Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 280 in window, 48941898 - 48942004, 107 bps 
B D                     Human  ccaggctggtctcaaattcctgacctcaaacagtcca-tctgtctcagcctcccaaagtgctgggattac
B D                     Chimp  ccagactggtctcgaattcctgacctcaaacagtcca-tctgtctcaccctcccaaagtgctgggattac
B D                   Gorilla  ccaggctggtctcgaattcctgacctcaaacagtcca-tctgtctcagcctcccaaagtgctgggattac
B D                 Orangutan  ccaggctggtctcgaattcctgacctcaaacagtcca-tctgtctcagcctcccaaagtgctgggattac
B D                    Gibbon  ccaggctggtctcgaattcctgacctcaaacagtcca-tccgtctcagcctcccaaagtgctgggattac
B D                    Rhesus  ccaggctggtctcgaattcctgacttcaagcaatcca-tcagcctcagcctcccaaagtggtgggattac
B D       Crab-eating macaque  ccaggctggtctcgaattcctgacttcaagcaatcca-tcagcctcagcctcccaaagtggtgggattac
B D                    Baboon  ccaggctggtctcgaattcctgacttcaagcaatcca-tctgcctcagcctcccaaagtgctgggattac
B D              Green monkey  ccaggctggcctcgaattcctgacctcaagcaatcca-tctgcctcagcctcccaaagtgctgggattac
B D                  Marmoset  ccaggatggtctcgaattcctgacctcaagcaattta-tctacctcgacctctcaaagtgctgggattac
B D            Naked mole-rat  -------------ggatgcct--------acactccactctgtcttgg-------aagtgagggaa----
B D                    Tenrec  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
B D                  Elephant  ======================================================================
            Tibetan antelope  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Shrew  ======================================================================
        David's myotis (bat)  ======================================================================
B D                     Horse  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
B D                    Alpaca  ======================================================================
             Star-nosed mole  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ----------------------------------------------------------------------
B D                 Armadillo  ======================================================================
B D                   Manatee  ----------------------------------------------------------------------
                  Chinchilla  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D          White rhinoceros  ======================================================================
            Brush-tailed rat  ======================================================================
          Chinese tree shrew  ======================================================================
              Pacific walrus  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
B D                  Microbat  ======================================================================
B D                  Bushbaby  ======================================================================
               Big brown bat  ======================================================================
                Killer whale  ----------------------------------------------------------------------
              Bactrian camel  ======================================================================
B D                     Panda  ======================================================================
            Black flying-fox  ======================================================================
B D                   Ferret   ======================================================================
            Cape golden mole  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
                Weddell seal  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
                    Aardvark  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                    Medaka  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Lamprey  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  agatgtgagccaccgcacagggccaatcaat--------caatcaa
                        Chimp  agatgtgagccaccgcacagggccaatcaat--------caatcaa
                      Gorilla  agatgtgagccaccacacagggccaatcaat--------caatcaa
                    Orangutan  agatgtgagccaccgcacagggccaatcaat--------caatcaa
                       Gibbon  agatgtaagccaccgcacagggccaatcaat--------caaccaa
                       Rhesus  agatgtgagccaccgcgcagggtcaatcaatcaatcaaccaaccaa
          Crab-eating macaque  agatgtgagccaccgcgcagggtcaatcaatcaatcaaccaaccaa
                       Baboon  agatgtaagccaccgcgcagggtcaatcaatcaat----caaccaa
                 Green monkey  agatgtgagccaccacgcagggtcaatcaat--------caaccaa
                     Marmoset  ggatgttagccatcaggcagggccaatcaat--------caatcaa
               Naked mole-rat  ---------------agcagtggttatttac--------cactcca
                       Tenrec  ==============================================
                     Hedgehog  ==============================================
                   Guinea pig  ==============================================
                          Rat  ==============================================
                        Mouse  ==============================================
               Golden hamster  ==============================================
              Chinese hamster  ==============================================
                 Prairie vole  ==============================================
                     Elephant  ==============================================
             Tibetan antelope  ==============================================
          Cape elephant shrew  ==============================================
                        Shrew  ==============================================
         David's myotis (bat)  ==============================================
                        Horse  ==============================================
                Domestic goat  ==============================================
                        Sheep  ==============================================
                          Cow  ==============================================
                       Alpaca  ==============================================
              Star-nosed mole  ----------------------------------------------
                     Squirrel  ==============================================
                         Pika  ==============================================
                       Rabbit  ----------------------------------------------
                    Armadillo  ==============================================
                      Manatee  ----------------------------------------------
                   Chinchilla  ==============================================
       Lesser Egyptian jerboa  ==============================================
             White rhinoceros  ==============================================
             Brush-tailed rat  ==============================================
           Chinese tree shrew  ==============================================
               Pacific walrus  ==============================================
                          Dog  ==============================================
                          Cat  ==============================================
                     Microbat  ==============================================
                     Bushbaby  ==============================================
                Big brown bat  ==============================================
                 Killer whale  ----------------------------------------------
               Bactrian camel  ==============================================
                        Panda  ==============================================
             Black flying-fox  ==============================================
                      Ferret   ==============================================
             Cape golden mole  ==============================================
                      Dolphin  ----------------------------------------------
                 Weddell seal  ==============================================
       Yellowbelly pufferfish  ==============================================
                         Fugu  ==============================================
                     Aardvark  ==============================================
                  Stickleback  ==============================================
          Pundamilia nyererei  ==============================================
                  Zebra mbuna  ==============================================
        Burton's mouthbreeder  ==============================================
          Princess of Burundi  ==============================================
                       Medaka  ==============================================
                   Coelacanth  ==============================================
                       Turkey  ==============================================
                  Spotted gar  ==============================================
                 Mallard duck  ==============================================
                Scarlet macaw  ==============================================
                       Parrot  ==============================================
                   Budgerigar  ==============================================
                      Wallaby  ==============================================
                       Lizard  ==============================================
           Southern platyfish  ==============================================
     Mexican tetra (cavefish)  ==============================================
             Peregrine falcon  ==============================================
                    Zebrafish  ==============================================
                  Rock pigeon  ==============================================
                      Lamprey  ==============================================
                 Nile tilapia  ==============================================
               Painted turtle  ==============================================
                    Tetraodon  ==============================================
                      Chicken  ==============================================
                 Atlantic cod  ==============================================
          Collared flycatcher  ==============================================
     Chinese softshell turtle  ==============================================
              Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Saker falcon  ==============================================
                X. tropicalis  ==============================================
              Green seaturtle  ==============================================
                      Opossum  ==============================================
           American alligator  ==============================================
           Tibetan ground jay  ==============================================
                      Megabat  ==============================================
                          Pig  ==============================================
              Tasmanian devil  ==============================================

Alignment block 2 of 280 in window, 48942005 - 48942028, 24 bps 
B D                     Human  ccaatataaatt----aaa---aaaacaa------------aa---
B D                     Chimp  ccaatataaatttaaaaaa---caaacaa------------aa---
B D                   Gorilla  ccaatataaatttaaaaaa---caaacaa------------aa---
B D                 Orangutan  ccaatataaatttaaaaaaaacaaaacaa------------aa---
B D                    Gibbon  acaatataaattaaaaaaa---aaaaaaaaaaaaaaacaacaa---
B D                    Rhesus  ccaatataaatt----------taaaaaa------------aa---
B D       Crab-eating macaque  ccaatataaatt----------aaaaaaa------------aa---
B D                    Baboon  ccaatataaatt----------taaaaaa------------aa---
B D              Green monkey  ccaatataaatt------a---aaaaaaa------------aa---
B D                  Marmoset  tc----taaatt----------tctaaaa------------aa---
B D            Naked mole-rat  c---------------------------------------------
B D                   Manatee  ctggtatgaatt----------aagagtg------------cagtg
B D                    Tenrec  ==============================================
B D                  Hedgehog  ==============================================
B D                Guinea pig  ==============================================
B D                       Rat  ==============================================
B D                     Mouse  ==============================================
              Golden hamster  ==============================================
B D           Chinese hamster  ==============================================
                Prairie vole  ==============================================
B D                  Elephant  ==============================================
            Tibetan antelope  ==============================================
         Cape elephant shrew  ==============================================
B D                     Shrew  ==============================================
        David's myotis (bat)  ==============================================
B D                     Horse  ==============================================
               Domestic goat  ==============================================
B D                     Sheep  ==============================================
B D                       Cow  ==============================================
B D                    Alpaca  ==============================================
             Star-nosed mole  ----------------------------------------------
B D                  Squirrel  ==============================================
B D                      Pika  ==============================================
B D                    Rabbit  ----------------------------------------------
B D                 Armadillo  ==============================================
                  Chinchilla  ==============================================
      Lesser Egyptian jerboa  ==============================================
B D          White rhinoceros  ==============================================
            Brush-tailed rat  ==============================================
          Chinese tree shrew  ==============================================
              Pacific walrus  ==============================================
B D                       Dog  ==============================================
B D                       Cat  ==============================================
B D                  Microbat  ==============================================
B D                  Bushbaby  ==============================================
               Big brown bat  ==============================================
                Killer whale  ----------------------------------------------
              Bactrian camel  ==============================================
B D                     Panda  ==============================================
            Black flying-fox  ==============================================
B D                   Ferret   ==============================================
            Cape golden mole  ==============================================
B D                   Dolphin  ----------------------------------------------
                Weddell seal  ==============================================
      Yellowbelly pufferfish  ==============================================
B D                      Fugu  ==============================================
                    Aardvark  ==============================================
B D               Stickleback  ==============================================
         Pundamilia nyererei  ==============================================
                 Zebra mbuna  ==============================================
       Burton's mouthbreeder  ==============================================
         Princess of Burundi  ==============================================
B D                    Medaka  ==============================================
B D                Coelacanth  ==============================================
B D                    Turkey  ==============================================
                 Spotted gar  ==============================================
  D              Mallard duck  ==============================================
  D             Scarlet macaw  ==============================================
  D                    Parrot  ==============================================
B D                Budgerigar  ==============================================
B D                   Wallaby  ==============================================
B D                    Lizard  ==============================================
          Southern platyfish  ==============================================
    Mexican tetra (cavefish)  ==============================================
  D          Peregrine falcon  ==============================================
B D                 Zebrafish  ==============================================
  D               Rock pigeon  ==============================================
B D                   Lamprey  ==============================================
B D              Nile tilapia  ==============================================
  D            Painted turtle  ==============================================
B D                 Tetraodon  ==============================================
B D                   Chicken  ==============================================
B D              Atlantic cod  ==============================================
  D       Collared flycatcher  ==============================================
  D  Chinese softshell turtle  ==============================================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  ==============================================
B D             X. tropicalis  ==============================================
  D           Green seaturtle  ==============================================
B D                   Opossum  ==============================================
B D        American alligator  ==============================================
          Tibetan ground jay  ==============================================
B D                   Megabat  ==============================================
B D                       Pig  ==============================================
B D           Tasmanian devil  ==============================================

Inserts between block 2 and 3 in window
B D                  Manatee 7bp

Alignment block 3 of 280 in window, 48942029 - 48942029, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Chinese hamster  a
               Golden hamster  a
B D                    Alpaca  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D          White rhinoceros  a
B D                       Cat  a
B D                     Panda  a
B D                  Elephant  a
B D                   Manatee  a
                     Aardvark  a
B D                 Armadillo  a
B D                    Tenrec  =
B D                  Hedgehog  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
                Prairie vole  =
         Cape elephant shrew  =
B D                     Shrew  =
        David's myotis (bat)  =
B D                     Horse  =
             Star-nosed mole  -
B D                  Squirrel  =
B D                      Pika  =
B D                    Rabbit  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
          Chinese tree shrew  =
              Pacific walrus  =
B D                       Dog  =
B D                  Microbat  =
B D                  Bushbaby  =
               Big brown bat  =
B D            Naked mole-rat  -
                Killer whale  -
              Bactrian camel  =
            Black flying-fox  =
B D                   Ferret   =
            Cape golden mole  =
B D                   Dolphin  -
                Weddell seal  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  N
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D                   Opossum  =
B D        American alligator  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  =
B D           Tasmanian devil  =

Alignment block 4 of 280 in window, 48942030 - 48942030, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  c
B D           Chinese hamster  a
               Golden hamster  a
B D                    Alpaca  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                     Panda  a
B D                  Elephant  a
B D                   Manatee  a
                     Aardvark  a
B D                 Armadillo  a
B D                    Tenrec  =
B D                  Hedgehog  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
                Prairie vole  =
         Cape elephant shrew  =
B D                     Shrew  =
        David's myotis (bat)  =
             Star-nosed mole  -
B D                  Squirrel  =
B D                      Pika  =
B D                    Rabbit  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
          Chinese tree shrew  =
              Pacific walrus  =
B D                       Dog  =
B D                  Microbat  =
B D                  Bushbaby  =
               Big brown bat  =
B D            Naked mole-rat  -
                Killer whale  -
              Bactrian camel  =
            Black flying-fox  =
B D                   Ferret   =
            Cape golden mole  =
B D                   Dolphin  -
                Weddell seal  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  N
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D                   Opossum  =
B D        American alligator  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  =
B D           Tasmanian devil  =

Alignment block 5 of 280 in window, 48942031 - 48942031, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  t
           Chinese tree shrew  c
B D           Chinese hamster  c
               Golden hamster  c
B D                    Alpaca  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                     Panda  t
B D                  Elephant  c
B D                   Manatee  c
                     Aardvark  c
B D                 Armadillo  c
B D                    Tenrec  =
B D                  Hedgehog  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
                Prairie vole  =
         Cape elephant shrew  =
B D                     Shrew  =
        David's myotis (bat)  =
             Star-nosed mole  -
B D                  Squirrel  =
B D                      Pika  =
B D                    Rabbit  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
              Pacific walrus  =
B D                       Dog  =
B D                  Microbat  =
B D                  Bushbaby  =
               Big brown bat  =
B D            Naked mole-rat  -
                Killer whale  -
              Bactrian camel  =
            Black flying-fox  =
B D                   Ferret   =
            Cape golden mole  =
B D                   Dolphin  -
                Weddell seal  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  N
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D                   Opossum  =
B D        American alligator  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  =
B D           Tasmanian devil  =

Alignment block 6 of 280 in window, 48942032 - 48942032, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  g
           Chinese tree shrew  c
B D           Chinese hamster  c
               Golden hamster  c
B D                    Alpaca  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                     Panda  c
B D                     Shrew  c
B D                  Elephant  c
B D                   Manatee  c
                     Aardvark  c
B D                 Armadillo  c
B D                    Tenrec  =
B D                  Hedgehog  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
                Prairie vole  =
         Cape elephant shrew  =
        David's myotis (bat)  =
             Star-nosed mole  -
B D                  Squirrel  =
B D                      Pika  =
B D                    Rabbit  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
              Pacific walrus  =
B D                       Dog  =
B D                  Microbat  =
B D                  Bushbaby  =
               Big brown bat  =
B D            Naked mole-rat  -
                Killer whale  -
              Bactrian camel  =
            Black flying-fox  =
B D                   Ferret   =
            Cape golden mole  =
B D                   Dolphin  -
                Weddell seal  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  N
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D                   Opossum  =
B D        American alligator  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  =
B D           Tasmanian devil  =

Alignment block 7 of 280 in window, 48942033 - 48942034, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  ct
           Chinese tree shrew  tt
B D           Chinese hamster  tt
               Golden hamster  tt
B D                    Rabbit  -t
B D                    Alpaca  tt
B D                   Dolphin  tc
                 Killer whale  tc
             Tibetan antelope  tt
B D                       Cow  tc
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tc
B D          White rhinoceros  tt
B D                       Cat  tt
B D                       Dog  tt
B D                     Panda  tt
             Black flying-fox  tc
B D                   Megabat  tc
                Big brown bat  tc
         David's myotis (bat)  tc
B D                  Microbat  tc
B D                     Shrew  tt
B D                  Elephant  tt
B D                   Manatee  tt
                     Aardvark  tc
B D                 Armadillo  tt
B D                    Tenrec  ==
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  ==
                Prairie vole  ==
         Cape elephant shrew  ==
             Star-nosed mole  --
B D                  Squirrel  ==
B D                      Pika  ==
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
B D                  Bushbaby  ==
B D            Naked mole-rat  --
              Bactrian camel  ==
B D                   Ferret   ==
            Cape golden mole  ==
                Weddell seal  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
B D                   Wallaby  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D                   Lamprey  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  NN
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D        American alligator  ==
          Tibetan ground jay  ==
B D                       Pig  ==
B D           Tasmanian devil  ==

Inserts between block 7 and 8 in window
B D                   Rabbit 1bp

Alignment block 8 of 280 in window, 48942035 - 48942035, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
           Chinese tree shrew  t
B D                  Squirrel  t
B D           Chinese hamster  t
               Golden hamster  t
B D                    Rabbit  t
B D                    Alpaca  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                     Panda  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                     Shrew  t
B D                  Elephant  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D                    Tenrec  =
B D                  Hedgehog  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
                Prairie vole  =
         Cape elephant shrew  =
             Star-nosed mole  -
B D                      Pika  =
                  Chinchilla  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
              Pacific walrus  =
B D                  Bushbaby  =
B D            Naked mole-rat  -
              Bactrian camel  =
B D                   Ferret   =
            Cape golden mole  =
                Weddell seal  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  N
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D                   Opossum  =
B D        American alligator  =
          Tibetan ground jay  =
B D                       Pig  =
B D           Tasmanian devil  =

Alignment block 9 of 280 in window, 48942036 - 48942037, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  g-
           Chinese tree shrew  ga
B D                  Squirrel  ga
B D           Chinese hamster  aa
               Golden hamster  aa
B D                    Rabbit  gc
B D                    Alpaca  ga
B D                   Dolphin  ga
                 Killer whale  ga
             Tibetan antelope  gg
B D                       Cow  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  ga
B D          White rhinoceros  ga
B D                       Cat  cg
B D                       Dog  ca
B D                     Panda  ca
             Black flying-fox  ga
B D                   Megabat  ga
                Big brown bat  ga
         David's myotis (bat)  ga
B D                  Microbat  ga
B D                     Shrew  ga
B D                  Elephant  ga
B D                   Manatee  ga
B D                    Tenrec  ga
                     Aardvark  ga
B D                 Armadillo  gc
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  ==
                Prairie vole  ==
         Cape elephant shrew  ==
             Star-nosed mole  --
B D                      Pika  ==
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
B D                  Bushbaby  ==
B D            Naked mole-rat  --
              Bactrian camel  ==
B D                   Ferret   ==
            Cape golden mole  ==
                Weddell seal  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
B D                   Wallaby  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D                   Lamprey  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  NN
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D        American alligator  ==
          Tibetan ground jay  ==
B D                       Pig  ==
B D           Tasmanian devil  ==

Inserts between block 9 and 10 in window
B D                    Shrew 1bp

Alignment block 10 of 280 in window, 48942038 - 48942039, 2 bps 
B D                     Human  gt
B D                     Chimp  gt
B D                   Gorilla  gt
B D                 Orangutan  gt
B D                    Gibbon  gt
B D                    Rhesus  gt
B D       Crab-eating macaque  gt
B D                    Baboon  gt
B D              Green monkey  gt
           Chinese tree shrew  cg
B D                  Squirrel  gt
B D           Chinese hamster  at
               Golden hamster  at
B D            Naked mole-rat  -t
B D                    Rabbit  gt
B D                    Alpaca  gt
               Bactrian camel  gt
B D                   Dolphin  gt
                 Killer whale  gt
             Tibetan antelope  gt
B D                       Cow  gt
B D                     Sheep  gt
                Domestic goat  gt
B D                     Horse  ct
B D          White rhinoceros  gt
B D                       Cat  gt
B D                       Dog  gt
B D                     Panda  gt
             Black flying-fox  gt
B D                   Megabat  gt
                Big brown bat  gt
         David's myotis (bat)  gt
B D                  Microbat  gt
B D                     Shrew  g-
B D                  Elephant  gt
B D                   Manatee  gt
B D                    Tenrec  gc
                     Aardvark  gt
B D                 Armadillo  gt
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  ==
                Prairie vole  ==
         Cape elephant shrew  ==
             Star-nosed mole  --
B D                      Pika  ==
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
B D                  Bushbaby  ==
B D                   Ferret   ==
            Cape golden mole  ==
                Weddell seal  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
B D                   Wallaby  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D                   Lamprey  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                  Marmoset  --
B D                   Chicken  ==
B D              Atlantic cod  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  NN
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D        American alligator  ==
          Tibetan ground jay  ==
B D                       Pig  ==
B D           Tasmanian devil  ==

Alignment block 11 of 280 in window, 48942040 - 48942049, 10 bps 
B D                     Human  catgaacctc
B D                     Chimp  catgaacctc
B D                   Gorilla  catgaacctc
B D                 Orangutan  catgaacctc
B D                    Gibbon  catgaacctc
B D                    Rhesus  catgaacctc
B D       Crab-eating macaque  catgaacctc
B D                    Baboon  catgaacctc
B D              Green monkey  catgaa----
B D                  Marmoset  ---------c
           Chinese tree shrew  catggacctc
B D                  Squirrel  catggatctc
B D           Chinese hamster  cttgtaccaa
               Golden hamster  cttgtacctc
B D            Naked mole-rat  ccctggtctc
B D                    Rabbit  cggcgacggc
B D                    Alpaca  tatggacctc
               Bactrian camel  tatggacctc
B D                   Dolphin  caagaacctc
                 Killer whale  caagaacctc
             Tibetan antelope  caaggacctc
B D                       Cow  caaggacctc
B D                     Sheep  caaggacttc
                Domestic goat  caaggacctc
B D                     Horse  catggacctc
B D          White rhinoceros  cacggacctc
B D                       Cat  catggacctt
B D                       Dog  catggacctt
B D                     Panda  catggacctt
             Black flying-fox  catggacctc
B D                   Megabat  catggacctc
                Big brown bat  catggacctt
         David's myotis (bat)  catgga-ctc
B D                  Microbat  catggacctc
B D                     Shrew  cacaaacctc
              Star-nosed mole  cgtggacatc
B D                  Elephant  cacagaccgc
B D                   Manatee  catgaacctc
B D                    Tenrec  caggggccac
                     Aardvark  catggacctc
B D                 Armadillo  tatggccctc
B D                  Hedgehog  ==========
B D                Guinea pig  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
                Prairie vole  ==========
         Cape elephant shrew  ==========
B D                      Pika  ==========
                  Chinchilla  ==========
      Lesser Egyptian jerboa  ==========
            Brush-tailed rat  ==========
              Pacific walrus  ==========
B D                  Bushbaby  ==========
B D                   Ferret   ==========
            Cape golden mole  ==========
                Weddell seal  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D             Scarlet macaw  ==========
  D                    Parrot  ==========
B D                Budgerigar  ==========
B D                   Wallaby  ==========
B D                    Lizard  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
  D          Peregrine falcon  ==========
B D                 Zebrafish  ==========
  D               Rock pigeon  ==========
B D                   Lamprey  ==========
B D              Nile tilapia  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
B D           Squirrel monkey  NNNNNNNNNN
  D              Saker falcon  ==========
B D             X. tropicalis  ==========
  D           Green seaturtle  ==========
B D                   Opossum  ==========
B D        American alligator  ==========
          Tibetan ground jay  ==========
B D                       Pig  ==========
B D           Tasmanian devil  ==========

Inserts between block 11 and 12 in window
B D                   Tenrec 2bp

Alignment block 12 of 280 in window, 48942050 - 48942061, 12 bps 
B D                     Human  cct-ggggatcaa
B D                     Chimp  cct-ggggatcaa
B D                   Gorilla  cct-ggggatcaa
B D                 Orangutan  cct-gggggtcaa
B D                    Gibbon  cct-ggggatcaa
B D                    Rhesus  cct-ggggatcaa
B D       Crab-eating macaque  cct-ggggatcaa
B D                    Baboon  cct-ggggatcaa
B D              Green monkey  cct-ggggatcaa
B D                  Marmoset  ttt-ggcagtaca
           Chinese tree shrew  ctt-ggggatcaa
B D                  Squirrel  ctt-agggatcaa
B D           Chinese hamster  cg---agagccaa
               Golden hamster  ct---agatccaa
B D            Naked mole-rat  ctt-ggggatcaa
B D                    Rabbit  gct-ggggatcag
B D                    Alpaca  ctt-ggggataaa
               Bactrian camel  ctt-ggggataaa
B D                   Dolphin  ctc-ggggat-aa
                 Killer whale  ctctggggat-aa
             Tibetan antelope  ctt-gaggat-aa
B D                       Cow  ctt-gaggat-aa
B D                     Sheep  ctt-gaggat-aa
                Domestic goat  ctt-gaggat-aa
B D                     Horse  ctt-gggcatcaa
B D          White rhinoceros  ctt-ggggatcaa
B D                       Cat  ctt--ggaatcaa
B D                       Dog  ctt-gggaatcaa
B D                     Panda  ctt-gggaatcaa
             Black flying-fox  ctt-ggagactga
B D                   Megabat  ctt-ggagattga
                Big brown bat  ctt-ggggatcaa
         David's myotis (bat)  ctt-ggggatcaa
B D                  Microbat  cgt-ggggatcaa
B D                     Shrew  ctt-tgggatcaa
              Star-nosed mole  c-c-cgggagtaa
B D                  Elephant  ctt-gggggtcaa
B D                   Manatee  cct-gggggtcaa
             Cape golden mole  ctt-tggggtcca
B D                    Tenrec  ctg-ggggcgcag
                     Aardvark  ctt-ggggatcca
B D                 Armadillo  ctt-gggggtcta
B D                  Hedgehog  =============
B D                Guinea pig  =============
B D                       Rat  =============
B D                     Mouse  =============
                Prairie vole  =============
         Cape elephant shrew  =============
B D                      Pika  =============
                  Chinchilla  =============
      Lesser Egyptian jerboa  =============
            Brush-tailed rat  =============
              Pacific walrus  =============
B D                  Bushbaby  =============
B D                   Ferret   =============
                Weddell seal  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
B D               Stickleback  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D                    Medaka  =============
B D                Coelacanth  =============
B D                    Turkey  =============
                 Spotted gar  =============
  D              Mallard duck  =============
  D             Scarlet macaw  =============
  D                    Parrot  =============
B D                Budgerigar  =============
B D                   Wallaby  =============
B D                    Lizard  =============
          Southern platyfish  =============
    Mexican tetra (cavefish)  =============
  D          Peregrine falcon  =============
B D                 Zebrafish  =============
  D               Rock pigeon  =============
B D                   Lamprey  =============
B D              Nile tilapia  =============
  D            Painted turtle  =============
B D                 Tetraodon  =============
B D                   Chicken  =============
B D              Atlantic cod  =============
  D       Collared flycatcher  =============
  D  Chinese softshell turtle  =============
B D           Squirrel monkey  NNNNNNNNNNNNN
  D              Saker falcon  =============
B D             X. tropicalis  =============
  D           Green seaturtle  =============
B D                   Opossum  =============
B D        American alligator  =============
          Tibetan ground jay  =============
B D                       Pig  =============
B D           Tasmanian devil  =============

Alignment block 13 of 280 in window, 48942062 - 48942075, 14 bps 
B D                     Human  ctc-c--agataaagaa
B D                     Chimp  ctc-c--agataaagaa
B D                   Gorilla  ctc-c--agataaagaa
B D                 Orangutan  ttc-c--agataaagaa
B D                    Gibbon  ttc-c--agataaagaa
B D                    Rhesus  ttc-c--agataaagaa
B D       Crab-eating macaque  ttc-c--agataaagaa
B D                    Baboon  ttc-c--agataaagaa
B D              Green monkey  ttc-c--agataaagaa
B D                  Marmoset  t------atattaaaaa
           Chinese tree shrew  cttac--agataaagaa
B D                  Squirrel  ttc-c--acataaagaa
                 Prairie vole  ctc-c--agataaagaa
B D           Chinese hamster  ctc-t--agataaagaa
               Golden hamster  ctc-c--agataaagac
B D            Naked mole-rat  ctc-c--aagtatgggg
B D                    Rabbit  ctg-c--agacacagca
B D                    Alpaca  ccc-c--atatacagaa
               Bactrian camel  ccc-c--atatacagaa
B D                   Dolphin  cca-t--agataaagaa
                 Killer whale  cca-t--agataaagaa
             Tibetan antelope  ccc-t--ggataaagaa
B D                       Cow  ccc-t--ggataaagaa
B D                     Sheep  ccc-t--ggataaagaa
                Domestic goat  ccc-t--ggataaagaa
B D                     Horse  ctc-c--agataaggaa
B D          White rhinoceros  ctc-c--agacagagaa
B D                       Cat  ctc-caaaaaaaaagaa
B D                       Dog  ctc-c--aaataaaaaa
B D                     Panda  ctc-c--aaataaagaa
             Black flying-fox  ctg-c--aaataaagaa
B D                   Megabat  ctg-c--aaataaagaa
                Big brown bat  ctc-c--aaataaagaa
         David's myotis (bat)  ttc-c--agataaagaa
B D                  Microbat  ttc-c--agatcaagaa
B D                     Shrew  ttc-t--agagagagaa
              Star-nosed mole  atc-c--aattagagaa
B D                  Elephant  ctt-c--agataaagaa
B D                   Manatee  ctt-c--agataaggaa
             Cape golden mole  ctg-t--agataaagaa
B D                    Tenrec  cta-c--agatatagaa
                     Aardvark  cta-c--ggaggacaaa
B D                 Armadillo  atc-c--aggtgaagaa
B D                  Hedgehog  =================
B D                Guinea pig  =================
B D                       Rat  =================
B D                     Mouse  =================
         Cape elephant shrew  =================
B D                      Pika  =================
                  Chinchilla  =================
      Lesser Egyptian jerboa  =================
            Brush-tailed rat  =================
              Pacific walrus  =================
B D                  Bushbaby  =================
B D                   Ferret   =================
                Weddell seal  =================
      Yellowbelly pufferfish  =================
B D                      Fugu  =================
B D               Stickleback  =================
         Pundamilia nyererei  =================
                 Zebra mbuna  =================
       Burton's mouthbreeder  =================
         Princess of Burundi  =================
B D                    Medaka  =================
B D                Coelacanth  =================
B D                    Turkey  =================
                 Spotted gar  =================
  D              Mallard duck  =================
  D             Scarlet macaw  =================
  D                    Parrot  =================
B D                Budgerigar  =================
B D                   Wallaby  =================
B D                    Lizard  =================
          Southern platyfish  =================
    Mexican tetra (cavefish)  =================
  D          Peregrine falcon  =================
B D                 Zebrafish  =================
  D               Rock pigeon  =================
B D                   Lamprey  =================
B D              Nile tilapia  =================
  D            Painted turtle  =================
B D                 Tetraodon  =================
B D                   Chicken  =================
B D              Atlantic cod  =================
  D       Collared flycatcher  =================
  D  Chinese softshell turtle  =================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNN
  D              Saker falcon  =================
B D             X. tropicalis  =================
  D           Green seaturtle  =================
B D                   Opossum  =================
B D        American alligator  =================
          Tibetan ground jay  =================
B D                       Pig  =================
B D           Tasmanian devil  =================

Inserts between block 13 and 14 in window
B D                 Elephant 818bp
                    Aardvark 2bp

Alignment block 14 of 280 in window, 48942076 - 48942078, 3 bps 
B D                     Human  ctg
B D                     Chimp  gtg
B D                   Gorilla  ctg
B D                 Orangutan  ctg
B D                    Gibbon  ctg
B D                    Rhesus  cta
B D       Crab-eating macaque  cta
B D                    Baboon  cta
B D              Green monkey  ctg
B D                  Marmoset  ctg
           Chinese tree shrew  tct
B D                  Squirrel  atg
                 Prairie vole  tgg
B D           Chinese hamster  ttg
               Golden hamster  ttg
B D            Naked mole-rat  g--
B D                    Rabbit  aac
B D                    Alpaca  t--
               Bactrian camel  t--
B D                   Dolphin  t--
                 Killer whale  t--
             Tibetan antelope  t--
B D                       Cow  t--
B D                     Sheep  t--
                Domestic goat  t--
B D                     Horse  t--
B D          White rhinoceros  t--
B D                       Cat  t--
B D                       Dog  t--
B D                     Panda  t--
             Black flying-fox  t--
B D                   Megabat  t--
                Big brown bat  t--
         David's myotis (bat)  t--
B D                  Microbat  t--
B D                     Shrew  t--
              Star-nosed mole  t--
B D                   Manatee  t--
             Cape golden mole  t--
B D                    Tenrec  t--
B D                 Armadillo  t--
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
B D                  Elephant  ===
         Cape elephant shrew  ===
B D                      Pika  ===
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
            Brush-tailed rat  ===
              Pacific walrus  ===
B D                  Bushbaby  ===
B D                   Ferret   ===
                Weddell seal  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
B D                Budgerigar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  NNN
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D        American alligator  ===
          Tibetan ground jay  ===
B D                       Pig  ===
B D           Tasmanian devil  ===

Inserts between block 14 and 15 in window
B D                 Squirrel 198bp
B D                   Rabbit 3bp

Alignment block 15 of 280 in window, 48942079 - 48942096, 18 bps 
B D                     Human  ctctgg--g-------a------------ctgt-aatttg
B D                     Chimp  ctctgg--g-------a------------gtgt-aatttg
B D                   Gorilla  ctctgg--g-------a------------ctgt-aatttg
B D                 Orangutan  ctctgg--g-------a------------ctgt-aatttg
B D                    Gibbon  ctctgg--g-------a------------ctgt-aatttg
B D                    Rhesus  ctctgg--g-------a------------cttt-aatttg
B D       Crab-eating macaque  ctctgg--g-------a------------cttt-aatttg
B D                    Baboon  ctctgg--g-------a------------cttt-aatttg
B D              Green monkey  ctctgg--g-------a------------cttt-aatttg
B D                  Marmoset  ctctgg--g-------a------------ctgt-aatttg
           Chinese tree shrew  ctcaggcca-------a------------gtgtgggtcta
                 Prairie vole  ---cta--t-------g------------gtgg-agcatg
B D           Chinese hamster  ---gta--a-------g------------gtga-agcatg
               Golden hamster  ---gta--a-------g------------gtgg-agcatg
B D            Naked mole-rat  -----a--a-------g------------gggg-a--ctg
B D                    Rabbit  -agccg--g-------g------------gctg-tgcatc
B D                    Alpaca  ctctga--g-------g------------gagg-ggtgtg
               Bactrian camel  ctccga--g-------g------------gagg-ggtgtg
B D                   Dolphin  ctctga--g-------g------------aagg-gatgtg
                 Killer whale  ctctga--g-------g------------aagg-gatgtg
             Tibetan antelope  ctctga--g-------t------------aagg-gttttg
B D                       Cow  ctctga--g-------g------------aagg-gttttg
B D                     Sheep  ctctga--g-------g------------aagg-gttttg
                Domestic goat  ctctga--g-------g------------aagg-gttttg
B D                     Horse  ccctga--g-------g------------gagg-ggtgtg
B D          White rhinoceros  cccgga--g-------g------------gagg-ggtgta
B D                       Cat  ccctaa--g-------g------------gagg-ggtggg
B D                       Dog  cccaaa--g-------g------------gaga-ggt--g
B D                     Panda  -ccaaa--g-------g------------gagg-ggt--c
             Black flying-fox  ccctga--a-------g------------gagg-gctgtg
B D                   Megabat  ccctga--a-------g------------gagg-gctgtg
                Big brown bat  ccctga--c-------t------------gagg-gctgtg
         David's myotis (bat)  ccctga--c-------t------------gagg-gctgtg
B D                  Microbat  ccctga--c-------t------------gagg-gctgtg
B D                     Shrew  cttgga--g-------ggagggaaggagagagg-g-tgtg
              Star-nosed mole  tcccaa--t-------g------------gagg-a-tgtg
B D                   Manatee  ccctga--ggctgg--g------------tgtg-ggtcta
             Cape golden mole  ccccgg--g-------g------------tatg-ggtcta
B D                    Tenrec  ccctga--g-ctggccg------------tgcg-ggtcta
                     Aardvark  --ctgg--ggcggga-a------------tgtg-ggttta
B D                 Armadillo  tcctga--ggtgtgt-t------------tatg-gatcta
B D                  Hedgehog  ========================================
B D                Guinea pig  ========================================
B D                       Rat  ========================================
B D                     Mouse  ========================================
B D                  Elephant  ========================================
         Cape elephant shrew  ========================================
B D                  Squirrel  ========================================
B D                      Pika  ========================================
                  Chinchilla  ========================================
      Lesser Egyptian jerboa  ========================================
            Brush-tailed rat  ========================================
              Pacific walrus  ========================================
B D                  Bushbaby  ========================================
B D                   Ferret   ========================================
                Weddell seal  ========================================
      Yellowbelly pufferfish  ========================================
B D                      Fugu  ========================================
B D               Stickleback  ========================================
         Pundamilia nyererei  ========================================
                 Zebra mbuna  ========================================
       Burton's mouthbreeder  ========================================
         Princess of Burundi  ========================================
B D                    Medaka  ========================================
B D                Coelacanth  ========================================
B D                    Turkey  ========================================
                 Spotted gar  ========================================
  D              Mallard duck  ========================================
  D             Scarlet macaw  ========================================
  D                    Parrot  ========================================
B D                Budgerigar  ========================================
B D                   Wallaby  ========================================
B D                    Lizard  ========================================
          Southern platyfish  ========================================
    Mexican tetra (cavefish)  ========================================
  D          Peregrine falcon  ========================================
B D                 Zebrafish  ========================================
  D               Rock pigeon  ========================================
B D                   Lamprey  ========================================
B D              Nile tilapia  ========================================
  D            Painted turtle  ========================================
B D                 Tetraodon  ========================================
B D                   Chicken  ========================================
B D              Atlantic cod  ========================================
  D       Collared flycatcher  ========================================
  D  Chinese softshell turtle  ========================================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  ========================================
B D             X. tropicalis  ========================================
  D           Green seaturtle  ========================================
B D                   Opossum  ========================================
B D        American alligator  ========================================
          Tibetan ground jay  ========================================
B D                       Pig  ========================================
B D           Tasmanian devil  ========================================

Inserts between block 15 and 16 in window
B D                   Alpaca 6bp
              Bactrian camel 6bp
B D                  Dolphin 6bp
                Killer whale 6bp
            Tibetan antelope 13bp
B D                      Cow 13bp
B D                    Sheep 13bp
               Domestic goat 13bp
B D                    Horse 6bp
B D         White rhinoceros 6bp
B D                      Cat 6bp
B D                      Dog 6bp
B D                    Panda 6bp
            Black flying-fox 6bp
B D                  Megabat 6bp
               Big brown bat 6bp
        David's myotis (bat) 6bp
B D                 Microbat 6bp
B D                    Shrew 6bp
             Star-nosed mole 6bp

Alignment block 16 of 280 in window, 48942097 - 48942105, 9 bps 
B D                     Human  ccaga-ttcc
B D                     Chimp  ccaga-ttgc
B D                   Gorilla  ccaga-ttgc
B D                 Orangutan  ccaga-ttgc
B D                    Gibbon  ccaga-ttgc
B D                    Rhesus  ccaga-ttgc
B D       Crab-eating macaque  ccaga-ttgc
B D                    Baboon  ccaga-ttgc
B D              Green monkey  ccaga-ttgc
B D                  Marmoset  ccaga-ccgc
           Chinese tree shrew  ccagg-ttgc
                 Prairie vole  ctgga-gccc
B D           Chinese hamster  ctgca-gtcc
               Golden hamster  ctgca-gttc
B D            Naked mole-rat  cacaa-acc-
B D                    Rabbit  taaca-gtgc
B D                       Pig  ccaga-ttag
B D                    Alpaca  ccaga-ttac
               Bactrian camel  ccaga-ttac
B D                   Dolphin  ccaga-gtac
                 Killer whale  ccaga-gtac
             Tibetan antelope  ccaca-ttac
B D                       Cow  ccaca-ttac
B D                     Sheep  ccaca-ttac
                Domestic goat  ccaca-ttac
B D                     Horse  ccgga-ttac
B D          White rhinoceros  ccaga-ttac
B D                       Cat  ccaga-ctgc
B D                       Dog  ccaga-tttt
B D                     Panda  ccaga-ttat
             Black flying-fox  ccaga-ttac
B D                   Megabat  ccaga-ttac
                Big brown bat  ccaga-ttac
         David's myotis (bat)  ccaga-ttac
B D                  Microbat  ccaga-ttac
B D                     Shrew  acaga-ttcc
              Star-nosed mole  gcaga-tgac
B D                   Manatee  ccagatttgc
             Cape golden mole  ccagatttac
B D                    Tenrec  ccaaatttgc
                     Aardvark  ccagatttgc
B D                 Armadillo  ccaca-ttgc
B D                  Hedgehog  ==========
B D                Guinea pig  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
B D                  Elephant  ==========
         Cape elephant shrew  ==========
B D                  Squirrel  ==========
B D                      Pika  ==========
                  Chinchilla  ==========
      Lesser Egyptian jerboa  ==========
            Brush-tailed rat  ==========
              Pacific walrus  ==========
B D                  Bushbaby  ==========
B D                   Ferret   ==========
                Weddell seal  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D             Scarlet macaw  ==========
  D                    Parrot  ==========
B D                Budgerigar  ==========
B D                   Wallaby  ==========
B D                    Lizard  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
  D          Peregrine falcon  ==========
B D                 Zebrafish  ==========
  D               Rock pigeon  ==========
B D                   Lamprey  ==========
B D              Nile tilapia  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
B D           Squirrel monkey  NNNNNNNNNN
  D              Saker falcon  ==========
B D             X. tropicalis  ==========
  D           Green seaturtle  ==========
B D                   Opossum  ==========
B D        American alligator  ==========
          Tibetan ground jay  ==========
B D           Tasmanian devil  ==========

Inserts between block 16 and 17 in window
B D                   Rabbit 1bp

Alignment block 17 of 280 in window, 48942106 - 48942134, 29 bps 
B D                     Human  atttc-a--tg-ttaa-atacaaaaga---ctt-gg---gg
B D                     Chimp  atttc-a--tg-ttaa-atacagaaga---ctt-gg---gg
B D                   Gorilla  atttc-a--tg-ttaa-acacaaaaga---ctt-gg---gg
B D                 Orangutan  atttc-a--tg-ttaa-atacaaaaga---ctt-gg---gg
B D                    Gibbon  atttc-a--tg-ttaa-atacaaaaga---ctt-gg---gg
B D                    Rhesus  atttc-a--tg-ttaa-atacaaaaga---ctt-gg---gg
B D       Crab-eating macaque  atttc-a--tg-ttaa-atacaaaaga---ctt-gg---gg
B D                    Baboon  atttc-a--tg-ttaa-atacaaaaga---ctt-gg---gg
B D              Green monkey  atttc-a--tg-ttaa-atacaaaaga---ctt-gg---gg
B D                  Marmoset  atttt-a--ta-ctaa-atacaaaata---ctt-gg---gg
           Chinese tree shrew  attccaa--aa-ctaa-atacaaaagt---gct-gg---gg
B D                  Squirrel  atatcag--ag-caaacacaataaagt---ttg-tg---g-
                 Prairie vole  -----aa--ag-ccat-gtataagcct---tcg-ga---g-
B D           Chinese hamster  -----ag--ag-ccaa-gtataaaccc---ttg-ga---g-
               Golden hamster  -----aa--ag-ctaa-gtataaagct---ttg-ga---g-
B D            Naked mole-rat  -------------aac-acaaaagggt---tgg-gg---g-
B D                    Rabbit  -ttccaa--ag-ctga-gtgcaaaagg---gct-gg---g-
B D                       Pig  attctaa--ag-ctaa-atacttttgg---ttt-gg---gg
B D                    Alpaca  attccaa--ag-ccaa-ataattttgg--tttg-gg---ga
               Bactrian camel  attccaa--ag-ccaa-ataattttgg--tttg-gg---ga
B D                   Dolphin  attctaa--ag-ctaa-atacttttgg---ttt-gg---gg
                 Killer whale  attctaa--ag-ctaa-atacttttgg---ttt-gg---gg
             Tibetan antelope  attctaa--at-ctac-attctttttagcttta-gg---gg
B D                       Cow  attctaa--ag-ctac-attctttttagcttca-gg---gg
B D                     Sheep  attctaa--ac-ctac-attctttttagcttca-gg---gg
                Domestic goat  attctaa--ac-ctac-attctttttagcttca-gg---gg
B D                     Horse  attccaa--aa-ctaa-gcacaaatgg---tgt-gg---gg
B D          White rhinoceros  atcccaa--ag-ctaa-gtacaaaagg---ttt-ga---gg
B D                       Cat  attccaa--agctccg-gtgctaatga---tttggg---gg
B D                       Dog  ttccaaa--g--ctaa-atacaaatgg---ttt-gg---gg
B D                     Panda  attccaa--a--ctaa-atacaaatgg---ttt-gg---gg
             Black flying-fox  attccaa--ag-ctaa-atacaaatgg---ttt-gg---gg
B D                   Megabat  attccaa--ag-ctaa-atacaaatgg---ttt-gg---gg
                Big brown bat  attccag--ag-ttaa-atacaaatat---ttt-gg---gg
         David's myotis (bat)  attccaa--ag-ttaa-acacaagtat---ttt-gg---gg
B D                  Microbat  attccaa--ag-ttaa-atacaaatat---ttt-gg---gg
B D                     Shrew  actccaaacag-ttcg-aggaaatt-----ttt-agaatag
              Star-nosed mole  attctaa--ag-ctaa-atacaaatgg---ttt-ag---ag
B D                   Manatee  attccaa--ag-ccaa-atataaacca---ttt-gg---gg
             Cape golden mole  attccaa--ag-ccaa-atatacaaca---ctt-gg---gg
B D                    Tenrec  attccaa--ga-gcaa-atataaatca---ttt-gg---gg
                     Aardvark  attccaa--ag-ccaa-atataaatca---ttt-gg---ga
B D                 Armadillo  acttcaa--ag-tcaa-gtacaaatga---ttt-gg---ga
B D                  Hedgehog  =========================================
B D                Guinea pig  =========================================
B D                       Rat  =========================================
B D                     Mouse  =========================================
B D                  Elephant  =========================================
         Cape elephant shrew  =========================================
B D                      Pika  =========================================
                  Chinchilla  =========================================
      Lesser Egyptian jerboa  =========================================
            Brush-tailed rat  =========================================
              Pacific walrus  =========================================
B D                  Bushbaby  =========================================
B D                   Ferret   =========================================
                Weddell seal  =========================================
      Yellowbelly pufferfish  =========================================
B D                      Fugu  =========================================
B D               Stickleback  =========================================
         Pundamilia nyererei  =========================================
                 Zebra mbuna  =========================================
       Burton's mouthbreeder  =========================================
         Princess of Burundi  =========================================
B D                    Medaka  =========================================
B D                Coelacanth  =========================================
B D                    Turkey  =========================================
                 Spotted gar  =========================================
  D              Mallard duck  =========================================
  D             Scarlet macaw  =========================================
  D                    Parrot  =========================================
B D                Budgerigar  =========================================
B D                   Wallaby  =========================================
B D                    Lizard  =========================================
          Southern platyfish  =========================================
    Mexican tetra (cavefish)  =========================================
  D          Peregrine falcon  =========================================
B D                 Zebrafish  =========================================
  D               Rock pigeon  =========================================
B D                   Lamprey  =========================================
B D              Nile tilapia  =========================================
  D            Painted turtle  =========================================
B D                 Tetraodon  =========================================
B D                   Chicken  =========================================
B D              Atlantic cod  =========================================
  D       Collared flycatcher  =========================================
  D  Chinese softshell turtle  =========================================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  =========================================
B D             X. tropicalis  =========================================
  D           Green seaturtle  =========================================
B D                   Opossum  =========================================
B D        American alligator  =========================================
          Tibetan ground jay  =========================================
B D           Tasmanian devil  =========================================

Inserts between block 17 and 18 in window
B D                    Shrew 5bp
             Star-nosed mole 8bp

Alignment block 18 of 280 in window, 48942135 - 48942144, 10 bps 
B D                     Human  attttctgac
B D                     Chimp  attttctgac
B D                   Gorilla  attttctgac
B D                 Orangutan  attttctgac
B D                    Gibbon  attttctgac
B D                    Rhesus  attttctgac
B D       Crab-eating macaque  attttctgac
B D                    Baboon  attttctgac
B D              Green monkey  attttctgac
B D                  Marmoset  atttt----c
B D                  Bushbaby  attttctgat
           Chinese tree shrew  attgtctgac
B D                  Squirrel  attctatgaa
                 Prairie vole  a-tgtaggat
B D           Chinese hamster  attttatgat
               Golden hamster  attttatgat
B D            Naked mole-rat  ---ttctgac
B D                    Rabbit  gttttctaaa
B D                       Pig  atactgtgac
B D                    Alpaca  acattctgac
               Bactrian camel  acattctgac
B D                   Dolphin  atattctgac
                 Killer whale  atattctgac
             Tibetan antelope  ctattctgat
B D                       Cow  ctattctgat
B D                     Sheep  ctattctgat
                Domestic goat  ctattctgat
B D                     Horse  attttcctac
B D          White rhinoceros  attttctgat
B D                       Cat  attttctgac
B D                       Dog  cttttcggac
B D                     Panda  attttctgat
             Black flying-fox  actttc----
B D                   Megabat  actttc----
                Big brown bat  attttctgac
         David's myotis (bat)  attttctgac
B D                  Microbat  attttctgat
B D                  Hedgehog  --------ac
B D                     Shrew  --------ac
              Star-nosed mole  --------gc
B D                   Manatee  attttctgca
             Cape golden mole  attttctggt
B D                    Tenrec  gttttccggt
                     Aardvark  atttctggc-
B D                 Armadillo  attttctagg
B D                Guinea pig  ==========
B D                       Rat  ==========
B D                     Mouse  ==========
B D                  Elephant  ==========
         Cape elephant shrew  ==========
B D                      Pika  ==========
                  Chinchilla  ==========
      Lesser Egyptian jerboa  ==========
            Brush-tailed rat  ==========
              Pacific walrus  ==========
B D                   Ferret   ==========
                Weddell seal  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D             Scarlet macaw  ==========
  D                    Parrot  ==========
B D                Budgerigar  ==========
B D                   Wallaby  ==========
B D                    Lizard  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
  D          Peregrine falcon  ==========
B D                 Zebrafish  ==========
  D               Rock pigeon  ==========
B D                   Lamprey  ==========
B D              Nile tilapia  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
  D       Collared flycatcher  ==========
  D  Chinese softshell turtle  ==========
B D           Squirrel monkey  NNNNNNNNNN
  D              Saker falcon  ==========
B D             X. tropicalis  ==========
  D           Green seaturtle  ==========
B D                   Opossum  ==========
B D        American alligator  ==========
          Tibetan ground jay  ==========
B D           Tasmanian devil  ==========

Inserts between block 18 and 19 in window
B D                  Manatee 6bp
            Cape golden mole 6bp
B D                   Tenrec 6bp
                    Aardvark 2bp
B D                Armadillo 1bp

Alignment block 19 of 280 in window, 48942145 - 48942176, 32 bps 
B D                     Human  t-------t------tgt----att-----------ac-cccttctcttttc---------ctaattaac
B D                     Chimp  t-------t------tgt----att-----------ac-cccttctcttttc---------ctaattaac
B D                   Gorilla  t-------t------tgt----att-----------ac-cccttctcttttc---------ctaattaac
B D                 Orangutan  t-----------------------------------------ttctcttttc---------ctaattaac
B D                    Gibbon  t-------t------tgt----att-----------ac-cccttctcttttc---------ctaattaac
B D                    Rhesus  t-------t------tgt----att-----------ac-cccttctcttttc---------ctaattaac
B D       Crab-eating macaque  t-------t------tgt----att-----------ac-cccttctcttttc---------ctaattaac
B D                    Baboon  t-------t------tgt----att-----------ac-cccttctcttttc---------ctaattaac
B D              Green monkey  t-------t------tgt----att-----------ac-cccttctcttttc---------ctaattaac
B D                  Marmoset  t-------t------tgt----att-----------actccttttttttttc---------ctaattaac
B D                  Bushbaby  ttttttatt------tgt----att-----------ac-cacttcttttttt---------ctaattaat
           Chinese tree shrew  t-------tttcagctgt----att-----------ac-cacttctgttttc---------ctaattaac
B D                  Squirrel  t-------t------ttt----atttatattaccc-ct-tctttcattttcc---------ctaattaat
                 Prairie vole  c--------------ttt----atttgagctgtat-aa-cctctctctgttc---------ctgattaac
B D           Chinese hamster  c-------t------ttt----gttttatctgcatcag-cctttt--ttttc---------ctgata---
               Golden hamster  c-------t------ttt----gttttatctgcaccag-cctttttcttttc---------ctaataaac
B D            Naked mole-rat  t-------t------ttt----gtgtgaattactt-ac-tctc----taccc---------ctaattaat
B D                    Rabbit  a-------c------gtt----gttggtactacct--------tctctttcc---------ctcattaac
B D                       Pig  t-------tcctatttgt----att-----------ac-tccttttctttcc---------ctaattaat
B D                    Alpaca  t-------tcctatttgt----atc-----------ac-tc---ctctttcc---------ctaattaac
               Bactrian camel  t-------tcctatttat----atc-----------ac-tc---ctctttcc---------ctaattaac
B D                   Dolphin  t-------tcccatttgc----att-----------ac-tccttttctttcc---------ctaattaac
                 Killer whale  t-------tcccatttgc----att-----------ac-tccttttctttcc---------ctaattaac
             Tibetan antelope  t-------tcctatttgc----att-----------ac-tccttctctttcc---------ctaattaac
B D                       Cow  t-------tcctatttgc----att-----------ac-tc---ctctttcc---------ctaattaac
B D                     Sheep  t-------tcctatttgc----att-----------ac-tccttctctttcc---------ctaattaac
                Domestic goat  t-------tcctatttgc----att-----------ac-tccttctctttcc---------ctaattaac
B D                     Horse  a-------t------cct----atc-----------ac-cccttctctgtcc---------ctaactaac
B D          White rhinoceros  g-------t------cct----gtt-----------ac-tc---ctctttcc---------ctaactaac
B D                       Cat  t-------c---atggct----gtg-----------ac-tccttccctttct---------ctaattaac
B D                       Dog  t-------t---atttgt----agt-----------at-tcttcctctttcc---------cgaattaac
B D                     Panda  t-------t---atttgt----agt-----------at-tccttctctttcc---------ctaattaac
             Black flying-fox  --------ttttatttgt----att-----------ac-tc---ctc---------------------ac
B D                   Megabat  --------ttttatttgt----att-----------ac-tc---ctc---------------------ac
                Big brown bat  g-------tcctgtttgt----att-----------ac-tccttctc---------------------ac
         David's myotis (bat)  g-------ttctgtttgt----atta----------ac-tc---ctc---------------------ac
B D                  Microbat  g-------tcctgtttgt----atta----------ac-tccttctc---------------------ac
B D                  Hedgehog  t-------ttctatttgt----att-----------ac-tccttgtcttctc---------ctaattaac
B D                     Shrew  t-------ttctatttgtttgcaat-----------ac-ttcatttatttctgtataaggaataattaag
              Star-nosed mole  t-------tcctatttgt-----gt-----------at-gccttttctttcc---------ctaaataac
B D                  Elephant  -------------tttat----att-----------at-tccttctctttcc---------ctaattaac
B D                   Manatee  -------------tttgt----att-----------at-tccttctctttcc---------ctaattaac
             Cape golden mole  -------------tcggt----aca-----------at-ttattctctttcc---------ctgtttaac
B D                    Tenrec  -------------tgtat----att-----------gt-tttttct-ttccc---------ctatttaag
                     Aardvark  -------------tgtgt-----tt-----------at-tccttctctttcc---------ctaattaac
B D                 Armadillo  -------------attat----att-----------at-tcattctctttcc---------ctagttaac
B D                Guinea pig  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
         Cape elephant shrew  ======================================================================
B D                      Pika  ======================================================================
                  Chinchilla  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
            Brush-tailed rat  ======================================================================
              Pacific walrus  ======================================================================
B D                   Ferret   ======================================================================
                Weddell seal  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D               Stickleback  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D                    Medaka  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Turkey  ======================================================================
                 Spotted gar  ======================================================================
  D              Mallard duck  ======================================================================
  D             Scarlet macaw  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Lizard  ======================================================================
          Southern platyfish  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
  D          Peregrine falcon  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
B D                   Lamprey  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D                   Chicken  ======================================================================
B D              Atlantic cod  ======================================================================
  D       Collared flycatcher  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  ======================================================================
B D             X. tropicalis  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D           Tasmanian devil  ======================================================================

Inserts between block 19 and 20 in window
B D                 Squirrel 427bp

Alignment block 20 of 280 in window, 48942177 - 48942181, 5 bps 
B D                     Human  aagga
B D                     Chimp  aagga
B D                   Gorilla  aagga
B D                 Orangutan  aagga
B D                    Gibbon  aagga
B D                    Rhesus  aagga
B D       Crab-eating macaque  aagga
B D                    Baboon  aagga
B D              Green monkey  aagga
B D                  Marmoset  aaagc
B D                  Bushbaby  aaagt
           Chinese tree shrew  a--tt
B D                  Squirrel  aaaga
                 Prairie vole  aaaga
B D           Chinese hamster  ----a
               Golden hamster  aaaga
B D            Naked mole-rat  aaaga
B D                    Rabbit  aaagc
B D                       Pig  aaagc
B D                    Alpaca  aaagc
               Bactrian camel  aaagc
B D                   Dolphin  aa--c
                 Killer whale  aa--c
             Tibetan antelope  aaagc
B D                       Cow  aaagc
B D                     Sheep  aaagc
                Domestic goat  aaagc
B D                     Horse  gaagc
B D          White rhinoceros  aaagc
B D                       Cat  aaagc
B D                       Dog  aaaac
B D                     Panda  aaagc
             Black flying-fox  aaagc
B D                   Megabat  aaagc
                Big brown bat  agagc
         David's myotis (bat)  aaagc
B D                  Microbat  aaagc
B D                  Hedgehog  aaagc
B D                     Shrew  gaagc
              Star-nosed mole  aaagc
B D                  Elephant  aagg-
B D                   Manatee  aaggc
             Cape golden mole  aaggc
B D                    Tenrec  aaggc
                     Aardvark  aaggt
B D                 Armadillo  aaagc
B D                Guinea pig  =====
B D                       Rat  =====
B D                     Mouse  =====
         Cape elephant shrew  =====
B D                      Pika  =====
                  Chinchilla  =====
      Lesser Egyptian jerboa  =====
            Brush-tailed rat  =====
              Pacific walrus  =====
B D                   Ferret   =====
                Weddell seal  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D               Stickleback  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                    Medaka  =====
B D                Coelacanth  =====
B D                    Turkey  =====
                 Spotted gar  =====
  D              Mallard duck  =====
  D             Scarlet macaw  =====
  D                    Parrot  =====
B D                Budgerigar  =====
B D                   Wallaby  =====
B D                    Lizard  =====
          Southern platyfish  =====
    Mexican tetra (cavefish)  =====
  D          Peregrine falcon  =====
B D                 Zebrafish  =====
  D               Rock pigeon  =====
B D                   Lamprey  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
B D                 Tetraodon  =====
B D                   Chicken  =====
B D              Atlantic cod  =====
  D       Collared flycatcher  =====
  D  Chinese softshell turtle  =====
B D           Squirrel monkey  NNNNN
  D              Saker falcon  =====
B D             X. tropicalis  =====
  D           Green seaturtle  =====
B D                   Opossum  =====
B D        American alligator  =====
          Tibetan ground jay  =====
B D           Tasmanian devil  =====

Alignment block 21 of 280 in window, 48942182 - 48942200, 19 bps 
B D                     Human  ccatcttctatcccacc--aa
B D                     Chimp  ccatcttctatcccacc--aa
B D                   Gorilla  ccatcttctatcccacc--aa
B D                 Orangutan  ccatcttctatcccacc--aa
B D                    Gibbon  ccatcttctatcccacc--aa
B D                    Rhesus  ccatcttctattccacc--aa
B D       Crab-eating macaque  ccatcttctattccacc--aa
B D                    Baboon  ccatcttctattccacc--aa
B D              Green monkey  ccaccttctactccacc--aa
B D                  Marmoset  ccatcttctatcccacc--aa
B D                  Bushbaby  ccatcttttaccccaac--aa
           Chinese tree shrew  ccatcttggatgccaac--ag
B D                  Squirrel  ctatcttctatccttcc--aa
                 Prairie vole  acagcttttaggctact--ga
B D           Chinese hamster  atagcttttaggccact--aa
               Golden hamster  acagcttttaggtcacc--aa
B D            Naked mole-rat  ccatcttctgtcccacc--aa
B D                    Rabbit  ccaccttcaaccccatc--ga
B D                       Pig  ctatcttcaacc-cacc--ca
B D                    Alpaca  ctattttcaac----------
               Bactrian camel  ctattttcaac----------
B D                   Dolphin  ctatcttcaact-cacc--aa
                 Killer whale  ctatcttcaact-cacc--aa
             Tibetan antelope  ctatcttcaacc-cacc--aa
B D                       Cow  ctatcttcaacc-cacc--aa
B D                     Sheep  ctatcttcaacc-cacc--aa
                Domestic goat  ctatcttcaacc-cacc--aa
B D                     Horse  ctatcttctacc---cc--aa
B D          White rhinoceros  ctatcttctgcc---cc--aa
B D                       Cat  ctactttctacc-tgccggga
B D                       Dog  ctgtgttctacc-cacc--at
B D                     Panda  ctatgttctacc-cacc--aa
             Black flying-fox  ttaccttctaccccacc--aa
B D                   Megabat  ttaccttctaccccacc--aa
                Big brown bat  ctatcttctaccccacc--aa
         David's myotis (bat)  ctgtcttctaccccacc--aa
B D                  Microbat  ctgtcttctaccccacc--aa
B D                  Hedgehog  ctatctgctaccagacc--aa
B D                     Shrew  ctaccaga-atcagacc--aa
              Star-nosed mole  ctatc----------------
B D                  Elephant  ccatcttctaccccacc--aa
          Cape elephant shrew  ctaacttctgcctcatc--aa
B D                   Manatee  cta---tctaccccacc--aa
             Cape golden mole  ccattt-ctaccacaac--aa
B D                    Tenrec  tcatct---------------
                     Aardvark  tcaccttctaccccacc--aa
B D                 Armadillo  ttatcttctaccccact--aa
B D                Guinea pig  =====================
B D                       Rat  =====================
B D                     Mouse  =====================
B D                      Pika  =====================
                  Chinchilla  =====================
      Lesser Egyptian jerboa  =====================
            Brush-tailed rat  =====================
              Pacific walrus  =====================
B D                   Ferret   =====================
                Weddell seal  =====================
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
B D               Stickleback  =====================
         Pundamilia nyererei  =====================
                 Zebra mbuna  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
B D                    Medaka  =====================
B D                Coelacanth  =====================
B D                    Turkey  =====================
                 Spotted gar  =====================
  D              Mallard duck  =====================
  D             Scarlet macaw  =====================
  D                    Parrot  =====================
B D                Budgerigar  =====================
B D                   Wallaby  =====================
B D                    Lizard  =====================
          Southern platyfish  =====================
    Mexican tetra (cavefish)  =====================
  D          Peregrine falcon  =====================
B D                 Zebrafish  =====================
  D               Rock pigeon  =====================
B D                   Lamprey  =====================
B D              Nile tilapia  =====================
  D            Painted turtle  =====================
B D                 Tetraodon  =====================
B D                   Chicken  =====================
B D              Atlantic cod  =====================
  D       Collared flycatcher  =====================
  D  Chinese softshell turtle  =====================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  =====================
B D             X. tropicalis  =====================
  D           Green seaturtle  =====================
B D                   Opossum  =====================
B D        American alligator  =====================
          Tibetan ground jay  =====================
B D           Tasmanian devil  =====================

Alignment block 22 of 280 in window, 48942201 - 48942226, 26 bps 
B D                     Human  aaa-taa-----gcactcctagcccaatat----tt---------
B D                     Chimp  aaa-taa-----gcactcctagcccaatat----tt---------
B D                   Gorilla  aaa-taa-----gcactcctagcccaatat----tt---------
B D                 Orangutan  aaa-taa-----gcactcctagcccaatat----tt---------
B D                    Gibbon  gaa-taa-----gcactcctagcccaatat----tt---------
B D                    Rhesus  gaa-taa-----gcactcctagcccaatat---------------
B D       Crab-eating macaque  gaa-taa-----gcactcctagcccaatat---------------
B D                    Baboon  gaa-taa-----gcactcctagcccaatat---------------
B D              Green monkey  gaa-taa-----gcactcctagcccaatat---------------
B D                  Marmoset  gag-taa-----gtacttctggcccaatat----tt---------
           Chinese tree shrew  gag-taa-----ccatgcctggctaaacac----tt---------
B D                  Squirrel  aaa-taa-----ccattcctggtccaatat----ct---------
                 Prairie vole  gag-gaa-----tcactcctggtccaacat----ct---------
B D           Chinese hamster  ----gaa-----tcactcttga-ccaatag----ct---------
               Golden hamster  gag-gaa-----tcactcttga-ccaacat----ct---------
B D            Naked mole-rat  gagttaa-----ccactcctggctgagcac----ct---------
B D                    Rabbit  gag-tgg-----tcactccc-------------------------
B D                       Pig  gaa-taa-----cctctcctggcccaacat---------------
B D                    Alpaca  ------------ccactcctggcccaacat---------------
               Bactrian camel  ------------ccactcctggcccaacat---------------
B D                   Dolphin  gaa-taa-----ccactcctggcccagcat---------------
                 Killer whale  gaa-taa-----ccactcctggcccagcat---------------
             Tibetan antelope  gaa-taa-----ccactcttggcccagcat---------------
B D                       Cow  gaa-taa-----ccactcctggcccagcat---------------
B D                     Sheep  gaa-taa-----ccactcctggcctagcat---------------
                Domestic goat  gaa-taa-----ccactcctggcccagcat---------------
B D                     Horse  gag-taa-----ccactcctgggccagcat---------------
B D          White rhinoceros  gag-taa-----ccactcctggcccaacat---------------
B D                       Cat  gag-taa-----ccgctcctgacccaaca----------------
B D                       Dog  ggg-taa-----ccactcctggcccagcgtct-------------
B D                     Panda  gag-taac----ccactcctggcccaacatct-------------
             Black flying-fox  aag-taa-----ta-tttttgtcccaatatct-------------
B D                   Megabat  aag-taa-----ca-tttttgtcccaatatct-------------
                Big brown bat  gag-tta-----cg---tctggcccaatatct-------------
         David's myotis (bat)  agg-taa-----cg---tctggcccactctct-------------
B D                  Microbat  gag-taa-----cg---tctggcccactctct-------------
B D                  Hedgehog  gtg-taattaatccgcccctgtgccaacac---------------
B D                     Shrew  aag-gaacc-atccattcctggccgaacat--tt-----------
              Star-nosed mole  ----------------tcttggtccaacat--tt-----------
B D                  Elephant  aag-taa-----ccactcctgg-ccaacat---------cttctc
          Cape elephant shrew  aag-taa-----ccattcctggtccaacat-------tccttacc
B D                   Manatee  aag-gaa-----ccactcctggcccaacat---------cttctc
             Cape golden mole  aag-aaa-----ccactccaggcccaacat---------ttcctt
B D                    Tenrec  ------------ccattcctggctcaacag---------ctcctc
                     Aardvark  aag-taa-----ccactacttgcccaacag------ctctttctc
B D                 Armadillo  aag-taa-----ctactcctgacctaacat------ccccttctc
B D                Guinea pig  =============================================
B D                       Rat  =============================================
B D                     Mouse  =============================================
B D                      Pika  =============================================
                  Chinchilla  =============================================
      Lesser Egyptian jerboa  =============================================
            Brush-tailed rat  =============================================
              Pacific walrus  =============================================
B D                  Bushbaby  ---------------------------------------------
B D                   Ferret   =============================================
                Weddell seal  =============================================
      Yellowbelly pufferfish  =============================================
B D                      Fugu  =============================================
B D               Stickleback  =============================================
         Pundamilia nyererei  =============================================
                 Zebra mbuna  =============================================
       Burton's mouthbreeder  =============================================
         Princess of Burundi  =============================================
B D                    Medaka  =============================================
B D                Coelacanth  =============================================
B D                    Turkey  =============================================
                 Spotted gar  =============================================
  D              Mallard duck  =============================================
  D             Scarlet macaw  =============================================
  D                    Parrot  =============================================
B D                Budgerigar  =============================================
B D                   Wallaby  =============================================
B D                    Lizard  =============================================
          Southern platyfish  =============================================
    Mexican tetra (cavefish)  =============================================
  D          Peregrine falcon  =============================================
B D                 Zebrafish  =============================================
  D               Rock pigeon  =============================================
B D                   Lamprey  =============================================
B D              Nile tilapia  =============================================
  D            Painted turtle  =============================================
B D                 Tetraodon  =============================================
B D                   Chicken  =============================================
B D              Atlantic cod  =============================================
  D       Collared flycatcher  =============================================
  D  Chinese softshell turtle  =============================================
B D           Squirrel monkey  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D              Saker falcon  =============================================
B D             X. tropicalis  =============================================
  D           Green seaturtle  =============================================
B D                   Opossum  =============================================
B D        American alligator  =============================================
          Tibetan ground jay  =============================================
B D           Tasmanian devil  =============================================

Inserts between block 22 and 23 in window
          Chinese tree shrew 7bp
B D                 Squirrel 4bp
                Prairie vole 4bp
B D          Chinese hamster 5bp
              Golden hamster 5bp
B D           Naked mole-rat 1bp
B D                      Pig 6bp
B D                   Alpaca 6bp
              Bactrian camel 3bp
B D                  Dolphin 6bp
                Killer whale 6bp
            Tibetan antelope 6bp
B D                      Cow 8bp
B D                    Sheep 6bp
               Domestic goat 6bp
B D                    Horse 6bp
B D         White rhinoceros 6bp
B D                      Cat 7bp
B D                      Dog 197bp
B D                    Panda 22bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 3bp
B D                    Shrew 7bp
             Star-nosed mole 4bp
            Cape golden mole 3bp

Alignment block 23 of 280 in window, 48942227 - 48942237, 11 bps 
B D                     Human  atttctcatat
B D                     Chimp  atttctcacat
B D                   Gorilla  atttctcacat
B D                 Orangutan  aattctcacat
B D                    Gibbon  atttctcacat
B D                    Rhesus  --ttctcacat
B D       Crab-eating macaque  --ttctcacat
B D                    Baboon  --ttctcacat
B D              Green monkey  --ttctcacat
B D                  Marmoset  att--tcacat
           Chinese tree shrew  atttgccacat
B D                  Squirrel  atttgcaacat
                 Prairie vole  atattccacag
B D           Chinese hamster  attttccacat
               Golden hamster  atcttccacat
B D            Naked mole-rat  -tttccagtat
B D                       Pig  attcaccacat
B D                    Alpaca  atttgctacgt
               Bactrian camel  atttgctacat
B D                   Dolphin  atttccaacat
                 Killer whale  atttccaacat
             Tibetan antelope  attttc-tcct
B D                       Cow  attttc-tcct
B D                     Sheep  attttc-tcct
                Domestic goat  attttc-tcct
B D                     Horse  atttgctacat
B D          White rhinoceros  atttgctacat
B D                       Cat  acttgctacat
             Black flying-fox  atttgctaagt
B D                   Megabat  atttgctaagt
                Big brown bat  ttc--------
         David's myotis (bat)  ttc--------
B D                  Microbat  ttc--------
B D                  Hedgehog  atatgctacat
B D                     Shrew  atttactacac
              Star-nosed mole  atttgctacgt
B D                  Elephant  attttccacat
          Cape elephant shrew  ctttctcacat
B D                   Manatee  attttccacat
             Cape golden mole  attttccatat
B D                    Tenrec  aattcccatat
                     Aardvark  atttcccacat
B D                 Armadillo  atttcccacat
B D                Guinea pig  ===========
B D                       Rat  ===========
B D                     Mouse  ===========
B D                      Pika  ===========
B D                    Rabbit  -----------
                  Chinchilla  ===========
      Lesser Egyptian jerboa  ===========
            Brush-tailed rat  ===========
              Pacific walrus  ===========
B D                       Dog  ===========
B D                  Bushbaby  -----------
B D                     Panda  ===========
B D                   Ferret   ===========
                Weddell seal  ===========
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
B D               Stickleback  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D                    Medaka  ===========
B D                Coelacanth  ===========
B D                    Turkey  ===========
                 Spotted gar  ===========
  D              Mallard duck  ===========
  D             Scarlet macaw  ===========
  D                    Parrot  ===========
B D                Budgerigar  ===========
B D                   Wallaby  ===========
B D                    Lizard  ===========
          Southern platyfish  ===========
    Mexican tetra (cavefish)  ===========
  D          Peregrine falcon  ===========
B D                 Zebrafish  ===========
  D               Rock pigeon  ===========
B D                   Lamprey  ===========
B D              Nile tilapia  ===========
  D            Painted turtle  ===========
B D                 Tetraodon  ===========
B D                   Chicken  ===========
B D              Atlantic cod  ===========
  D       Collared flycatcher  ===========
  D  Chinese softshell turtle  ===========
B D           Squirrel monkey  NNNNNNNNNNN
  D              Saker falcon  ===========
B D             X. tropicalis  ===========
  D           Green seaturtle  ===========
B D                   Opossum  ===========
B D        American alligator  ===========
          Tibetan ground jay  ===========
B D           Tasmanian devil  ===========

Inserts between block 23 and 24 in window
B D           Naked mole-rat 2087bp

Alignment block 24 of 280 in window, 48942238 - 48942252, 15 bps 
B D                     Human  aaaactgttagaaac
B D                     Chimp  aaaactgttagaaac
B D                   Gorilla  aaaactgttagaaac
B D                 Orangutan  aaaactgttagaaac
B D                    Gibbon  aaaactgttagaaac
B D                    Rhesus  aaaactgttagaaac
B D       Crab-eating macaque  aaaactgttagaaac
B D                    Baboon  aaaactgttagaaac
B D              Green monkey  aaaactgttagaaac
B D                  Marmoset  aaaactattagaaac
           Chinese tree shrew  acaactattagaaac
B D                  Squirrel  aaaactatcagaagc
                 Prairie vole  aaaattactccaaat
B D           Chinese hamster  aagattaccagaaat
               Golden hamster  aaaattaccagaaat
B D                       Pig  ------attagaaat
B D                    Alpaca  ------atgggaaat
               Bactrian camel  ------atgggaaat
B D                   Dolphin  ------attagaaat
                 Killer whale  ------attagaaat
             Tibetan antelope  ------attaaaaat
B D                       Cow  ------attaaaaat
B D                     Sheep  ------attaaaaat
                Domestic goat  ------attaaaaat
B D                     Horse  ------attagaaac
B D          White rhinoceros  ------attagaaac
B D                       Cat  ------ctt------
             Black flying-fox  ------attagaaac
B D                   Megabat  ------attagaaac
                Big brown bat  -------------ac
         David's myotis (bat)  -------------ac
B D                  Microbat  -------------ac
B D                  Hedgehog  ------attagcaac
B D                     Shrew  ------aatagaaac
              Star-nosed mole  ------attagaaac
B D                  Elephant  aaaaccattagaaac
          Cape elephant shrew  aacatgattagaaaa
B D                   Manatee  aaaatgattagaaac
             Cape golden mole  aaagcgattagaagc
B D                    Tenrec  taaatgattagaaac
                     Aardvark  gaaacgattacaaac
B D                 Armadillo  aaaactattagaaat
B D                Guinea pig  ===============
B D                       Rat  ===============
B D                     Mouse  ===============
B D                      Pika  ===============
B D                    Rabbit  ---------------
                  Chinchilla  ===============
      Lesser Egyptian jerboa  ===============
            Brush-tailed rat  ===============
              Pacific walrus  ===============
B D                       Dog  ===============
B D                  Bushbaby  ---------------
B D            Naked mole-rat  ===============
B D                     Panda  ===============
B D                   Ferret   ===============
                Weddell seal  ===============
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
B D               Stickleback  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D                    Medaka  ===============
B D                Coelacanth  ===============
B D                    Turkey  ===============
                 Spotted gar  ===============
  D              Mallard duck  ===============
  D             Scarlet macaw  ===============
  D                    Parrot  ===============
B D                Budgerigar  ===============
B D                   Wallaby  ===============
B D                    Lizard  ===============
          Southern platyfish  ===============
    Mexican tetra (cavefish)  ===============
  D          Peregrine falcon  ===============
B D                 Zebrafish  ===============
  D               Rock pigeon  ===============
B D                   Lamprey  ===============
B D              Nile tilapia  ===============
  D            Painted turtle  ===============
B D                 Tetraodon  ===============
B D                   Chicken  ===============
B D              Atlantic cod  ===============
  D       Collared flycatcher  ===============
  D  Chinese softshell turtle  ===============
B D           Squirrel monkey  NNNNNNNNNNNNNNN
  D              Saker falcon  ===============
B D             X. tropicalis  ===============
  D           Green seaturtle  ===============
B D                   Opossum  ===============
B D        American alligator  ===============
          Tibetan ground jay  ===============
B D           Tasmanian devil  ===============

Inserts between block 24 and 25 in window
B D                 Squirrel 2518bp

Alignment block 25 of 280 in window, 48942253 - 48942254, 2 bps 
B D                     Human  ct
B D                     Chimp  ct
B D                   Gorilla  ct
B D                 Orangutan  ct
B D                    Gibbon  ct
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  ct
B D                  Marmoset  ct
           Chinese tree shrew  ct
                 Prairie vole  ct
B D           Chinese hamster  ct
               Golden hamster  ct
B D                       Pig  tt
B D                    Alpaca  tc
               Bactrian camel  tc
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  gt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tt
B D          White rhinoceros  tt
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tt
B D                  Microbat  tt
B D                  Hedgehog  tt
B D                     Shrew  at
B D                  Elephant  ca
          Cape elephant shrew  ct
B D                   Manatee  ca
             Cape golden mole  cg
B D                    Tenrec  tc
                     Aardvark  ct
B D                 Armadillo  ct
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  ==
             Star-nosed mole  --
B D                  Squirrel  ==
B D                      Pika  ==
B D                    Rabbit  --
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
B D                       Dog  ==
B D                       Cat  --
B D                  Bushbaby  --
B D            Naked mole-rat  ==
B D                     Panda  ==
B D                   Ferret   ==
                Weddell seal  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
B D                   Wallaby  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D                   Lamprey  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  NN
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D        American alligator  ==
          Tibetan ground jay  ==
B D           Tasmanian devil  ==

Inserts between block 25 and 26 in window
              Golden hamster 12406bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp

Alignment block 26 of 280 in window, 48942255 - 48942256, 2 bps 
B D                     Human  -cc
B D                     Chimp  -cc
B D                   Gorilla  -cc
B D                 Orangutan  -cc
B D                    Gibbon  -cc
B D                    Rhesus  -cc
B D       Crab-eating macaque  -cc
B D                    Baboon  -cc
B D              Green monkey  -cc
B D                  Marmoset  -cc
           Chinese tree shrew  -cc
                 Prairie vole  -ct
B D           Chinese hamster  -ct
B D                       Pig  -c-
B D                    Alpaca  -c-
               Bactrian camel  -c-
B D                   Dolphin  -c-
                 Killer whale  -c-
             Tibetan antelope  -t-
B D                       Cow  -t-
B D                     Sheep  -t-
                Domestic goat  -t-
B D                     Horse  -t-
B D          White rhinoceros  -c-
             Black flying-fox  -t-
B D                   Megabat  -t-
B D                  Hedgehog  -c-
B D                  Elephant  cc-
          Cape elephant shrew  cc-
B D                   Manatee  cc-
             Cape golden mole  ct-
B D                    Tenrec  cc-
                     Aardvark  cc-
B D                 Armadillo  tc-
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
B D                     Shrew  ===
        David's myotis (bat)  ---
             Star-nosed mole  ---
B D                  Squirrel  ===
B D                      Pika  ===
B D                    Rabbit  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
            Brush-tailed rat  ===
              Pacific walrus  ===
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ---
B D                  Bushbaby  ---
               Big brown bat  ---
B D            Naked mole-rat  ===
B D                     Panda  ===
B D                   Ferret   ===
                Weddell seal  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
B D                Budgerigar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  NNN
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D        American alligator  ===
          Tibetan ground jay  ===
B D           Tasmanian devil  ===

Inserts between block 26 and 27 in window
B D                 Marmoset 287bp

Alignment block 27 of 280 in window, 48942257 - 48942259, 3 bps 
B D                     Human  aca
B D                     Chimp  aca
B D                   Gorilla  aca
B D                 Orangutan  aca
B D                    Gibbon  aca
B D                    Rhesus  aca
B D       Crab-eating macaque  aca
B D                    Baboon  aca
B D              Green monkey  aca
           Chinese tree shrew  aca
                 Prairie vole  gtg
B D           Chinese hamster  ata
B D                       Pig  aca
B D                    Alpaca  aca
               Bactrian camel  aca
B D                   Dolphin  aca
                 Killer whale  aca
             Tibetan antelope  atg
B D                       Cow  atg
B D                     Sheep  atg
                Domestic goat  atg
B D                     Horse  gaa
B D          White rhinoceros  aca
             Black flying-fox  aca
B D                   Megabat  aca
B D                  Hedgehog  aca
B D                  Elephant  aca
          Cape elephant shrew  aca
B D                   Manatee  aca
             Cape golden mole  aca
B D                    Tenrec  aca
                     Aardvark  aca
B D                 Armadillo  ata
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
B D                     Shrew  ===
        David's myotis (bat)  ---
             Star-nosed mole  ---
B D                  Squirrel  ===
B D                      Pika  ===
B D                    Rabbit  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
            Brush-tailed rat  ===
              Pacific walrus  ===
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ---
B D                  Bushbaby  ---
               Big brown bat  ---
B D            Naked mole-rat  ===
B D                     Panda  ===
B D                   Ferret   ===
                Weddell seal  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
B D                Budgerigar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                  Marmoset  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  NNN
  D              Saker falcon  ===
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D        American alligator  ===
          Tibetan ground jay  ===
B D           Tasmanian devil  ===

Inserts between block 27 and 28 in window
B D                 Hedgehog 145bp

Alignment block 28 of 280 in window, 48942260 - 48942261, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
           Chinese tree shrew  tt
                 Prairie vole  tt
B D           Chinese hamster  tt
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tt
B D          White rhinoceros  tt
             Black flying-fox  tt
B D                   Megabat  tt
B D                  Elephant  tt
          Cape elephant shrew  tt
B D                   Manatee  tt
             Cape golden mole  tt
B D                    Tenrec  gt
                     Aardvark  tt
B D                 Armadillo  tt
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  ==
B D                     Shrew  ==
        David's myotis (bat)  --
             Star-nosed mole  --
B D                  Squirrel  ==
B D                      Pika  ==
B D                    Rabbit  --
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
B D                       Dog  ==
B D                       Cat  --
B D                  Microbat  --
B D                  Bushbaby  --
               Big brown bat  --
B D            Naked mole-rat  ==
B D                     Panda  ==
B D                   Ferret   ==
                Weddell seal  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
B D                   Wallaby  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D                   Lamprey  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                  Marmoset  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  NN
  D              Saker falcon  ==
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D        American alligator  ==
          Tibetan ground jay  ==
B D           Tasmanian devil  ==

Inserts between block 28 and 29 in window
B D                   Alpaca 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
         Cape elephant shrew 402bp

Alignment block 29 of 280 in window, 48942262 - 48942262, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
           Chinese tree shrew  c
                 Prairie vole  c
B D           Chinese hamster  c
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  t
                     Aardvark  c
B D                 Armadillo  c
B D                  Hedgehog  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
            Tibetan antelope  =
         Cape elephant shrew  =
B D                     Shrew  =
        David's myotis (bat)  -
B D                     Horse  =
               Domestic goat  =
B D                     Sheep  =
B D                       Cow  =
B D                    Alpaca  =
             Star-nosed mole  -
B D                  Squirrel  =
B D                      Pika  =
B D                    Rabbit  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
B D          White rhinoceros  =
            Brush-tailed rat  =
              Pacific walrus  =
B D                       Dog  =
B D                       Cat  -
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
B D            Naked mole-rat  =
                Killer whale  =
              Bactrian camel  -
B D                     Panda  =
            Black flying-fox  =
B D                   Ferret   =
B D                   Dolphin  =
                Weddell seal  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                  Marmoset  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  N
  D              Saker falcon  =
B D             X. tropicalis  =
  D           Green seaturtle  =
B D                   Opossum  =
B D        American alligator  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  -
B D           Tasmanian devil  =

Inserts between block 29 and 30 in window
B D                  Gorilla 420bp
          Chinese tree shrew 16bp

Alignment block 30 of 280 in window, 48942263 - 48942263, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                 Orangutan  t
B D                    Gibbon  t
           Chinese tree shrew  c
                 Prairie vole  t
B D           Chinese hamster  c
B D                    Alpaca  c
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
             Black flying-fox  t
B D                   Megabat  t
B D                  Elephant  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                  Hedgehog  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  =
              Golden hamster  =
         Cape elephant shrew  =
B D                     Shrew  =
        David's myotis (bat)  -
             Star-nosed mole  -
B D                  Squirrel  =
B D                      Pika  =
B D                    Rabbit  -
                  Chinchilla  =
      Lesser Egyptian jerboa  =
            Brush-tailed rat  =
              Pacific walrus  =
B D                       Dog  =
B D                       Cat  -
B D                  Microbat  -
B D                  Bushbaby  -
               Big brown bat  -
B D            Naked mole-rat  =
              Bactrian camel  -
B D                     Panda  =
B D                   Ferret   =
                Weddell seal  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D             Scarlet macaw  =
  D                    Parrot  =
B D                Budgerigar  =
B D                   Wallaby  =
B D                    Lizard  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
  D          Peregrine falcon  =
B D                 Zebrafish  =
  D               Rock pigeon  =
B D                   Lamprey  =
B D              Nile tilapia  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D                  Marmoset  =
B D                   Chicken  =
B D              Atlantic cod  =
  D       Collared flycatcher  =
  D  Chinese softshell turtle  =
B D              Green monkey  -
B D           Squirrel monkey  N
  D              Saker falcon  =
B D                    Rhesus  -
B D             X. tropicalis  =
  D           Green seaturtle  =
B D                   Opossum  =
B D                   Gorilla  =
B D                    Baboon  -
B D        American alligator  =
          Tibetan ground jay  =
B D                       Pig  -
B D           Tasmanian devil  =
B D       Crab-eating macaque  -

Inserts between block 30 and 31 in window
                Prairie vole 2093bp
B D          Chinese hamster 23bp

Alignment block 31 of 280 in window, 48942264 - 48942265, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
           Chinese tree shrew  ta
B D           Chinese hamster  tg
B D                    Alpaca  ta
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  ta
B D          White rhinoceros  ta
             Black flying-fox  ta
B D                   Megabat  ta
B D                  Elephant  ta
B D                   Manatee  ta
             Cape golden mole  ta
B D                    Tenrec  ta
                     Aardvark  ta
B D                 Armadillo  ta
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  ==
              Golden hamster  ==
                Prairie vole  ==
         Cape elephant shrew  ==
B D                     Shrew  ==
        David's myotis (bat)  --
             Star-nosed mole  --
B D                  Squirrel  ==
B D                      Pika  ==
B D                    Rabbit  --
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
B D                       Dog  ==
B D                       Cat  --
B D                  Microbat  --
B D                  Bushbaby  --
               Big brown bat  --
B D            Naked mole-rat  ==
              Bactrian camel  --
B D                     Panda  ==
B D                   Ferret   ==
                Weddell seal  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D             Scarlet macaw  ==
  D                    Parrot  ==
B D                Budgerigar  ==
B D                   Wallaby  ==
B D                    Lizard  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
  D          Peregrine falcon  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D                   Lamprey  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D                  Marmoset  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D       Collared flycatcher  ==
  D  Chinese softshell turtle  ==
B D              Green monkey  --
B D           Squirrel monkey  NN
  D              Saker falcon  ==
B D                    Rhesus  --
B D             X. tropicalis  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D                   Gorilla  ==
B D                    Baboon  --
B D        American alligator  ==
          Tibetan ground jay  ==
B D                       Pig  --
B D           Tasmanian devil  ==
B D       Crab-eating macaque  --

Inserts between block 31 and 32 in window
B D                   Tenrec 641bp

Alignment block 32 of 280 in window, 48942266 - 48942267, 2 bps 
B D                     Human  -gg
B D                     Chimp  -gg
B D                 Orangutan  -gg
B D                    Gibbon  -gg
           Chinese tree shrew  -gc
B D           Chinese hamster  -gg
             Cape golden mole  ag-
B D                    Tenrec  ===
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
                Prairie vole  ===
B D                  Elephant  ---
            Tibetan antelope  ---
         Cape elephant shrew  ===
B D                     Shrew  ===
        David's myotis (bat)  ---
B D                     Horse  ---
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ---
B D                    Alpaca  ---
             Star-nosed mole  ---
B D                  Squirrel  ===
B D                      Pika  ===
B D                    Rabbit  ---
B D                 Armadillo  ---
B D                   Manatee  ---
                  Chinchilla  ===
      Lesser Egyptian jerboa  ===
B D          White rhinoceros  ---
            Brush-tailed rat  ===
              Pacific walrus  ===
B D                       Dog  ===
B D                       Cat  ---
B D                  Microbat  ---
B D                  Bushbaby  ---
               Big brown bat  ---
B D            Naked mole-rat  ===
                Killer whale  ---
              Bactrian camel  ---
B D                     Panda  ===
            Black flying-fox  ---
B D                   Ferret   ===
B D                   Dolphin  ---
                Weddell seal  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ---
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D             Scarlet macaw  ===
  D                    Parrot  ===
B D                Budgerigar  ===
B D                   Wallaby  ===
B D                    Lizard  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
  D          Peregrine falcon  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
B D                   Lamprey  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D                  Marmoset  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
  D       Collared flycatcher  ===
  D  Chinese softshell turtle  ===
B D              Green monkey  ---
B D           Squirrel monkey  NNN
  D              Saker falcon  ===
B D                    Rhesus  ---
B D             X. tropicalis  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D                   Gorilla  ===
B D                    Baboon  ---
B D        American alligator  ===
          Tibetan ground jay  ===
B D                   Megabat  ---
B D                       Pig  ---