Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 872 in window, 4854339 - 4854341, 3 bps 
B D                     Human  ct---a
B D                     Chimp  ct---a
B D                   Gorilla  ct---a
B D                 Orangutan  ct---a
B D                    Gibbon  ct---a
B D                    Rhesus  ct---a
B D       Crab-eating macaque  ct---a
B D                    Baboon  ct---a
B D              Green monkey  ct---a
B D                  Marmoset  ct---a
B D           Squirrel monkey  ctagaa
B D                    Alpaca  ct---g
               Bactrian camel  ct---g
B D                   Dolphin  ct---g
                 Killer whale  ct---g
             Tibetan antelope  ct---g
B D                       Cow  ct---g
B D                     Sheep  ct---g
                Domestic goat  ct---g
B D                     Horse  at---g
B D          White rhinoceros  ct---g
B D                       Cat  cg---g
B D                       Dog  cg---g
B D                   Ferret   cc---g
B D                     Panda  cg---g
               Pacific walrus  cg---g
                 Weddell seal  cg---g
             Black flying-fox  ct---g
B D                   Megabat  ct---g
                Big brown bat  ct---g
         David's myotis (bat)  ct---g
B D                  Microbat  ct---g
B D                     Shrew  ct---g
B D                  Elephant  ca---g
          Cape elephant shrew  tt---g
B D                   Manatee  ct---g
B D                    Tenrec  cc---t
                     Aardvark  ct---g
B D                 Armadillo  ct---g
             Star-nosed mole  ======
B D                    Rabbit  ======
            Brush-tailed rat  ======
              Golden hamster  ======
B D           Chinese hamster  ======
B D                     Mouse  ======
B D                       Rat  ======
                Prairie vole  ======
B D                      Pika  ======
                  Chinchilla  ======
          Chinese tree shrew  ======
B D                Guinea pig  ======
B D            Naked mole-rat  ======
      Lesser Egyptian jerboa  ======
B D                  Squirrel  ------
B D              Atlantic cod  ======
         Pundamilia nyererei  ======
         Princess of Burundi  ======
                 Spotted gar  ======
B D                      Fugu  ======
B D              Nile tilapia  ======
B D               Stickleback  ======
                 Zebra mbuna  ======
B D                 Zebrafish  ======
B D                    Medaka  ======
B D                 Tetraodon  ======
       Burton's mouthbreeder  ======
          Southern platyfish  ======
B D        American alligator  ======
B D                   Chicken  ======
  D              Mallard duck  ======
B D                Budgerigar  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
B D                  Platypus  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D       Collared flycatcher  ======
B D           Tasmanian devil  ======
B D                   Wallaby  ======
B D                    Turkey  ======
          Tibetan ground jay  ======
  D    White-throated sparrow  ======
  D           Green seaturtle  ======
B D                Coelacanth  ======
B D             X. tropicalis  ======
B D                   Opossum  ======
B D                       Pig  ------
  D    Spiny softshell turtle  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
            Cape golden mole  ======
B D                  Bushbaby  ======

Alignment block 2 of 872 in window, 4854342 - 4854343, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Squirrel  ta
       Lesser Egyptian jerboa  ta
B D                     Mouse  ta
B D                       Rat  ta
                   Chinchilla  ca
B D                       Pig  ta
B D                    Alpaca  ta
               Bactrian camel  ta
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  gg
B D                       Cow  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  ta
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  tg
B D                   Megabat  tg
                Big brown bat  tg
         David's myotis (bat)  tg
B D                  Microbat  tg
B D                     Shrew  ca
B D                  Elephant  ta
          Cape elephant shrew  gg
B D                   Manatee  ta
B D                    Tenrec  tg
                     Aardvark  tg
B D                 Armadillo  ta
             Star-nosed mole  ==
B D                    Rabbit  ==
            Brush-tailed rat  ==
              Golden hamster  ==
B D           Chinese hamster  ==
                Prairie vole  ==
B D                      Pika  ==
          Chinese tree shrew  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
B D              Atlantic cod  ==
         Pundamilia nyererei  ==
         Princess of Burundi  ==
                 Spotted gar  ==
B D                      Fugu  ==
B D              Nile tilapia  ==
B D               Stickleback  ==
                 Zebra mbuna  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
B D                 Tetraodon  ==
       Burton's mouthbreeder  ==
          Southern platyfish  ==
B D        American alligator  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                  Platypus  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Wallaby  ==
B D                    Turkey  ==
          Tibetan ground jay  ==
  D    White-throated sparrow  ==
  D           Green seaturtle  ==
B D                Coelacanth  ==
B D             X. tropicalis  ==
B D                   Opossum  ==
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
            Cape golden mole  ==
B D                  Bushbaby  ==

Inserts between block 2 and 3 in window
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp

Alignment block 3 of 872 in window, 4854344 - 4854344, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
B D                     Mouse  c
B D                       Rat  c
                   Chinchilla  c
B D                    Rabbit  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                     Shrew  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
             Star-nosed mole  =
            Brush-tailed rat  =
              Golden hamster  =
B D           Chinese hamster  =
                Prairie vole  =
B D                      Pika  =
          Chinese tree shrew  =
B D                Guinea pig  =
B D            Naked mole-rat  =
B D              Atlantic cod  =
         Pundamilia nyererei  =
         Princess of Burundi  =
                 Spotted gar  =
B D                      Fugu  =
B D              Nile tilapia  =
B D               Stickleback  =
                 Zebra mbuna  =
B D                 Zebrafish  =
B D                    Medaka  =
B D                 Tetraodon  =
       Burton's mouthbreeder  =
          Southern platyfish  =
B D        American alligator  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D       Medium ground finch  =
B D                    Lizard  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                    Turkey  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                   Opossum  =
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
            Cape golden mole  =
B D                  Bushbaby  =

Alignment block 4 of 872 in window, 4854345 - 4854346, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tt
B D                     Mouse  tt
B D                       Rat  tt
B D                Guinea pig  tt
                   Chinchilla  tt
             Brush-tailed rat  tt
B D                    Rabbit  tt
B D                       Pig  tg
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tt
B D          White rhinoceros  tt
B D                       Cat  tt
B D                       Dog  tt
B D                   Ferret   tt
B D                     Panda  tt
               Pacific walrus  tt
                 Weddell seal  tt
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tt
B D                  Microbat  tt
B D                     Shrew  tc
B D                  Elephant  tt
          Cape elephant shrew  tt
B D                   Manatee  tt
B D                    Tenrec  gc
                     Aardvark  tt
B D                 Armadillo  tt
             Star-nosed mole  ==
              Golden hamster  ==
B D           Chinese hamster  ==
                Prairie vole  ==
B D                      Pika  ==
          Chinese tree shrew  ==
B D            Naked mole-rat  ==
B D              Atlantic cod  ==
         Pundamilia nyererei  ==
         Princess of Burundi  ==
                 Spotted gar  ==
B D                      Fugu  ==
B D              Nile tilapia  ==
B D               Stickleback  ==
                 Zebra mbuna  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
B D                 Tetraodon  ==
       Burton's mouthbreeder  ==
          Southern platyfish  ==
B D        American alligator  ==
B D                   Chicken  ==
  D              Mallard duck  ==
B D                Budgerigar  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
B D                  Platypus  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Wallaby  ==
B D                    Turkey  ==
          Tibetan ground jay  ==
  D    White-throated sparrow  ==
  D           Green seaturtle  ==
B D                Coelacanth  ==
B D             X. tropicalis  ==
B D                   Opossum  ==
  D    Spiny softshell turtle  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
            Cape golden mole  ==
B D                  Bushbaby  ==

Alignment block 5 of 872 in window, 4854347 - 4854357, 11 bps 
B D                     Human  tagtg----catttc
B D                     Chimp  taatg----catttc
B D                   Gorilla  taatg----catttc
B D                 Orangutan  tcatg----catttc
B D                    Gibbon  taatg----catttc
B D                    Rhesus  taatg----catttc
B D       Crab-eating macaque  taatg----catttc
B D                    Baboon  taatg----catttc
B D              Green monkey  taatg----catttc
B D                  Marmoset  tagtg----catttc
B D           Squirrel monkey  tagtg----catttc
B D                  Squirrel  taatg----ctcttg
       Lesser Egyptian jerboa  ta--g----cagttc
B D                     Mouse  cagtg----cagttt
B D                       Rat  caatg----cagttt
B D                Guinea pig  cagag----catttg
                   Chinchilla  cagtg----cacttg
             Brush-tailed rat  cagcg----cattca
B D                    Rabbit  cagtg----cgtttc
B D                       Pig  taatg----cttttt
B D                    Alpaca  taatg----cttttc
               Bactrian camel  taatg----cttttc
B D                   Dolphin  taatg----cgtttc
                 Killer whale  taatg----cgtttc
             Tibetan antelope  tagag----cgtctc
B D                       Cow  tagag----catctc
B D                     Sheep  cagag----catctc
                Domestic goat  cagag----catctc
B D                     Horse  taacg----catctc
B D          White rhinoceros  taatg----catttc
B D                       Cat  caatgcattcatttc
B D                       Dog  caatgcgttcatttc
B D                   Ferret   caatgcattcatttc
B D                     Panda  cagtgcattcatttc
               Pacific walrus  cagtgcattcatttc
                 Weddell seal  caatgcattcatttc
             Black flying-fox  gaata----cattgc
B D                   Megabat  gaata----cattgc
                Big brown bat  taatg----cgtttc
         David's myotis (bat)  taatg----cgtttc
B D                  Microbat  taatg----catttc
B D                     Shrew  tcctg----cgtttc
B D                  Elephant  taatg----catttc
          Cape elephant shrew  taaca----cagttc
B D                   Manatee  taaag----cgtttc
             Cape golden mole  tgatg----catctc
B D                    Tenrec  gaacg----aagatc
                     Aardvark  tagtg----catttc
B D                 Armadillo  taatg----cattcc
             Star-nosed mole  ===============
              Golden hamster  ===============
B D           Chinese hamster  ===============
                Prairie vole  ===============
B D                      Pika  ===============
          Chinese tree shrew  ===============
B D            Naked mole-rat  ===============
B D              Atlantic cod  ===============
         Pundamilia nyererei  ===============
         Princess of Burundi  ===============
                 Spotted gar  ===============
B D                      Fugu  ===============
B D              Nile tilapia  ===============
B D               Stickleback  ===============
                 Zebra mbuna  ===============
B D                 Zebrafish  ===============
B D                    Medaka  ===============
B D                 Tetraodon  ===============
       Burton's mouthbreeder  ===============
          Southern platyfish  ===============
B D        American alligator  ===============
B D                   Chicken  ===============
  D              Mallard duck  ===============
B D                Budgerigar  ===============
  D              Saker falcon  ===============
  D               Rock pigeon  ===============
B D                  Platypus  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D       Collared flycatcher  ===============
B D           Tasmanian devil  ===============
B D                   Wallaby  ===============
B D                    Turkey  ===============
          Tibetan ground jay  ===============
  D    White-throated sparrow  ===============
  D           Green seaturtle  ===============
B D                Coelacanth  ===============
B D             X. tropicalis  ===============
B D                   Opossum  ===============
  D    Spiny softshell turtle  ===============
  D  Chinese softshell turtle  ===============
  D            Painted turtle  ===============
B D                  Bushbaby  ===============

Alignment block 6 of 872 in window, 4854358 - 4854360, 3 bps 
B D                     Human  ctc
B D                     Chimp  ctc
B D                   Gorilla  ctc
B D                 Orangutan  gtc
B D                    Gibbon  gtc
B D                    Rhesus  gtc
B D       Crab-eating macaque  gtc
B D                    Baboon  gtc
B D              Green monkey  gtc
B D                  Marmoset  gtc
B D           Squirrel monkey  ttc
B D                  Squirrel  gat
       Lesser Egyptian jerboa  agc
B D                     Mouse  ggt
B D                       Rat  gac
B D                Guinea pig  gtg
                   Chinchilla  gtg
             Brush-tailed rat  ggg
B D                    Rabbit  gtc
B D                       Pig  gtc
B D                    Alpaca  atc
               Bactrian camel  atc
B D                   Dolphin  gtc
                 Killer whale  gtc
             Tibetan antelope  ctc
B D                       Cow  ctc
B D                     Sheep  ctc
                Domestic goat  ctc
B D                     Horse  gtc
B D          White rhinoceros  gtc
B D                       Cat  gtc
B D                       Dog  gtc
B D                   Ferret   atc
B D                     Panda  gtc
               Pacific walrus  gtc
                 Weddell seal  ctc
             Black flying-fox  gac
B D                   Megabat  gtc
                Big brown bat  ctc
         David's myotis (bat)  ctc
B D                  Microbat  ctc
B D                     Shrew  ttc
              Star-nosed mole  -ct
B D                  Elephant  gtc
          Cape elephant shrew  atc
B D                   Manatee  gtc
             Cape golden mole  atc
B D                    Tenrec  ttc
                     Aardvark  gtc
B D                 Armadillo  agg
              Golden hamster  ===
B D           Chinese hamster  ===
                Prairie vole  ===
B D                      Pika  ===
          Chinese tree shrew  ===
B D            Naked mole-rat  ===
B D              Atlantic cod  ===
         Pundamilia nyererei  ===
         Princess of Burundi  ===
                 Spotted gar  ===
B D                      Fugu  ===
B D              Nile tilapia  ===
B D               Stickleback  ===
                 Zebra mbuna  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
B D                 Tetraodon  ===
       Burton's mouthbreeder  ===
          Southern platyfish  ===
B D        American alligator  ===
B D                   Chicken  ===
  D              Mallard duck  ===
B D                Budgerigar  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D                  Platypus  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D       Collared flycatcher  ===
B D           Tasmanian devil  ===
B D                   Wallaby  ===
B D                    Turkey  ===
          Tibetan ground jay  ===
  D    White-throated sparrow  ===
  D           Green seaturtle  ===
B D                Coelacanth  ===
B D             X. tropicalis  ===
B D                   Opossum  ===
  D    Spiny softshell turtle  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
B D                  Bushbaby  ===

Alignment block 7 of 872 in window, 4854361 - 4854361, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  g
B D                    Rabbit  t
B D                       Pig  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  t
          Cape elephant shrew  c
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D           Chinese hamster  =
              Bactrian camel  -
B D                    Alpaca  -
B D                      Pika  =
          Chinese tree shrew  =
B D              Atlantic cod  =
         Pundamilia nyererei  =
         Princess of Burundi  =
                 Spotted gar  =
B D                      Fugu  =
B D              Nile tilapia  =
B D               Stickleback  =
                 Zebra mbuna  =
B D                 Zebrafish  =
B D                    Medaka  =
B D                 Tetraodon  =
       Burton's mouthbreeder  =
          Southern platyfish  =
B D        American alligator  =
B D                   Chicken  =
  D              Mallard duck  =
B D                Budgerigar  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D                  Platypus  =
B D       Medium ground finch  =
B D                    Lizard  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Wallaby  =
B D                    Turkey  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                Coelacanth  =
B D             X. tropicalis  =
B D                   Opossum  =
  D    Spiny softshell turtle  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                  Bushbaby  =

Alignment block 8 of 872 in window, 4854362 - 4854365, 4 bps 
B D                     Human  tttg
B D                     Chimp  tttg
B D                   Gorilla  tttg
B D                 Orangutan  tttg
B D                    Gibbon  tttg
B D                    Rhesus  tttg
B D       Crab-eating macaque  tttg
B D                    Baboon  tttg
B D              Green monkey  tttg
B D                  Marmoset  cttg
B D           Squirrel monkey  cttg
       Lesser Egyptian jerboa  tttg
                 Prairie vole  tttg
B D           Chinese hamster  tttg
               Golden hamster  tttg
B D                     Mouse  tttg
B D                       Rat  tttg
B D            Naked mole-rat  tttg
B D                Guinea pig  tttg
                   Chinchilla  tttg
             Brush-tailed rat  tttg
B D                    Rabbit  tttg
B D                       Pig  tttg
B D                    Alpaca  tttg
               Bactrian camel  tttg
B D                   Dolphin  tttg
                 Killer whale  tttg
             Tibetan antelope  tttg
B D                       Cow  tttg
B D                     Sheep  tttg
                Domestic goat  tttg
B D                     Horse  tttg
B D          White rhinoceros  tttg
B D                       Cat  cttg
B D                       Dog  cttg
B D                   Ferret   cttg
B D                     Panda  cttg
               Pacific walrus  cttg
                 Weddell seal  cttg
             Black flying-fox  tgtg
B D                   Megabat  tgtg
                Big brown bat  cgtg
         David's myotis (bat)  cgtg
B D                  Microbat  tgtg
B D                     Shrew  tttg
              Star-nosed mole  tttg
B D                  Elephant  tttg
          Cape elephant shrew  gtgg
B D                   Manatee  tttg
             Cape golden mole  ttcg
B D                    Tenrec  ttgg
                     Aardvark  tttg
B D                 Armadillo  tt-g
B D                      Pika  ====
          Chinese tree shrew  ====
B D                  Squirrel  ----
B D              Atlantic cod  ====
         Pundamilia nyererei  ====
         Princess of Burundi  ====
                 Spotted gar  ====
B D                      Fugu  ====
B D              Nile tilapia  ====
B D               Stickleback  ====
                 Zebra mbuna  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
B D                 Tetraodon  ====
       Burton's mouthbreeder  ====
          Southern platyfish  ====
B D        American alligator  ====
B D                   Chicken  ====
  D              Mallard duck  ====
B D                Budgerigar  ====
  D              Saker falcon  ====
  D               Rock pigeon  ====
B D                  Platypus  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D       Collared flycatcher  ====
B D           Tasmanian devil  ====
B D                   Wallaby  ====
B D                    Turkey  ====
          Tibetan ground jay  ====
  D    White-throated sparrow  ====
  D           Green seaturtle  ====
B D                Coelacanth  ====
B D             X. tropicalis  ====
B D                   Opossum  ====
  D    Spiny softshell turtle  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
B D                  Bushbaby  ====

Alignment block 9 of 872 in window, 4854366 - 4854378, 13 bps 
B D                     Human  aa-----agcgccccgag--
B D                     Chimp  aa-----agcgccccgag--
B D                   Gorilla  aa-----agcgccccgag--
B D                 Orangutan  aa-----agcgccccgag--
B D                    Gibbon  aa-----agcgcccggag--
B D                    Rhesus  aa-----agcgccccgag--
B D       Crab-eating macaque  aa-----agcgcccctag--
B D                    Baboon  aa-----agcgccccgag--
B D              Green monkey  aa-----agcgccccgag--
B D                  Marmoset  ga-----agctccccgag--
B D           Squirrel monkey  ga-----agctccccggg--
B D                  Bushbaby  aa-----cgcgtacctag--
B D                  Squirrel  ----------------tt--
       Lesser Egyptian jerboa  aa-----ccagccttttg--
                 Prairie vole  ga-----ggggccc-aag--
B D           Chinese hamster  ga-----gaggccc-tag--
               Golden hamster  ga-----ggggccc-tag--
B D                     Mouse  aa-----agggccc-aag--
B D                       Rat  ga-----ggggccc--ag--
B D            Naked mole-rat  ga-----aacgcccaggg--
B D                Guinea pig  ga-----aacacctaaag--
                   Chinchilla  ga-----aacacctagag--
             Brush-tailed rat  ga-----aacgcctaggg--
B D                    Rabbit  aa-----ggcgcc-------
B D                       Pig  aa-----agcttggggaa--
B D                    Alpaca  aa-----agctcaatgaa--
               Bactrian camel  aa-----agcccaatgaa--
B D                   Dolphin  ac-----agctcagtgag--
                 Killer whale  ac-----agctcagtgag--
             Tibetan antelope  aa-----agctccctgag--
B D                       Cow  aa-----agctccctgag--
B D                     Sheep  aa-----agctccctgag--
                Domestic goat  aa-----agctccctgag--
B D                     Horse  aa-----agcgcgat-----
B D          White rhinoceros  aa-----aacgcggtgag--
B D                       Cat  aa-----agcgcagcgag--
B D                       Dog  aa-----agcgcagtgag--
B D                   Ferret   aa-----agcgcagtgag--
B D                     Panda  aa-----agcgcagtgag--
               Pacific walrus  aa-----agcgcagtgag--
                 Weddell seal  aa-----agcgcagtgag--
             Black flying-fox  ga-----agcgaggcgag--
B D                   Megabat  ga-----agcgagacgag--
                Big brown bat  aa-----aacgccgcgag--
         David's myotis (bat)  aa-----aactccgcaag--
B D                  Microbat  aa-----aa-----------
B D                     Shrew  aa----cagcgccagggg--
              Star-nosed mole  caaagtcggtgccacgag--
B D                  Elephant  aa-----agcgcctggaggg
          Cape elephant shrew  ga-----agcgcagcgctgt
B D                   Manatee  aa-----agcgccgcaaggg
             Cape golden mole  aa-----attgttgtacggg
B D                    Tenrec  aa-----agagcc---cgag
                     Aardvark  aa-----agcgccgcgcgag
B D                 Armadillo  aa-----agggcctagagaa
B D                      Pika  ====================
          Chinese tree shrew  ====================
B D              Atlantic cod  ====================
         Pundamilia nyererei  ====================
         Princess of Burundi  ====================
                 Spotted gar  ====================
B D                      Fugu  ====================
B D              Nile tilapia  ====================
B D               Stickleback  ====================
                 Zebra mbuna  ====================
B D                 Zebrafish  ====================
B D                    Medaka  ====================
B D                 Tetraodon  ====================
       Burton's mouthbreeder  ====================
          Southern platyfish  ====================
B D        American alligator  ====================
B D                   Chicken  ====================
  D              Mallard duck  ====================
B D                Budgerigar  ====================
  D              Saker falcon  ====================
  D               Rock pigeon  ====================
B D                  Platypus  ====================
B D       Medium ground finch  ====================
B D                    Lizard  ====================
  D       Collared flycatcher  ====================
B D           Tasmanian devil  ====================
B D                   Wallaby  ====================
B D                    Turkey  ====================
          Tibetan ground jay  ====================
  D    White-throated sparrow  ====================
  D           Green seaturtle  ====================
B D                Coelacanth  ====================
B D             X. tropicalis  ====================
B D                   Opossum  ====================
  D    Spiny softshell turtle  ====================
  D  Chinese softshell turtle  ====================
  D            Painted turtle  ====================

Alignment block 10 of 872 in window, 4854379 - 4854428, 50 bps 
B D                     Human  a-gag-gctgcaccca------g-----gaa-tgaagggag--------------t------------gg
B D                     Chimp  a-gag-gctgcaccca------g-----gaa-tgaagggag--------------c------------gg
B D                   Gorilla  a-gag-gctgcaccca------g-----gaa-tgaagggac--------------t------------gg
B D                 Orangutan  a-gag-gctgcacccg------g-----gag-tgaagggag--------------t------------gg
B D                    Gibbon  a-gag-gctgcaccca------g-----gag-tgaagggag--------------t------------gg
B D                    Rhesus  a-gag-gctgcaccca------a-----gag-tgaagggag--------------t------------gg
B D       Crab-eating macaque  a-gag-gctgcaccca------a-----gag-tgaagggat--------------t------------gg
B D                    Baboon  a-gag-gctgcaccca------a-----gag-tgaagggag--------------t------------gg
B D              Green monkey  a-gag-gctgcaccca------g-----gag-tgaagggag--------------t------------gg
B D                  Marmoset  a-gag-gctgcacccg------g-----gag-tgaagggag--------------t------------gg
B D           Squirrel monkey  a-gag-gctgcaccca------g-----gag-tgaagggag--------------t------------gg
B D                  Bushbaby  a-gag-gctgc-cctg------g-----gaa-tggacggagggcgc---------t------------gg
           Chinese tree shrew  a-gag-gatgc-ccct------g-----ggc-tggatagag--------------t------------gg
B D                  Squirrel  t-gag-actgcttctg------g-----gagctgaaagagt---------------------------gg
       Lesser Egyptian jerboa  a-gat-gttgctcctg------g-----gaa-tgggaaagt---------------------------gg
                 Prairie vole  t-gag-gctgttcctc------g-----caa-tgaaaaagg--------------caaggtgg-----gg
B D           Chinese hamster  t-gag-gctattcctc------g-----taa-tgaaaaagg--------------caaggcgg-----gg
               Golden hamster  c-gag-gctgttcctcgta-aag-----taa-tgaaaaagg--------------caaggcgg-----gg
B D                     Mouse  a-gag-gctgctcttg------g-----gaa-tgaaaaagg--------------ccaggctgaa---ga
B D                       Rat  a-gag-tctgctcctg------g-----taa-tg-aaaagg--------------ccacactgaa---aa
B D            Naked mole-rat  a-gag-gccgctcccg------g-----gag-tggaaaaag--------------tggatt---------
B D                Guinea pig  a-gag-gctgctcctg------g-----gag-tgggaaaag--------------tggattaaaaagtgg
                   Chinchilla  a-gag-gccgatcctg------g-----gag-tggaaaaag--------------tggattaaaaagtgg
             Brush-tailed rat  a-gag-gctgatcctg------g-----gag-tggaaaaag--------------tggattaaaaagtgg
B D                    Rabbit  ---------gctcccg------g-----gag-aggggagc----------------------------gg
B D                       Pig  a-gag-acaaacccatctc-tcc-----cat-ggcaaaaag--------------t------------gg
B D                    Alpaca  g-gag-accactacaa------a-----gag-tgaaaagag--------------t------------gg
               Bactrian camel  g-gag-accactacaa------a-----gag-tgaaaagag--------------t------------gg
B D                   Dolphin  aggag-accgctacag------c-----gag-tgaaaagag--------------t------------gg
                 Killer whale  aggag-accgctacag------c-----gag-tgaaaagag--------------t------------gg
             Tibetan antelope  a-cag-actgctgca-------------gag-tg--aagag--------------t------------gg
B D                       Cow  a-gag-actgccaca-------------gag-tg--aagag--------------t------------gg
B D                     Sheep  a-cag-actgccgca-------------gag-tgaaaagag--------------t------------gg
                Domestic goat  a-cag-actgccgca-------------gaa-tgaaaagag--------------t------------gg
B D                     Horse  --gag-accgctctca------g-----gag-tgaaaagag--------------c------------ag
B D          White rhinoceros  a-gag-accgctccca------g-----gag-taagaagag--------------t------------gg
B D                       Cat  a-gag-accgctcccc------g-----cag-tgtaaggag--------------t------------gg
B D                       Dog  a-gag-atcgcttcct------g-----cag-tgtaaagagagatcgcttcctgcg------------gc
B D                   Ferret   a-gag-atcgctccct------g-----cag-tgtaaggag--------------t------------gc
B D                     Panda  a-gag-attgctccct------g-----cag-tgtaaggag--------------t------------ga
               Pacific walrus  a-gag-atcgctccct------g-----cag-tgtaaggag--------------t------------gc
                 Weddell seal  a-gag-atcgctccct------g-----cag-tgtaaggag--------------t------------gc
             Black flying-fox  g-gag-a-cgctcccg------g-----gaa-tgagtgga------------------------------
B D                   Megabat  g-gag-a-cgctccgg------g-----caa-tgagtgga------------------------------
                Big brown bat  g-gag-g-tgctcccg------g-----ggg-ttaaaggac--------------t------------ga
         David's myotis (bat)  g-gag-g-tgctcccc------a-----ggg-ttaaaggac--------------t------------gg
B D                  Microbat  ----------ctcccc------g-----ggg-ttaaaggac--------------t------------gg
B D                     Shrew  a-act-gctgcctgta------aagggtggg-tgggggcgg--------------g------------gg
              Star-nosed mole  a-ggt-g--gccgctc------a--ggtgag-tggaaccag--------------t------------gg
B D                  Elephant  a-gag-gctgctcccaggcgtgg-----aag-gaaagagtg--------------t------------gg
          Cape elephant shrew  a-aaa-gcctctctgcgtggtgg-----act-gaaagagtg--------------a------------gg
B D                   Manatee  a-gag-gctgctcccaggagtgg-----atg-gaaagagtg--------------t------------gg
             Cape golden mole  a-aag-gctgttcgtgggcatgg-----ata-ctaaatgtg--------------t------------gg
B D                    Tenrec  g-aag---------------------------cgatgcgtg--------------t------------gg
                     Aardvark  a-gag-gcggctcccgggcgtgg-----gcg-caaagcgtg--------------t------------gg
B D                 Armadillo  a-gaaagtcattccc-----tgg-----agg-aggaaagag--------------t------------gt
B D                      Pika  ======================================================================
B D              Atlantic cod  ======================================================================
         Pundamilia nyererei  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                      Fugu  ======================================================================
B D              Nile tilapia  ======================================================================
B D               Stickleback  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                   Opossum  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================

                        Human  a--ttcc-------------a--------g--gcgttcagaccca
                        Chimp  a--ttcc-------------a--------g--gcgttcagaccca
                      Gorilla  a--ttcc-------------a--------g--gcgttcagaccca
                    Orangutan  a--ttcc-------------a--------g--gcgttcagatcca
                       Gibbon  a--ttcc-------------a--------g--gcgttcagaccca
                       Rhesus  a--ttcc-------------a--------g--gctttcagaccca
          Crab-eating macaque  a--ttcc-------------a--------g--gcgttcagaccca
                       Baboon  a--ttcc-------------a--------g--gcgttcagaccca
                 Green monkey  a--ttcc-------------a--------g--gcgttcagaccca
                     Marmoset  a--ttct-------------a--------t--tcgttcagaccca
              Squirrel monkey  a--ttcc-------------a--------g--gcgttcagaccca
                     Bushbaby  a--tttc-------------a--------g--ggttttagatcca
           Chinese tree shrew  a--tttc-------------g--------ggagggttcataccca
                     Squirrel  g--tttg----------------------g--tggttcagaacca
       Lesser Egyptian jerboa  a--ttac-------------a--------a--tggtttcgaccca
                 Prairie vole  g--cttg-------------a--------g--tggttcggagctc
              Chinese hamster  g--tttg-------------a--------g--tgcttcagagcta
               Golden hamster  g--tttg-------------a--------g--tgctt-agagcta
                        Mouse  g--tttg-------------g--------a--tggttcgtacaaa
                          Rat  g--cttg-------------g--------a--tgcttcggagata
               Naked mole-rat  -----tt-------------g--------g--tggttcagactca
                   Guinea pig  g--tttc-------------a--------g--gggtgtagactca
                   Chinchilla  g--tctc-------------g--------g--tggtatagactta
             Brush-tailed rat  g--tttt-------------g--------c--tggtatagactga
                       Rabbit  a--tttc-------------t--------g--gggctcagaccca
                          Pig  a----tt-------------g--------g--agtttcagactca
                       Alpaca  g----tt-------------g--------g--gggttccaaccca
               Bactrian camel  g-----t-------------g--------g--gggttccaaccca
                      Dolphin  t----tt-------------g--------g--ggattcaga-cca
                 Killer whale  t----tt-------------g--------g--ggattcaga-cca
             Tibetan antelope  a----tt-------------t--------g--gggctcagaccca
                          Cow  a----tt-------------c--------g--gggctcagaccca
                        Sheep  a----tt-------------c--------g--gggctcagaccca
                Domestic goat  a----tt-------------c--------g--gggctcagaccca
                        Horse  a--tttc-------------g--------g--aggttcagaccca
             White rhinoceros  a--tttc-------------a--------g--gggttcagaccca
                          Cat  a--tttc-------------g--------g--gggttcagaccca
                          Dog  a--tttc-------------gggcatttcg--gggttcagaccca
                      Ferret   a--tttc-------------g--------g--gggttcagaccca
                        Panda  a--tttc-------------a--------g--gggttcagaccca
               Pacific walrus  a--tttt-------------g--------g--gggttcagaccca
                 Weddell seal  a--tttt-------------g--------g--gggttcagaccca
             Black flying-fox  ---attc-------------g--------g--tgtttcagaacca
                      Megabat  ---attc-------------g--------g--tgtttcagaacca
                Big brown bat  aatattc-------------g--------g--aggttcagaccca
         David's myotis (bat)  aatattc-------------g--------g--ggcttcagaccca
                     Microbat  aatattc-------------g--------g--ggcttcagaccca
                        Shrew  c----------------------------c--gcatcacggctcc
              Star-nosed mole  a----------------------------g--gggtctcctggcc
                     Elephant  a--tggcggggtgaggggggg--------g--gggttcagatcca
          Cape elephant shrew  a--tttt----------------------g--ggcctcagccaca
                      Manatee  a--tttc-------------g--------g--ggatccagaccca
             Cape golden mole  a--tttc-------------t--------a--gagctccgaccca
                       Tenrec  a--tttc-----agggaatga--------g--gggctcagaccca
                     Aardvark  a--tttc-------------g--------g--ggattcggaccca
                    Armadillo  a--ttta----------------------g--gggttcggaacca
                         Pika  =============================================
                 Atlantic cod  =============================================
          Pundamilia nyererei  =============================================
          Princess of Burundi  =============================================
                  Spotted gar  =============================================
                         Fugu  =============================================
                 Nile tilapia  =============================================
                  Stickleback  =============================================
                  Zebra mbuna  =============================================
                    Zebrafish  =============================================
                       Medaka  =============================================
                    Tetraodon  =============================================
        Burton's mouthbreeder  =============================================
           Southern platyfish  =============================================
           American alligator  =============================================
                      Chicken  =============================================
                 Mallard duck  =============================================
                   Budgerigar  =============================================
                 Saker falcon  =============================================
                  Rock pigeon  =============================================
                     Platypus  =============================================
          Medium ground finch  =============================================
                       Lizard  =============================================
          Collared flycatcher  =============================================
              Tasmanian devil  =============================================
                      Wallaby  =============================================
                       Turkey  =============================================
           Tibetan ground jay  =============================================
       White-throated sparrow  =============================================
              Green seaturtle  =============================================
                   Coelacanth  =============================================
                X. tropicalis  =============================================
                      Opossum  =============================================
       Spiny softshell turtle  =============================================
     Chinese softshell turtle  =============================================
               Painted turtle  =============================================

Alignment block 11 of 872 in window, 4854429 - 4854517, 89 bps 
B D                     Human  c---ctgcgaacagat--------cctg----a------tgccacta-ctaact--------agctgtgt
B D                     Chimp  c---ctgcgagcagat--------cctg----a------tgccacta-ctaact--------agctgtgt
B D                   Gorilla  c---ctgcgaacagat--------cctg----a------tgccacta-ctaact--------agctgtgt
B D                 Orangutan  c---ctgcgaacagat--------cctg----g------tgtcacta-ctaact--------agctgtgt
B D                    Gibbon  c---ctgcgaacagat--------cctg----g------tgccacta-ctaact--------agctgtgt
B D                    Rhesus  c---ctgcgaacagat--------cccg----g------tcccacta-ctaact--------agctgtgt
B D       Crab-eating macaque  c---ctgcgaacagat--------cccg----g------tcccacta-ctaact--------agctgtgt
B D                    Baboon  c---ctgcgaacagat--------cccg----g------tcccacta-ctaact--------agctgtgt
B D              Green monkey  c---ctgcgaacagat--------cccg----g------tcccacta-ctaact--------agctgtgt
B D                  Marmoset  c---ctgcgaacagat--------cccg----g------tgccacta-ctaact--------agctgtgt
B D           Squirrel monkey  c---ctgcaaacagat--------cccg----g------tgccacta-ctaact--------agctgtgt
B D                  Bushbaby  c---ctgggaccagat--------cctg----c------tgccccgg-ctaacc--------agctgagt
           Chinese tree shrew  c---atggggccagat--------tct----------------------caact--------agctgtgt
B D                  Squirrel  cccctgccaacc--ac--------cact----a------------------act--------agtggtgt
       Lesser Egyptian jerboa  c---tggcaaccagat--------cctc----a------c---acc-----acc--------acttgtat
                 Prairie vole  c---cagcaatcccac--------c--------------------------gct--------agctgtgt
B D           Chinese hamster  ctagcaacaaccgcac--------tgct----a------------------gct--------agctgtgt
               Golden hamster  ctagcaacaaccccac--------ctct----a------------------gct--------agctgtgt
B D                     Mouse  c---cagcaatcccac--------ctct----a------------------gct--------agctgtgt
B D                       Rat  c---cagcaatcccac--------ctct----a------------------gct--------agctgtgt
B D            Naked mole-rat  c---cagcatccagat--------cctg----a------cgcctcc-----act--------aattgtgt
B D                Guinea pig  c---cagcatccagat--------cttg----t------cgacatc-----act--------aactgtgt
                   Chinchilla  c---cagcatccagag--------ctct----g------tgtggcc-----agatctctgcgcaccgtgt
             Brush-tailed rat  c---ctgcatccacat--------cttg----g------tgctgc-----------------cactgtgt
B D                    Rabbit  c---ctgcgt-----------------------------------------tct--------agctgggc
B D                       Pig  c---cggcatccagat--------cctg----gcaccaccaccacca-ctaact--------agctgtgt
B D                    Alpaca  c---ctgtgtccagat--------cctg----g------caccacca-ctaact--------agctgtgt
               Bactrian camel  c---ctgtgtccagat--------cctg----g------caccacca-ctaact--------agctgtgt
B D                   Dolphin  c---ctgtgtccagat--------cctg----g------cgccacca-ccagct--------ggctgtgt
                 Killer whale  c---ctgtgtccagat--------cctg----g------cgccacca-ccaact--------ggctgtgt
             Tibetan antelope  c---ccgtgtccagat--------cctg----g------cgccactg-ctacct--------agctgtgc
B D                       Cow  c---ccgtgtccagat--------cctg----g------cgccacta-ctacct--------agctgtgt
B D                     Sheep  c---ccgtgtccagat--------cctg----g------cgccactg-ctacct--------agctgtgt
                Domestic goat  c---ccgtgtccagat--------cctg----g------cgccactg-ctacct--------agctgtgt
B D                     Horse  c---ctccgtccagat--------cctg----g------cgccacca-ctaact--------agctgtgt
B D          White rhinoceros  c---ctgcgtccagat--------cctg----g------tgccacca-ctaact--------agttgtgt
B D                       Cat  c---ccgcgtctggat--------cccg----g------cgccaccg-ctaact--------agctgtgt
B D                       Dog  c---ccgcgtccagat--------cccgggttg------ggccacca-ccagcc--------ggctgtgt
B D                   Ferret   c---ctacatccagat--------cccg----a------cggcacca-ctaact--------agctgtat
B D                     Panda  c---ccgcatccagat--------cccg----g------cgccacca-ctaact--------tgctgtgt
               Pacific walrus  c---ctgcatcccgat--------cccg----g------tgccacca-ctaact--------agctgtgg
                 Weddell seal  c---ttgcatcccgat--------cccg----g------cgccacca-ctaact--------agctgtgc
             Black flying-fox  c---ctgagtccagat--------cccg----t------cgcctcca-ctaacc--------agctgggt
B D                   Megabat  c---ctgagtccagat--------cccg----t------cgcctcca-ctaacc--------agctgggt
                Big brown bat  c---ccgcgtccagac--------ccag----g------tgccacca-ctaacc--------agctgtgt
         David's myotis (bat)  c---ccgtgtccagat--------ccag----g------tgccacca-c--acc--------agctgtgt
B D                  Microbat  c---gcgcgtccagat--------ccag----g------tgccacca-ctaacc--------agctgtgt
B D                     Shrew  t---ctgagtccgggt-------ccccg----c------cagcgctg-ctaact--------agatgg-t
              Star-nosed mole  c---ctgcgtgcaggtgctctgctcctg----c------ccacactgactggcc--------cagtgg--
B D                  Elephant  c---ctgcgtctggaa--------tccg----g------cgccacca-ctaact--------agctttgt
          Cape elephant shrew  c---ctgcgtctgtaa--------cctg----g------cactatca-ccaacc--------ggctgtgt
B D                   Manatee  c---ttgcgtctggaa--------tccg----g------cgccacca-ctaact--------agctgtgt
             Cape golden mole  c---ctgcgtagggaa--------tcag----g------cgtcagca-ctaatt--------aactgtgt
B D                    Tenrec  c---ctgccttggaat--------cctg----g------cgccacca-ctaacg--------agctgtgt
                     Aardvark  c---ctgcgtctggct--------acca----g------cgccatca-ctaact--------agctgagt
B D                 Armadillo  c---tggcagccacat--------cccg----g------gaccacca-ctaact--------agctgtgt
B D                  Platypus  c---atgagttcgaat--------cccg----g------ctcggcca-ctcgtc--------agctgggt
B D                      Pika  ======================================================================
B D              Atlantic cod  ======================================================================
         Pundamilia nyererei  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                      Fugu  ======================================================================
B D              Nile tilapia  ======================================================================
B D               Stickleback  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                   Opossum  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================

                        Human  gaccctgagcaagaca-----cttaacctctctga--ttctgttctttcatct--------gag-----
                        Chimp  gaccctgagcaagaca-----cttaacctctctga--ttctgttctttcatct--------gag-----
                      Gorilla  gaccctgagcaagaca-----cttaacctctctga--ttctgttctttcatct--------gag-----
                    Orangutan  gaccctgagcaagaca-----cttaacctctctga--ttctgttctttcatct--------gag-----
                       Gibbon  gaccctgagcaagata-----cttaacctctctga--ttctgttctttcatct--------gag-----
                       Rhesus  gaccctgagcaagacg-----cttaacctctctga--ttctgttctttcatcttgg-----ggg-----
          Crab-eating macaque  gaccctgagcaagaca-----cttaacctctctga--ttctgttctttcatcttgg-----ggg-----
                       Baboon  gaccctgagcaagaca-----cttaacctctctga--ttctgttctttcatcttgg-----ggg-----
                 Green monkey  gaccctgagcaagata-----cttaacctctctga--ttctgttctttcatcttgg-----ggg-----
                     Marmoset  gaccctgagcaagaca-----cttaacctccctga--ttctgttctttcatct--------gga-----
              Squirrel monkey  gacccttagcaagaca-----cttaacctctctga--ttctgttctttcactt--------gga-----
                     Bushbaby  ggctctgagaaagaca-----cttaacctctctga--ttctgttctttcacct--------gg------
           Chinese tree shrew  ggccccgagcaagata-----cctaacctc--------tctgttctttcatct--------ga------
                     Squirrel  gaccctgagcaagacg-----c-taacccctggga--ctttgttcttcca-----------tg------
       Lesser Egyptian jerboa  accccttagctaggca-----cttaacctttctga--ttctgtcctttcgcct--------gg------
                 Prairie vole  gacccttagttaggtg-----cgtttcctctctga--tactcccttttcagcc--------ct------
              Chinese hamster  aacccttagca-agcg-----c-ttttctctctaa--ctctcccttttcagcc--------t-------
               Golden hamster  aacccttagcagggcg-----c-ttttctctctga--ctctcccttttcagct--------cg------
                        Mouse  gacctttagctaggcg-----cttttcctctctga--tttttccctttcatcc--------cc------
                          Rat  gacctttagctaggcg-----cttttcctctctga-ctctcccccttttatcc--------cc------
               Naked mole-rat  gaccctgaacaagata-----ctgaacctctctga--ttctgttctttcatct--------gg------
                   Guinea pig  gacctcaagcaagaca-----cttaacctctctga--ttctgttctttcatct--------gg------
                   Chinchilla  gagcctgagcaagacg-----cctagcctctctga--ttctgttctttcacct--------gg------
             Brush-tailed rat  gaccatgagcaagaca-----ctcaacctctctga--ttctgttctttcagct--------ga------
                       Rabbit  g-ccctgggcaacgcg-----cgcgacctgtctga--ttctgtcctttcgtcttg------cg------
                          Pig  gaccctgggcaagaca-----cttaacctctctga--ttctattcactcttct--------gg------
                       Alpaca  gaccctgggcaagatg-----cttaacctctctga--ttctagtctgtcatct--------gg------
               Bactrian camel  gaccctgggcaagatg-----cttaacctctctga--ttctagtctctcatct--------gg------
                      Dolphin  gaccctggacgagaca-----cttaacctctctga--ttctattctctcatct--------gg------
                 Killer whale  gaccctggacaagaca-----cttaacctctctga--ttctattctctcatct--------gg------
             Tibetan antelope  gaccctgggcaagata-----cttagccactctga--ttctattctctcatct--------gg------
                          Cow  gaccctgggcaagata-----cttagcctctctga--ttctattctctcatct--------gg------
                        Sheep  gaccctgggcaagata-----cttagccactctga--ttctattctctcatct--------gg------
                Domestic goat  gactctgggcaagata-----cttggccactctga--ttctattctctcatct--------gg------
                        Horse  gaccctgggcaagaca-----cttaacctctctga--ttctgttctctcatct--------gg------
             White rhinoceros  gaccctgggcaagaca-----cttaacctctctga--ttctgttctctcatct--------gg------
                          Cat  gaccctgggcaagaca-----ctttacctctctga--ttctgttttgtcatgt--------gg------
                          Dog  gaccctggacaagact-----ctttacctctctga--ctctgttttctcatgt--------gg------
                      Ferret   gatcccggggaagacacgacgctttgactccctga--ttctgttttctcatgg--------ga------
                        Panda  gaccctgggcaataca-----ctctacctctctga--ctctgttttctcatgt--------gg------
               Pacific walrus  gaccctgggcaagaca-----ctttacctctctga--ctctgttttctcatgg--------gg------
                 Weddell seal  gaccctgggcaagaca-----ctttacctctctga--ctctgttttctcatgt--------gg------
             Black flying-fox  gactctgcgcaagaca-----cttaacctctctga--ttctgttctctcatcc--------gg------
                      Megabat  gactctgcgcaagaca-----cttaacctctctga--ttctgttctctcatcc--------gg------
                Big brown bat  gtctctgggccacaca-----cttaacctctctgg--tcctgtcctctcacct--------gg------
         David's myotis (bat)  gtctctgggcaacaca-----ctgaacctctctgg--tcctgtcctctcacct--------gg------
                     Microbat  gtctctgggcaacaca-----cttaacctctctgg--tcctgtcctctcacct--------gg------
                        Shrew  gaccctgggcaaggca-----tttaacccctctga--ttctgttctctcatct--------gg------
              Star-nosed mole  ---cctggggaggaca-----ctgcacccct--------------------------------------
                     Elephant  gaccctgggcaaaaca-----cttaacctctctga--ttctcttctctcatct--------gg------
          Cape elephant shrew  gacctcaagcaaaccat----tttaacctctctgt--ttctgt--tctcatct--------gg------
                      Manatee  gaccctgagcaagaca-----cttaacctctctga--ttctcttctctcatct--------gg------
             Cape golden mole  gctcttggacaagatt-----cttga--tctctga--ct--attctctcat----------gg------
                       Tenrec  gaccccgggcaagata-----cttaacctctctga--ttcagttctctcatctcgaggggcgg------
                     Aardvark  gaccctgggcaagaca-----cttaacccctcgga--ttctgttttctcctct--------gg------
                    Armadillo  gaccccaggccagaca-----cttaacctctctga--ttctcttttctcctct--------ga------
                     Platypus  gactgtgggcgagtca-----cttgacttctctgcgcctcggttccctcgtcc--------gt-aaaat
                         Pika  =====================================================================
                 Atlantic cod  =====================================================================
          Pundamilia nyererei  =====================================================================
          Princess of Burundi  =====================================================================
                  Spotted gar  =====================================================================
                         Fugu  =====================================================================
                 Nile tilapia  =====================================================================
                  Stickleback  =====================================================================
                  Zebra mbuna  =====================================================================
                    Zebrafish  =====================================================================
                       Medaka  =====================================================================
                    Tetraodon  =====================================================================
        Burton's mouthbreeder  =====================================================================
           Southern platyfish  =====================================================================
           American alligator  =====================================================================
                      Chicken  =====================================================================
                 Mallard duck  =====================================================================
                   Budgerigar  =====================================================================
                 Saker falcon  =====================================================================
                  Rock pigeon  =====================================================================
          Medium ground finch  =====================================================================
                       Lizard  =====================================================================
          Collared flycatcher  =====================================================================
              Tasmanian devil  =====================================================================
                      Wallaby  =====================================================================
                       Turkey  =====================================================================
           Tibetan ground jay  =====================================================================
       White-throated sparrow  =====================================================================
              Green seaturtle  =====================================================================
                   Coelacanth  =====================================================================
                X. tropicalis  =====================================================================
                      Opossum  =====================================================================
       Spiny softshell turtle  =====================================================================
     Chinese softshell turtle  =====================================================================
               Painted turtle  =====================================================================

Alignment block 12 of 872 in window, 4854518 - 4854544, 27 bps 
B D                     Human  ggggagc-----g--g--------------------g----------gggaa--a----------tctga
B D                     Chimp  ggggagc-----g--g--------------------g----------gggaa--g----------tctga
B D                   Gorilla  ggggagc-----g--g--------------------g----------gggaa--a----------tctga
B D                 Orangutan  ggggagc-----g--g--------------------g----------gggaa--a----------tctga
B D                    Gibbon  ggggagc-----g--g--------------------g----------aggaa--a----------tctga
B D                    Rhesus  gtggggt-----g--g--------------------g----------gggaa--a----------gctga
B D       Crab-eating macaque  gtggggt-----g--g--------------------g----------gggaa--a----------gctga
B D                    Baboon  gtggggt-----g--g--------------------g----------gggaa--a----------gctga
B D              Green monkey  gtggggc-----g--g--------------------g----------gggaa--a----------gctga
B D                  Marmoset  ag----------a--a--------------------g----------aaaaa--a----------gcgaa
B D           Squirrel monkey  agagaaaaaaaaa--a--------------------a----------aaaaa--a----------gcgga
B D                  Bushbaby  ------------a--a--------------------a----------acaaa--a----------gccga
           Chinese tree shrew  ------------a--a--------------------a----------ttaga--a----------gctga
B D                  Squirrel  ------------g--g--------------------g----------ctggg--g----------gtggc
       Lesser Egyptian jerboa  ------------g--g--------------------g----------cagag--a----------gctgg
                 Prairie vole  ------------g--g--------------------c----------ctggg--a----------acgta
B D           Chinese hamster  ---------------g--------------------a----------ctagg--g----------aggta
               Golden hamster  ------------ggag--------------------a----------ctagg--g----------aggta
B D                     Mouse  ------------g--g--------------------c----------cagcg--a----------gcgtg
B D                       Rat  ------------g--g--------------------c----------caggg--a----------gcgtg
B D            Naked mole-rat  ------------g--g--------------------g----------cctgagca----------gataa
B D                Guinea pig  ------------g--g--------------------c----------cggaa--g----------gataa
                   Chinchilla  ------------g--g--------------------c----------ccggag-g----------gataa
             Brush-tailed rat  ------------g--g--------------------g----------tcaga--g----------gataa
B D                    Rabbit  ------------g--g--------------------a----------caggg--g----------gcctc
B D                       Pig  ------------a--a----------------gtggg----------gggtg--g----------g----
B D                    Alpaca  ------------a--a----------------gggattaaaaaaaaacaaaa--a----------gcct-
               Bactrian camel  ------------a--a----------------gggat---aaaaaaaaaaaa--a----------gccta
B D                   Dolphin  ------------a--a----------------g-ggg----------gaaaa--a----------ggcta
                 Killer whale  ------------a--a----------------g-ggg----------gaaaa--a----------ggcta
             Tibetan antelope  ------------a--a----------------atagt----------gggaa--a----------gccta
B D                       Cow  ------------a--a----------------atagt----------gggaa--a----------gccta
B D                     Sheep  ------------a--a----------------atagt----------gggaa--a----------gccta
                Domestic goat  ------------a--a----------------atagt----------gggaa--a----------gccta
B D                     Horse  ------------a--a----------------gggga----------aaaaa--a----------gccta
B D          White rhinoceros  ------------a--a----------------ggggg----------aaaaa--a----------gccta
B D                       Cat  ------------a--a-----------------ggcg----------aagaa--a----------gccta
B D                       Dog  ------------a--aggcgttggggggggggggttg----------cgggg--g---------agccta
B D                   Ferret   ------------g--g-------------------------------cgggg--a------------cta
B D                     Panda  ------------a--g------gcggggtggggggtg----------gaggg--a----------gccta
               Pacific walrus  ------------g--g--------------------g----------cgggg--c----------cccta
                 Weddell seal  ------------g--g-------------tgggggcg----------cgggg--g----------cccta
             Black flying-fox  ------------a--a-----------------gagg----------gggtg--a----------gccaa
B D                   Megabat  ------------a--a-----------------gagg----------gggtg--a----------gccaa
                Big brown bat  ------------a--a-----------------ggga-------aacaaaaa--a----------gcctt
         David's myotis (bat)  ------------a--a-----------------ggga-------aacaaaaa--a----------gcctt
B D                  Microbat  ------------a--a-----------------ggga-------aacaaaaa--a----------gcctt
B D                     Shrew  ------------a--a--------------------c----------agaaa--c----------gtcta
              Star-nosed mole  ---------------g--------------------c----------agggg--a----------gtgga
B D                  Elephant  ------------g--g--------------------g----------ggaga--g------aaaagctga
          Cape elephant shrew  ------------g--g------------c-------g----------agaga--ga---ctaaaacccca
B D                   Manatee  ------------g--g--------------------g----------ggggg--a---------agctga
             Cape golden mole  ------------g--g------------caacggaag----------gggga--gaaggagtgaggccga
B D                    Tenrec  ------------g--g------------tagctg--g----------ggagg--ggggggcggagggcga
                     Aardvark  ------------g--g--------------------g----------tgggg--g-----cgccagccaa
B D                 Armadillo  ------------g--g--------------------a----------agaaa--a---gaaaaaagctga
B D                   Opossum  --------------------------------gaaga----------tggga--g----------ggaaa
B D                  Platypus  ----------------------------------ggg----------gatgg--a----------gactg
B D                      Pika  ======================================================================
B D              Atlantic cod  ======================================================================
         Pundamilia nyererei  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                      Fugu  ======================================================================
B D              Nile tilapia  ======================================================================
B D               Stickleback  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================

                        Human  c-------------aataa-----------
                        Chimp  c-------------aataa-----------
                      Gorilla  c-------------aataa-----------
                    Orangutan  c-------------aataa-----------
                       Gibbon  c-------------aataa-----------
                       Rhesus  c----------------aa-----------
          Crab-eating macaque  c----------------aa-----------
                       Baboon  c----------------aa-----------
                 Green monkey  c----------------aa-----------
                     Marmoset  c-------------aataa-----------
              Squirrel monkey  c-------------aataa-----------
                     Bushbaby  t-------------gataa-----------
           Chinese tree shrew  t-------------aatag-----------
                     Squirrel  c----------------aa-----------
       Lesser Egyptian jerboa  t-------------acgat-----------
                 Prairie vole  t----------------at-----------
              Chinese hamster  t----------------at-----------
               Golden hamster  t----------------at-----------
                        Mouse  t----------------gt-----------
                          Rat  t----------------gt-----------
               Naked mole-rat  t----------------aa-----------
                   Guinea pig  t----------------aa-----------
                   Chinchilla  t----------------aa-----------
             Brush-tailed rat  t----------------aa-----------
                       Rabbit  c-----------------------------
                          Pig  ------------------g-----------
                       Alpaca  ---------------ataa-----------
               Bactrian camel  t-------------aataa-----------
                      Dolphin  t-------------agtaa-----------
                 Killer whale  t-------------agtaa-----------
             Tibetan antelope  t-------------aataa-----------
                          Cow  t-------------aataa-----------
                        Sheep  t-------------aataa-----------
                Domestic goat  t-------------aataa-----------
                        Horse  t-------------aataa-----------
             White rhinoceros  g-------------aataa-----------
                          Cat  t-------------aataa-----------
                          Dog  t-------------aatag-----------
                      Ferret   t-------------aatag-----------
                        Panda  t-------------agtaa-----------
               Pacific walrus  t-------------aataa-----------
                 Weddell seal  t-------------aataa-----------
             Black flying-fox  t-------------aataa-----------
                      Megabat  t-------------aataa-----------
                Big brown bat  t-------------aataa-----------
         David's myotis (bat)  t-------------aataa-----------
                     Microbat  t-------------aataa-----------
                        Shrew  t-------------gataa-----------
              Star-nosed mole  g-------------cagag-----------
                     Elephant  t-------------cataa-----------
          Cape elephant shrew  a-------------agcaa-----------
                      Manatee  t-------------cataa-----------
             Cape golden mole  c-------------cataa-----------
                       Tenrec  t-------------caaaa-----------
                     Aardvark  t-------------catga-----------
                    Armadillo  t-------------aataa-----------
                      Opossum  t-------------gaaga-----------
                     Platypus  tgagccccacgtgggacaacctgattcccc
                         Pika  ==============================
                 Atlantic cod  ==============================
          Pundamilia nyererei  ==============================
          Princess of Burundi  ==============================
                  Spotted gar  ==============================
                         Fugu  ==============================
                 Nile tilapia  ==============================
                  Stickleback  ==============================
                  Zebra mbuna  ==============================
                    Zebrafish  ==============================
                       Medaka  ==============================
                    Tetraodon  ==============================
        Burton's mouthbreeder  ==============================
           Southern platyfish  ==============================
           American alligator  ==============================
                      Chicken  ==============================
                 Mallard duck  ==============================
                   Budgerigar  ==============================
                 Saker falcon  ==============================
                  Rock pigeon  ==============================
          Medium ground finch  ==============================
                       Lizard  ==============================
          Collared flycatcher  ==============================
              Tasmanian devil  ==============================
                      Wallaby  ==============================
                       Turkey  ==============================
           Tibetan ground jay  ==============================
       White-throated sparrow  ==============================
              Green seaturtle  ==============================
                   Coelacanth  ==============================
                X. tropicalis  ==============================
       Spiny softshell turtle  ==============================
     Chinese softshell turtle  ==============================
               Painted turtle  ==============================

Inserts between block 12 and 13 in window
         Cape elephant shrew 100bp
B D                  Opossum 4bp

Alignment block 13 of 872 in window, 4854545 - 4854573, 29 bps 
B D                     Human  tacctacc-------tcccagagtacagag----t-----------------agaga-------
B D                     Chimp  tacctacc-------tcccagagtacagag----t-----------------agaca-------
B D                   Gorilla  tacctacc-------tcccagagtacagag----t-----------------agaga-------
B D                 Orangutan  tacctacc-------tcccagagtacagag----t-----------------agaga-------
B D                    Gibbon  tacgtacc-------tcc-------cagag----t-----------------agaga-------
B D                    Rhesus  tacctacc-------tccaagagtacagag----t-----------------agaga-------
B D       Crab-eating macaque  tacctacc-------tccaagagtacagag----t-----------------agaga-------
B D                    Baboon  tacctacc-------tccaagagtacagag----t-----------------agaga-------
B D              Green monkey  tacctacc-------tccaagagtacagag----t-----------------agaga-------
B D                  Marmoset  tacctacc-------tcccagagtacagag----t-----------------agaga-------
B D           Squirrel monkey  tacctacc-------tcccagagtacagag----t-----------------agaga-------
B D                  Bushbaby  cgcccatc-------ttc-------ctcaa----t-----------------aggga-------
           Chinese tree shrew  tacctatg-------ccc-------cagag----t-----------------ggaga-------
B D                  Squirrel  tcttaatactttttctcc-------ccgag----t-----------------agaga-------
       Lesser Egyptian jerboa  tgcccatc-------ttc-------ctatg----t-----------------agaaa-------
                 Prairie vole  ttccgaag-------ttc-------cagag----c-----------------agaaa-------
B D           Chinese hamster  tttcgaag-------tcc-------cagag----c-----------------agaaa-------
               Golden hamster  tttcgaag-------tcc-------caggg----t-----------------agaaa-------
B D                     Mouse  ttccgaag-------ttc-------cagag----t-----------------agaaa-------
B D                       Rat  ttccgatg-------tct-------cagag----a-----------------agaaa-------
B D            Naked mole-rat  tacc-att-------tcc-------cacag----t-----------------ccaga-------
B D                Guinea pig  tacctatt-------tcc-------caagg----t-----------------ccaga-------
                   Chinchilla  tacctatt-------cct-------cagag----t-----------------ttgga-------
             Brush-tailed rat  cacttatt-------tct-------cagag----t-----------------ccaga-------
B D                    Rabbit  -------c-------tcc-------cagag----c-----------------acgca-------
B D                       Pig  agcctatc-------tcc-------caggg----t-----------------agaga-------
B D                    Alpaca  tacctctc-------tcc-------caggg----t-----------------agaga-------
               Bactrian camel  tacctctc-------tcc-------caggg----t-----------------agaga-------
B D                   Dolphin  tacctatc-------tcc-------cagaa----t-----------------agaga-------
                 Killer whale  tacctatc-------ttc-------cagag----t-----------------agaga-------
             Tibetan antelope  tacctatc-------tcc-------caaag----t-----------------aaaga-------
B D                       Cow  tacctatc-------tcc-------caaag----t-----------------aaaga-------
B D                     Sheep  tacctatc-------tcc-------caaag----t-----------------aaaga-------
                Domestic goat  tacctatc-------tcc-------caaag----t-----------------aaaga-------
B D                     Horse  tacctatc-------tcc-------caggg----t-----------------aga-a-------
B D          White rhinoceros  tacctatc-------tcc-------caggg----t-----------------agaga-------
B D                       Cat  tgcctatc-------tcc-------ccggg----t-----------------agagg-------
B D                       Dog  tgcctctc-------tct-------caggg----t-----------------agaga-------
B D                   Ferret   tgtgcatc-------tcc-------caggg----c-----------------tgaga-------
B D                     Panda  tgcctatc-------tcc-------cagag----t-----------------agaga-------
               Pacific walrus  tgcctgtc-------tcc-------caggg----t-----------------agaga-------
                 Weddell seal  tgcctgtc-------tcc-------caggg----t-----------------agaga-------
             Black flying-fox  tacctgtc-------tcc-------taggg----t-----------------agaga-------
B D                   Megabat  tacctgtc-------tcc-------taggg----t-----------------agaga-------
                Big brown bat  tacccacc-------tcc-------ccggg----c-----------------agaga-------
         David's myotis (bat)  tacccatc-------tcc-------ccggg----c-----------------agaga-------
B D                  Microbat  tacccatc-------tcc-------ccggg----c-----------------agaga-------
B D                     Shrew  tacctctc-------tcc-------caggg----g-----------------acaga-------
              Star-nosed mole  tgcccatg-------tcc-------caaag-----------------------tgga-------
B D                  Elephant  tacctacc-------tcc-------cagga----t-----------------aaaaa-------
B D                   Manatee  tacctacc-------tcc-------caaga----t----------------aaaaaa-------
             Cape golden mole  tacttacc-------tcg-------cagga----t-----------------aagaa-------
B D                    Tenrec  tcccgacc-------tcc-------cagaa----t-----------------gaaaa-------
                     Aardvark  tacttacc-------tcc-------cagga----ttaaaaaaaaaaaaaaaaaaaaa-------
B D                 Armadillo  taccttcc-------tcc-------caggg----t-----------------agaga-------
B D                   Opossum  ----tagt-------ccc-------caaagaaatc-----------------agaga-------
B D                  Platypus  tgtgtctc-------ccc-------cagcg----c-----------------ttagaacggtgc
         Cape elephant shrew  ================================================================
B D                      Pika  ================================================================
B D              Atlantic cod  ================================================================
         Pundamilia nyererei  ================================================================
         Princess of Burundi  ================================================================
                 Spotted gar  ================================================================
B D                      Fugu  ================================================================
B D              Nile tilapia  ================================================================
B D               Stickleback  ================================================================
                 Zebra mbuna  ================================================================
B D                 Zebrafish  ================================================================
B D                    Medaka  ================================================================
B D                 Tetraodon  ================================================================
       Burton's mouthbreeder  ================================================================
          Southern platyfish  ================================================================
B D        American alligator  ================================================================
B D                   Chicken  ================================================================
  D              Mallard duck  ================================================================
B D                Budgerigar  ================================================================
  D              Saker falcon  ================================================================
  D               Rock pigeon  ================================================================
B D       Medium ground finch  ================================================================
B D                    Lizard  ================================================================
  D       Collared flycatcher  ================================================================
B D           Tasmanian devil  ================================================================
B D                   Wallaby  ================================================================
B D                    Turkey  ================================================================
          Tibetan ground jay  ================================================================
  D    White-throated sparrow  ================================================================
  D           Green seaturtle  ================================================================
B D                Coelacanth  ================================================================
B D             X. tropicalis  ================================================================
  D    Spiny softshell turtle  ================================================================
  D  Chinese softshell turtle  ================================================================
  D            Painted turtle  ================================================================

Inserts between block 13 and 14 in window
B D                 Elephant 53bp
B D                  Manatee 59bp
            Cape golden mole 58bp
B D                   Tenrec 47bp
                    Aardvark 47bp
B D                  Opossum 6bp
B D                 Platypus 5bp

Alignment block 14 of 872 in window, 4854574 - 4854628, 55 bps 
B D                     Human  --ggattataaagaga--t-aaagt---ttgtgaaacctctgacaa----ggggcctga---ca-cccaa
B D                     Chimp  --ggattataaagaga--t-aaagt---ttgtgaaacctctgacaa----ggggcctga---ca-cccaa
B D                   Gorilla  --ggattataaagaga--t-aaagt---ttgtgaaacctctgacaa----ggggcctga---ca-cccaa
B D                 Orangutan  --ggattat-aagaga--t-aaagt---ttgtgaaacctctgacaa----ggggcctga---ca-cccaa
B D                    Gibbon  --ggattat-aagaga--t-aaagt---ttgtgaaacctctgacaa----ggggcctga---ca-cccag
B D                    Rhesus  --ggattaa-aagaga--t-aaagt---ttgtgaaacctctgacaa----ggggcctga---ca-cccaa
B D       Crab-eating macaque  --ggattaa-aagaga--t-aaagt---ttgtgaaacctctgacaa----ggggcctga---ca-cccaa
B D                    Baboon  --ggattaa-aagaga--t-aaagt---ttgtgaaacctctgacaa----ggggcctga---ca-cccaa
B D              Green monkey  --ggattaa-aagaga--t-aaagt---ttgtggaacctctgacaa----ggggcctga---ca-cccaa
B D                  Marmoset  --ggattaa-aacaga--taaaagt---ttgcgaaacctctgacga----agggcctga---ca-cccaa
B D           Squirrel monkey  --ggattaa-aacaga--t-aacgt---ttgtgaaacctctgacga----ggggcctga---ca-cccaa
B D                  Bushbaby  --gtattaa-atcaga--t-aaagt---ttgtgaaacctctgacag----gagacctga---ta-ccc--
           Chinese tree shrew  --ggcttaa-attaga--t-aaagt---tta-ggaacctccgaaga----gaggcctga---ca-cccca
B D                  Squirrel  --ggattga-atcaga--t-acaat---ttgtgaaacctcgggc-------aggcctga---ca-ctcaa
       Lesser Egyptian jerboa  --atactaa-gaggga--t-gaagt---tttccaaacctcagacaa----ggggcctgt---ca-ctagc
                 Prairie vole  --gaattaa-gttagc--t-aaag----tttagaaacttctagcca----gaagtctga---ca-ccagg
B D           Chinese hamster  --ggattaa-gttagc--t-aaatt---ttttgaatcttctgatca----aaggtcaa---------aag
               Golden hamster  --ggattaa-gtcagt--t-aaaat---tttcgaaacttctcatca----aagatctga---tg-ccaag
B D                     Mouse  --ataataa-gttagc--t-aaagt---tttcaaaacttctgacca----gaggcctga---ca-ccaag
B D                       Rat  --aga----------t--t-aaagt---tttcgaaacttctgacca----gaggcatga---ca-ccaag
B D            Naked mole-rat  --gaattac------a--t-gaagt---ctgcgaaacctgc-accc----gaggcctga---ct-cccag
B D                Guinea pig  --gaattaa------a--c-gaagt---ttgtgaaacctgt-gtat----gaggcctca---ca-cacag
                   Chinchilla  --gtattca------a--t-gaggt---ttgtgaaacccgc-atga----gaggtctga---ct-cccag
             Brush-tailed rat  --gaattaa------a--t-gaaa----ttgtgaaacccgt-atac----gaggcctga---ctccccag
B D                    Rabbit  --attttag----------------------cgagagctcc-gacg----aaggcgcag---cg-cctag
B D                       Pig  --ggattaa-atcgga--t-aaagt---ttgtgaaacctctgacaa----gagccatg----ca-cccag
B D                    Alpaca  --ggattaa-atcgga--t-aaagt---ttgtgaaacctctgacaa----gagccctga---ca-cccag
               Bactrian camel  --ggattaa-atcgga--t-aaagt---ttgtgaaacctctggcaa----gagccctga---ca-cccag
B D                   Dolphin  --ggattaa-atcggg--g-aaagt---ttgtgaaacctctgacaa----gagccctga---ca-cccaa
                 Killer whale  --ggattaa-atcggg--g-aaagt---ttgtgaaaactctgacaa----gagcgctga---ca-cccaa
             Tibetan antelope  --ggattaa-atcgga--t-aaagt---ttgtgaaacctctgacaa----gagtcctga---ca-cccag
B D                       Cow  --ggattaa-atcaga--t-aaagt---ttgtgaaacctctgacaa----gagtcctga---ca-cccag
B D                     Sheep  --ggattaa-atcgga--t-gaagt---ttgtgaaacctctgacaa----gagtcctga---ca-cccag
                Domestic goat  --ggattaa-atcgga--t-aaagt---ttgtgaaacctctgacaa----gagtcctga---ca-cccag
B D                     Horse  --ggattaa-gtcgga--t-aaagt---gtgtgaaacctctgacaa----gaggcctga---ca-cccag
B D          White rhinoceros  --ggattaa-atcgga--t-aaagt---gtgtgaaacctctgacaa----gaggcctga---ca---cag
B D                       Cat  --ggattaa-atcgga--t-aaagt---ttgcaaaacctctgacga----caggcctga---ca-ccctg
B D                       Dog  --ggattaa-atcgga--t-aaagt---ttttgaaacctctaagga----gaggcctga---ca-cccag
B D                   Ferret   --ggattaa-atcgga--t-aaagt---tttcgagacctctaacga----gaggcctga---ca--ccag
B D                     Panda  --ggattaa-atcgga--t-aaagt---tttcgagacctctgacga----gatgcctga---ca--ccag
               Pacific walrus  --ggattaa-atcgga--t-aaagt---tttctagacctctgagga----gaggcctgacacca--ccag
                 Weddell seal  --ggattaa-atcgga--t-aaagt---tttcgagacctctgacga----gaggcctgacacca--ccag
             Black flying-fox  --ggattaa-atcgga--t-aaagt---ttgtggaacctctgacaa----taggcctga---ca-cccag
B D                   Megabat  --ggattaa-atcgga--t-aaagt---ttgtggaacctctgacaa----aaagcctga---ca-cccag
                Big brown bat  --ggattaa-accgga--t-aaagt---ctgtgaaacctctgacag----gaggcctga---ct-cccag
         David's myotis (bat)  --ggattaa-accgga--t-aaagt---ctgtgaaacccctgacag----gaggcctga---c--accag
B D                  Microbat  --ggattaa-accgga--t-aaagt---ctgtgaaacctctgacag----gaggcctga---c--accag
B D                     Shrew  --ggattaa-atcgga--t-aaagt---tcgtgaagcctgggacaa----gaggcctga---ca-cccgt
              Star-nosed mole  --ggattca-atcaggatt-gagat---ttgtgaagctc----cag----aaggagtgg---cc-ccccc
B D                  Elephant  --ggattaa-atcaga--t-aaagt---ttttgaaacctctgacaa----gagacttga---ca-cccaa
          Cape elephant shrew  --ggattaa-atcaga--t-aaagt---tattaaaacttctgacaa----gaggattga---ca-ctcag
B D                   Manatee  --ggattaa-atcaga--t-aaagt---ttttgaaacctttgtcaa----gaagcttga---ca-ccaag
             Cape golden mole  --ggattaa-atcaga--t-aaagt---ttttgaaacctcagacaa--------cttga---ca-cccag
B D                    Tenrec  --ggactaa-atcaga--g-aaagt---tttt-aaatctatgacaa--------cttga---ca-cccag
                     Aardvark  --ggattaa-ttcaga--t-aaagt---ttttgaaacctctgacaa----gaggctgga---ca-cccag
B D                 Armadillo  --ggattaa-atcaga--g-gaagt---ttgtgaaacctctgacaa----aaggcctga---ct-ccca-
B D                   Opossum  --tgacaag-gtaggg--g-aaggtcccctgttcgttaccaaactg----gaagtctca---gc-ctca-
B D                  Platypus  acatagtaa-gcgctt--a-acaga---taccgacatcattagtaagaatgagacctgg---ac-tttgg
B D                      Pika  ======================================================================
B D              Atlantic cod  ======================================================================
         Pundamilia nyererei  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                      Fugu  ======================================================================
B D              Nile tilapia  ======================================================================
B D               Stickleback  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================

                        Human  c
                        Chimp  c
                      Gorilla  c
                    Orangutan  c
                       Gibbon  c
                       Rhesus  c
          Crab-eating macaque  c
                       Baboon  c
                 Green monkey  c
                     Marmoset  c
              Squirrel monkey  c
                     Bushbaby  -
           Chinese tree shrew  c
                     Squirrel  c
       Lesser Egyptian jerboa  -
                 Prairie vole  -
              Chinese hamster  -
               Golden hamster  -
                        Mouse  -
                          Rat  -
               Naked mole-rat  c
                   Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
                       Rabbit  c
                          Pig  c
                       Alpaca  a
               Bactrian camel  a
                      Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
                          Cow  c
                        Sheep  c
                Domestic goat  c
                        Horse  c
             White rhinoceros  c
                          Cat  c
                          Dog  c
                      Ferret   c
                        Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
                      Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
                     Microbat  c
                        Shrew  t
              Star-nosed mole  t
                     Elephant  c
          Cape elephant shrew  -
                      Manatee  c
             Cape golden mole  c
                       Tenrec  c
                     Aardvark  c
                    Armadillo  -
                      Opossum  -
                     Platypus  -
                         Pika  =
                 Atlantic cod  =
          Pundamilia nyererei  =
          Princess of Burundi  =
                  Spotted gar  =
                         Fugu  =
                 Nile tilapia  =
                  Stickleback  =
                  Zebra mbuna  =
                    Zebrafish  =
                       Medaka  =
                    Tetraodon  =
        Burton's mouthbreeder  =
           Southern platyfish  =
           American alligator  =
                      Chicken  =
                 Mallard duck  =
                   Budgerigar  =
                 Saker falcon  =
                  Rock pigeon  =
          Medium ground finch  =
                       Lizard  =
          Collared flycatcher  =
              Tasmanian devil  =
                      Wallaby  =
                       Turkey  =
           Tibetan ground jay  =
       White-throated sparrow  =
              Green seaturtle  =
                   Coelacanth  =
                X. tropicalis  =
       Spiny softshell turtle  =
     Chinese softshell turtle  =
               Painted turtle  =

Inserts between block 14 and 15 in window
B D                   Tenrec 874bp

Alignment block 15 of 872 in window, 4854629 - 4854652, 24 bps 
B D                     Human  tc-aata----c------------aagtc-agttat------------cttcct
B D                     Chimp  tc-aata----t------------aagtc-acttat------------cttcct
B D                   Gorilla  tc-aata----t------------aagtc-agttat------------cttcct
B D                 Orangutan  tc-aata----t------------aagtc-agttct------------cttcct
B D                    Gibbon  tc-aata----t------------aagtc-agttct------------cttcct
B D                    Rhesus  tc-aata----t------------caggc-agttct------------cttcct
B D       Crab-eating macaque  tc-aata----t------------gaggc-agttct------------cttcct
B D                    Baboon  tc-aata----t------------gaggc-agttct------------cttcct
B D              Green monkey  tc-aata----t------------gaggc-agttct------------cttcct
B D                  Marmoset  tc-aata----t--------------gtc-agttct------------ctccct
B D           Squirrel monkey  tc-aata----t--------------gtc-agttct------------ctccct
B D                  Bushbaby  -----tt----t------------ctgtt-agttct------------ctccct
           Chinese tree shrew  tc-aatg----g------------aagtc-agccct------------ctttct
B D                  Squirrel  ---------------------------------tccttaagccagttctttctc
       Lesser Egyptian jerboa  ------------------------------------------------tttt--
                 Prairie vole  ------------------------------------------------tttctc
B D           Chinese hamster  ------------------------------------------------tttttc
               Golden hamster  ------------------------------------------------tttttc
B D                     Mouse  ------------------------------------------------tttctc
B D                       Rat  ------------------------------------------------tttttc
B D            Naked mole-rat  ---------------------------------tct------------ctcccc
B D                Guinea pig  ---------------------------------tct------------cttccc
                   Chinchilla  ---------------------------------tct------------ctcccc
             Brush-tailed rat  ---------------------------------tgt------------cttccc
B D                    Rabbit  gc-agga----g------------ggg------tca------------cttctc
B D                       Pig  tc-aaaa----a------------aagtc-aa-tct------------cttcct
B D                    Alpaca  tc-aaaa----a------------aagtc-aattct------------cttcct
               Bactrian camel  tc-aaaa----a------------cagtc-aattct------------cttcct
B D                   Dolphin  tcaaaaa----a------------aagtc-aattcc------------cttcct
                 Killer whale  tcaaaaa----a------------aagtc-aattcc------------cttcct
             Tibetan antelope  tc-aaaa----a------------aagtc-aattct------------cttcct
B D                       Cow  tc-aaaa----a------------aagtc-aattct------------tttcct
B D                     Sheep  tc-aaaa----a------------aagtc-aattct------------cttcct
                Domestic goat  tc-aaaa----a------------aagtc-aattct------------cttcct
B D                     Horse  tc-aata----t------------aagtc-aattct------------cttcct
B D          White rhinoceros  tc-aata----t------------aagtc-atttct------------cttcct
B D                       Cat  tc-aata----g------------aagtc-aatttt------------cttttt
B D                       Dog  tc-aaca----ac---------agaagtc-agttct------------cttctc
B D                   Ferret   tc-aata----a------------aagtcaaattct------------cttctc
B D                     Panda  tc-aata----g------------aagtc-aattct------------cttctc
               Pacific walrus  tc-aata----a------------aagtc-aattct------------cttctc
                 Weddell seal  tc-aata----a------------aagtc-aattct------------cttctc
             Black flying-fox  tc-gata----t------------aagtc-aaattt------------ctttct
B D                   Megabat  tc-gata----t------------aagtc-aaattt------------ctttct
                Big brown bat  tc-cataggagt------------aagtc-aaatct------------ctcccc
         David's myotis (bat)  tc-aacataaat------------aagtc-aaactt------------cttccc
B D                  Microbat  tc-aatataaat------------aagtc-aaattt------------cttccc
B D                     Shrew  tc-aaca----t------------aagtc-aattcc------------c-----
              Star-nosed mole  cg-gcc--------------------gcc-ggctct------------c---cc
B D                  Elephant  ------------tcga-----cataaatc-agctcc------------ctctct
B D                   Manatee  ------------ccaa-----tataaatc-------------------------
             Cape golden mole  ------------tcga-----tacaagtt-agctcc------------ctctcc
                     Aardvark  ------------ccga-----cataagtc-agcgcc------------cggccc
B D                 Armadillo  ----------------------ggaagtt-gacttc------------ctccta
B D                   Opossum  -------------tgaat---agtatttc-gtctct------------cctttt
B D                  Platypus  -----------------tcaggctgggcc-cgacct------------ccctcc
B D                    Tenrec  ======================================================
         Cape elephant shrew  ------------------------------------------------------
B D                      Pika  ======================================================
B D              Atlantic cod  ======================================================
         Pundamilia nyererei  ======================================================
         Princess of Burundi  ======================================================
                 Spotted gar  ======================================================
B D                      Fugu  ======================================================
B D              Nile tilapia  ======================================================
B D               Stickleback  ======================================================
                 Zebra mbuna  ======================================================
B D                 Zebrafish  ======================================================
B D                    Medaka  ======================================================
B D                 Tetraodon  ======================================================
       Burton's mouthbreeder  ======================================================
          Southern platyfish  ======================================================
B D        American alligator  ======================================================
B D                   Chicken  ======================================================
  D              Mallard duck  ======================================================
B D                Budgerigar  ======================================================
  D              Saker falcon  ======================================================
  D               Rock pigeon  ======================================================
B D       Medium ground finch  ======================================================
B D                    Lizard  ======================================================
  D       Collared flycatcher  ======================================================
B D           Tasmanian devil  ======================================================
B D                   Wallaby  ======================================================
B D                    Turkey  ======================================================
          Tibetan ground jay  ======================================================
  D    White-throated sparrow  ======================================================
  D           Green seaturtle  ======================================================
B D                Coelacanth  ======================================================
B D             X. tropicalis  ======================================================
  D    Spiny softshell turtle  ======================================================
  D  Chinese softshell turtle  ======================================================
  D            Painted turtle  ======================================================

Alignment block 16 of 872 in window, 4854653 - 4854654, 2 bps 
B D                     Human  c-----------g
B D                     Chimp  c-----------g
B D                   Gorilla  c-----------g
B D                 Orangutan  c-----------g
B D                    Gibbon  c-----------g
B D                    Rhesus  c-----------g
B D       Crab-eating macaque  c-----------g
B D                    Baboon  c-----------g
B D              Green monkey  c-----------g
B D                  Marmoset  c-----------g
B D           Squirrel monkey  c-----------g
B D                  Bushbaby  c-----------g
           Chinese tree shrew  c------cgagtg
B D                  Squirrel  c------------
       Lesser Egyptian jerboa  c------------
                 Prairie vole  c------------
B D           Chinese hamster  c------------
               Golden hamster  c------------
B D                     Mouse  c------------
B D                       Rat  c------------
B D            Naked mole-rat  g------------
B D                Guinea pig  t------------
                   Chinchilla  c------------
             Brush-tailed rat  c------------
B D                    Rabbit  tcctgac------
B D                       Pig  c------------
B D                    Alpaca  t------------
               Bactrian camel  t------------
B D                   Dolphin  c------------
                 Killer whale  c------------
             Tibetan antelope  c------------
B D                       Cow  t------------
B D                     Sheep  c------------
                Domestic goat  c------------
B D                     Horse  c------------
B D          White rhinoceros  c------------
B D                       Cat  c------------
B D                       Dog  c------------
B D                   Ferret   c------------
B D                     Panda  c------------
               Pacific walrus  c------------
                 Weddell seal  c------------
             Black flying-fox  a------------
B D                   Megabat  a------------
                Big brown bat  a------------
         David's myotis (bat)  a------------
B D                  Microbat  a------------
              Star-nosed mole  a------------
B D                  Elephant  c------------
             Cape golden mole  c------------
                     Aardvark  c------------
B D                 Armadillo  c------------
B D                   Opossum  c------------
B D        American alligator  -----------cg
B D                    Tenrec  =============
         Cape elephant shrew  -------------
B D                     Shrew  -------------
B D                      Pika  =============
B D                   Manatee  -------------
B D              Atlantic cod  =============
         Pundamilia nyererei  =============
         Princess of Burundi  =============
                 Spotted gar  =============
B D                      Fugu  =============
B D              Nile tilapia  =============
B D               Stickleback  =============
                 Zebra mbuna  =============
B D                 Zebrafish  =============
B D                    Medaka  =============
B D                 Tetraodon  =============
       Burton's mouthbreeder  =============
          Southern platyfish  =============
B D                   Chicken  =============
  D              Mallard duck  =============
B D                Budgerigar  =============
  D              Saker falcon  =============
  D               Rock pigeon  =============
B D                  Platypus  -------------
B D       Medium ground finch  =============
B D                    Lizard  =============
  D       Collared flycatcher  =============
B D           Tasmanian devil  =============
B D                   Wallaby  =============
B D                    Turkey  =============
          Tibetan ground jay  =============
  D    White-throated sparrow  =============
  D           Green seaturtle  =============
B D                Coelacanth  =============
B D             X. tropicalis  =============
  D    Spiny softshell turtle  =============
  D  Chinese softshell turtle  =============
  D            Painted turtle  =============

Inserts between block 16 and 17 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 1bp

Alignment block 17 of 872 in window, 4854655 - 4854678, 24 bps 
B D                     Human  ca-------t----------tccctcc-------cac--------c------------------------
B D                     Chimp  ca-------t----------tccctcc-------cac--------c------------------------
B D                   Gorilla  ca-------t----------tccctcc-------cac--------c------------------------
B D                 Orangutan  ca-------t----------tccctcc-------aac--------c------------------------
B D                    Gibbon  ca-------t----------tccctcc-------aac--------c------------------------
B D                    Rhesus  cc-------t----------tccctcc-------aac--------c------------------------
B D       Crab-eating macaque  cc-------t----------tccctcc-------aac--------c------------------------
B D                    Baboon  ca-------t----------tccctcc-------aac--------c------------------------
B D              Green monkey  ca-------t----------tccctcc-------aac--------c------------------------
B D                  Marmoset  ca-------t----------tccctcc-------aac--------c------------------------
B D           Squirrel monkey  ca-------t----------tccctcc-------agc--------c------------------------
B D                  Bushbaby  ct-------t----------tccctcc-------aac--------c------------------------
           Chinese tree shrew  cc-------tccgactcctgcccctcc-------agg--------t------------------------
B D                  Squirrel  ca-------t----------tccctcc-------atc-cccctgcc-----ctccc----------a-gg
       Lesser Egyptian jerboa  cg-------t----------tccctcc-------atc-ctttgtcc-------ctc----------a-gg
                 Prairie vole  ta-------g----------cccctcc-------acc-ccttaccc-------ccg----------c-gg
B D           Chinese hamster  cgttcccctt----------ccccccc-------agc-ccatatcc-------ccg----------a-gg
               Golden hamster  ca-------t----------cccctcc-------aac-ccatgacc-------ccg----------a-gg
B D                     Mouse  aa-------t----------gccctcc-------aat-ccgtacgc-------ccg----------a-gg
B D                       Rat  ca-------t----------gccctcc-------agt-ccgtaccc-------ccg----------a-gg
B D            Naked mole-rat  ca-------t----------cccctcc-------aaaaccctgcac-------tcc----------a-gg
B D                Guinea pig  ca-------t----------cccctct-------aaaaccctgccc-------tcc----------a-gg
                   Chinchilla  ca-------t----------cccctcc-------agagccttgccc-------tcc----------a-gg
             Brush-tailed rat  ca------------------cccatcc-------aaaaccttgccc-------tcc----------a-gg
B D                    Rabbit  ca-------c----------tccctcc-------gagcccctgccc-------ctc----------c-ga
B D                      Pika  ca-------c----------tccctcc-------agg---------------------------------
B D                       Pig  ca-------t----------tccttct-------gac------act-------ctg--cccctccag-gc
B D                    Alpaca  ca-------t----------ttcttcc-------aac------ccc-------cta--cccctccag-gc
               Bactrian camel  ca-------t----------ttcttcc-------aac------ccc-------cta--cccctccag-gc
B D                   Dolphin  ca-------t----------tccttcc-------aa-------ccc-------ttg--cacgtccag-gc
                 Killer whale  ca-------t----------tccttcc-------aa-------ccc-------ttg--cacgtccag-gc
             Tibetan antelope  ca-------c----------tccttcc-------aac------ccc-------ttg--cccctccag-gc
B D                       Cow  ca-------c----------ttcttcc-------aac------ccc-------ctg--cccctccag-gc
B D                     Sheep  ca-------c----------tccttcc-------acc------ccc-------ctg--cccctccag-gc
                Domestic goat  ca-------c----------tccttcc-------aac------ccc-------ctg--cccctccag-gc
B D                     Horse  ca-------t----------tccgtct-------gac------ccctgccgctcc-----------aggc
B D          White rhinoceros  cc-------t----------tccctcc-------aac------ccctgacgctcc-----------c-gc
B D                       Cat  ca---ttcct----------tccctcc-------aat------ccc-------ctg--gccctccag-gc
B D                       Dog  cc-------c----------tgcctcc-------aat------ccc-------ct-----------a-ac
B D                   Ferret   ca-------t----------tccctcc-------aat------ccc-------ct-----------a-ac
B D                     Panda  ca-------t----------tccctcc-------aat------ccc-------ct-----------a-ac
               Pacific walrus  ca-------t----------tccctcc-------aat------ccc-------ct-----------a-ac
                 Weddell seal  ca-------t----------tccctcc-------aat------ccc-------ct-----------a-ac
             Black flying-fox  cg-------t----------tccctcc-------ggc------ccc-------tag--cgcctccgg-gc
B D                   Megabat  cg-------t----------tccctcc---t---ggc------ccc-------tag--cgcctccgg-gc
                Big brown bat  ca-------t----------tcctcccaccc---cgc------ccc-------ccg--cccctccag-gc
         David's myotis (bat)  ca-------a----------tccttcc-ccc---tct------ccc-------ccg--cccctccag-gc
B D                  Microbat  ca-------t----------tccttccaccc---cct------ccc-------ccg--cccctccag-gc
B D                     Shrew  ---------t----------tccgccc----------------ccg-------cggagcggagcgga-gt
              Star-nosed mole  ca-------c----------cctgccc----------------ctt-------cag------------gt
B D                  Elephant  ---------------------caccc--gccgccagt------ccc-------ccg--ccccgggag-gc
          Cape elephant shrew  ----------------------------------agc------ctg-------cct--ggcctgggg-gc
B D                   Manatee  ----------------------------------acc------ccc-------ctg--cccctggag-gc
             Cape golden mole  ---------------------tgccctagcc---agc------ccc-------ctg--tccctcaag-gc
                     Aardvark  ---------------------gtc----------agt------cc--------ctg--ctcctcgag-gc
B D                 Armadillo  ---------------------ccctcg-------aac------cta-------cgg--cgcctcgag-gc
B D                   Opossum  -----------------------------------------------------------cactcctt-ac
B D                  Platypus  --------------------------------------tcctcccc-------ccg--taaggacgg-gt
B D        American alligator  -----------------cggtcctccc-------ggcgcccggccc-------cg---------------
B D                    Tenrec  ======================================================================
B D              Atlantic cod  ======================================================================
         Pundamilia nyererei  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                      Fugu  ======================================================================
B D              Nile tilapia  ======================================================================
B D               Stickleback  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================

                        Human  ---ccc--tg----------------------ccgga
                        Chimp  ---ccc--tg----------------------ccgga
                      Gorilla  ---ccc--tg----------------------ccgga
                    Orangutan  ---ccc--tg----------------------ccgca
                       Gibbon  ---ccc--tg----------------------ccgga
                       Rhesus  ---ccc--tg----------------------ccgga
          Crab-eating macaque  ---ccc--tg----------------------ccgga
                       Baboon  ---ccc--tg----------------------ccgga
                 Green monkey  ---ccc--tg----------------------ccaga
                     Marmoset  ---ccc--tg----------------------ccgga
              Squirrel monkey  ---ccc--tg----------------------ccgga
                     Bushbaby  ---cca---g----------------------ccgga
           Chinese tree shrew  ---ccc--aa----------------------cagga
                     Squirrel  ---ccct-tg----------------------ctgga
       Lesser Egyptian jerboa  ---ccct-gg----------------------cagga
                 Prairie vole  ---ccagagg----------------------caaga
              Chinese hamster  ---ccagggg----------------------ctaga
               Golden hamster  ---ccagggg----------------------ctaga
                        Mouse  ---ccatggg----------------------taaaa
                          Rat  ---ctatggg----------------------tgaaa
               Naked mole-rat  ---cca--gg----------------------ctgga
                   Guinea pig  ---cct--tg----------------------ctgga
                   Chinchilla  ---ccg--gg----------------------ctgga
             Brush-tailed rat  ---ctg--gg----------------------ctgga
                       Rabbit  gccccg--gg----------------------ccgga
                         Pika  ---cca--gg----------------------ctaga
                          Pig  ---ccg--tg----------------------ctgga
                       Alpaca  ---ccc--ag----------------------ccgga
               Bactrian camel  ---ccc--ag----------------------ccaga
                      Dolphin  ---ccc--tg----------------------ccgga
                 Killer whale  ---ccc--tg----------------------ccgga
             Tibetan antelope  ---ccc--ta----------------------ccgga
                          Cow  ---ccc--tg----------------------ctgga
                        Sheep  ---ccc--ta----------------------ccgga
                Domestic goat  ---ccc--ta----------------------ccgga
                        Horse  ---cct--tg----------------------ccgga
             White rhinoceros  ---cct--tg----------------------cggga
                          Cat  ---cct--tg----------------------ccgga
                          Dog  ---cct--gg----------------------ccgga
                      Ferret   ---cct--tg----------------------ccaga
                        Panda  ---cct--tg----------------------cggga
               Pacific walrus  ---cct--tg----------------------ccaga
                 Weddell seal  ---ctt--tg----------------------tcgga
             Black flying-fox  ---ccc--ag----------------------ctgaa
                      Megabat  ---ccc--cg----------------------ctgaa
                Big brown bat  ---ccg--cg----------------------ccgga
         David's myotis (bat)  ---ccg--cg----------------------ccgga
                     Microbat  ---ccg--cg----------------------ccgga
                        Shrew  ---cct--cg----------------------cgggc
              Star-nosed mole  ---ccc--ag----------------------cgggc
                     Elephant  ---cgg--tg----------------------gggga
          Cape elephant shrew  cg-cgg--cg----------------------cacgg
                      Manatee  ---cca--cg----------------------cagga
             Cape golden mole  ---tct--tt----------------------cagca
                     Aardvark  ---cca--cg----------------------cagga
                    Armadillo  ---cct--gg----------------------ccgga
                      Opossum  ---ccc--cc----------------------aaata
                     Platypus  ---cct--gggaaggaggggagatgcctgagccggga
           American alligator  -------------------------------------
                       Tenrec  =====================================
                 Atlantic cod  =====================================
          Pundamilia nyererei  =====================================
          Princess of Burundi  =====================================
                  Spotted gar  =====================================
                         Fugu  =====================================
                 Nile tilapia  =====================================
                  Stickleback  =====================================
                  Zebra mbuna  =====================================
                    Zebrafish  =====================================
                       Medaka  =====================================
                    Tetraodon  =====================================
        Burton's mouthbreeder  =====================================
           Southern platyfish  =====================================
                      Chicken  =====================================
                 Mallard duck  =====================================
                   Budgerigar  =====================================
                 Saker falcon  =====================================
                  Rock pigeon  =====================================
          Medium ground finch  =====================================
                       Lizard  =====================================
          Collared flycatcher  =====================================
              Tasmanian devil  =====================================
                      Wallaby  =====================================
                       Turkey  =====================================
           Tibetan ground jay  =====================================
       White-throated sparrow  =====================================
              Green seaturtle  =====================================
                   Coelacanth  =====================================
                X. tropicalis  =====================================
       Spiny softshell turtle  =====================================
     Chinese softshell turtle  =====================================
               Painted turtle  =====================================

Alignment block 18 of 872 in window, 4854679 - 4854702, 24 bps 
B D                     Human  act---gag--atgg--------------------------gg---cccac---g-----------g---
B D                     Chimp  act---gag--atgg--------------------------gg---cccac---g-----------g---
B D                   Gorilla  act---gag--atgg--------------------------gg---cccac---g-----------g---
B D                 Orangutan  act---gag--atgg--------------------------gg---cccac---g-----------g---
B D                    Gibbon  acc---gag--atgg--------------------------gg---cccac---g-----------g---
B D                    Rhesus  act---gag--atgg--------------------------gg---cccac---g-----------g---
B D       Crab-eating macaque  act---gag--atgg--------------------------gg---cccac---g-----------g---
B D                    Baboon  act---gag--atgg--------------------------gg---cccac---g-----------g---
B D              Green monkey  act---gag--atgg--------------------------gg---cccac---g-----------g---
B D                  Marmoset  act---gag--aggg--------------------------gg---cccac---a-----------g---
B D           Squirrel monkey  act---gag--aggg--------------------------gg---cccac---g-----------g---
B D                  Bushbaby  act---gag--agga--------------------------gg---ccc-c---g-----------g---
           Chinese tree shrew  act---gag--cggg--------------------------gg---ccctt---g-----------g---
B D                  Squirrel  att---ggg--atgg--------------------------gg---ccctc---a-----------g---
       Lesser Egyptian jerboa  ccc---gag--tggg--------------------------atttcaccaa---g-----------t---
                 Prairie vole  ggc---gag--agag--------------------------gc---gctta---g-----------ttga
B D           Chinese hamster  gcc---ggg--agag--------------------------gt---gctta---g-----------t---
               Golden hamster  gcc---cag--agag--------------------------gt---gctta---g-----------t---
B D                     Mouse  gcc---gag--accg--------------------------gt---gctcc---g-----------t---
B D                       Rat  gcc---cac--accg--------------------------gt---gctca---g-----------t---
B D            Naked mole-rat  act---ga--------------------------------------gctgg---g-----------g---
B D                Guinea pig  act---ga--------------------------------------actgg---g-----------g---
                   Chinchilla  agt---ga----------------------------------------------------------g---
             Brush-tailed rat  cct---ga--------------------------------------gctgg---g-----------g---
B D                    Rabbit  act---cagctgggg--------------------------gg---ccccc---a-----------g---
B D                      Pika  act---a----gggg--------------------------ga---ccccc---a-----------g---
B D                       Pig  act---gaa--gtgg--------------------------gg---gcctcccgg-----------c---
B D                    Alpaca  act---gag--atg----------------------------------------------------c---
               Bactrian camel  act---gag--atg----------------------------------------------------c---
B D                   Dolphin  act---gag--atgg--------------------------gg---gcctc---g-----------g---
                 Killer whale  act---gag--atgg--------------------------gg---gcctc---g-----------g---
             Tibetan antelope  act---gag--atgg--------------------------gg---ccctc---g-----------g---
B D                       Cow  act---gag--atgg--------------------------gg---ccctc---g-----------g---
B D                     Sheep  act---gag--atgg--------------------------gg---ccctc---ggggcggggggtg---
                Domestic goat  act---gag--atgg--------------------------gg---ccctc---g-----------g---
B D                     Horse  act---gag--atga--------------------------gg---ccctc---a-----------g---
B D          White rhinoceros  act---gag--atgg--------------------------gg---ccctc---a-----------g---
B D                       Cat  act---gag--acgg--------------------------gg---ccctc---a-----------g---
B D                       Dog  act---gaa--acgg--------------------------gg---cgccc---c-----------g---
B D                   Ferret   acc---gag--acgg--------------------------gg---ccctc---a-----------a---
B D                     Panda  act---gag--acgg--------------------------gg---cgctc---g-----------g---
               Pacific walrus  acc---gag--tcgggagtcg-------------------cgg---ccctc---a-----------g---
                 Weddell seal  acc---gag--tcgg--------------------------gg---ccctc---a-----------g---
             Black flying-fox  act---gag--ctg---------------------------gg---ccctc---a-----------g---
B D                   Megabat  act---gag--ctg---------------------------gg---tcctc---a-----------g---
                Big brown bat  act---gag--agc---------------------------gg---ccctc---g-----------c---
         David's myotis (bat)  act---gag--gcc---------------------------ga---ccctc---g-----------c---
B D                  Microbat  act---gag--gcc---------------------------gg---ccctc---g-----------c---
B D                     Shrew  a-----ggg--cag---------------------------gg---cctgg---g-----------g---
              Star-nosed mole  act---gag--aca---------------------------gg---cctgc---g-----------c---
B D                  Elephant  act---gag--atgg--------------------------gg---ccctc---g-----------g---
          Cape elephant shrew  tct---gag--gtga--------------------------gg---gctcc---g-----------c---
B D                   Manatee  act---gag--atgg--------------------------gg---ccctc---a-----------g---
             Cape golden mole  acc---aag--ctag--------------------------gg---tccac---t-----------g---
                     Aardvark  att---gag--at-g--------------------------gg---ttcac---a-----------g---
B D                 Armadillo  act---gag--atgg--------------------------gg---ccctg---a-----------g---
B D                   Opossum  tctcacaag--ttaa--------------------------aa---tcctt---t-----------g---
B D                  Platypus  act---agg--atgggaaaagaccccttctctctgccatccga---tccgg---a-----------a---
B D        American alligator  ------------ctc--------------------------gt---ctccc---c-----------g---
  D    Spiny softshell turtle  act---ggg--tcag--------------------------ag---ttgat---g-----------g---
B D                    Tenrec  ======================================================================
B D              Atlantic cod  ======================================================================
         Pundamilia nyererei  ======================================================================
         Princess of Burundi  ======================================================================
                 Spotted gar  ======================================================================
B D                      Fugu  ======================================================================
B D              Nile tilapia  ======================================================================
B D               Stickleback  ======================================================================
                 Zebra mbuna  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
B D                 Tetraodon  ======================================================================
       Burton's mouthbreeder  ======================================================================
          Southern platyfish  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Turkey  ======================================================================
          Tibetan ground jay  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================

                        Human  c-g----------g--gc
                        Chimp  c-g----------g--gc
                      Gorilla  c-g----------g--gc
                    Orangutan  c-g----------g--gc
                       Gibbon  c-g----------g--gc
                       Rhesus  c-g----------g--gc
          Crab-eating macaque  c-g----------g--gc
                       Baboon  c-g----------g--gc
                 Green monkey  c-g----------g--gc
                     Marmoset  c-g----------g--gc
              Squirrel monkey  c-g----------g--gc
                     Bushbaby  a-g----------a--gt
           Chinese tree shrew  c-g----------g--gc
                     Squirrel  c-g----------gccc-
       Lesser Egyptian jerboa  g-g----------g--g-
                 Prairie vole  c-g----------g--c-
              Chinese hamster  c-g----------g--c-
               Golden hamster  c-g----------g--c-
                        Mouse  c-g----------g--c-
                          Rat  c-g----------g--c-
               Naked mole-rat  c-c----------c--t-
                   Guinea pig  c-c----------c--t-
                   Chinchilla  c-c----------c--t-
             Brush-tailed rat  c-c----------c--t-
                       Rabbit  c-g----------g----
                         Pika  c-a----------g--c-
                          Pig  t-g----------g--gc
                       Alpaca  t-g----------g--gc
               Bactrian camel  t-g----------g--gc
                      Dolphin  t-g----------g--gc
                 Killer whale  t-g----------g--gc
             Tibetan antelope  t-g----------g--gc
                          Cow  t-g----------g----
                        Sheep  g-g----------g--gc
                Domestic goat  t-g----------g--gc
                        Horse  c-g----------g--gc
             White rhinoceros  c-g----------g--gc
                          Cat  c-c----------g--gc
                          Dog  c-g----------g--gc
                      Ferret   cgg----------g--gc
                        Panda  c-g----------g--gc
               Pacific walrus  c-g----------g--ac
                 Weddell seal  c-g----------g--gc
             Black flying-fox  c-g----------g--gc
                      Megabat  c-g----------g--gc
                Big brown bat  g-g----------g--gc
         David's myotis (bat)  g-g----------g--gc
                     Microbat  g-g----------g--gc
                        Shrew  a-c----------c--gt
              Star-nosed mole  g-g----------c--cc
                     Elephant  c-g----------g--gc
          Cape elephant shrew  t-gcctgggccccg--tt
                      Manatee  a-g----------a--gc
             Cape golden mole  c-g----------g--gc
                     Aardvark  c-g----------g--gc
                    Armadillo  c-g----------g--gc
                      Opossum  c-g----------t--tt
                     Platypus  c-g----------g--tt
           American alligator  c-g----------g--gc
       Spiny softshell turtle  a-a----------t--gt
                       Tenrec  ==================
                 Atlantic cod  ==================
          Pundamilia nyererei  ==================
          Princess of Burundi  ==================
                  Spotted gar  ==================
                         Fugu  ==================
                 Nile tilapia  ==================
                  Stickleback  ==================
                  Zebra mbuna  ==================
                    Zebrafish  ==================
                       Medaka  ==================
                    Tetraodon  ==================
        Burton's mouthbreeder  ==================
           Southern platyfish  ==================
                      Chicken  ==================
                 Mallard duck  ==================
                   Budgerigar  ==================
                 Saker falcon  ==================
                  Rock pigeon  ==================
          Medium ground finch  ==================
                       Lizard  ==================
          Collared flycatcher  ==================
              Tasmanian devil  ==================
                      Wallaby  ==================
                       Turkey  ==================
           Tibetan ground jay  ==================
       White-throated sparrow  ==================
              Green seaturtle  ==================
                   Coelacanth  ==================
                X. tropicalis  ==================
     Chinese softshell turtle  ==================
               Painted turtle  ==================

Alignment block 19 of 872 in window, 4854703 - 4854725, 23 bps 
B D                     Human  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D                     Chimp  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D                   Gorilla  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D                 Orangutan  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D                    Gibbon  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D                    Rhesus  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D       Crab-eating macaque  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D                    Baboon  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D              Green monkey  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D                  Marmoset  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D           Squirrel monkey  tgcgca------gggc---aga-gctg---------ga----ggg--------------------g-
B D                  Bushbaby  t-----------gggc---aga-gcct---------ga----ggg--------------------g-
           Chinese tree shrew  tgcgcggaggctgagc---aga-gccg---------ca----ggg--------------------g-
B D                  Squirrel  ------------gggc---aga-gcct---------gg----ggg--------------------a-
       Lesser Egyptian jerboa  ------------aagt---act-gacc---------ag----gga----------------------
                 Prairie vole  ------------aggc---aga-gcga---------ga----gga--------------------a-
B D           Chinese hamster  ------------ggac---aga-gcta---------ga----gga--------------------a-
               Golden hamster  ------------ggac---aga-agga---------ga----aga--------------------a-
B D                     Mouse  ------------gggc---aaa-gaga---------gg----gga--------------------a-
B D                       Rat  ------------gggc---aga-gaga---------gg----gga--------------------a-
B D            Naked mole-rat  ------------tgtc---ca----------------------------------------------
B D                Guinea pig  ------------tggc---cg----------------------------------------------
                   Chinchilla  ------------cggc---cg----------------------------------------------
             Brush-tailed rat  ------------tgac---cg----------------------------------------------
B D                    Rabbit  ------------------------------------gt----tga--------------------g-
B D                      Pika  ------------tgag---cgg-gggccaggaaccagg----tga--------------------g-
B D                       Pig  -------------------aga-gtct---------gg----ggt----------gggggatggag-
B D                    Alpaca  -------------------aga-tctt---------gg----ggg--------------------g-
               Bactrian camel  -------------------aga-tcct---------gg----ggg--------------------g-
B D                   Dolphin  t-----------gggc---aga-gcct---------gg----ggg--------------------g-
                 Killer whale  t-----------gggc---aga-gcct---------gg----ggg--------------------g-
             Tibetan antelope  a-----------gagc-ctgga-ggtg---------gg----ggc--agggggggtggaggggacg-
B D                       Cow  a-----------aagc-ctgga-ggtg---------gg----ggt----------tagagggggcg-
B D                     Sheep  g-----------ggg----ggg-gggg---------gg----ggggggggggggggggaggggacg-
                Domestic goat  a-----------gagc-ctgga-ggtg---------gg----ggcggggggtgggtggaggggacg-
B D                     Horse  t-----------gggc---aga-gcct----------gg---ggg--------------------g-
B D          White rhinoceros  t-----------gggc---aga-gcccc--------ggg---ggg--------------------g-
B D                       Cat  g-----------gggc---aga-gcct---------ggc---ggg--------------------g-
B D                       Dog  t-----------gcgc---agc-gccc---------ggc---ggg--------------------g-
B D                   Ferret   t-----------gggc---agc-gcct---------gga---ggg--------------------g-
B D                     Panda  t-----------gagc---agc-gcct---------gac---ggg--------------------c-
               Pacific walrus  t-----------gggc---agc-gcct---------ggc---ggg--------------------g-
                 Weddell seal  t-----------gggc---agc-gcct---------ggc---ggg--------------------g-
             Black flying-fox  t-----------gggc---agaggctg---------g-----ggg--------------------a-
B D                   Megabat  t-----------gggc---agaggccg---------g-----ggg--------------------a-
                Big brown bat  t-----------gggc---aga-gccg---------g-----ggg--------------------g-
         David's myotis (bat)  c------------ggc---aga-acc----------g-----ggg--------------------g-
B D                  Microbat  t-----------gggc---aga-gcct---------g-----ggg--------------------g-
B D                     Shrew  g-----------gggc-------gctg---------g-----gga--------------------g-
              Star-nosed mole  c-----------tgcc-------ggcg---------g-----ggg--------------------c-
B D                  Elephant  t-----------gggc---aca-gcct---------g-----ggg--------------------g-
          Cape elephant shrew  t-----------gggc---cca-tcct---------g-----ggg--------------------g-
B D                   Manatee  t-----------gggc---aga-gcct---------g-----ggg--------------------g-
             Cape golden mole  t-----------gcgc---aga-gcct---------a-----ggg--------------------g-
                     Aardvark  t-----------gggc---aga-gcct---------g-----ggg--------------------g-
B D                 Armadillo  t-----------gggc---aga-------------------------------------------g-
B D                   Opossum  ------------ggtccctaaa-gaca---------ga----gaa--------------------a-
B D                  Platypus  -----------tgcgt---aag-acag---------ag----aag--------------------t-
B D        American alligator  -----------tgttc---agg-gccg---------tgctcgggg--------------------gc
  D    Spiny softshell turtle  -----------cgcgc---agg-acag---------agc---agg--------------------ac
B D                    Tenrec  ===================================================================
B D              Atlantic cod  ===================================================================
         Pundamilia nyererei  ===================================================================
         Princess of Burundi  ===================================================================
                 Spotted gar  ===================================================================
B D                      Fugu  ===================================================================
B D              Nile tilapia  ===================================================================
B D               Stickleback  ===================================================================
                 Zebra mbuna  ===================================================================
B D                 Zebrafish  ===================================================================
B D                    Medaka  ===================================================================
B D                 Tetraodon  ===================================================================
       Burton's mouthbreeder  ===================================================================
          Southern platyfish  ===================================================================
B D                   Chicken  ===================================================================
  D              Mallard duck  ===================================================================
B D                Budgerigar  ===================================================================
  D              Saker falcon  ===================================================================
  D               Rock pigeon  ===================================================================
B D       Medium ground finch  ===================================================================
B D                    Lizard  ===================================================================
  D       Collared flycatcher  ===================================================================
B D           Tasmanian devil  ===================================================================
B D                   Wallaby  ===================================================================
B D                    Turkey  ===================================================================
          Tibetan ground jay  ===================================================================
  D    White-throated sparrow  ===================================================================
  D           Green seaturtle  ===================================================================
B D                Coelacanth  ===================================================================
B D             X. tropicalis  ===================================================================
  D  Chinese softshell turtle  ===================================================================
  D            Painted turtle  ===================================================================

Inserts between block 19 and 20 in window
B D                     Pika 13bp
  D   Spiny softshell turtle 3bp

Alignment block 20 of 872 in window, 4854726 - 4854726, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  g
B D                  Squirrel  a
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  c
B D                       Rat  t
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
B D                 Armadillo  g
B D                   Opossum  a
B D                  Platypus  c
B D                   Chicken  a
B D                    Turkey  a
B D        American alligator  a
  D    Spiny softshell turtle  g
B D                    Tenrec  =
            Brush-tailed rat  -
                  Chinchilla  -
B D                Guinea pig  -
B D            Naked mole-rat  -
      Lesser Egyptian jerboa  -
B D              Atlantic cod  =
         Pundamilia nyererei  =
         Princess of Burundi  =
                 Spotted gar  =
B D                      Fugu  =
B D              Nile tilapia  =
B D               Stickleback  =
                 Zebra mbuna  =
B D                 Zebrafish  =
B D                    Medaka  =
B D                 Tetraodon  =
       Burton's mouthbreeder  =
          Southern platyfish  =
  D              Mallard duck  =
B D                Budgerigar  =
  D              Saker falcon  =
  D               Rock pigeon  =
B D       Medium ground finch  =
B D                    Lizard  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Wallaby  =
          Tibetan ground jay  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                Coelacanth  =
B D             X. tropicalis  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =

Alignment block 21 of 872 in window, 4854727 - 4854731, 5 bps 
B D                     Human  gaa-------gg---
B D                     Chimp  gaa-------gg---
B D                   Gorilla  gaa-------gg---
B D                 Orangutan  gaa-------gg---
B D                    Gibbon  gaa-------gg---
B D                    Rhesus  gaa-------gc---
B D       Crab-eating macaque  gaa-------gc---
B D                    Baboon  gaa-------gc---
B D              Green monkey  gaa-------gc---
B D                  Marmoset  gaa-------gg---
B D           Squirrel monkey  gaa-------gg---
B D                  Bushbaby  gaa-------cg---
           Chinese tree shrew  aaa-------ag---
B D                  Squirrel  gcc-------gc---
       Lesser Egyptian jerboa  ccg-------g----
                 Prairie vole  cca-------gg---
B D           Chinese hamster  tcg-------gg---
               Golden hamster  tct-------gg---
B D                     Mouse  tcg-------g----
B D                       Rat  tcg-------gg---
B D                    Rabbit  cca-------gg---
B D                      Pika  ccacccccgcgg---
B D                       Pig  gaa-------gg---
B D                    Alpaca  gaa-------gg---
               Bactrian camel  gaa-------gg---
B D                   Dolphin  gaa-------gg---
                 Killer whale  gaa-------gg---
             Tibetan antelope  gaa-------gg---
B D                       Cow  gaa-------gg---
B D                     Sheep  gaa-------gg---
                Domestic goat  gaa-------gg---
B D                     Horse  gaa-------gg---
B D          White rhinoceros  gaa-------gg---
B D                       Cat  gaa-------gg---
B D                       Dog  gga-------gg---
B D                   Ferret   gaa-------gg---
B D                     Panda  gaa-------gg---
               Pacific walrus  gaa-------gg---
                 Weddell seal  gaa-------gg---
             Black flying-fox  gaa-------gg---
B D                   Megabat  gaa-------gg---
                Big brown bat  gaa-------gg---
         David's myotis (bat)  gca-------gg---
B D                  Microbat  gca-------gg---
B D                     Shrew  c--------------
              Star-nosed mole  g--------------
B D                  Elephant  gaa-------gg---
          Cape elephant shrew  gcc-------ga---
B D                   Manatee  gaa-------gg---
             Cape golden mole  gaa-------gg---
                     Aardvark  gaa-------gg---
B D                 Armadillo  gga-------gg---
B D                   Opossum  gag-------gc---
B D                  Platypus  gtg-------aa---
  D              Saker falcon  -----------gaag
  D          Peregrine falcon  -----------gaag
B D                   Chicken  --------------g
B D                    Turkey  --------------g
B D        American alligator  ----------ggatg
  D    Spiny softshell turtle  ----------ggtaa
B D                    Tenrec  ===============
            Brush-tailed rat  ---------------
                  Chinchilla  ---------------
B D                Guinea pig  ---------------
B D            Naked mole-rat  ---------------
B D              Atlantic cod  ===============
         Pundamilia nyererei  ===============
         Princess of Burundi  ===============
                 Spotted gar  ===============
B D                      Fugu  ===============
B D              Nile tilapia  ===============
B D               Stickleback  ===============
                 Zebra mbuna  ===============
B D                 Zebrafish  ===============
B D                    Medaka  ===============
B D                 Tetraodon  ===============
       Burton's mouthbreeder  ===============
          Southern platyfish  ===============
  D              Mallard duck  ===============
B D                Budgerigar  ===============
  D               Rock pigeon  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D       Collared flycatcher  ===============
B D           Tasmanian devil  ===============
B D                   Wallaby  ===============
          Tibetan ground jay  ===============
  D    White-throated sparrow  ===============
  D           Green seaturtle  ===============
B D                Coelacanth  ===============
B D             X. tropicalis  ===============
  D  Chinese softshell turtle  ===============
  D            Painted turtle  ===============

Inserts between block 21 and 22 in window
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp
B D       American alligator 4043bp

Alignment block 22 of 872 in window, 4854732 - 4854736, 5 bps 
B D                     Human  gccag
B D                     Chimp  gccag
B D                   Gorilla  gccag
B D                 Orangutan  gccag
B D                    Gibbon  gccag
B D                    Rhesus  gccag
B D       Crab-eating macaque  gccag
B D                    Baboon  gccag
B D              Green monkey  gccag
B D                  Marmoset  gcgag
B D           Squirrel monkey  gcgag
B D                  Bushbaby  gacaa
           Chinese tree shrew  gcgag
B D                  Squirrel  g-gag
       Lesser Egyptian jerboa  ----a
                 Prairie vole  g-tag
B D           Chinese hamster  g-gaa
               Golden hamster  g-gaa
B D                       Rat  a-cag
B D                    Rabbit  c-tgg
B D                      Pika  c-ggg
B D                       Pig  acgag
B D                    Alpaca  gtgaa
               Bactrian camel  gtgag
B D                   Dolphin  gcgag
                 Killer whale  gcgag
             Tibetan antelope  gcgag
B D                       Cow  gcgaa
B D                     Sheep  gctag
                Domestic goat  gcgag
B D                     Horse  gcgag
B D          White rhinoceros  gcgag
B D                       Cat  gcgag
B D                       Dog  gcgag
B D                   Ferret   gcaag
B D                     Panda  gcgag
               Pacific walrus  gcgag
                 Weddell seal  gcgag
             Black flying-fox  gcgag
B D                   Megabat  gcgag
                Big brown bat  gccag
         David's myotis (bat)  gccag
B D                  Microbat  gccag
B D                     Shrew  ----a
              Star-nosed mole  ----g
B D                  Elephant  gtgag
          Cape elephant shrew  gtgag
B D                   Manatee  gtgag
             Cape golden mole  gcgca
                     Aardvark  gacag
B D                 Armadillo  gcaaa
B D                   Opossum  gctga
B D                  Platypus  gccag
  D              Saker falcon  gaaag
  D          Peregrine falcon  gaaag
B D                   Chicken  ggaac
B D                    Turkey  ggaac
  D    Spiny softshell turtle  gccag
B D                    Tenrec  =====
            Brush-tailed rat  -----
B D                     Mouse  -----
                  Chinchilla  -----
B D                Guinea pig  -----
B D            Naked mole-rat  -----
B D              Atlantic cod  =====
         Pundamilia nyererei  =====
         Princess of Burundi  =====
                 Spotted gar  =====
B D                      Fugu  =====
B D              Nile tilapia  =====
B D               Stickleback  =====
                 Zebra mbuna  =====
B D                 Zebrafish  =====
B D                    Medaka  =====
B D                 Tetraodon  =====
       Burton's mouthbreeder  =====
          Southern platyfish  =====
B D        American alligator  =====
  D              Mallard duck  =====
B D                Budgerigar  =====
  D               Rock pigeon  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D       Collared flycatcher  =====
B D           Tasmanian devil  =====
B D                   Wallaby  =====
          Tibetan ground jay  =====
  D    White-throated sparrow  =====
  D           Green seaturtle  =====
B D                Coelacanth  =====
B D             X. tropicalis  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====

Inserts between block 22 and 23 in window
  D   Spiny softshell turtle 5857bp

Alignment block 23 of 872 in window, 4854737 - 4854764, 28 bps 
B D                     Human  -ccttc--ctccg---c----cgggg-tgggcagagcca
B D                     Chimp  -ccttc--ctccg---c----cgggggtgggcagagcca
B D                   Gorilla  -ccttc--ctccg---c----cgggggtgggcagagcca
B D                 Orangutan  -ccttc--ctccg---c----cgggggtgggcagagcca
B D                    Gibbon  -ccttc--ctccg---c----cgggggtgggcagagcca
B D                    Rhesus  -ccttc--ctccg---c----cgggggtgggcagagcca
B D       Crab-eating macaque  -ccttc--ctccg---c----cgggggtgggcagagcca
B D                    Baboon  -ccttc--ctccg---c----cgggggtgggcagagcca
B D              Green monkey  -ccttc--ctccg---c----cgggggtgggcagagcca
B D                  Marmoset  -ccttc--ctcca---c----cgggggtgggtaaagcgg
B D           Squirrel monkey  -ccttc--ctcca---c----cgggggtgggtaaagctg
B D                  Bushbaby  -ccttc--c-ccg---c----ccggggccgggagagccg
           Chinese tree shrew  -ccttc--ctccg---c----tgggg-tgggcagagccg
B D                  Squirrel  --cctt--cctcc---g----ctgggggtggcgcagcca
       Lesser Egyptian jerboa  -ccctt--cctct---a--------ggtgggcagagctg
                 Prairie vole  -tcttt--cccgt---g----ccgcggtgggccaagctg
B D           Chinese hamster  -tcctt--cccgt---a----ccgcggtgggccgagctg
               Golden hamster  -tcttt--cccgt---a----cggcggtgggccgagctg
B D                     Mouse  -----------gt---a----cagcggtgggccgagacg
B D                       Rat  -tcttt--ccagt---a----ccgcggtgggccgagacc
B D            Naked mole-rat  -------------------------gctgggcagggcca
B D                Guinea pig  -------------------------gtcgggcagggcca
                   Chinchilla  -------------------------gctgggcagggccg
             Brush-tailed rat  -------------------------gctggccagggccc
B D                    Rabbit  -ccttc--ctggg---c----ctcgggtgggccgagccg
B D                      Pika  -cctcc--ccagg---c----ccaccctgggccaagcct
B D                       Pig  -ccttc--ctcgg---c----ccagggtgggcagagcca
B D                    Alpaca  -ccttc--ctcgg---c----ccagggtgggcagagtca
               Bactrian camel  -ccttc--ctcgt---c----ccagggtgggcagagtca
B D                   Dolphin  -ccttc--ctcag---c----tcagggtgggcagagccg
                 Killer whale  -ccttc--ctcag---c----tcagggtgggcaaagccg
             Tibetan antelope  -ccttc--tttag---c----ccagggtgggcagagcca
B D                       Cow  -ccttc--tttag---c----ccagggtgga-agagcca
B D                     Sheep  -ccttc--tttag---c----ccagggtgggcagagcca
                Domestic goat  -ccttc--tttag---c----ccagggtgggcagagcca
B D                     Horse  -ccttc--tccag---c----ccggggtgggcagcggca
B D          White rhinoceros  -ccttc--ctggg---c----ccagggtgggcagcgcca
B D                       Cat  -cctcc--ctcgg---c----ccggggtgggcagagccg
B D                       Dog  -ccttc--ctcgg---c----ctggggtgggccgagcca
B D                   Ferret   -ccgtc--ctcgg---c----gcagggaggtcagagcca
B D                     Panda  -ccttc--cttgg---c----cagggg------------
               Pacific walrus  -ccttc--ctcgg---c----ccggggtgggcagagcca
                 Weddell seal  -ccctc--ctcgg---c----ccggggtgggcagagcca
             Black flying-fox  -cgttc--ctccg---c----ccgaggtgggcagtgccg
B D                   Megabat  -cattc--ctcgg---c----ccgaggtgggcagtgccg
                Big brown bat  -gctcc--ctggg---c----ccagggcgggcagcgcc-
         David's myotis (bat)  -ccctc--ctggg---c----tcagggtgggcagcgcc-
B D                  Microbat  -ccctc--ctggg---c----ccagggtgggcagcgcc-
B D                     Shrew  -cccag--cctgg---cgggtcccgggtgggcagaggcc
              Star-nosed mole  -cgcct--cccgg---c----cctgggagggcagagtcg
B D                  Elephant  -ccttc--cccga---t----ccggggtgggcagagcca
          Cape elephant shrew  -ccctcagaccggggtc----ccggggtgggcaacccga
B D                   Manatee  -ccttc--ccggg---t----ccggggtgggcagagcct
             Cape golden mole  -ctgtc-tcccggccgg----ccggggtgggcagaacca
                     Aardvark  -ctttc--caggg---t----ccggggtgggcagagccg
B D                 Armadillo  -cgacc---cagg---c----ccggagtgggccgagcag
B D                   Opossum  -tttag--ctgggga-g----ccctggtcacttcagcca
B D                  Platypus  -ttttc--cccga--------cgggagcctataaaacat
  D              Saker falcon  cactgc--cttag---c----catgg--ggctttcacca
  D          Peregrine falcon  cactgc--cttag---c----catgg--ggctttcacca
B D                   Chicken  cgctgc--cttcg---c----catgg--ggctagcacca
B D                    Turkey  cgctgc--cttcg---c----catgg--ggctaacacca
B D                    Tenrec  =======================================
B D              Atlantic cod  =======================================
         Pundamilia nyererei  =======================================
         Princess of Burundi  =======================================
                 Spotted gar  =======================================
B D                      Fugu  =======================================
B D              Nile tilapia  =======================================
B D               Stickleback  =======================================
                 Zebra mbuna  =======================================
B D                 Zebrafish  =======================================
B D                    Medaka  =======================================
B D                 Tetraodon  =======================================
       Burton's mouthbreeder  =======================================
          Southern platyfish  =======================================
B D        American alligator  =======================================
  D              Mallard duck  =======================================
B D                Budgerigar  =======================================
  D               Rock pigeon  =======================================
B D       Medium ground finch  =======================================
B D                    Lizard  =======================================
  D       Collared flycatcher  =======================================
B D           Tasmanian devil  =======================================
B D                   Wallaby  =======================================
          Tibetan ground jay  =======================================
  D    White-throated sparrow  =======================================
  D           Green seaturtle  =======================================
B D                Coelacanth  =======================================
B D             X. tropicalis  =======================================
  D    Spiny softshell turtle  =======================================
  D  Chinese softshell turtle  =======================================
  D            Painted turtle  =======================================

Alignment block 24 of 872 in window, 4854765 - 4854770, 6 bps 
B D                     Human  gaat--g-------g
B D                     Chimp  gaat--g-------g
B D                   Gorilla  gaat--g-------g
B D                 Orangutan  gaat--g-------g
B D                    Gibbon  gaat--g-------g
B D                    Rhesus  gaat--g-------g
B D       Crab-eating macaque  gaat--g-------g
B D                    Baboon  gaat--g-------g
B D              Green monkey  gaat--g-------g
B D                  Marmoset  ggct--g-------g
B D           Squirrel monkey  ggat--g-------g
B D                  Bushbaby  ggag--g-------g
           Chinese tree shrew  gggt--g-------g
B D                  Squirrel  ggat--g-------g
       Lesser Egyptian jerboa  gg-------------
                 Prairie vole  gggt--g-------g
B D           Chinese hamster  gggt--g-------g
               Golden hamster  gggt--g-------g
B D                     Mouse  gggt--g-------g
B D                       Rat  gggt--g-------g
B D            Naked mole-rat  ggct--g-------g
B D                Guinea pig  ggat-gg-------g
                   Chinchilla  ggac-gg-------g
             Brush-tailed rat  ggacggg-------g
B D                    Rabbit  ggac--t-------c
B D                      Pika  ggat--g-------c
B D                       Pig  ggat--a-------g
B D                    Alpaca  ggat--g-------g
               Bactrian camel  ggat--g-------g
B D                   Dolphin  ggat--g-------g
                 Killer whale  ggat--g-------g
             Tibetan antelope  ggat--g-------g
B D                       Cow  ggat--g-------g
B D                     Sheep  ggat--g-------g
                Domestic goat  ggat--g-------g
B D                     Horse  ggat--g-------g
B D          White rhinoceros  ggat--g-------g
B D                       Cat  ggat-----------
B D                       Dog  ggat--g-------g
B D                   Ferret   ggat--g-------g
B D                     Panda  ---t--g-------g
               Pacific walrus  ggat--g-------g
                 Weddell seal  ggat--g-------g
             Black flying-fox  gggt--g-------g
B D                   Megabat  gggt--t-------g
                Big brown bat  gggt--g-------g
         David's myotis (bat)  cggt--a-------g
B D                  Microbat  gggt--a-------g
B D                     Shrew  ggat--g-------g
              Star-nosed mole  ggat--g-------g
B D                  Elephant  ggat--g-------g
          Cape elephant shrew  ggat--g-------g
B D                   Manatee  ggat--g-------g
             Cape golden mole  ggat--g-------g
                     Aardvark  ggat--g-------g
B D                 Armadillo  gccg--g-------g
B D                   Opossum  ggag--a-------t
B D                  Platypus  gaga--gagcccccg
  D              Saker falcon  agac--a-------g
  D          Peregrine falcon  agac--a-------g
B D                   Chicken  aggc--a-------g
B D                    Turkey  agcc--a-------g
B D               Stickleback  gact--g-------a
B D                    Tenrec  ===============
B D              Atlantic cod  ===============
         Pundamilia nyererei  ===============
         Princess of Burundi  ===============
                 Spotted gar  ===============
B D                      Fugu  ===============
B D              Nile tilapia  ===============
                 Zebra mbuna  ===============
B D                 Zebrafish  ===============
B D                    Medaka  ===============
B D                 Tetraodon  ===============
       Burton's mouthbreeder  ===============
          Southern platyfish  ===============
B D        American alligator  ===============
  D              Mallard duck  ===============
B D                Budgerigar  ===============
  D               Rock pigeon  ===============
B D       Medium ground finch  ===============
B D                    Lizard  ===============
  D       Collared flycatcher  ===============
B D           Tasmanian devil  ===============
B D                   Wallaby  ===============
          Tibetan ground jay  ===============
  D    White-throated sparrow  ===============
  D           Green seaturtle  ===============
B D                Coelacanth  ===============
B D             X. tropicalis  ===============
  D    Spiny softshell turtle  ===============
  D  Chinese softshell turtle  ===============
  D            Painted turtle  ===============

Alignment block 25 of 872 in window, 4854771 - 4854774, 4 bps 
B D                     Human  aaga
B D                     Chimp  aaga
B D                   Gorilla  aaga
B D                 Orangutan  aaga
B D                    Gibbon  aaga
B D                    Rhesus  aaga
B D       Crab-eating macaque  aaga
B D                    Baboon  aaga
B D              Green monkey  aaga
B D                  Marmoset  aaga
B D           Squirrel monkey  aaga
B D                  Bushbaby  aaga
           Chinese tree shrew  aaga
B D                  Squirrel  aaga
       Lesser Egyptian jerboa  -gac
                 Prairie vole  agga
B D           Chinese hamster  agga
               Golden hamster  agga
B D                     Mouse  agga
B D                       Rat  agga
B D            Naked mole-rat  gggc
B D                Guinea pig  gggc
                   Chinchilla  gggc
             Brush-tailed rat  gggc
B D                    Rabbit  aaaa
B D                      Pika  aaaa
B D                       Pig  aaga
B D                    Alpaca  aaga
               Bactrian camel  aaga
B D                   Dolphin  aaga
                 Killer whale  aaga
             Tibetan antelope  aaga
B D                       Cow  aaga
B D                     Sheep  aaga
                Domestic goat  aaga
B D                     Horse  aaga
B D          White rhinoceros  aaga
B D                       Dog  aaga
B D                   Ferret   aaga
B D                     Panda  aaga
               Pacific walrus  aaga
                 Weddell seal  aaga
             Black flying-fox  gaga
B D                   Megabat  gaga
                Big brown bat  aaga
         David's myotis (bat)  aagg
B D                  Microbat  aagg
B D                     Shrew  aaga
              Star-nosed mole  -aga
B D                  Elephant  gaga
          Cape elephant shrew  gaga
B D                   Manatee  aaga
             Cape golden mole  aagt
                     Aardvark  ggga
B D                 Armadillo  aaga
B D                   Opossum  attg
B D                  Platypus  ggga
  D              Saker falcon  ccaa
  D          Peregrine falcon  ccaa
B D                   Chicken  ccaa
B D                    Turkey  ccaa
B D               Stickleback  agca
                  Spotted gar  aaga
B D                    Tenrec  ====
B D                       Cat  ----
B D              Atlantic cod  ====
         Pundamilia nyererei  ====
         Princess of Burundi  ====
B D                      Fugu  ====
B D              Nile tilapia  ====
                 Zebra mbuna  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
B D                 Tetraodon  ====
       Burton's mouthbreeder  ====
          Southern platyfish  ====
B D        American alligator  ====
  D              Mallard duck  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D       Collared flycatcher  ====
B D           Tasmanian devil  ====
B D                   Wallaby  ====
          Tibetan ground jay  ====
  D    White-throated sparrow  ====
  D           Green seaturtle  ====
B D                Coelacanth  ====
B D             X. tropicalis  ====
  D    Spiny softshell turtle  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====

Inserts between block 25 and 26 in window
  D             Saker falcon 7bp
  D         Peregrine falcon 7bp
B D                  Chicken 6bp
B D                   Turkey 6bp

Alignment block 26 of 872 in window, 4854775 - 4854776, 2 bps 
B D                     Human  -c-g
B D                     Chimp  -c-g
B D                   Gorilla  -c-g
B D                 Orangutan  -c-g
B D                    Gibbon  -c-g
B D                    Rhesus  -t-g
B D       Crab-eating macaque  -t-g
B D                    Baboon  -t-g
B D              Green monkey  -t-g
B D                  Marmoset  -t-g
B D           Squirrel monkey  -c-g
B D                  Bushbaby  -c-g
           Chinese tree shrew  -t-a
B D                  Squirrel  -c--
       Lesser Egyptian jerboa  -c--
                 Prairie vole  -c--
B D           Chinese hamster  -c--
               Golden hamster  -c--
B D                     Mouse  -c--
B D                       Rat  -c--
B D            Naked mole-rat  -a--
B D                Guinea pig  -a--
                   Chinchilla  -a--
             Brush-tailed rat  -a--
B D                    Rabbit  -c--
B D                      Pika  -c--
B D                       Pig  -c-t
B D                    Alpaca  -c-g
               Bactrian camel  -c-g
B D                   Dolphin  -t-g
                 Killer whale  -t-g
             Tibetan antelope  -t-g
B D                       Cow  -t-g
B D                     Sheep  -t-g
                Domestic goat  -t-g
B D                     Horse  -c-g
B D          White rhinoceros  -c-g
B D                       Dog  -c-g
B D                   Ferret   -c-g
B D                     Panda  -c-g
               Pacific walrus  -c-g
                 Weddell seal  -c-g
             Black flying-fox  -c-g
B D                   Megabat  -c-g
                Big brown bat  -c-g
         David's myotis (bat)  -c-a
B D                  Microbat  -c-a
B D                     Shrew  -c-g
              Star-nosed mole  -g-g
B D                  Elephant  -c-t
          Cape elephant shrew  -t-g
B D                   Manatee  -c-g
             Cape golden mole  -ctg
                     Aardvark  -c-g
B D                 Armadillo  -a-g
B D                   Opossum  -c-t
B D                  Platypus  -g-g
  D              Saker falcon  -t--
  D          Peregrine falcon  -t--
           Tibetan ground jay  -t--
B D                   Chicken  -t--
B D                    Turkey  -t--
B D               Stickleback  ct--
                  Spotted gar  ct--
B D                    Tenrec  ====
B D                       Cat  ----
B D              Atlantic cod  ====
         Pundamilia nyererei  ====
         Princess of Burundi  ====
B D                      Fugu  ====
B D              Nile tilapia  ====
                 Zebra mbuna  ====
B D                 Zebrafish  ====
B D                    Medaka  ====
B D                 Tetraodon  ====
       Burton's mouthbreeder  ====
          Southern platyfish  ====
B D        American alligator  ====
  D              Mallard duck  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
B D       Medium ground finch  ====
B D                    Lizard  ====
  D       Collared flycatcher  ====
B D           Tasmanian devil  ====
B D                   Wallaby  ====
  D    White-throated sparrow  ====
  D           Green seaturtle  ====
B D                Coelacanth  ====
B D             X. tropicalis  ====
  D    Spiny softshell turtle  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====

Inserts between block 26 and 27 in window
B D                  Chicken 1bp
B D                   Turkey 1bp

Alignment block 27 of 872 in window, 4854777 - 4854777, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  g
       Lesser Egyptian jerboa  t
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  c
B D                Guinea pig  t
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  c
B D          White rhinoceros  c
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
B D                  Platypus  t
  D               Rock pigeon  t
  D              Saker falcon  t
  D          Peregrine falcon  t
           Tibetan ground jay  t
B D                Budgerigar  t
  D             Scarlet macaw  t
  D              Mallard duck  t
B D                   Chicken  t
B D                    Turkey  t
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  t
B D                Coelacanth  t
B D               Stickleback  g
                  Spotted gar  t
B D                    Tenrec  =
B D                       Cat  -
B D              Atlantic cod  =
         Pundamilia nyererei  =
         Princess of Burundi  =
B D                      Fugu  =
B D              Nile tilapia  =
                 Zebra mbuna  =
B D                 Zebrafish  =
B D                    Medaka  =
B D                 Tetraodon  =
       Burton's mouthbreeder  =
          Southern platyfish  =
B D        American alligator  =
B D       Medium ground finch  =
B D                    Lizard  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Wallaby  =
  D    White-throated sparrow  =
B D             X. tropicalis  =

Alignment block 28 of 872 in window, 4854778 - 4854779, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  tt
           Chinese tree shrew  tt
B D                  Squirrel  tt
       Lesser Egyptian jerboa  tt
                 Prairie vole  tt
B D           Chinese hamster  tt
               Golden hamster  tc
B D                     Mouse  tg
B D                       Rat  tt
B D            Naked mole-rat  tc
B D                Guinea pig  tt
                   Chinchilla  tc
             Brush-tailed rat  tc
B D                    Rabbit  tc
B D                      Pika  ct
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tt
B D          White rhinoceros  tt
B D                       Dog  tg
B D                   Ferret   tt
B D                     Panda  tt
               Pacific walrus  tt
                 Weddell seal  tt
                Big brown bat  cg
         David's myotis (bat)  tg
B D                  Microbat  tg
B D                     Shrew  tt
              Star-nosed mole  tt
B D                  Elephant  tt
          Cape elephant shrew  tt
B D                   Manatee  tt
             Cape golden mole  tt
                     Aardvark  tg
B D                 Armadillo  tg
B D                   Opossum  tc
B D                  Platypus  tg
  D               Rock pigeon  -t
  D              Saker falcon  -t
  D          Peregrine falcon  -t
           Tibetan ground jay  tt
B D                Budgerigar  -t
  D                    Parrot  -t
  D             Scarlet macaw  -t
  D              Mallard duck  -t
B D                   Chicken  -c
B D                    Turkey  -c
  D           Green seaturtle  -t
  D            Painted turtle  -t
  D  Chinese softshell turtle  -t
  D    Spiny softshell turtle  -t
B D                Coelacanth  ct
B D               Stickleback  ca
                  Spotted gar  tt
B D                    Tenrec  ==
            Black flying-fox  --
B D                       Cat  --
B D              Atlantic cod  ==
         Pundamilia nyererei  ==
         Princess of Burundi  ==
B D                      Fugu  ==
B D              Nile tilapia  ==
                 Zebra mbuna  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
B D                 Tetraodon  ==
       Burton's mouthbreeder  ==
          Southern platyfish  ==
B D        American alligator  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Wallaby  ==
  D    White-throated sparrow  ==
B D             X. tropicalis  ==
B D                   Megabat  --

Inserts between block 28 and 29 in window
                 Spotted gar 1bp

Alignment block 29 of 872 in window, 4854780 - 4854781, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                   Gorilla  gg
B D                 Orangutan  gg
B D                    Gibbon  gg
B D                    Rhesus  gg
B D       Crab-eating macaque  gg
B D                    Baboon  gg
B D              Green monkey  gg
B D                  Marmoset  gg
B D           Squirrel monkey  gg
B D                  Bushbaby  gg
           Chinese tree shrew  gg
B D                  Squirrel  tg
       Lesser Egyptian jerboa  gg
                 Prairie vole  gg
B D           Chinese hamster  gg
               Golden hamster  gg
B D                     Mouse  gg
B D                       Rat  gg
B D            Naked mole-rat  gg
B D                Guinea pig  ag
                   Chinchilla  gg
             Brush-tailed rat  gg
B D                    Rabbit  gg
B D                      Pika  gc
B D                       Pig  gg
B D                    Alpaca  gg
               Bactrian camel  gg
B D                   Dolphin  gg
                 Killer whale  gg
             Tibetan antelope  gg
B D                       Cow  gg
B D                     Sheep  gg
                Domestic goat  gg
B D                     Horse  gg
B D          White rhinoceros  gg
B D                       Cat  gg
B D                       Dog  gg
B D                   Ferret   gg
B D                     Panda  gg
               Pacific walrus  gg
                 Weddell seal  gg
                Big brown bat  gg
         David's myotis (bat)  gg
B D                  Microbat  gg
B D                     Shrew  gg
              Star-nosed mole  g-
B D                  Elephant  gg
          Cape elephant shrew  gg
B D                   Manatee  gg
             Cape golden mole  gg
                     Aardvark  gg
B D                 Armadillo  gg
B D                   Opossum  gg
B D                  Platypus  gg
  D               Rock pigeon  gg
  D              Saker falcon  gg
  D          Peregrine falcon  gg
           Tibetan ground jay  gg
B D                Budgerigar  gg
  D                    Parrot  gg
  D             Scarlet macaw  gg
  D              Mallard duck  gg
B D                   Chicken  gg
B D                    Turkey  gg
  D           Green seaturtle  gg
  D            Painted turtle  gg
  D  Chinese softshell turtle  gg
  D    Spiny softshell turtle  gg
B D                Coelacanth  gg
B D              Nile tilapia  ga
B D               Stickleback  gg
                  Spotted gar  gg
B D                    Tenrec  ==
            Black flying-fox  --
B D              Atlantic cod  ==
         Pundamilia nyererei  ==
         Princess of Burundi  ==
B D                      Fugu  ==
                 Zebra mbuna  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
B D                 Tetraodon  ==
       Burton's mouthbreeder  ==
          Southern platyfish  ==
B D        American alligator  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Wallaby  ==
  D    White-throated sparrow  ==
B D             X. tropicalis  ==
B D                   Megabat  --

Alignment block 30 of 872 in window, 4854782 - 4854783, 2 bps 
B D                     Human  tc-
B D                     Chimp  tc-
B D                   Gorilla  tc-
B D                 Orangutan  tc-
B D                    Gibbon  tc-
B D                    Rhesus  tc-
B D       Crab-eating macaque  tc-
B D                    Baboon  tc-
B D              Green monkey  tc-
B D                  Marmoset  tc-
B D           Squirrel monkey  tc-
B D                  Bushbaby  tg-
           Chinese tree shrew  tc-
B D                  Squirrel  gc-
       Lesser Egyptian jerboa  t--
                 Prairie vole  tc-
B D           Chinese hamster  tc-
               Golden hamster  tc-
B D                     Mouse  tc-
B D                       Rat  tc-
B D            Naked mole-rat  tt-
B D                Guinea pig  tc-
                   Chinchilla  tc-
             Brush-tailed rat  tc-
B D                    Rabbit  gt-
B D                      Pika  tc-
B D                       Pig  tc-
B D                    Alpaca  tc-
               Bactrian camel  tc-
B D                   Dolphin  tc-
                 Killer whale  tc-
             Tibetan antelope  tc-
B D                       Cow  tc-
B D                     Sheep  tc-
                Domestic goat  tc-
B D                     Horse  tc-
B D          White rhinoceros  tc-
B D                       Cat  tc-
B D                       Dog  tc-
B D                   Ferret   tc-
B D                     Panda  tc-
               Pacific walrus  tc-
                 Weddell seal  tc-
             Black flying-fox  tt-
B D                   Megabat  tt-
                Big brown bat  tt-
         David's myotis (bat)  tt-
B D                  Microbat  tt-
B D                     Shrew  tg-
              Star-nosed mole  -g-
B D                  Elephant  cc-
          Cape elephant shrew  -c-
B D                   Manatee  cc-
             Cape golden mole  cc-
                     Aardvark  cg-
B D                 Armadillo  cc-
B D                   Opossum  ac-
B D                  Platypus  ac-
  D               Rock pigeon  gc-
  D              Saker falcon  gc-
  D          Peregrine falcon  gc-
           Tibetan ground jay  gc-
B D                Budgerigar  gc-
  D                    Parrot  gc-
  D             Scarlet macaw  gc-
  D              Mallard duck  gc-
B D                   Chicken  gc-
B D                    Turkey  gc-
  D           Green seaturtle  gc-
  D            Painted turtle  gc-
  D  Chinese softshell turtle  gc-
  D    Spiny softshell turtle  gc-
B D                    Lizard  tc-
B D                Coelacanth  gc-
B D              Nile tilapia  -ct
B D               Stickleback  -aa
                  Spotted gar  -ca
B D                    Tenrec  ===
B D              Atlantic cod  ===
         Pundamilia nyererei  ===
         Princess of Burundi  ===
B D                      Fugu  ===
                 Zebra mbuna  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
B D                 Tetraodon  ===
       Burton's mouthbreeder  ===
          Southern platyfish  ===
B D        American alligator  ===
B D       Medium ground finch  ===
  D       Collared flycatcher  ===
B D           Tasmanian devil  ===
B D                   Wallaby  ===
  D    White-throated sparrow  ===
B D             X. tropicalis  ===

Inserts between block 30 and 31 in window
          Chinese tree shrew 1bp
B D                 Squirrel 3bp
      Lesser Egyptian jerboa 2bp
                Prairie vole 3bp
B D          Chinese hamster 3bp
              Golden hamster 3bp
B D                    Mouse 3bp
B D                      Rat 3bp
B D                   Rabbit 3bp
B D                     Pika 3bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 3bp
B D                 Platypus 24bp
  D              Rock pigeon 1bp
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
          Tibetan ground jay 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp
B D                   Lizard 1bp
B D               Coelacanth 1bp

Alignment block 31 of 872 in window, 4854784 - 4854785, 2 bps 
B D                     Human  -g------a
B D                     Chimp  -g------a
B D                   Gorilla  -g------a
B D                 Orangutan  -g------a
B D                    Gibbon  -g------a
B D                    Rhesus  -g------a
B D       Crab-eating macaque  -g------a
B D                    Baboon  -g------a
B