================
B D                    Turkey  =================================================================
                 Spotted gar  =================================================================
  D              Mallard duck  =================================================================
  D             Scarlet macaw  =================================================================
B D                Budgerigar  =================================================================
B D                   Wallaby  =================================================================
B D                    Lizard  =================================================================
    Mexican tetra (cavefish)  =================================================================
  D          Peregrine falcon  =================================================================
B D                 Zebrafish  =================================================================
  D               Rock pigeon  =================================================================
  D            Painted turtle  =================================================================
B D                   Chicken  =================================================================
B D                  Platypus  =================================================================
  D       Collared flycatcher  =================================================================
  D  Chinese softshell turtle  =================================================================
B D               Zebra finch  =================================================================
  D              Saker falcon  =================================================================
B D             X. tropicalis  =================================================================
  D           Green seaturtle  =================================================================
B D       Medium ground finch  =================================================================
B D        American alligator  =================================================================
  D    White-throated sparrow  =================================================================
          Tibetan ground jay  =================================================================
B D                   Megabat  =================================================================
B D                       Pig  =================================================================
B D           Tasmanian devil  =================================================================

Alignment block 17 of 94 in window, 57696193 - 57696204, 12 bps 
B D                     Human  agacaggaagaa
B D                     Chimp  agacaggaagaa
B D                   Gorilla  agacaggaagaa
B D                 Orangutan  agacaggaagaa
B D                    Gibbon  agacaggaagaa
B D                    Rhesus  agata-gaagaa
B D       Crab-eating macaque  agata-gaagaa
B D                    Baboon  agaca-gaagaa
B D              Green monkey  agaca-gaagaa
B D                  Marmoset  agacaggaagaa
B D           Squirrel monkey  agacaggaagaa
B D                  Bushbaby  aaacaagaggaa
           Chinese tree shrew  agataggaagaa
B D                  Squirrel  agataggaag--
       Lesser Egyptian jerboa  agacaggaag--
B D            Naked mole-rat  acaggaagag--
             Brush-tailed rat  ggaagaagag--
B D                 Armadillo  agacaaaatgga
B D                    Tenrec  ============
B D                Guinea pig  ============
B D                       Rat  ============
B D                     Mouse  ============
              Golden hamster  ============
B D           Chinese hamster  ============
                Prairie vole  ============
B D                  Elephant  ============
            Tibetan antelope  ============
         Cape elephant shrew  ============
B D                     Shrew  ============
        David's myotis (bat)  ============
B D                     Horse  ============
               Domestic goat  ============
B D                     Sheep  ============
B D                       Cow  ============
B D                    Alpaca  ============
             Star-nosed mole  ============
B D                      Pika  ============
B D                    Rabbit  ============
B D                   Manatee  ============
                  Chinchilla  ============
B D          White rhinoceros  ============
              Pacific walrus  ============
B D                       Dog  ============
B D                       Cat  ============
B D                  Microbat  ============
               Big brown bat  ============
                Killer whale  ============
              Bactrian camel  ============
B D                     Panda  ============
            Black flying-fox  ============
B D                   Ferret   ============
            Cape golden mole  ============
B D                   Dolphin  ============
                Weddell seal  ============
                    Aardvark  ============
B D                Coelacanth  ============
B D                    Turkey  ============
                 Spotted gar  ============
  D              Mallard duck  ============
  D             Scarlet macaw  ============
B D                Budgerigar  ============
B D                   Wallaby  ============
B D                    Lizard  ============
    Mexican tetra (cavefish)  ============
  D          Peregrine falcon  ============
B D                 Zebrafish  ============
  D               Rock pigeon  ============
  D            Painted turtle  ============
B D                   Chicken  ============
B D                  Platypus  ============
  D       Collared flycatcher  ============
  D  Chinese softshell turtle  ============
B D               Zebra finch  ============
  D              Saker falcon  ============
B D             X. tropicalis  ============
  D           Green seaturtle  ============
B D       Medium ground finch  ============
B D        American alligator  ============
  D    White-throated sparrow  ============
          Tibetan ground jay  ============
B D                   Megabat  ============
B D                       Pig  ============
B D           Tasmanian devil  ============

Inserts between block 17 and 18 in window
          Chinese tree shrew 142bp

Alignment block 18 of 94 in window, 57696205 - 57696307, 103 bps 
B D                     Human  ggatg-----------------------------------------------------------------
B D                     Chimp  ggatg-----------------------------------------------------------------
B D                   Gorilla  ggatg-----------------------------------------------------------------
B D                 Orangutan  ggatg-----------------------------------------------------------------
B D                    Gibbon  ggatg-----------------------------------------------------------------
B D                    Rhesus  ggatg-----------------------------------------------------------------
B D       Crab-eating macaque  ggatg-----------------------------------------------------------------
B D                    Baboon  ggatg-----------------------------------------------------------------
B D              Green monkey  ggatg-----------------------------------------------------------------
B D                  Marmoset  ggatg-----------------------------------------------------------------
B D           Squirrel monkey  ggatg-----------------------------------------------------------------
B D                  Bushbaby  gagtg-----------------------------------------------------------------
           Chinese tree shrew  ggatgcacgcactcgccagaaagacagagacagagaaatagaaagtgagaaatcacccccatccccagcc
B D                  Squirrel  ----a-----------------------------------------------------------------
       Lesser Egyptian jerboa  ---ta-----------------------------------------------------------------
B D            Naked mole-rat  ---tg-----------------------------------------------------------------
             Brush-tailed rat  ---gg-----------------------------------------------------------------
B D                 Armadillo  -gaaa-----------------------------------------------------------------
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
B D                  Elephant  ======================================================================
            Tibetan antelope  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
        David's myotis (bat)  ======================================================================
B D                     Horse  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
B D                    Alpaca  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                   Manatee  ======================================================================
                  Chinchilla  ======================================================================
B D          White rhinoceros  ======================================================================
              Pacific walrus  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
B D                  Microbat  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D                     Panda  ======================================================================
            Black flying-fox  ======================================================================
B D                   Ferret   ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
                Weddell seal  ======================================================================
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  --------------tccttcctc---c---ctcctc-----------ccgcca----tgttggg------
                        Chimp  --------------tccttcctc---c---ctcctc-----------ccgcca----tgttggg------
                      Gorilla  --------------tccttcctc---c---ctcctc-----------ccgcca----tgttggg------
                    Orangutan  --------------tccttcctc---c---ctcctc-----------ccgcca----tgttggg------
                       Gibbon  --------------tccttcctc---c---ctcctc-----------ccgcca----ttttggg------
                       Rhesus  --------------tccttcctc---c---gtcctc-----------ctgcca----tgttggg------
          Crab-eating macaque  --------------tccttcctc---c---gtcctc-----------ctgcca----tgttggg------
                       Baboon  --------------tccttcctc---t---gtcctc-----------ctgcca----tgttggg------
                 Green monkey  --------------tccttcctc---c---ctcctc-----------ctgcca----tgttggg------
                     Marmoset  --------------tctttcctc---c---ctcctcc---ctccccgccccca----tgttggg------
              Squirrel monkey  --------------tctttcctc---c---ctccttc---ctc----ccgcca----tgttggg------
                     Bushbaby  --------------cccacccct---c---ctgccctgtggtctgctctgtcacttctgttggc------
           Chinese tree shrew  tagccacgctgcaatcctttctc---cattctcctc-----------ttggaa----tcttgggcacaca
                     Squirrel  --------------agagtagta---t---gatctc-----------ttgccc----tgtggtgtccttc
       Lesser Egyptian jerboa  --------------cccttcctc---c---ctcctc-----------ctgcct----tgttgtaccctc-
               Naked mole-rat  --------------tccctcctc---c---ctcttc-----------ctgccc----tcttgtgtcctct
             Brush-tailed rat  --------------tccttcctccggc---cacaac-----------ctgccc----tgttgtgtcctct
                    Armadillo  --------------tccttcctc---c---ccactc-----------ctgccc----tgcagtctcctct
                       Tenrec  ======================================================================
                   Guinea pig  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Elephant  ======================================================================
             Tibetan antelope  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
         David's myotis (bat)  ======================================================================
                        Horse  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
                       Alpaca  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                   Chinchilla  ======================================================================
             White rhinoceros  ======================================================================
               Pacific walrus  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
                     Microbat  ======================================================================
                Big brown bat  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                        Panda  ======================================================================
             Black flying-fox  ======================================================================
                      Ferret   ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
                 Weddell seal  ======================================================================
                     Aardvark  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
               Painted turtle  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ------------------------------agagcctgg---------------------catg------
                        Chimp  ------------------------------agagcctgg---------------------catg------
                      Gorilla  ------------------------------agagcctgg---------------------catg------
                    Orangutan  ------------------------------agagcctgg---------------------catg------
                       Gibbon  ------------------------------agagcctgg---------------------catg------
                       Rhesus  ------------------------------agagcctgg---------------------catg------
          Crab-eating macaque  ------------------------------agagcctgg---------------------catg------
                       Baboon  ------------------------------agagcctgg---------------------catg------
                 Green monkey  ------------------------------agagcctgg---------------------catg------
                     Marmoset  ------------------------------aaagcctgt---------------------catg------
              Squirrel monkey  ------------------------------agagcctgt---------------------catg------
                     Bushbaby  ------------------------------aaagcctga---------------------catg------
           Chinese tree shrew  cgcacatgtgcccaagtgagtttaagccaccgggtccgggacttgaaccacggtcaactacatg------
                     Squirrel  aacacctcccatagac--------------agggcct---------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
               Naked mole-rat  agcacctcctgcagat--------------gaagcat--------------------------g------
             Brush-tailed rat  agcacctgctatagat--------------ggagctcaa---------------------ca-a------
                    Armadillo  tgtgccacctcgtggc--------------agagcctgc---------------------catgcctccc
                       Tenrec  ======================================================================
                   Guinea pig  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Elephant  ======================================================================
             Tibetan antelope  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
         David's myotis (bat)  ======================================================================
                        Horse  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
                       Alpaca  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                   Chinchilla  ======================================================================
             White rhinoceros  ======================================================================
               Pacific walrus  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
                     Microbat  ======================================================================
                Big brown bat  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                        Panda  ======================================================================
             Black flying-fox  ======================================================================
                      Ferret   ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
                 Weddell seal  ======================================================================
                     Aardvark  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
               Painted turtle  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  g--atccagctggcaaagtggcaatgtca------------------cgg---------------cag--
                        Chimp  g--atccagctggcaaagtggcaatgtca------------------cgg---------------cag--
                      Gorilla  g--atccagctggcaaagtggcagtgtca------------------cgg---------------cag--
                    Orangutan  g--atccagcgggcaaaggggcaatgtca------------------cgg---------------cag--
                       Gibbon  g--atccagctggcaaaatggcaatgtca------------------cgg---------------cag--
                       Rhesus  g--atccagctggcaaagtggcaatgtca------------------tgg---------------cag--
          Crab-eating macaque  g--atacagctggcaaagtggcaatgtca------------------tgg---------------cag--
                       Baboon  g--atccagctggcaaagtggcaatgtca------------------cgg---------------cag--
                 Green monkey  g--atccagctggcaaagtggcaatgtca------------------cagcatgtgg--catccacag--
                     Marmoset  g--atccagctggtgaagtagcaatgtca------------------cgg---------------ccc--
              Squirrel monkey  g--atccagctggtggagtagcagtgtca------------------tgg---------------ccc--
                     Bushbaby  g--atccagctgacaaagtggcagtgtca------------------cag---------------cca--
           Chinese tree shrew  ggagtccagc-gacatagtcgttatgccaattgctggtctcaagtggcggtatgttgacaatgtgtag--
                     Squirrel  g--gcaaagtcggc--------aatgtca------------------cag---------------cag--
       Lesser Egyptian jerboa  ------------------------tgtta------------------tgg---------------ca---
               Naked mole-rat  g--gtgcagctggccgagtgaaaatgcct------------------cag---------------ca---
             Brush-tailed rat  g--atgcagctggccgagtgccagtgtca------------------ca---------------------
                    Armadillo  g--ctccagcaacctggtttgcagggtcc------------------ccg---------------caaaa
                       Tenrec  ======================================================================
                   Guinea pig  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Elephant  ======================================================================
             Tibetan antelope  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
         David's myotis (bat)  ======================================================================
                        Horse  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
                       Alpaca  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                   Chinchilla  ======================================================================
             White rhinoceros  ======================================================================
               Pacific walrus  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
                     Microbat  ======================================================================
                Big brown bat  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                        Panda  ======================================================================
             Black flying-fox  ======================================================================
                      Ferret   ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
                 Weddell seal  ======================================================================
                     Aardvark  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
               Painted turtle  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  --agtgtggaaggctgagtgtggag
                        Chimp  --agtgtggaaggctgagtgtggag
                      Gorilla  --agtgtggaaggctgagtgtggag
                    Orangutan  --agtgtggaaggctgagtgtggag
                       Gibbon  --agtgtggaaggctgagtgtggag
                       Rhesus  --agtgtggaaggctgagtgtggag
          Crab-eating macaque  --agtgtggaaggctgagtgtggag
                       Baboon  --agtgtggaaggctgagtgtggag
                 Green monkey  --catgtggaaggctgagtgtggag
                     Marmoset  --aatgtggaaggctgagcgtggag
              Squirrel monkey  --agtgtggaaggctgagtgtggag
                     Bushbaby  --aagatggaagactgagtgtggag
           Chinese tree shrew  --agtatgaaaggctgaatgtggag
                     Squirrel  --agtgtgggaggctgagtgtgaag
       Lesser Egyptian jerboa  -------------------------
               Naked mole-rat  ---------------gagcacagag
             Brush-tailed rat  ----------------agcgtagag
                    Armadillo  gcagtttggaaggttgagtgtggag
                       Tenrec  =========================
                   Guinea pig  =========================
                          Rat  =========================
                        Mouse  =========================
               Golden hamster  =========================
              Chinese hamster  =========================
                 Prairie vole  =========================
                     Elephant  =========================
             Tibetan antelope  =========================
          Cape elephant shrew  =========================
                        Shrew  =========================
         David's myotis (bat)  =========================
                        Horse  =========================
                Domestic goat  =========================
                        Sheep  =========================
                          Cow  =========================
                       Alpaca  =========================
              Star-nosed mole  =========================
                         Pika  =========================
                       Rabbit  =========================
                      Manatee  =========================
                   Chinchilla  =========================
             White rhinoceros  =========================
               Pacific walrus  =========================
                          Dog  =========================
                          Cat  =========================
                     Microbat  =========================
                Big brown bat  =========================
                 Killer whale  =========================
               Bactrian camel  =========================
                        Panda  =========================
             Black flying-fox  =========================
                      Ferret   =========================
             Cape golden mole  =========================
                      Dolphin  =========================
                 Weddell seal  =========================
                     Aardvark  =========================
                   Coelacanth  =========================
                       Turkey  =========================
                  Spotted gar  =========================
                 Mallard duck  =========================
                Scarlet macaw  =========================
                   Budgerigar  =========================
                      Wallaby  =========================
                       Lizard  =========================
     Mexican tetra (cavefish)  =========================
             Peregrine falcon  =========================
                    Zebrafish  =========================
                  Rock pigeon  =========================
               Painted turtle  =========================
                      Chicken  =========================
                     Platypus  =========================
          Collared flycatcher  =========================
     Chinese softshell turtle  =========================
                  Zebra finch  =========================
                 Saker falcon  =========================
                X. tropicalis  =========================
              Green seaturtle  =========================
          Medium ground finch  =========================
           American alligator  =========================
       White-throated sparrow  =========================
           Tibetan ground jay  =========================
                      Megabat  =========================
                          Pig  =========================
              Tasmanian devil  =========================

Inserts between block 18 and 19 in window
B D                 Squirrel 20bp
      Lesser Egyptian jerboa 6bp
B D           Naked mole-rat 13bp
            Brush-tailed rat 34bp

Alignment block 19 of 94 in window, 57696308 - 57696415, 108 bps 
B D                     Human  ctgag----------------------------------aggaa--------------------------
B D                     Chimp  ctgag----------------------------------aggaa--------------------------
B D                   Gorilla  ctgag----------------------------------aggaa--------------------------
B D                 Orangutan  ctgag----------------------------------aggaa--------------------------
B D                    Gibbon  ctgag----------------------------------aggaa--------------------------
B D                    Rhesus  ctgag----------------------------------aggaa--------------------------
B D       Crab-eating macaque  ctgag----------------------------------aggaa--------------------------
B D                    Baboon  ctgag----------------------------------aggaa--------------------------
B D              Green monkey  ctgag----------------------------------aggaa--------------------------
B D                  Marmoset  ctgag----------------------------------aggaa--------------------------
B D           Squirrel monkey  ctgag----------------------------------gggaa--------------------------
B D                  Bushbaby  ctgaa----------------------------------aggaagcagcttagtgactggcac-attccc
           Chinese tree shrew  ctgagaagtaataattcaacaaatgcacggttctcccataggaa--------------------------
B D                  Squirrel  tcagt----------------------------------aggaa--------------------------
       Lesser Egyptian jerboa  ccagt----------------------------------agaaa--------------------------
B D            Naked mole-rat  ctgac----------------------------------ag--a--------------------------
B D                Guinea pig  ccaat----------------------------------agaaa--------------------------
             Brush-tailed rat  tgaat----------------------------------agaaa--------------------------
B D                 Armadillo  ctgag----------------------------------agagagcatctcaatcactgacacaattccc
B D                    Tenrec  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
B D                  Elephant  ======================================================================
            Tibetan antelope  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
        David's myotis (bat)  ======================================================================
B D                     Horse  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
B D                    Alpaca  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                   Manatee  ======================================================================
                  Chinchilla  ======================================================================
B D          White rhinoceros  ======================================================================
              Pacific walrus  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
B D                  Microbat  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D                     Panda  ======================================================================
            Black flying-fox  ======================================================================
B D                   Ferret   ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
                Weddell seal  ======================================================================
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  -----------cc--ctctccagccaagacagaccatggaaccagagc-aatcaaacatttattgagtac
                        Chimp  -----------cc--ctctccagccaagacagaccatggaaccagagc-aatcaaacatttattgagtac
                      Gorilla  -----------cc--ctctccagccaagacagaccatggaaccagagc-aatcaaacatttattgagtac
                    Orangutan  -----------cc--ctctccagccaagatagaccatggaaccagagc-aatcaaacatttattgagtat
                       Gibbon  -----------cc--ctctccaggcaagacagaccacggaaccagagc-aatcaaacatttattgagtac
                       Rhesus  -----------cc--ctctccagccaagacagaccatggaaccagagc-aatcaaacatttattgagtac
          Crab-eating macaque  -----------cc--ctctccagccaagacagaccatggaaccagagc-aatcaaacatttattgagtac
                       Baboon  -----------cc--ctctccagctaagacagaccatggaaccagagc-aatcaaacatttattgagtac
                 Green monkey  -----------cc--ctctccagccaagacagaccatggaaccagagc-aatcaaacatttattgagtac
                     Marmoset  -----------cc--ctctccagtcaaggcagaccatggaaccagag------caat---------atac
              Squirrel monkey  -----------cc--ctctccagccaaggcagaccatggaaccagagc-aatccaat---------gtac
                     Bushbaby  tggtaggaa-ttc--ctcttcacccatgatagaccacaggttcagagc-aatccagcatttactgagtac
           Chinese tree shrew  -----------ct--cgctgcatcca----agaccatggaatgagagc-aatccaacctttatcgagcac
                     Squirrel  -----------ctgcctctgcatccaagagagattgtggaattagaac-aatccaacatgtattgggcac
       Lesser Egyptian jerboa  -----------ccctccctccacccaagataagccataaaccatgaaa-gttccaacttcaagaggccat
               Naked mole-rat  -----------tcatggcttaa--tgactggcgtgactccaacatagcaacccca-catttactgagcac
                   Guinea pig  -----------ccttttcttca--caagatactccacagagtcagagc-accccagcatttactgagcac
             Brush-tailed rat  -----------ccctctctccatccaaaataaaccataaaattagagcaactccaacattaactgaacgc
                    Armadillo  cagtatgaaccct--ctcgccttccaagacagaccatgaaatcagatc-aatccaatgtttactgagcac
                       Tenrec  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Elephant  ======================================================================
             Tibetan antelope  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
         David's myotis (bat)  ======================================================================
                        Horse  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
                       Alpaca  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                   Chinchilla  ======================================================================
             White rhinoceros  ======================================================================
               Pacific walrus  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
                     Microbat  ======================================================================
                Big brown bat  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                        Panda  ======================================================================
             Black flying-fox  ======================================================================
                      Ferret   ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
                 Weddell seal  ======================================================================
                     Aardvark  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
               Painted turtle  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ttat---------tatgtaaaatagtaaaagtcacat---------------------------------
                        Chimp  ttat---------tatgtaaaatagtaaaagtcacat---------------------------------
                      Gorilla  ttat---------tatgtaaaatagtaaaagtcacat---------------------------------
                    Orangutan  ttat---------tatgtaaaatagtaaaagtcacat---------------------------------
                       Gibbon  ttat---------tatgtaaaatagtaaaagtcacat---------------------------------
                       Rhesus  ttat---------tatgtaagatagtaaaagtcacat---------------------------------
          Crab-eating macaque  ttat---------tatgtaagatagtaaaagtcacat---------------------------------
                       Baboon  ttat---------tatgtaagatagtaaaagtcacat---------------------------------
                 Green monkey  ttat---------tatgtaagatagtaaaagtcacat---------------------------------
                     Marmoset  tta------------------atagtaaaagccacgt---------------------------------
              Squirrel monkey  tta------------------atggtaaaagtcacgt---------------------------------
                     Bushbaby  ctga---------tctg-----tagcaaaaatcacat---------------------------------
           Chinese tree shrew  ctatgagaagacctctgaaagttcatggaaggtgcatattataaaaacaaacaaacaaacaaacaaaaaa
                     Squirrel  ctat---------tatg-----tgccaaaagtcatgt---------------------------------
       Lesser Egyptian jerboa  tcat---------tctt-----ctctc----tctctt---------------------------------
               Naked mole-rat  cgat---------catg-----tatgaaaagacacat---------------------------------
                   Guinea pig  ctat---------gacg-----tctgaaaagatacac---------------------------------
             Brush-tailed rat  ctat---------gatg-----tttgagaagacgcgt---------------------------------
                    Armadillo  ctat---------tatg-----tgccaaaagccacat---------------------------------
                       Tenrec  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Elephant  ======================================================================
             Tibetan antelope  ======================================================================
          Cape elephant shrew  ======================================================================
                        Shrew  ======================================================================
         David's myotis (bat)  ======================================================================
                        Horse  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
                       Alpaca  ======================================================================
              Star-nosed mole  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                      Manatee  ======================================================================
                   Chinchilla  ======================================================================
             White rhinoceros  ======================================================================
               Pacific walrus  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
                     Microbat  ======================================================================
                Big brown bat  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                        Panda  ======================================================================
             Black flying-fox  ======================================================================
                      Ferret   ======================================================================
             Cape golden mole  ======================================================================
                      Dolphin  ======================================================================
                 Weddell seal  ======================================================================
                     Aardvark  ======================================================================
                   Coelacanth  ======================================================================
                       Turkey  ======================================================================
                  Spotted gar  ======================================================================
                 Mallard duck  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Wallaby  ======================================================================
                       Lizard  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
             Peregrine falcon  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
               Painted turtle  ======================================================================
                      Chicken  ======================================================================
                     Platypus  ======================================================================
          Collared flycatcher  ======================================================================
     Chinese softshell turtle  ======================================================================
                  Zebra finch  ======================================================================
                 Saker falcon  ======================================================================
                X. tropicalis  ======================================================================
              Green seaturtle  ======================================================================
          Medium ground finch  ======================================================================
           American alligator  ======================================================================
       White-throated sparrow  ======================================================================
           Tibetan ground jay  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  --tcactccccaggat
                        Chimp  --tcactccccaggat
                      Gorilla  --tcactccccaggat
                    Orangutan  --tcactccccaggat
                       Gibbon  --tcactccccaggat
                       Rhesus  --tcactccccaggat
          Crab-eating macaque  --tcactccccaggat
                       Baboon  --tcactccccaggat
                 Green monkey  --tcactccccaggat
                     Marmoset  --tcgctccccaggat
              Squirrel monkey  --tcgctccccaggat
                     Bushbaby  --tcgctccctgagat
           Chinese tree shrew  caactattgcctggat
                     Squirrel  --tcactcctcaagat
       Lesser Egyptian jerboa  --tctctctcagaaat
               Naked mole-rat  --tcactccccaagat
                   Guinea pig  --tgactccccaggat
             Brush-tailed rat  --tcactccccaagac
                    Armadillo  --tagctccctcagac
                       Tenrec  ================
                          Rat  ================
                        Mouse  ================
               Golden hamster  ================
              Chinese hamster  ================
                 Prairie vole  ================
                     Elephant  ================
             Tibetan antelope  ================
          Cape elephant shrew  ================
                        Shrew  ================
         David's myotis (bat)  ================
                        Horse  ================
                Domestic goat  ================
                        Sheep  ================
                          Cow  ================
                       Alpaca  ================
              Star-nosed mole  ================
                         Pika  ================
                       Rabbit  ================
                      Manatee  ================
                   Chinchilla  ================
             White rhinoceros  ================
               Pacific walrus  ================
                          Dog  ================
                          Cat  ================
                     Microbat  ================
                Big brown bat  ================
                 Killer whale  ================
               Bactrian camel  ================
                        Panda  ================
             Black flying-fox  ================
                      Ferret   ================
             Cape golden mole  ================
                      Dolphin  ================
                 Weddell seal  ================
                     Aardvark  ================
                   Coelacanth  ================
                       Turkey  ================
                  Spotted gar  ================
                 Mallard duck  ================
                Scarlet macaw  ================
                   Budgerigar  ================
                      Wallaby  ================
                       Lizard  ================
     Mexican tetra (cavefish)  ================
             Peregrine falcon  ================
                    Zebrafish  ================
                  Rock pigeon  ================
               Painted turtle  ================
                      Chicken  ================
                     Platypus  ================
          Collared flycatcher  ================
     Chinese softshell turtle  ================
                  Zebra finch  ================
                 Saker falcon  ================
                X. tropicalis  ================
              Green seaturtle  ================
          Medium ground finch  ================
           American alligator  ================
       White-throated sparrow  ================
           Tibetan ground jay  ================
                      Megabat  ================
                          Pig  ================
              Tasmanian devil  ================

Inserts between block 19 and 20 in window
B D           Naked mole-rat 13bp

Alignment block 20 of 94 in window, 57696416 - 57696418, 3 bps 
B D                     Human  tac
B D                     Chimp  tac
B D                   Gorilla  tac
B D                 Orangutan  tac
B D                    Gibbon  tac
B D                    Rhesus  tac
B D       Crab-eating macaque  tac
B D                    Baboon  tac
B D              Green monkey  tac
B D                  Marmoset  tac
B D           Squirrel monkey  gac
B D                  Bushbaby  tac
           Chinese tree shrew  ttc
B D                  Squirrel  tac
       Lesser Egyptian jerboa  aaa
B D                Guinea pig  tgc
             Brush-tailed rat  cgc
B D                 Armadillo  cac
B D                    Tenrec  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
B D           Chinese hamster  ===
                Prairie vole  ===
B D                  Elephant  ===
            Tibetan antelope  ===
         Cape elephant shrew  ===
B D                     Shrew  ===
        David's myotis (bat)  ===
B D                     Horse  ===
               Domestic goat  ===
B D                     Sheep  ===
B D                       Cow  ===
B D                    Alpaca  ===
             Star-nosed mole  ===
B D                      Pika  ===
B D                    Rabbit  ===
B D                   Manatee  ===
                  Chinchilla  ===
B D          White rhinoceros  ===
              Pacific walrus  ===
B D                       Dog  ===
B D                       Cat  ===
B D                  Microbat  ===
               Big brown bat  ===
B D            Naked mole-rat  ===
                Killer whale  ===
              Bactrian camel  ===
B D                     Panda  ===
            Black flying-fox  ===
B D                   Ferret   ===
            Cape golden mole  ===
B D                   Dolphin  ===
                Weddell seal  ===
                    Aardvark  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
  D            Painted turtle  ===
B D                   Chicken  ===
B D                  Platypus  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D               Zebra finch  ===
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ===
B D                       Pig  ===
B D           Tasmanian devil  ===

Inserts between block 20 and 21 in window
B D               Guinea pig 10bp
            Brush-tailed rat 419bp

Alignment block 21 of 94 in window, 57696419 - 57696437, 19 bps 
B D                     Human  ctaaaatcttg----aaagtcat
B D                     Chimp  ctaaaatcttg----aaagtcat
B D                   Gorilla  ctaaaatcttg----aaagtcat
B D                 Orangutan  ctaaactcttg----aaagtcat
B D                    Gibbon  ctaaaatcttg----aaagtcat
B D                    Rhesus  ctaaaatcttg----aaagtcat
B D       Crab-eating macaque  ctaaaatcttg----aaagtcat
B D                    Baboon  ctaaaatcttg----aaagtcat
B D              Green monkey  ctaaaatcttg----aaagtcat
B D                  Marmoset  ctcaaatcttg----aacatcat
B D           Squirrel monkey  ctcagatcttg----aatgtcat
B D                  Bushbaby  agaatgtctta----gatattgt
           Chinese tree shrew  aaaaatttttgcacaaaaataa-
B D                  Squirrel  --aaaatctttt-----------
       Lesser Egyptian jerboa  --aatattttt------------
B D                 Armadillo  ----agtcttt----aatgtcgg
B D                    Tenrec  =======================
B D                Guinea pig  =======================
B D                       Rat  =======================
B D                     Mouse  =======================
              Golden hamster  =======================
B D           Chinese hamster  =======================
                Prairie vole  =======================
B D                  Elephant  =======================
            Tibetan antelope  =======================
         Cape elephant shrew  =======================
B D                     Shrew  =======================
        David's myotis (bat)  =======================
B D                     Horse  =======================
               Domestic goat  =======================
B D                     Sheep  =======================
B D                       Cow  =======================
B D                    Alpaca  =======================
             Star-nosed mole  =======================
B D                      Pika  =======================
B D                    Rabbit  =======================
B D                   Manatee  =======================
                  Chinchilla  =======================
B D          White rhinoceros  =======================
            Brush-tailed rat  =======================
              Pacific walrus  =======================
B D                       Dog  =======================
B D                       Cat  =======================
B D                  Microbat  =======================
               Big brown bat  =======================
B D            Naked mole-rat  =======================
                Killer whale  =======================
              Bactrian camel  =======================
B D                     Panda  =======================
            Black flying-fox  =======================
B D                   Ferret   =======================
            Cape golden mole  =======================
B D                   Dolphin  =======================
                Weddell seal  =======================
                    Aardvark  =======================
B D                Coelacanth  =======================
B D                    Turkey  =======================
                 Spotted gar  =======================
  D              Mallard duck  =======================
  D             Scarlet macaw  =======================
B D                Budgerigar  =======================
B D                   Wallaby  =======================
B D                    Lizard  =======================
    Mexican tetra (cavefish)  =======================
  D          Peregrine falcon  =======================
B D                 Zebrafish  =======================
  D               Rock pigeon  =======================
  D            Painted turtle  =======================
B D                   Chicken  =======================
B D                  Platypus  =======================
  D       Collared flycatcher  =======================
  D  Chinese softshell turtle  =======================
B D               Zebra finch  =======================
  D              Saker falcon  =======================
B D             X. tropicalis  =======================
  D           Green seaturtle  =======================
B D       Medium ground finch  =======================
B D        American alligator  =======================
  D    White-throated sparrow  =======================
          Tibetan ground jay  =======================
B D                   Megabat  =======================
B D                       Pig  =======================
B D           Tasmanian devil  =======================

Alignment block 22 of 94 in window, 57696438 - 57696444, 7 bps 
B D                     Human  attaaag
B D                     Chimp  attaaag
B D                   Gorilla  attaaag
B D                 Orangutan  attaaag
B D                    Gibbon  attaaag
B D                    Rhesus  attaaag
B D       Crab-eating macaque  attaaag
B D                    Baboon  attaaag
B D              Green monkey  attaaag
B D                  Marmoset  attaaag
B D           Squirrel monkey  attaaag
           Chinese tree shrew  attaata
B D                 Armadillo  attaaag
B D                    Tenrec  =======
B D                Guinea pig  =======
B D                       Rat  =======
B D                     Mouse  =======
              Golden hamster  =======
B D           Chinese hamster  =======
                Prairie vole  =======
B D                  Elephant  =======
            Tibetan antelope  =======
         Cape elephant shrew  =======
B D                     Shrew  =======
        David's myotis (bat)  =======
B D                     Horse  =======
               Domestic goat  =======
B D                     Sheep  =======
B D                       Cow  =======
B D                    Alpaca  =======
             Star-nosed mole  =======
B D                  Squirrel  -------
B D                      Pika  =======
B D                    Rabbit  =======
B D                   Manatee  =======
                  Chinchilla  =======
      Lesser Egyptian jerboa  -------
B D          White rhinoceros  =======
            Brush-tailed rat  =======
              Pacific walrus  =======
B D                       Dog  =======
B D                       Cat  =======
B D                  Microbat  =======
B D                  Bushbaby  -------
               Big brown bat  =======
B D            Naked mole-rat  =======
                Killer whale  =======
              Bactrian camel  =======
B D                     Panda  =======
            Black flying-fox  =======
B D                   Ferret   =======
            Cape golden mole  =======
B D                   Dolphin  =======
                Weddell seal  =======
                    Aardvark  =======
B D                Coelacanth  =======
B D                    Turkey  =======
                 Spotted gar  =======
  D              Mallard duck  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
B D                   Wallaby  =======
B D                    Lizard  =======
    Mexican tetra (cavefish)  =======
  D          Peregrine falcon  =======
B D                 Zebrafish  =======
  D               Rock pigeon  =======
  D            Painted turtle  =======
B D                   Chicken  =======
B D                  Platypus  =======
  D       Collared flycatcher  =======
  D  Chinese softshell turtle  =======
B D               Zebra finch  =======
  D              Saker falcon  =======
B D             X. tropicalis  =======
  D           Green seaturtle  =======
B D       Medium ground finch  =======
B D        American alligator  =======
  D    White-throated sparrow  =======
          Tibetan ground jay  =======
B D                   Megabat  =======
B D                       Pig  =======
B D           Tasmanian devil  =======

Inserts between block 22 and 23 in window
B D                Armadillo 154bp

Alignment block 23 of 94 in window, 57696445 - 57696448, 4 bps 
B D                     Human  tttt-----
B D                     Chimp  gttt-----
B D                   Gorilla  gttt-----
B D                 Orangutan  gttt-----
B D                    Gibbon  gttt-----
B D                    Rhesus  gttt-----
B D       Crab-eating macaque  gttt-----
B D                    Baboon  gttt-----
B D              Green monkey  gttt-----
B D                  Marmoset  gttt-----
B D           Squirrel monkey  gttt-----
           Chinese tree shrew  cttt-----
B D                  Squirrel  -tttttttt
B D                    Tenrec  =========
B D                Guinea pig  =========
B D                       Rat  =========
B D                     Mouse  =========
              Golden hamster  =========
B D           Chinese hamster  =========
                Prairie vole  =========
B D                  Elephant  =========
            Tibetan antelope  =========
         Cape elephant shrew  =========
B D                     Shrew  =========
        David's myotis (bat)  =========
B D                     Horse  =========
               Domestic goat  =========
B D                     Sheep  =========
B D                       Cow  =========
B D                    Alpaca  =========
             Star-nosed mole  =========
B D                      Pika  =========
B D                    Rabbit  =========
B D                 Armadillo  =========
B D                   Manatee  =========
                  Chinchilla  =========
      Lesser Egyptian jerboa  ---------
B D          White rhinoceros  =========
            Brush-tailed rat  =========
              Pacific walrus  =========
B D                       Dog  =========
B D                       Cat  =========
B D                  Microbat  =========
B D                  Bushbaby  ---------
               Big brown bat  =========
B D            Naked mole-rat  =========
                Killer whale  =========
              Bactrian camel  =========
B D                     Panda  =========
            Black flying-fox  =========
B D                   Ferret   =========
            Cape golden mole  =========
B D                   Dolphin  =========
                Weddell seal  =========
                    Aardvark  =========
B D                Coelacanth  =========
B D                    Turkey  =========
                 Spotted gar  =========
  D              Mallard duck  =========
  D             Scarlet macaw  =========
B D                Budgerigar  =========
B D                   Wallaby  =========
B D                    Lizard  =========
    Mexican tetra (cavefish)  =========
  D          Peregrine falcon  =========
B D                 Zebrafish  =========
  D               Rock pigeon  =========
  D            Painted turtle  =========
B D                   Chicken  =========
B D                  Platypus  =========
  D       Collared flycatcher  =========
  D  Chinese softshell turtle  =========
B D               Zebra finch  =========
  D              Saker falcon  =========
B D             X. tropicalis  =========
  D           Green seaturtle  =========
B D       Medium ground finch  =========
B D        American alligator  =========
  D    White-throated sparrow  =========
          Tibetan ground jay  =========
B D                   Megabat  =========
B D                       Pig  =========
B D           Tasmanian devil  =========

Inserts between block 23 and 24 in window
          Chinese tree shrew 308bp

Alignment block 24 of 94 in window, 57696449 - 57696478, 30 bps 
B D                     Human  tagaattagagctgggctcagtggttcatg
B D                     Chimp  tagaattagagctgggctcagtggttcatg
B D                   Gorilla  tagaattagagctgggctcagtggttcatg
B D                 Orangutan  cagaattagggctgggcccagtggttcatg
B D                    Gibbon  tagaattagggctgggctcagtggttcatg
B D                    Rhesus  tagaattagggatgggctcagtgattcatg
B D       Crab-eating macaque  tagaattagggatgggctcagtgattcatg
B D                    Baboon  tagaattagggatgggctcagtgattcatg
B D              Green monkey  tagaattagggctgggctcagtgattcatg
B D                  Marmoset  tggaatttgggctgggctcagtggctcatg
B D           Squirrel monkey  tggagtttgggctgggctcagtggctcatg
B D                  Squirrel  tgtaccaaggattggacccaggggtgctta
       Lesser Egyptian jerboa  ---------agccgggtgtggtggcgcacg
B D                    Tenrec  ==============================
B D                Guinea pig  ==============================
B D                       Rat  ==============================
B D                     Mouse  ==============================
              Golden hamster  ==============================
B D           Chinese hamster  ==============================
                Prairie vole  ==============================
B D                  Elephant  ==============================
            Tibetan antelope  ==============================
         Cape elephant shrew  ==============================
B D                     Shrew  ==============================
        David's myotis (bat)  ==============================
B D                     Horse  ==============================
               Domestic goat  ==============================
B D                     Sheep  ==============================
B D                       Cow  ==============================
B D                    Alpaca  ==============================
             Star-nosed mole  ==============================
B D                      Pika  ==============================
B D                    Rabbit  ==============================
B D                 Armadillo  ==============================
B D                   Manatee  ==============================
                  Chinchilla  ==============================
B D          White rhinoceros  ==============================
            Brush-tailed rat  ==============================
          Chinese tree shrew  ==============================
              Pacific walrus  ==============================
B D                       Dog  ==============================
B D                       Cat  ==============================
B D                  Microbat  ==============================
B D                  Bushbaby  ------------------------------
               Big brown bat  ==============================
B D            Naked mole-rat  ==============================
                Killer whale  ==============================
              Bactrian camel  ==============================
B D                     Panda  ==============================
            Black flying-fox  ==============================
B D                   Ferret   ==============================
            Cape golden mole  ==============================
B D                   Dolphin  ==============================
                Weddell seal  ==============================
                    Aardvark  ==============================
B D                Coelacanth  ==============================
B D                    Turkey  ==============================
                 Spotted gar  ==============================
  D              Mallard duck  ==============================
  D             Scarlet macaw  ==============================
B D                Budgerigar  ==============================
B D                   Wallaby  ==============================
B D                    Lizard  ==============================
    Mexican tetra (cavefish)  ==============================
  D          Peregrine falcon  ==============================
B D                 Zebrafish  ==============================
  D               Rock pigeon  ==============================
  D            Painted turtle  ==============================
B D                   Chicken  ==============================
B D                  Platypus  ==============================
  D       Collared flycatcher  ==============================
  D  Chinese softshell turtle  ==============================
B D               Zebra finch  ==============================
  D              Saker falcon  ==============================
B D             X. tropicalis  ==============================
  D           Green seaturtle  ==============================
B D       Medium ground finch  ==============================
B D        American alligator  ==============================
  D    White-throated sparrow  ==============================
          Tibetan ground jay  ==============================
B D                   Megabat  ==============================
B D                       Pig  ==============================
B D           Tasmanian devil  ==============================

Inserts between block 24 and 25 in window
B D                 Squirrel 97bp

Alignment block 25 of 94 in window, 57696479 - 57696553, 75 bps 
B D                     Human  ctagcaatcccaatgttttgggaggccaaggcaggaggatctcttgaggagttccaggctgcctggggaa
B D                     Chimp  ctagcaatcccaatgttttgggatgccaaggcaggaggatcgcttgaggagttccaggctgcctggggaa
B D                   Gorilla  ctagcaatcccaatgttttgggacgccaaggcaggaggatcgcttgaggagttccaggctgcctggggaa
B D                 Orangutan  ctagcaatcccaatgttttgggaggccaaggcaggaggatcgcttgaggagttccaggctgcctgggcaa
B D                    Gibbon  ctagcagtcccagtgttttgggaggccaaggcaggaggatcgcttgaggagttccaggctgcctgggcaa
B D                    Rhesus  ctagtaattccaatgttttgggaggccaaggcaggaggatcgcttgaggagttccaggctgcctggacaa
B D       Crab-eating macaque  ctagtaattccaatgttttgggaggccaaggcaggaggatcgcttgaggagttccaggctgcctgggcaa
B D                    Baboon  ctagtaattccaatgttttgggaggccaaggcaggaggatcgcttgaggagttccaggctgcctgggcaa
B D              Green monkey  ctagtaattccaatgttttgggaggccaaggcaggaggatcgcttgaggagttccaggctgcctgggcaa
B D                  Marmoset  ctagtaatcccaatgtttggggaggccaaggcaggc-gattgcttgaggagttccagactgcctgggcaa
B D           Squirrel monkey  ctagtaatcctaatgtttggggaggccaaggcaggc-gattgcttgaggagttccagaccgcctggacaa
       Lesser Egyptian jerboa  cctttaatcccagcactc-gggaggcagaggtaggaggatcact--gtgagctcaaggccaccctgagac
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
B D                  Elephant  ======================================================================
            Tibetan antelope  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
        David's myotis (bat)  ======================================================================
B D                     Horse  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
B D                    Alpaca  ======================================================================
             Star-nosed mole  ======================================================================
B D                  Squirrel  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
                  Chinchilla  ======================================================================
B D          White rhinoceros  ======================================================================
            Brush-tailed rat  ======================================================================
          Chinese tree shrew  ======================================================================
              Pacific walrus  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
B D                  Microbat  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------
               Big brown bat  ======================================================================
B D            Naked mole-rat  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D                     Panda  ======================================================================
            Black flying-fox  ======================================================================
B D                   Ferret   ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
                Weddell seal  ======================================================================
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  catag
                        Chimp  catag
                      Gorilla  catag
                    Orangutan  cattg
                       Gibbon  catag
                       Rhesus  catag
          Crab-eating macaque  catag
                       Baboon  catag
                 Green monkey  catag
                     Marmoset  catag
              Squirrel monkey  cacag
       Lesser Egyptian jerboa  tacag
                       Tenrec  =====
                   Guinea pig  =====
                          Rat  =====
                        Mouse  =====
               Golden hamster  =====
              Chinese hamster  =====
                 Prairie vole  =====
                     Elephant  =====
             Tibetan antelope  =====
          Cape elephant shrew  =====
                        Shrew  =====
         David's myotis (bat)  =====
                        Horse  =====
                Domestic goat  =====
                        Sheep  =====
                          Cow  =====
                       Alpaca  =====
              Star-nosed mole  =====
                     Squirrel  =====
                         Pika  =====
                       Rabbit  =====
                    Armadillo  =====
                      Manatee  =====
                   Chinchilla  =====
             White rhinoceros  =====
             Brush-tailed rat  =====
           Chinese tree shrew  =====
               Pacific walrus  =====
                          Dog  =====
                          Cat  =====
                     Microbat  =====
                     Bushbaby  -----
                Big brown bat  =====
               Naked mole-rat  =====
                 Killer whale  =====
               Bactrian camel  =====
                        Panda  =====
             Black flying-fox  =====
                      Ferret   =====
             Cape golden mole  =====
                      Dolphin  =====
                 Weddell seal  =====
                     Aardvark  =====
                   Coelacanth  =====
                       Turkey  =====
                  Spotted gar  =====
                 Mallard duck  =====
                Scarlet macaw  =====
                   Budgerigar  =====
                      Wallaby  =====
                       Lizard  =====
     Mexican tetra (cavefish)  =====
             Peregrine falcon  =====
                    Zebrafish  =====
                  Rock pigeon  =====
               Painted turtle  =====
                      Chicken  =====
                     Platypus  =====
          Collared flycatcher  =====
     Chinese softshell turtle  =====
                  Zebra finch  =====
                 Saker falcon  =====
                X. tropicalis  =====
              Green seaturtle  =====
          Medium ground finch  =====
           American alligator  =====
       White-throated sparrow  =====
           Tibetan ground jay  =====
                      Megabat  =====
                          Pig  =====
              Tasmanian devil  =====

Inserts between block 25 and 26 in window
      Lesser Egyptian jerboa 1169bp

Alignment block 26 of 94 in window, 57696554 - 57696605, 52 bps 
B D                     Human  caagacccctatctctacaaaaaaattaaaaattaatcaggcatgccagcag
B D                     Chimp  caagacccctatctctacaaaaaaattaaaaattaatcaggcatgccagcag
B D                   Gorilla  caagacccctatctctacaaaaaaattaaaaattaatcaggcatgccagcag
B D                 Orangutan  caagacccctatctctacaagaaaattaaaaattaatcaggcatgccagcag
B D                    Gibbon  caagacccc-atctctacaaaaaaattaaaaattaatcaggcatgccagcag
B D                    Rhesus  caagacccctatctctacaaaaaaattaaaaattaaccaggcatgcaagcag
B D       Crab-eating macaque  caagacccctatctctacaaaaaaattaaaaattaaccaggcatgcaagcag
B D                    Baboon  caagacccctatctctacaaaaaaattaaaaattaaccaggcatgcaggcag
B D              Green monkey  caagacccctatctctacaaaaaaattaaaaattaaccaggcatgcaagcag
B D                  Marmoset  caagacccctctctctacaaaagagttaaaaattaaccaggcatgctggcat
B D           Squirrel monkey  caagacccctgtctctacaaaagagttaaaagttaaccaggcatgctggcat
B D                    Tenrec  ====================================================
B D                Guinea pig  ====================================================
B D                       Rat  ====================================================
B D                     Mouse  ====================================================
              Golden hamster  ====================================================
B D           Chinese hamster  ====================================================
                Prairie vole  ====================================================
B D                  Elephant  ====================================================
            Tibetan antelope  ====================================================
         Cape elephant shrew  ====================================================
B D                     Shrew  ====================================================
        David's myotis (bat)  ====================================================
B D                     Horse  ====================================================
               Domestic goat  ====================================================
B D                     Sheep  ====================================================
B D                       Cow  ====================================================
B D                    Alpaca  ====================================================
             Star-nosed mole  ====================================================
B D                  Squirrel  ====================================================
B D                      Pika  ====================================================
B D                    Rabbit  ====================================================
B D                 Armadillo  ====================================================
B D                   Manatee  ====================================================
                  Chinchilla  ====================================================
      Lesser Egyptian jerboa  ====================================================
B D          White rhinoceros  ====================================================
            Brush-tailed rat  ====================================================
          Chinese tree shrew  ====================================================
              Pacific walrus  ====================================================
B D                       Dog  ====================================================
B D                       Cat  ====================================================
B D                  Microbat  ====================================================
B D                  Bushbaby  ----------------------------------------------------
               Big brown bat  ====================================================
B D            Naked mole-rat  ====================================================
                Killer whale  ====================================================
              Bactrian camel  ====================================================
B D                     Panda  ====================================================
            Black flying-fox  ====================================================
B D                   Ferret   ====================================================
            Cape golden mole  ====================================================
B D                   Dolphin  ====================================================
                Weddell seal  ====================================================
                    Aardvark  ====================================================
B D                Coelacanth  ====================================================
B D                    Turkey  ====================================================
                 Spotted gar  ====================================================
  D              Mallard duck  ====================================================
  D             Scarlet macaw  ====================================================
B D                Budgerigar  ====================================================
B D                   Wallaby  ====================================================
B D                    Lizard  ====================================================
    Mexican tetra (cavefish)  ====================================================
  D          Peregrine falcon  ====================================================
B D                 Zebrafish  ====================================================
  D               Rock pigeon  ====================================================
  D            Painted turtle  ====================================================
B D                   Chicken  ====================================================
B D                  Platypus  ====================================================
  D       Collared flycatcher  ====================================================
  D  Chinese softshell turtle  ====================================================
B D               Zebra finch  ====================================================
  D              Saker falcon  ====================================================
B D             X. tropicalis  ====================================================
  D           Green seaturtle  ====================================================
B D       Medium ground finch  ====================================================
B D        American alligator  ====================================================
  D    White-throated sparrow  ====================================================
          Tibetan ground jay  ====================================================
B D                   Megabat  ====================================================
B D                       Pig  ====================================================
B D           Tasmanian devil  ====================================================

Alignment block 27 of 94 in window, 57696606 - 57696731, 126 bps 
B D                     Human  gtgcctgtaattccagctgcttgggaggctgaggcaagaggatcacttgagcccaggagttcaaggctgc
B D                     Chimp  gtgcctgtaattccagctacttgggaggctgaggcaagaggatcacttgagcccaggagttcaaggctgc
B D                   Gorilla  gtgcctgtaattccagctacttgggaggctgaggcaagaggatcacttgagcccaggagttcaaggctgc
B D                 Orangutan  gtgcctgtaattccagctacttgggaggctgaggcaagaggatcacttgagcccaggagttcaaggctgc
B D                    Gibbon  gtgcctgtaattccagctacttgggaggctgaggcaagaggatcacttgagcccaggagttcaaggctgc
B D                    Rhesus  gtgcctgtagttccagctacttgggaggctgaggcaagaggatcacttgagcccaggagttcaaggctgc
B D       Crab-eating macaque  gtgcctgtagttccagctacttgggaggctgaggcaagaggatcacttgagcccaggagttcaaggctgc
B D                    Baboon  gtgcctgtagttccagctacttgggaggctgaggcaagaggatcacttgagcccaggagttcaaggctgc
B D              Green monkey  gtgcctgtagttccagctacttgggaggctgaggcaagaggatcacttgagcccaggagttcaaggctgc
B D                  Marmoset  gtgcctgtagttccagctacttgggagggtgaggcaagagggtcacttgagcccaggagttcaaggctgt
B D           Squirrel monkey  gtgcctgtagttccagctacttgggagggtgaggcaagagggtcacttgagcccaggagttgaaggctgt
B D                  Squirrel  gaacttgcaattctcctaccttagcatcctgagtcactgggat---------------------------
B D                    Tenrec  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
B D                  Elephant  ======================================================================
            Tibetan antelope  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
        David's myotis (bat)  ======================================================================
B D                     Horse  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
B D                    Alpaca  ======================================================================
             Star-nosed mole  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
                  Chinchilla  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D          White rhinoceros  ======================================================================
            Brush-tailed rat  ======================================================================
          Chinese tree shrew  ======================================================================
              Pacific walrus  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
B D                  Microbat  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------
               Big brown bat  ======================================================================
B D            Naked mole-rat  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D                     Panda  ======================================================================
            Black flying-fox  ======================================================================
B D                   Ferret   ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ======================================================================
                Weddell seal  ======================================================================
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Chicken  ======================================================================
B D                  Platypus  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D       Medium ground finch  ======================================================================
B D        American alligator  ======================================================================
  D    White-throated sparrow  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  agtgagctacaatg-gcaccactgcactgcagcctgggccacagagcaagaccttat
                        Chimp  agtgagctacaatg-gcaccactgcactgcagcctgggccacagagcaagaccttat
                      Gorilla  agtgagttacaatg-gcaccactgcactgcagcctgggccacagagcaagacgttat
                    Orangutan  agtgagctacaatg-gtgccactgcactgcagcctgggccacagagcaagaccttat
                       Gibbon  ggtgagctacaatg-gcgccactgcactgcagcctgggccacaaagcaagaccttat
                       Rhesus  ggtgacctacaacg-acaccactgcactgcagcctgggccacagagcaagaccttat
          Crab-eating macaque  ggtgagctacaatg-gcaccactgcactgcagcctgggccacagagcaagaccttat
                       Baboon  ggtgagctacaatg-gcgccactgcactgcagcctgggccacagagcaagaccttat
                 Green monkey  ggtgagctacaatg-gcgccactgcactgcagcctgggccacagagcaagaccttat
                     Marmoset  gatgagctaccatg-gcgcccctgcactgcagctggggc--cagagcaagaccttat
              Squirrel monkey  agtgagctaccatg-gcacccctgcactgcagccggggc--cagagcaagaccttat
                     Squirrel  -------tacaacatgcaccaccacacc---------------cagcaaga------
                       Tenrec  =========================================================
                   Guinea pig  =========================================================
                          Rat  =========================================================
                        Mouse  =========================================================
               Golden hamster  =========================================================
              Chinese hamster  =========================================================
                 Prairie vole  =========================================================
                     Elephant  =========================================================
             Tibetan antelope  =========================================================
          Cape elephant shrew  =========================================================
                        Shrew  =========================================================
         David's myotis (bat)  =========================================================
                        Horse  =========================================================
                Domestic goat  =========================================================
                        Sheep  =========================================================
                          Cow  =========================================================
                       Alpaca  =========================================================
              Star-nosed mole  =========================================================
                         Pika  =========================================================
                       Rabbit  =========================================================
                    Armadillo  =========================================================
                      Manatee  =========================================================
                   Chinchilla  =========================================================
       Lesser Egyptian jerboa  =========================================================
             White rhinoceros  =========================================================
             Brush-tailed rat  =========================================================
           Chinese tree shrew  =========================================================
               Pacific walrus  =========================================================
                          Dog  =========================================================
                          Cat  =========================================================
                     Microbat  =========================================================
                     Bushbaby  ---------------------------------------------------------
                Big brown bat  =========================================================
               Naked mole-rat  =========================================================
                 Killer whale  =========================================================
               Bactrian camel  =========================================================
                        Panda  =========================================================
             Black flying-fox  =========================================================
                      Ferret   =========================================================
             Cape golden mole  =========================================================
                      Dolphin  =========================================================
                 Weddell seal  =========================================================
                     Aardvark  =========================================================
                   Coelacanth  =========================================================
                       Turkey  =========================================================
                  Spotted gar  =========================================================
                 Mallard duck  =========================================================
                Scarlet macaw  =========================================================
                   Budgerigar  =========================================================
                      Wallaby  =========================================================
                       Lizard  =========================================================
     Mexican tetra (cavefish)  =========================================================
             Peregrine falcon  =========================================================
                    Zebrafish  =========================================================
                  Rock pigeon  =========================================================
               Painted turtle  =========================================================
                      Chicken  =========================================================
                     Platypus  =========================================================
          Collared flycatcher  =========================================================
     Chinese softshell turtle  =========================================================
                  Zebra finch  =========================================================
                 Saker falcon  =========================================================
                X. tropicalis  =========================================================
              Green seaturtle  =========================================================
          Medium ground finch  =========================================================
           American alligator  =========================================================
       White-throated sparrow  =========================================================
           Tibetan ground jay  =========================================================
                      Megabat  =========================================================
                          Pig  =========================================================
              Tasmanian devil  =========================================================

Alignment block 28 of 94 in window, 57696732 - 57696740, 9 bps 
B D                     Human  ctctaaaaa
B D                     Chimp  ctctaaaaa
B D                   Gorilla  ctctaaaaa
B D                 Orangutan  ctctaaaaa
B D                    Gibbon  ctctaaaaa
B D                    Rhesus  ctctaaaaa
B D       Crab-eating macaque  ctctaaaaa
B D                    Baboon  ctctaaaaa
B D              Green monkey  ctctaaaaa
B D                  Marmoset  ctct-aaaa
B D           Squirrel monkey  ctctaaaaa
          Cape elephant shrew  cttcagatt
B D                    Tenrec  =========
B D                Guinea pig  =========
B D                       Rat  =========
B D                     Mouse  =========
              Golden hamster  =========
B D           Chinese hamster  =========
                Prairie vole  =========
B D                  Elephant  =========
            Tibetan antelope  =========
B D                     Shrew  =========
        David's myotis (bat)  =========
B D                     Horse  =========
               Domestic goat  =========
B D                     Sheep  =========
B D                       Cow  =========
B D                    Alpaca  =========
             Star-nosed mole  =========
B D                  Squirrel  ---------
B D                      Pika  =========
B D                    Rabbit  =========
B D                 Armadillo  =========
B D                   Manatee  =========
                  Chinchilla  =========
      Lesser Egyptian jerboa  =========
B D          White rhinoceros  =========
            Brush-tailed rat  =========
          Chinese tree shrew  =========
              Pacific walrus  =========
B D                       Dog  =========
B D                       Cat  =========
B D                  Microbat  =========
B D                  Bushbaby  ---------
               Big brown bat  =========
B D            Naked mole-rat  =========
                Killer whale  =========
              Bactrian camel  =========
B D                     Panda  =========
            Black flying-fox  =========
B D                   Ferret   =========
            Cape golden mole  =========
B D                   Dolphin  =========
                Weddell seal  =========
                    Aardvark  =========
B D                Coelacanth  =========
B D                    Turkey  =========
                 Spotted gar  =========
  D              Mallard duck  =========
  D             Scarlet macaw  =========
B D                Budgerigar  =========
B D                   Wallaby  =========
B D                    Lizard  =========
    Mexican tetra (cavefish)  =========
  D          Peregrine falcon  =========
B D                 Zebrafish  =========
  D               Rock pigeon  =========
  D            Painted turtle  =========
B D                   Chicken  =========
B D                  Platypus  =========
  D       Collared flycatcher  =========
  D  Chinese softshell turtle  =========
B D               Zebra finch  =========
  D              Saker falcon  =========
B D             X. tropicalis  =========
  D           Green seaturtle  =========
B D       Medium ground finch  =========
B D        American alligator  =========
  D    White-throated sparrow  =========
          Tibetan ground jay  =========
B D                   Megabat  =========
B D                       Pig  =========
B D           Tasmanian devil  =========

Alignment block 29 of 94 in window, 57696741 - 57696742, 2 bps 
B D                     Human  at
B D                     Chimp  at
B D                   Gorilla  at
B D                 Orangutan  at
B D                    Gibbon  ct
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  ac
B D              Green monkey  ac
B D                  Marmoset  gt
B D           Squirrel monkey  at
           Chinese tree shrew  at
B D                  Squirrel  tt
          Cape elephant shrew  ag
B D                    Tenrec  ==
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  ==
B D           Chinese hamster  ==
                Prairie vole  ==
B D                  Elephant  ==
            Tibetan antelope  ==
B D                     Shrew  ==
        David's myotis (bat)  ==
B D                     Horse  ==
               Domestic goat  ==
B D                     Sheep  ==
B D                       Cow  ==
B D                    Alpaca  ==
             Star-nosed mole  ==
B D                      Pika  ==
B D                    Rabbit  ==
B D                 Armadillo  ==
B D                   Manatee  ==
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
B D          White rhinoceros  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
B D                       Dog  ==
B D                       Cat  ==
B D                  Microbat  ==
B D                  Bushbaby  --
               Big brown bat  ==
B