Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1399 in window, 53758977 - 53758995, 19 bps 
B D                     Human  tg------cc-----c----------t--c--cc--------tttca-----------------------
B D                     Chimp  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D                   Gorilla  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D                 Orangutan  tg------cc-----c----------t--g--cc--------ttcca-----------------------
B D                    Gibbon  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D                    Rhesus  tg------cc-----c----------t--c--tc--------ttcca-----------------------
B D       Crab-eating macaque  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D                    Baboon  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D              Green monkey  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D                  Marmoset  tg------cc-----c----------t--c--cc--------ttcct-----------------------
B D           Squirrel monkey  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D                  Bushbaby  tg------cc-----c----------t--g--cc--------ttccc-----------------------
           Chinese tree shrew  tg------tc-----c----------t--c--tc--------ttccg-----------------------
B D                  Squirrel  ta------cc-----c----------t--c--cc--------ttcca-----------------------
                 Prairie vole  ta------cc-----c----------t--c--cc--------catc------------------------
B D           Chinese hamster  ta------cc-----c----------t--c--cc--------ctcca-----------------------
               Golden hamster  ca------cc-----c----------t--c--cc--------ctcca-----------------------
B D                     Mouse  ta------cc-----c----------t--c--cc--------ctcca-----------------------
B D                       Rat  ta------cc-----c----------t--c--cc--------ctccg-----------------------
B D            Naked mole-rat  cc------tc-----t----------t--c--cc--------ttcct-----------------------
B D                Guinea pig  tc------ct-----t----------t--c--cc--------tttg------------------------
                   Chinchilla  tc------cc-----t----------t--g--cc--------tttg------------------------
             Brush-tailed rat  tc------cc-----t----------t--c--cc--------ttcc------------------------
B D                    Rabbit  tc------cc-----t----------t--g--ct--------ttgct-----------------------
B D                      Pika  tc------cc-----c----------caag--cc--------ctaca-----------------------
B D                       Pig  cg------gc-----c----------t--c--cc--------ttcca-----------------------
B D                    Alpaca  tg------cc-----c----------t--c--cc--------ttcca-----------------------
               Bactrian camel  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D                   Dolphin  tg------cc-----t----------g--c--cc--------ttcca-----------------------
                 Killer whale  tg------cc-----t----------g--c--cc--------ttcca-----------------------
             Tibetan antelope  cg------cc-----t----------g--c--cc--------ttcca-----------------------
B D                       Cow  cg------cc-----t----------g--c--cc--------ttcca-----------------------
B D                     Sheep  cg------cc-----t----------g--c--cc--------ttcca-----------------------
                Domestic goat  cg------cc-----t----------g--c--cc--------ttcca-----------------------
B D                     Horse  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D          White rhinoceros  tg------cc-----c----------t--c--cc--------ttctc-----------------------
B D                       Cat  gg------cc-----c----------t--c--cc--------ttcct-----------------------
B D                       Dog  tgc-----cc-----c----------c--c--cc--------tt--------------------------
B D                   Ferret   tgccactcac-----c----------c--c--cc--------ttccg-----------------------
B D                     Panda  tg------cc-----c----------c--c--cc--------ttcca-----------------------
               Pacific walrus  tgc-----cc-----c----------c--c--ct--------ttcca-----------------------
                 Weddell seal  tgc----tcc-----c----------c--c--ct--------ttcca-----------------------
             Black flying-fox  tg------tc-----c----------t--c--cc--------tttca-----------------------
B D                   Megabat  tg------tc-----c----------t--c--cc---------ttca-----------------------
                Big brown bat  tg------ct-----t----------t--c--tc--------tttca-----------------------
         David's myotis (bat)  tg------cc-----t----------t--c--tc--------tttca-----------------------
B D                  Microbat  tg------cc-----t----------t--c--tc--------tttca-----------------------
B D                  Hedgehog  ct------cc-----c----------g--c--c-------------------------------------
B D                     Shrew  ct------cc-----c----------t--t--c-----------tca-----------------------
              Star-nosed mole  tc------cc-----c----------t--c--cc--------tgcca-----------------------
          Cape elephant shrew  tg------cc-----c----------t--c--cc--------tt--------------------------
B D                   Manatee  tg------cc-----c----------t--c--cc--------ttcca-----------------------
             Cape golden mole  tg------ct-----c----------t--c--cc--------ttcca-----------------------
B D                    Tenrec  tg------cc-----c----------t--c--tc--------ttcca-----------------------
                     Aardvark  tg------cc-----c----------t--c--cc--------ttcca-----------------------
B D                 Armadillo  gc------ct-----c----------c--c--cccactgttgttcca-----------------------
B D                   Opossum  gg------tc-----t----------c--t--tc--------atcct-----------------------
B D           Tasmanian devil  ca------cc-----c----------c--c--at--------tccct-----------------------
B D                  Platypus  ta------ccgatttg----------t--c--ca--------ttccaagcgcttagtccggtgctctgca
  D               Rock pigeon  ct------tt-----g----------c--a--cc--------tctcg-----------------------
B D               Zebra finch  ct------ct-----g----------c--t--cc--------tctct-----------------------
  D             Scarlet macaw  cc------tt-----t----------c--c--ca--------tgtct-----------------------
B D                    Turkey  ct------tt-----g----------t--a--tc--------tgtca-----------------------
B D        American alligator  gc------ct-----g----------c--aagcc--------tttct-----------------------
B D                    Lizard  ca------ct-----ggtcgatccctt--c--cc--------tatcc-----------------------
B D             X. tropicalis  tg------ct-----t----------c--c--cc--------tgcc------------------------
B D                Coelacanth  tg------tc-----tg---------t--c--tc--------cttgt-----------------------
B D                 Zebrafish  ct------cc-----c----------a--c--cc--------tgtcc-----------------------
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================

                        Human  -----------------------------------------------------tctct
                        Chimp  -----------------------------------------------------tctct
                      Gorilla  -----------------------------------------------------tctct
                    Orangutan  -----------------------------------------------------tctct
                       Gibbon  -----------------------------------------------------tctct
                       Rhesus  -----------------------------------------------------tctct
          Crab-eating macaque  -----------------------------------------------------tctct
                       Baboon  -----------------------------------------------------tctct
                 Green monkey  -----------------------------------------------------tctct
                     Marmoset  -----------------------------------------------------tctct
              Squirrel monkey  -----------------------------------------------------tctct
                     Bushbaby  -----------------------------------------------------gctct
           Chinese tree shrew  -----------------------------------------------------tctct
                     Squirrel  -----------------------------------------------------tctct
                 Prairie vole  ----------------------------------------------------------
              Chinese hamster  -----------------------------------------------------tctct
               Golden hamster  -----------------------------------------------------tctct
                        Mouse  -----------------------------------------------------tcctt
                          Rat  -----------------------------------------------------tccct
               Naked mole-rat  -----------------------------------------------------tctct
                   Guinea pig  -----------------------------------------------------tcttg
                   Chinchilla  -----------------------------------------------------tctct
             Brush-tailed rat  -----------------------------------------------------tctcc
                       Rabbit  -----------------------------------------------------tctct
                         Pika  -----------------------------------------------------tctct
                          Pig  -----------------------------------------------------tctct
                       Alpaca  -----------------------------------------------------gctct
               Bactrian camel  -----------------------------------------------------gctct
                      Dolphin  -----------------------------------------------------cctct
                 Killer whale  -----------------------------------------------------cctct
             Tibetan antelope  -------------------------------------------------------tct
                          Cow  -------------------------------------------------------tct
                        Sheep  -------------------------------------------------------tct
                Domestic goat  -------------------------------------------------------tct
                        Horse  -----------------------------------------------------cccct
             White rhinoceros  -----------------------------------------------------tctct
                          Cat  -----------------------------------------------------tctct
                          Dog  ----------------------------------------------------------
                      Ferret   -----------------------------------------------------tctct
                        Panda  -----------------------------------------------------tctct
               Pacific walrus  -----------------------------------------------------tctct
                 Weddell seal  -----------------------------------------------------tctct
             Black flying-fox  -----------------------------------------------------tctct
                      Megabat  -----------------------------------------------------tctct
                Big brown bat  -----------------------------------------------------cctct
         David's myotis (bat)  -----------------------------------------------------tctct
                     Microbat  -----------------------------------------------------tctct
                     Hedgehog  ----------------------------------------------------------
                        Shrew  -----------------------------------------------------tctct
              Star-nosed mole  -----------------------------------------------------gctcc
          Cape elephant shrew  -----------------------------------------------------tctct
                      Manatee  -----------------------------------------------------tctct
             Cape golden mole  -----------------------------------------------------tctca
                       Tenrec  -----------------------------------------------------tctct
                     Aardvark  -----------------------------------------------------tctct
                    Armadillo  -----------------------------------------------------tctct
                      Opossum  -----------------------------------------------------tctcc
              Tasmanian devil  -----------------------------------------------------tcccc
                     Platypus  catagtaagcgctcaataaatactattgagtgaatgaatgaatgaatatccggtcttt
                  Rock pigeon  -----------------------------------------------------cattt
                  Zebra finch  -----------------------------------------------------ttttt
                Scarlet macaw  -----------------------------------------------------ttcct
                       Turkey  -----------------------------------------------------cctct
           American alligator  -----------------------------------------------------ctctc
                       Lizard  -----------------------------------------------------ctttc
                X. tropicalis  -----------------------------------------------------tctct
                   Coelacanth  -----------------------------------------------------acact
                    Zebrafish  -----------------------------------------------------tcttc
               Painted turtle  ==========================================================
              Green seaturtle  ==========================================================
       Lesser Egyptian jerboa  ----------------------------------------------------------
             Peregrine falcon  ==========================================================
                 Saker falcon  ==========================================================
                     Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ==========================================================

Inserts between block 1 and 2 in window
B D                  Opossum 5bp
B D          Tasmanian devil 5bp
  D              Rock pigeon 8bp
B D              Zebra finch 5bp
  D            Scarlet macaw 6bp
B D                   Turkey 8bp
B D       American alligator 5bp
B D                   Lizard 9bp
B D            X. tropicalis 8bp

Alignment block 2 of 1399 in window, 53758996 - 53759019, 24 bps 
B D                     Human  cc-ttttt-gcttctcttct----------ccct-------g-t
B D                     Chimp  cc-ttttt-gcttttcttct----------ccct-------g-t
B D                   Gorilla  cc-ttttt-gcttcttttct----------ccct-------g-t
B D                 Orangutan  cc-ttttt-gcttctcttct----------ccct-------g-t
B D                    Gibbon  cc-ttttt-gcttctcttct----------ccct-------g-t
B D                    Rhesus  cc-ttttt-gc-----ttct----------ccct-------g-t
B D       Crab-eating macaque  cc-ttttt-gc-----ttct----------ccct-------g-t
B D                    Baboon  cc-ttttt-gc-----ttct----------ccct-------g-t
B D              Green monkey  cc-ttttt-gc-----ttct----------ccct-------g-t
B D                  Marmoset  cc-ttttt-gcttctcttct----------ccct-------g-t
B D           Squirrel monkey  cc-ttttt-gcttctctt-------------cct-------g-t
B D                  Bushbaby  ct-ttttt-gcttctcttat----------gtct-------g-t
           Chinese tree shrew  ---ttttt-gcttctctcat----------ctct-------g-t
B D                  Squirrel  ct-tttct-gcttttcttat----------ctct-------c-t
       Lesser Egyptian jerboa  ---cttct-gcttctcttat----------c------------t
                 Prairie vole  -----cct-gcttctcttgc----------ctat-------g-t
B D           Chinese hamster  c--catct-gcttttcttgc----------ctat-------g-t
               Golden hamster  c--catct-gcttttcttgc----------ctat-------g-t
B D                     Mouse  c--cttct-gcttctgtcgc----------t--t-------g-t
B D                       Rat  c--cttcc-gct-------------------------------t
B D            Naked mole-rat  ct-attct-gtttctcttat----------ctct-------g-a
B D                Guinea pig  ct-accct-gtttctcttat----------ctct-------g-t
                   Chinchilla  ct-gttct-gtttctcttat----------cctt-------g-t
             Brush-tailed rat  ct-gttct-gtttctcttat----------gtct-------g-c
B D                    Rabbit  cc-ctgtt---tgcttctgt----------ctct-------g-t
B D                      Pika  tc-cctct---ttttggctt----------ctct-------g-g
B D                       Pig  ct-ttttt-gcttctcttat----------ctgt-------g-t
B D                    Alpaca  ct-ttttt-gcttctcctat----------ctgc-------a-t
               Bactrian camel  ct-tttttcgcttctcctat----------ctgc-------g-t
B D                   Dolphin  ct-ctttt-gcttctcttat----------ctgt-------g-t
                 Killer whale  ct-ttttt-gcttctcttat----------ctgt-------g-t
             Tibetan antelope  ct-cattt-gcttctcttat----------ctgt-------g-t
B D                       Cow  ct-cgttt-gcttctcttat----------ctgg-------g-t
B D                     Sheep  ct-cattt-gcttctcttat----------ctgt-------g-t
                Domestic goat  ct-cattt-gcttctcttat----------ctgt-------g-t
B D                     Horse  ct-ttttt-gcttctcttat----------ctct-------g-t
B D          White rhinoceros  ct-ttttt-gcttctcttat----------ctcc-------g-t
B D                       Cat  ct-tcctt-gcttctcttat----------ctct-------g-t
B D                       Dog  ----cctt-gcttctcttat---------cccct-------g-g
B D                   Ferret   ct-ccctt-gcttctcttac----------ttct-------g--
B D                     Panda  ct-ccctt-gcttctcttat----------ctct-------g-t
               Pacific walrus  ct-ccctt-gcttctcctat----------ctct-------g-t
                 Weddell seal  ct-ccctt-gcttctcctat----------ctcg-------g-t
             Black flying-fox  ct-ttttt-gcctctcttat----------ctct-------g-t
                Big brown bat  ct-tttct-gcctctcttat----------ctct-------g-t
         David's myotis (bat)  ct-tttcc-g-ctctcttat----------ctct-------g-t
B D                  Microbat  ct-tttcc-g-ctctcttat----------ctct-------g-t
B D                  Hedgehog  ------gt-ctctctggtct----------ctctgct---tg-t
B D                     Shrew  ct-cttgt-gcttcccgtat----------ctct-------g-t
              Star-nosed mole  tt-tttgt-ttttctgatct----------ctct-ct---ga-t
          Cape elephant shrew  ca-ttttt-gcttctcttat----------ctcc-------a-c
B D                   Manatee  ca-tattg-gtgtctcttat----------ctct-------c-t
             Cape golden mole  t----ttt-gcttttcttat----------ctct-------g-a
B D                    Tenrec  cc-tgttt-gcttctcttgt----------ctct-------g-t
                     Aardvark  catttttt-gctttgcttat----------ctct-------g-t
B D                 Armadillo  cc-ttttt-gcctcgctcaa----------ctct----------
B D                   Opossum  tc-acttc-gctgacttctc----------atct-------a-t
B D           Tasmanian devil  ct-gtttt-tctgttttttt----------ttct-------c-t
B D                  Platypus  ---cctgt-cctcctctagt----------ctccccgcaaca-t
  D               Rock pigeon  cc-ccttt-gcctctctgcc----------ccct-------tc-
B D               Zebra finch  cc-ttttt-tccttatttct----------ccct-------t--
  D             Scarlet macaw  tc-ctccc-tccattttgtc----------ccct-------t--
B D                    Turkey  tg-catct-gatccttatgt----------ccct-------t--
B D        American alligator  tc-cccct-gct-------t----------cccg-------t--
B D                    Lizard  tc-tttct-ga---------------------------------
B D             X. tropicalis  tt-ccctc-acttcccctaccaattgcttcccct-------g-c
B D                Coelacanth  cc-ccctt-gtgtatctcac----------tcgt-------g-t
B D                 Zebrafish  cc-atttt-cctcctccacc----------cttt-------c-t
  D            Painted turtle  ============================================
  D           Green seaturtle  ============================================
  D          Peregrine falcon  ============================================
  D              Saker falcon  ============================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ============================================

Inserts between block 2 and 3 in window
B D       American alligator 6374bp
B D            X. tropicalis 4bp

Alignment block 3 of 1399 in window, 53759020 - 53759099, 80 bps 
B D                     Human  --c--tc---tttcagc------gtcttctcc-tc--tct-------ctggctc---------ac-ac--
B D                     Chimp  --c--tc---tttcagc------atcttctcc-tc--tct-------ctggctc---------ac-ac--
B D                   Gorilla  --c--tc---tttcagc------gtcttctcc-tc--tct-------ctggctc---------ac-ac--
B D                 Orangutan  --c--tc---tttcagc------gtcttctcc-tc--tct-------ctggctc---------ac-ac--
B D                    Gibbon  --c--tc---tttcagc------gtcttctcc-tc--tct-------gtggctc---------ac-ac--
B D                    Rhesus  --c--tc---tttcagc------gtcttctcc-tc--tct-------ctggctc---------ac-ac--
B D       Crab-eating macaque  --c--tc---tttcagc------gtcttctcc-tc--tct-------ctggctc---------ac-ac--
B D                    Baboon  --c--tc---tttcagc------gtcttctcc-tc--tct-------ctggctc---------ac-ac--
B D              Green monkey  --c--tc---tttcagc------gtcttctcc-tc--tct-------ctggctc---------ac-ac--
B D                  Marmoset  --c--tc---tttcagc------gtctcctcc-tc--tct-------ccagctc---------ac-ac--
B D           Squirrel monkey  --c--tc---tttcagc------gtcttctcc-tc--tct-------ctggctc---------ac-ac--
B D                  Bushbaby  --c--tc---tctcagt------ctcttctct-ta--ttt-------ctggctc---------ac-ac--
           Chinese tree shrew  --c--tc---ttttagc------ctcttccct-ct--tct-------ccagctc---------ac-ac--
B D                  Squirrel  --c--tc---ttttagt------ctctcctcc-tg--gtt-------ctggctt---------ac-ac--
       Lesser Egyptian jerboa  --g--tc---tttcagc------ttcttcctc-tg--gct-------cgagcac---------c------
                 Prairie vole  --t--tc---tttcagc------ttcttccc------agt----------gcac---------ac-ac--
B D           Chinese hamster  --c--tc---tttcagc------ttcttccct-tg--act-------tcagctc---------ac-ac--
               Golden hamster  --c---------tcagc------gtctcccct-tg--act-------ccagctc---------ac-ac--
B D                     Mouse  --c--tc---ttttagc------ttcttccccctg--atg-------cctgtac---------ac-ac--
B D                       Rat  --t--tc---ttttagc------ttcttcccc--a--atg-------cccgtac---------ac-ac--
B D            Naked mole-rat  --c--tc---ttt--ac------ctcaac-ct-ag--tct-------ctggctc---------ac-at--
B D                Guinea pig  --c--tc---ttt--ac------ctctacccc-tg--tct-------ctggctc---------ac-ac--
                   Chinchilla  --c--tc---ttt--ac------ctctgc-cg-cg--tct-------ctggttc---------gc-ac--
             Brush-tailed rat  --c--tc-----t--ac------ctctac----ca--tct-------ctggttc---------ac-ac--
B D                    Rabbit  --c--tc---tct------------ctcagcc-tc--tct-------cctgtctggggctgccgc-ac--
B D                      Pika  --g--tc---tgttagc--------ctccgct-gg--ccc-------cccacct---------cc-gc--
B D                       Pig  --c--tc---tttcagc------atctccccg-gg--tct-------ctggctc---------ct-ac--
B D                    Alpaca  --c--tc---tttcagc------ctcttcgcc-tt--tct-------ctggctc---------at-ac--
               Bactrian camel  --c--tc---tttcagc------ctcttcgcc-tt--tct-------ctggctc---------at-ac--
B D                   Dolphin  --g--tc---tttcggc------ctcttccc---g--tct-------ctggctc---------ct-ac--
                 Killer whale  --g--tc---tttcggc------ctcttcccc-tg--tct-------ctggctc---------ct-ac--
             Tibetan antelope  --c--tc---tttcagc------ctcttcccc-tg--tct-------ctggctc---------ct-ac--
B D                       Cow  --c--tc---tttcagc------ctcttcccc-tg--tct-------ctggctc---------ct-ac--
B D                     Sheep  --c--tc---tttcagc------ctctccccc-tg--tct-------ctggctc---------ct-ac--
                Domestic goat  --c--tc---tttcagc------ctcttcccc-tg--tct-------ctggctc---------ct-ac--
B D                     Horse  --c--tc---tttcagc------ctcttcccc-tg--tct-------ctggctc---------ac-ac--
B D          White rhinoceros  --c--tc---tttcagc------ctctt-ccc-tg--tct-------ctggctc---------ac-ac--
B D                       Cat  -----------------------ctctttccc-tg--cct-------ctagctc---------ac-at--
B D                       Dog  --c--tc---ttccagc------ctcttcccc-tgtctct-------ctgtctc---------ac-ac--
B D                   Ferret   -----tc---tttgag-------ctcttcccc-tg--tct-------ctggctc---------at-ac--
B D                     Panda  --c--tc---tttcag-------ctcttcccc-tg--tct-------ctggctc---------ac-ac--
               Pacific walrus  --c--tc---tttcag-------ctcttcccc-tg--tct-------ctggctc---------ac-ac--
                 Weddell seal  --c--tc---tttcag-------ctcttcccc-tg--tct-------ctggctc---------ac-ac--
             Black flying-fox  --c--tc---tttcagc------ctcttccc------tgt-------ctggttc---------ac-ac--
                Big brown bat  --c--tc---tttcagc------ctcttcctc-tg--tgt-------ctggctc---------ac-ac--
         David's myotis (bat)  --c--tc---tttcagc------ctcttcccc-tg--tgt-------cc-gctc---------ac-ac--
B D                  Microbat  --c--tc---tttcagc------ctcttcccc-tg--tgt-------ctggctc---------ac-ac--
B D                  Hedgehog  --c--tc---ttccagc------ctctc-ccc-tt--ttc-------tggcctc---------ac-ag--
B D                     Shrew  --c--cc---tgtcgcc------ttttctccc-ca--tct-------ctgcttt---------cc-gc--
              Star-nosed mole  --c--tc---tctcggc------ctctc-cct-tg--tct-------ctggctc---------tc-ac--
          Cape elephant shrew  --c--tc---ctctggt------tta-tccct-tg--tct-------ctggct-----------------
B D                   Manatee  --c--tc---tttcagc------ttcttccct-tg--tct-------ctggatc---------ac-ac--
             Cape golden mole  --c--tc---ctttagt------gtcttccct-gg--tgt-------ctggctc---------ac-ac--
B D                    Tenrec  --c--tc---attcagc------ttcttccgt-gg--tgt-------ctggctc---------ac-aa--
                     Aardvark  --c--tc---tttcagc------ttcttccct-tg--tct-------ctggctt---------ac-a---
B D                 Armadillo  -----------ttcagc------tcctgcccc-tg--cct-------ct-gctc---------ac-ac--
B D                   Opossum  --c--tc---tctcttc------atccttctc-cg--gttcgcttcactgtctt---------ct-gttt
B D           Tasmanian devil  --ctgtc---tgttttg------attcttttc-ct--gtt-------ctgccta---------ac-acat
B D                  Platypus  --c--tt---ctcgagg------cccctcaac-tc--ttc-------ttagccc---------ct-ac--
  D               Rock pigeon  -------gcatctctgc------cttttccca-tc--cct-------ccccttc---------gc-at--
B D               Zebra finch  ----------ttttctc------cttctctcc-tt--ttt-------cctctcc---------tt-tt--
  D             Scarlet macaw  ----------tccacgc------accgattcc-tg--ttt-------cctcttc---------cc-ac--
B D                    Turkey  ----------tttgtgt------ctcatgttc-tc--ttt-------ccatctc---------tc-tc--
B D        American alligator  ----------ttctttc------cttctctcc-cc--cac-------tctcttc---------cc-tt--
B D                    Lizard  -----ccctatccgcgc------cttttcttc-tt--ccg-------cgtcccc---------tc-cg--
B D             X. tropicalis  --c--ta---ctcctag------ttccctcac-tt--ccc-------ctggctc---------tctac--
B D                Coelacanth  --c--tg---tctcttt------gtacactcc-cc--ctt-------gtggatc---------tc-ac--
B D                 Zebrafish  tcc--tc---ctcccaccctgtcctcttccca-tt--ttc-------ctcctcc---------ac-cc--
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================

                        Human  --c--tc---tgcctg---c--ctc--tca-tc-------ct------------c---cc-------ca-
                        Chimp  --c--cc---tgcctg---c--ctc--tca-tc-------ct------------c---cc-------ca-
                      Gorilla  --c--cc---tgcctg---c--ctc--tca-tc-------ct------------c---cc-------ca-
                    Orangutan  --c--cc---tgcctg---g--ctc--tca-tc-------tt------------c---cc-------cc-
                       Gibbon  --c--cc---tgcctg---c--ctc--tca-tc-------tt------------c---cc-------cc-
                       Rhesus  --c--cc---tgcctg---c--ctc--tca-tc-------tt------------c---cc-------cc-
          Crab-eating macaque  --c--cc---tgcctg---c--ctc--tca-tc-------tt------------c---cc-------cc-
                       Baboon  --c--cc---tgcctg---c--ctc--tca-tc-------tt------------c---cc-------cc-
                 Green monkey  --c--cc---tgcctg---c--ctc--tca-tc-------tt------------a---cc-------cc-
                     Marmoset  --c--cc---tacctg---c--ttc--tca-tc-------tt------------c---cc-------c--
              Squirrel monkey  --c--cc---tacctg---c--ttc--tca-tc-------tt------------c---cc-------c--
                     Bushbaby  --c--ac---tgcctg---c--ctc--tca-tc-------tt------------c---cc-------tc-
           Chinese tree shrew  --c--ct---tgactg---c---tc--tca-tc-------tt------------c---cc-------tc-
                     Squirrel  --c--acctttgcctg---c--ctc--tca-tt-------gt------------c---cc-------c--
       Lesser Egyptian jerboa  ------------ccca---c--ctc--tca-tc-------gt----------------cc-------c--
                 Prairie vole  --c--tc---tgcccg---c--ctc--gca-tc-------tt------------t---ct-------c--
              Chinese hamster  --c--cc---tgcccg---c--ctc--tca-tc-------tt------------c---cc-------c--
               Golden hamster  --c--cc---tgcctg---c--ctc--tca-tc-------tt------------c---cc-------c--
                        Mouse  --c--cc---tgccct---c--ctc--tca-tc-------tt------------c---cc-------c--
                          Rat  --c--cc---tgcccg---c--ctc--tca-tc-------gtatctcacccaccc---ac-------c--
               Naked mole-rat  --c--cc---tgcctg---c--ctc--ttg-tc-------ac------------c---ct-------g--
                   Guinea pig  --c--cc---tgtctg---c--ctc--ttg-tc-------ac------------c---ca-------g--
                   Chinchilla  --c--gc---tgtctg---c--ctc--ttg-tc-------ac------------c---ca-------g--
             Brush-tailed rat  --c--cc---tgtctg---c--ctc--ctg-tc-------ac------------c---ct-------g--
                       Rabbit  --c--cc---tgccag---c--ctc--tcc-tt-------gt------------c---cc-------c--
                         Pika  --c--cc---tgccag---c--ctc--tcc-ct-------tg------------ctctct-------c--
                          Pig  --c--cc---tgtccg---c--ctc--tca-tc-------tt------------c---cc-------tc-
                       Alpaca  --c--cc---tgcctg---c--ctc--tca-tc-------tt------------t---cc-------tc-
               Bactrian camel  --c--cc---tgcctg---c--ctc--tca-tc-------tt------------c---cc-------tc-
                      Dolphin  --c--cc---tgcccg---c--ctc--tca-tc-------tt------------c---cc-------tc-
                 Killer whale  --c--cc---tgcccg---c--ctc--tca-tc-------tt------------c---cc-------tc-
             Tibetan antelope  --c--cc---tgccca---c--ctc--tcg-tt-------tt------------t---cc-------tc-
                          Cow  --c--cc---tgccca---c--ctc--tcg-tt-------tt------------t---cc-------tc-
                        Sheep  --c--cc---tgccca---c--ctc--ttg-tt-------tt------------t---cc-------tc-
                Domestic goat  --c--cc---tgccca---c--ctc--tcg-tt-------tt------------t---cc-------tc-
                        Horse  --c--cc---tgcatg---c--ctc--tcg-tc-------tt------------c---cc-------tc-
             White rhinoceros  --c--cc---tgcgtg---c--ctc--tca-tc-------tt------------c---cc-------tc-
                          Cat  --c--cc---tgcct----c--ctc--tcc-ac-------tt------------c---cc-------tc-
                          Dog  --c--cc---tgcct----c--ctc--tcc-ac-------ct------------c---cc-------tc-
                      Ferret   --c--cc---tgcct----c--ctc--tcc-ac-------ct------------c---tc-------tc-
                        Panda  --c--cc---t-ctt----c--ctc--tcc-ac-------ct------------c---cc-------tc-
               Pacific walrus  --c--cc---tgcct----c--ctc--acc-ac-------ct------------c---cc-------tc-
                 Weddell seal  --c--cc---tgcct----c--ctc--acc-ac-------ct------------c---cc-------tc-
             Black flying-fox  --c--cc---tgccag---c--ctc--tca-tt-------gt------------c---cc-------tc-
                Big brown bat  --t--cc---tgccag---c--ctc--tcg-cc-------gt------------c---cc-------tc-
         David's myotis (bat)  --t--cc---tgccag---c--ctc--ttgccc-------gt------------c---cc-------tc-
                     Microbat  --t--cc---tgccag---t--ctc--tcgccc-------gt------------c---cc-------tc-
                     Hedgehog  --c--cc---tgcctg---c--ctc--tca-tc-------tt------------c---cc-------tc-
                        Shrew  --c--cc---tgccag---c--ctc--tcc-gc-------ct------------c---cc-------tc-
              Star-nosed mole  --c--cc---tgcccg---c--ctc--tca-gcctctcatct------------c---cc-------tc-
          Cape elephant shrew  --c--cc---tgcctg---cttctc--tca-tc-------tt------------c---cc-------tc-
                      Manatee  --c--cc---tgcctg---cctctc--tca-tc-------tt------------c---cc-------tc-
             Cape golden mole  --c--cc---tgcctg---cttctc--tca-tc-------tt------------c---cc-------tc-
                       Tenrec  --c--cc---tgcctg---ctgctt--aca-tc-------tc------------c---cc-------tc-
                     Aardvark  --c--tc---tgctca---cctctc--tca-tc-------tt------------t---cc-------tc-
                    Armadillo  --c--cc---tgcttg---c--ctc--cca-tc-------tt------------c---cc-------tc-
                      Opossum  ctc--tc---ag-ctc---t--ctc--ttc-cc-------ct------------t---ct-------cc-
              Tasmanian devil  ttc--tc---tgcctg---c--ctc--ctc-tt-------ct------------t---ct-------tc-
                     Platypus  --c--tc---tgcctt---c--ctc--tca-tc-------tt------------c---tc-------tc-
                  Rock pigeon  --c--tc---tgctcc---c--cgc--acc-tc-------tg------------c---ccgtgtgcac--
                  Zebra finch  --ttcct---tatttc---t--ctc-tttt-tc-------tc------------t---cc----------
                Scarlet macaw  --t--ct---tatttc---c--ctc--ttc-tc-------ac------------t---ccat-----t--
                       Turkey  --c--tc---tgtttc---c--ctt--gtg-tc-------ca------------a---gt----------
           American alligator  --c--tc---tctcac---t--cta--tcc-at-------aa------------t---cc-------t--
                       Lizard  --c--cc---ggattcggac--ctaaactc-gc-------ca------------t---ct----------
                X. tropicalis  --t--cc---tagttc---c--ctc--act-tc-------cc------------c---ta-------cca
                   Coelacanth  --t--tg---tgtctg---t--ctc--ctt-gc-------at------------a---ct-------aa-
                    Zebrafish  --t--tt---cttcct---c--ctc--cca-tt-------tt------------c---ct----------
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                     Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================

                        Human  -------ctcccac------------------ccctca-------aggt-----------tca
                        Chimp  -------ctcccac------------------ccctca-------aggt-----------tca
                      Gorilla  -------ctcccac------------------ccctca-------aggt-----------tca
                    Orangutan  -------atcccac------------------ccctca-------aggt-----------tca
                       Gibbon  -------ctcccac------------------ccctca-------aggt-----------tca
                       Rhesus  -------ctcccac------------------ccctca-------aggt-----------tca
          Crab-eating macaque  -------ctcccac------------------ccctca-------aggt-----------tca
                       Baboon  -------ctcccac------------------ccctca-------aggt-----------tca
                 Green monkey  -------ctcccac------------------ccctca-------aggt-----------tca
                     Marmoset  -------ctcccac------------------ccctta-------aggt-----------tca
              Squirrel monkey  -------ctcccac------------------ccctca-------aggt-----------tca
                     Bushbaby  -------ctcccac------------------ccctca-------aggt-----------tca
           Chinese tree shrew  -------ctcccac------------------ccctca-------aggt-----------tca
                     Squirrel  -------ctcctac------------------ccctca-------agga-----------tca
       Lesser Egyptian jerboa  -------ctcctac------------------ccctgc-------aggt-----------ttg
                 Prairie vole  -------catccac------------------ccctgc-------agct-----------cca
              Chinese hamster  -------cacccac------------------ccctgc-------aggt-----------tca
               Golden hamster  -------cacccac------------------ccctgc-------aggt-----------tca
                        Mouse  -------cacccac------------------ccctgc-------aggt-----------tca
                          Rat  -------cacccac------------------ccctgc-------agga-----------tca
               Naked mole-rat  -------ctcccac------------------ccctca-------ggct-----------tca
                   Guinea pig  -------ctcccgc------------------ccctca-------ggct-----------tca
                   Chinchilla  -------ctcccac------------------ccctca-------ggct-----------tca
             Brush-tailed rat  -------ctcccac------------------ccctca-------ggct-----------tca
                       Rabbit  -------ctcctac------------------ccctca-------aggt-----------tca
                         Pika  -------ctcccac------------------ccctca-------aggt-----------gca
                          Pig  -------ctcccac------------------ccctca-------aggt-----------tca
                       Alpaca  -------ctcccac------------------ccctca-------aggt-----------tca
               Bactrian camel  -------ctccccc------------------ccctca-------aggt-----------tca
                      Dolphin  -------ctcccac------------------ccctca-------aggt-----------tca
                 Killer whale  -------ctcccac------------------ccctca-------aggt-----------tca
             Tibetan antelope  -------ctcccac------------------ccctca-------aggt-----------tca
                          Cow  -------ctcccac------------------ccctca-------aggt-----------tca
                        Sheep  -------ctcccac------------------ccctca-------aggt-----------tca
                Domestic goat  -------ctcccac------------------ccctca-------aggt-----------tca
                        Horse  -------ctcccac------------------ccctca-------aggt-----------tca
             White rhinoceros  -------ctcccac------------------ccctca-------aggt-----------tca
                          Cat  -------ctcccgc------------------ccctca-------aggt-----------gca
                          Dog  -------ctcccgc------------------ccctca-------aggt-----------tca
                      Ferret   -------ctcccac------------------ccctca-------aggt-----------tca
                        Panda  -------ctcccac------------------ccctca-------aggt-----------tca
               Pacific walrus  -------ctcccac------------------ccctca-------aggt-----------tca
                 Weddell seal  -------ctcccac------------------ccctca-------aggt-----------tca
             Black flying-fox  -------ctcctat------------------ccctca-------aggt-----------tca
                Big brown bat  -------ctcccac------------------ccctca-------aggt-----------tca
         David's myotis (bat)  -------ctcccac------------------ccctca-------aggt-----------tca
                     Microbat  -------ctcccac------------------ccctca-------aggt-----------tca
                     Hedgehog  -------ctcccac------------------ccctca-------aggt-----------tca
                        Shrew  -------ctcctac------------------ccctca-------aggt-----------tca
              Star-nosed mole  -------ctcccat------------------ccctca-------aggt-----------tca
          Cape elephant shrew  -------cta---c------------------ccctga-------aggt-----------tca
                      Manatee  -------ctccctc------------------ccctca-------aggt-----------tca
             Cape golden mole  -------ctcccat------------------ccctca-------aggt-----------tca
                       Tenrec  -------can-----------------------------------------------------
                     Aardvark  -------ctcctac------------------ccctca-------aggt-----------tca
                    Armadillo  -------ctccctc------------------ccctcg-------aggt-----------tca
                      Opossum  -------ctttttc------------------ccttcactgtct-------------------
              Tasmanian devil  -------cccaccc------------------cctcccctgccccaggt-----------tca
                     Platypus  -------cttttcc------------------ccggct-------cggtctcctctgccccca
                  Rock pigeon  -------tccctgc------------------ccctcg-------accc-----------ttt
                  Zebra finch  -------ttctctc------------------cttttt-------cctc-----------tct
                Scarlet macaw  -------ttctgtc------------------cccttt-------cccc-----------tca
                       Turkey  -------cctcaat------------------ctctca-------tcca-----------tcc
           American alligator  -------cttccac------------------atgtct-------acac-----------tcc
                       Lizard  -------ccgcatc------------------atttca-------ttta-----------ggc
                X. tropicalis  attgcttcccctgg------------------ctctct-------actc-----------cta
                   Coelacanth  -------ctctcacagattacttgtgactgcgtcctca-------------------------
                    Zebrafish  -------cctccac------------------ccttt--------------------------
               Painted turtle  ===============================================================
              Green seaturtle  ===============================================================
             Peregrine falcon  ===============================================================
                 Saker falcon  ===============================================================
                     Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ===============================================================

Inserts between block 3 and 4 in window
  D              Rock pigeon 6bp
B D              Zebra finch 12bp
  D            Scarlet macaw 6bp
B D                   Turkey 6bp
B D       American alligator 6bp
B D               Coelacanth 5bp

Alignment block 4 of 1399 in window, 53759100 - 53759151, 52 bps 
B D                     Human  gatacttcat-----------gcgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                     Chimp  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                   Gorilla  gatgcctcat-----------gcgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                 Orangutan  gatacttcat-----------gcg-aat-c--------acc--tggatgggctccaac---tgtcagt--
B D                    Gibbon  gatacttcat-----------gcgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                    Rhesus  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D       Crab-eating macaque  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                    Baboon  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D              Green monkey  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                  Marmoset  gatacttcat-----------gtgaaat-c--------acc--tggatggggtccaac---tgtcagg--
B D           Squirrel monkey  gatacttcat-----------gtgaaat-c--------acc--tggatggggtccaac---tgtcagg--
B D                  Bushbaby  gatacttcat-----------gtgaaat-c--------acc--tggataggctccaac---tgtcagg--
           Chinese tree shrew  gatacctcat-----------gcaaaat-c--------acc--tggatgggctccaac---tgtcag---
B D                  Squirrel  gatacttcat-----------gtgaaat-c--------acc--tggataggctccaac---tgtcagg--
       Lesser Egyptian jerboa  gctacttcac-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcaag--
                 Prairie vole  aatactttat-----------gtgaaat-c--------acc--tggatgggctccagt---tgtcaga--
B D           Chinese hamster  gatacttcat-----------gtgaaat-c--------acc--tggatgggctcccgc---tgtcagg--
               Golden hamster  gatacttcat-----------gtgaaat-c--------acc--tggatgggctcccgc---tgtcagg--
B D                     Mouse  gatacttcat-----------gtgaaat-c--------acc--tggatggactccagc---tgtcagg--
B D                       Rat  gatacttcac-----------gtgaaat-c--------acc--tggatggactccagc---tgtcagg--
B D            Naked mole-rat  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccagt---tgtcagc--
B D                Guinea pig  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaat---tgtcagc--
                   Chinchilla  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaat---tgtcagc--
             Brush-tailed rat  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccagt---tgtcagc--
B D                    Rabbit  gacacttgct-----------gtg-aat-c--------acc--tggataggctccaac---tgtcagt--
B D                      Pika  gacactgggc-----------gtg-aat-c--------acc--tggatgggctccagc---tgccagt--
B D                       Pig  gatgcttcat-----------gtgaaat-c--------acc--tggatgggttccaac---tgtcagg--
B D                    Alpaca  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
               Bactrian camel  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                   Dolphin  gctacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
                 Killer whale  gctacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
             Tibetan antelope  gatacttcac-----------gtgaaat-c--------acc--tggatgggctccaac---tgtagtg--
B D                       Cow  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcatg--
B D                     Sheep  gatacttcac-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcatg--
                Domestic goat  gatacttcac-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcatg--
B D                     Horse  gatactttat-----------gtaaaat-t--------acc--tggatgggctccaac---tgtcagg--
B D          White rhinoceros  gatacttcat-----------gtaaaat-t--------acc--tggatgggctccaac---tgtcagg--
B D                       Cat  gatacttcgt-----------gtgaaat-c--------acc--tggatgggctccaac---tgccagg--
B D                       Dog  gatacttcgt-----------gtgaaat-c--------acc--tggatgggctccaac---tgccagg--
B D                   Ferret   gatacttcgt-----------gtgaaat-c--------acc--tggatgggctccaac---taccagg--
B D                     Panda  ggtacttcgt-----------gtgaaat-c--------acc--tggatgggctccaac---tgccggg--
               Pacific walrus  gatactttgt-----------gtgaaat-c--------acc--tggatgggctccaac---tgccagg--
                 Weddell seal  gatacttcgt-----------gtgaaat-c--------acc--tggatgggctccaac---tgccagg--
             Black flying-fox  gatacctcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
                Big brown bat  gatacctcct-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
         David's myotis (bat)  gatgcctcct-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                  Microbat  gatacctcct-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                  Hedgehog  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcag---
B D                     Shrew  gatacttcat-----------gtgaaat-c--------acc--tggatgagctccaac---tgtcagc--
              Star-nosed mole  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccagc---tgtcagg--
          Cape elephant shrew  gatacctcat-----------gtgaaat-c--------acc--tggatgggttccaac---tgtcagg--
B D                   Manatee  gatacttcat-----------gtgaaat-t--------acc--tggatgggctccaac---tgtcagg--
             Cape golden mole  gatacttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
                     Aardvark  gatccttcat-----------gtgaaat-c--------acc--tggatgggctccaac---tgtcagg--
B D                 Armadillo  gatacttgat-----------gtgaaat-c--------acc--tggataggctccaac---tgtcagg--
B D                   Opossum  ----tctcat-----------ctatctt------------------------------------------
B D           Tasmanian devil  gatatttcat-----------atgattt-c--------acc--tggatgggctccagccagtgctgga--
B D                  Platypus  tcccactcat-----------gctctag-c--------acttatggagtgcacacaga---ggacggt--
  D               Rock pigeon  ttcccccttt-----------gcagccc-t--------gcc--cgcttggacctcagc---cctctgggt
B D               Zebra finch  tccccttttt-----------atgtccc-t--------ttt--tcc---------------tctctcttt
  D             Scarlet macaw  cctctatttt-----------atcaccc-t--------ttc--tcc-----ccccagt---tccctccat
B D                    Turkey  tccccccctt-----------gtgtccg-tcttctatgttc--tccagtagtgcccgt---cccctctgt
B D        American alligator  tctctcctta-----------ccctcct-c--------ttt--tgc---------------cctctcttc
B D             X. tropicalis  gttccctcactccccctaccaattgctt-c--------ccc--tggct---ctctac-------------
B D                Coelacanth  ccaccctcat-----------gcgttttgc--------tca--tgaatgtacacacac---aatcaca--
B D                 Zebrafish  ----cttcct----------------cc-c--------acc--ctgtcctcttcccat---tttcctc--
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================

                        Human  -------gtcccc---------c--a--t
                        Chimp  -------gtcccc---------c--a--t
                      Gorilla  -------gtcccc---------c--a--t
                    Orangutan  -------gtcccc---------c--a--t
                       Gibbon  -------gtcccc---------c--a--t
                       Rhesus  -------gccccc---------c--a--t
          Crab-eating macaque  -------gccccc---------c--a--t
                       Baboon  -------gccccc---------c--a--t
                 Green monkey  -------gccccc---------c--a--t
                     Marmoset  -------g-cccc---------c--a--t
              Squirrel monkey  -------gccccc---------c--a--t
                     Bushbaby  -------tcccc-----------------
           Chinese tree shrew  -------gtcccc---------c--t--t
                     Squirrel  -------tcccc--------cca--t--t
       Lesser Egyptian jerboa  -------tcccccc------ccc--a--t
                 Prairie vole  -------tcccc--------cta--g--t
              Chinese hamster  -------tcccc--------cta--g--t
               Golden hamster  -------tcccc--------cta--g--t
                        Mouse  -------tccccccaccccccca--g--t
                          Rat  -------tcccccccccacacca--g--t
               Naked mole-rat  -------c--------------------a
                   Guinea pig  -------cccccc---------c--a--t
                   Chinchilla  -------cccccc-------ccc--g--t
             Brush-tailed rat  -------cccccc---------------t
                       Rabbit  -------cccccc------------a--g
                         Pika  -------ctctgc------------g--t
                          Pig  -------tccccc---------cc-a--g
                       Alpaca  -------tcgccc---------c--a--t
               Bactrian camel  -------tccccc---------c--a--t
                      Dolphin  -------tccccc---------c--a--t
                 Killer whale  -------tccccc---------c--a--t
             Tibetan antelope  -------cccccc---------c--a--t
                          Cow  -------tccccc---------ccga--t
                        Sheep  -------cccccc---------c--a--t
                Domestic goat  -------cccccc---------c--a--t
                        Horse  -------tccccc------------a--t
             White rhinoceros  -------tccccc------------a--t
                          Cat  -------tccccc---------c--a--t
                          Dog  -------tccccc------------a--t
                      Ferret   -------tccccc---------c--a--t
                        Panda  -------tccccc------------a--t
               Pacific walrus  -------tccccc---------t--a--t
                 Weddell seal  -------tccccc---------t--a--t
             Black flying-fox  -------tccccc---------t--a-ct
                Big brown bat  -------tccccc---------c--a--t
         David's myotis (bat)  -------tccccc---------c--a--t
                     Microbat  -------gccccc---------c--a--t
                     Hedgehog  --------ccccc---------c--a--c
                        Shrew  -------cccccc---------t--a--c
              Star-nosed mole  -------tccccc---------t--g--t
          Cape elephant shrew  -------tccccc---------a--t---
                      Manatee  -------tccccc---------a--t---
             Cape golden mole  -------tccctc---------c--a---
                     Aardvark  -------tctccc---------c--a---
                    Armadillo  -------tccccc---------c--ct--
                      Opossum  -----------------------------
              Tasmanian devil  -------gcaac-----------------
                     Platypus  -------gcgccg---------t------
                  Rock pigeon  gtc----tgcctc----------------
                  Zebra finch  ctctagttctctc----------------
                Scarlet macaw  gttattttccctc----------------
                       Turkey  ctc----cccctc----------------
           American alligator  acc----ttcctc----------------
                X. tropicalis  -----------------------------
                   Coelacanth  -------atcaca---------c------
                    Zebrafish  -------ctccac----------------
               Painted turtle  =============================
              Green seaturtle  =============================
                       Lizard  =============================
             Peregrine falcon  =============================
                 Saker falcon  =============================
                     Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  =============================

Inserts between block 4 and 5 in window
            Cape golden mole 1bp
                    Aardvark 1bp
B D            X. tropicalis 2bp

Alignment block 5 of 1399 in window, 53759152 - 53759169, 18 bps 
B D                     Human  tctgta-cc---c---cct-tctccc
B D                     Chimp  tctgta-cc---c---cct-tctccc
B D                   Gorilla  tctgta-cc---c---cct-tctccc
B D                 Orangutan  tctgta-cc---c---cct-tctccc
B D                    Gibbon  tctgta-cc---c---cct-tctccc
B D                    Rhesus  tccgta-cc---c---cct-tctccc
B D       Crab-eating macaque  tccgta-cc---c---cct-tctccc
B D                    Baboon  tccgta-cc---c---cct-tctccc
B D              Green monkey  tccgta-cc---c---cct-tctccc
B D                  Marmoset  tctgta-cc---c---cct-tctccc
B D           Squirrel monkey  tccgta-cc---c---cct-tctccc
B D                  Bushbaby  -ctgta-cc---c---tct-tct-cc
           Chinese tree shrew  tctgta-cc---c---cct-tcttcc
B D                  Squirrel  tc-ata-cc---c---c-tttctctc
       Lesser Egyptian jerboa  tctgta-cc---c---cgt---tctc
                 Prairie vole  tctgta-cc---c---cctttctccc
B D           Chinese hamster  tctgta-cc---t---cttttctccc
               Golden hamster  tctgcaccc---c---cttttttccc
B D                     Mouse  cctgta-cc---c---cctttcttcc
B D                       Rat  tctgta-cc---c---cctttctctc
B D            Naked mole-rat  actgta-cc---c---cct--ctccc
B D                Guinea pig  tctgta-c----c---cct--ctccc
                   Chinchilla  tctgta-cc---c---cct--ctccc
             Brush-tailed rat  tcctta-ct---c---cct--ctccc
B D                    Rabbit  cttgca-cc---c---cct-tctccc
B D                      Pika  cctgca-cc---g---cct-tctcac
B D                       Pig  tccgga-cc---c---cct-cctccc
B D                    Alpaca  tctgta-cc---c---cct-cctcca
               Bactrian camel  tctgta-cc---c---cct-cctcca
B D                   Dolphin  tctgta-cc---c---cct-cctcc-
                 Killer whale  tctgta-cc---c---cct-cctcca
             Tibetan antelope  tctgtg-cc---ccctcct-cctccc
B D                       Cow  tctgta-cc---c---cct-cctccc
B D                     Sheep  tctgtg-cc---c---cct-cctccc
                Domestic goat  tctgtg-cc---c---cct-cctccc
B D                     Horse  tctgga-cc---c---cct-cctcca
B D          White rhinoceros  tctcta-cc---c---cct-cctcca
B D                       Cat  tctgta-cc---c---cct-cctctg
B D                       Dog  tctgta-cc---c---cct-cctcca
B D                   Ferret   tctgta--c---c---cct-cctcca
B D                     Panda  gctgta-cc---c---cca-cctgca
               Pacific walrus  tctgta-cc---c---cct-cctcca
                 Weddell seal  tctgta-cc---c---cct-cctcca
             Black flying-fox  tttgta-cc---t---cct-cctccg
                Big brown bat  tttgta-cc---g---act-cctcca
         David's myotis (bat)  tttgta-cc---g---act-gctccc
B D                  Microbat  tttgta-cc---g---act-cctcca
B D                  Hedgehog  cccact-cc---c---cct-cctcca
B D                     Shrew  cccctg-cc---c---cct-cctcca
              Star-nosed mole  cctgca-cc---c---cgt-cctcca
          Cape elephant shrew  tctgta-cc---c---cct-cctcca
B D                   Manatee  tctgta--c---c---cct-cctcga
             Cape golden mole  tctgta-cc---t---cct-cctcca
B D                    Tenrec  tctgta-cc---c---act-cctccc
                     Aardvark  tctgta-cc---c---cct-cctcca
B D                 Armadillo  tcgcta-cc---c---cct-cctcca
B D                   Opossum  tctctt-ca---t---cct-tct---
B D           Tasmanian devil  ccccca-ca---a---cca-ttt---
B D                  Platypus  actgag-cg---t---tt--------
  D               Rock pigeon  cttgca-ccttcc---act-tcccc-
B D               Zebra finch  tttttc-tc---t---cct-tccct-
  D             Scarlet macaw  atttta-ccacgt---ttt-cctcc-
B D                    Turkey  gtgtcc-gt---t---ccg-tgtcc-
B D        American alligator  ttctct-cc---t---ccc-ttact-
B D             X. tropicalis  ctagtt-cc---c---tca-cttccc
B D                Coelacanth  -----a-cc---c---ccc-ccccac
B D                 Zebrafish  cctgtc-ct---c---tta-cc----
  D            Painted turtle  ==========================
  D           Green seaturtle  ==========================
B D                    Lizard  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
B D                  Elephant  NNNNNNNNNNNNNNNNNNNNNNNNNN
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ==========================

Alignment block 6 of 1399 in window, 53759170 - 53759205, 36 bps 
B D                     Human  agggcgatttacagcccca-actcgg--c-----------atcttc--tgca
B D                     Chimp  agggagatttacagcccca-actcgg--c-----------atcttc--tgca
B D                   Gorilla  agggagatttacagcccca-actcgg--c-----------atcttc--tgca
B D                 Orangutan  agggagatttacagcccta-actcgg--c-----------atcttc--tgca
B D                    Gibbon  agggagatttacagcccca-actcgg--c-----------atcttc--tgca
B D                    Rhesus  aggaagatttacagcccca-actcgg--c-----------atcttc--tgca
B D       Crab-eating macaque  aggaagatttacagcccca-actcgg--c-----------atcttc--tgca
B D                    Baboon  aggaagatttacagcccca-actcgg--c-----------atcttc--tgca
B D              Green monkey  aggaagatttatagcccca-actcgg--c-----------atcttc--tgca
B D                  Marmoset  taggagatttacagcccca-actcgg--c-----------atcttc--tgca
B D           Squirrel monkey  tgggagatttaccgcccca-actcgg--c-----------atcctc--tgca
B D                  Bushbaby  agagagatttacagcccca-gccctg--c-----------atcctc--tgca
           Chinese tree shrew  agagagatttacggtccca-actctg--c-----------atcctc--tgca
B D                  Squirrel  gaaaagatttatggcacaa-actctg--t-----------ctcctc--tgca
       Lesser Egyptian jerboa  tgagagatttatggcccca-actctg--c-----------ctcctc--tgca
                 Prairie vole  tgagagatttatggcccta-actctg--c-----------ctcctc--tgca
B D           Chinese hamster  tgagagatttatggcccta-actctg--c-----------ctcctc--tgca
               Golden hamster  aaagagatttatggcccta-actctg--c-----------ctcctc--tgca
B D                     Mouse  tgagagatttatggcttca-actcgg--c-----------ctcctc--tgca
B D                       Rat  tgagagatttatggcttcg-actcgg--c-----------ctcctc--tgca
B D            Naked mole-rat  tgagagatttatggcccca-aatctg--a-----------ctcctc--tgca
B D                Guinea pig  tgagagatttatggtccca-actctg--t-----------ctcctc--tgca
                   Chinchilla  tgagagatttatggcccca-gctctg--t-----------ctcctc--tgcg
             Brush-tailed rat  tgagagatttatagtccca-actgtg--t-----------ctcctc--tgca
B D                    Rabbit  cgggagatttacgaccccg-actctg--c-----------ctcctc--tgca
B D                      Pika  tgggagatttatg------------g--c-----------ttcccc--agca
B D                       Pig  agagagatttatggcccca-actctg--c-----------atcctc--tgca
B D                    Alpaca  agagagatttatggcccca-actctg--c-----------atcctc--tgca
               Bactrian camel  agagagatttatggcccca-actctg--c-----------atcctc--tgca
B D                   Dolphin  agggagatttatggcccca-actctg--c-----------atcctc--tgca
                 Killer whale  agggagatttatggcccca-actctg--c-----------atcctc--tgca
             Tibetan antelope  agagagatttatggcccca-actctg--c-----------atcctc--tgcg
B D                       Cow  atagagatttatggcccca-actctg--c-----------atcctc--tgca
B D                     Sheep  agggagatttatggcccca-actctg--c-----------atcctc--tgcg
                Domestic goat  agggagatttatggcccca-actctg--c-----------atcctc--tgcg
B D                     Horse  agagagatttatggcccca-actctg--c-----------atcctc--tgca
B D          White rhinoceros  agagagatttatggcccca-actctg--c-----------atcctc--tgca
B D                       Cat  ggagagatttatggcccca-acctcg--c-----------atcctc--tgca
B D                       Dog  ggagagatttatggcccca-actctg--c-----------gtcctc--tgca
B D                   Ferret   ggagagatttatggcccca-aatctg--t-----------gtcctc--tgca
B D                     Panda  ggagagatttatggcccca-actctg--c-----------gtcctc--tgca
               Pacific walrus  ggagagatttatggcccca-actctg--c-----------atcctc--tgca
                 Weddell seal  agagagatttatggcccca-actctg--c-----------atcctc--tgca
             Black flying-fox  agagagatttatggcttca-actctg--c-----------atcctc--tgca
                Big brown bat  agagagatttatggcacca-accctg--c-----------atcctc--tgca
         David's myotis (bat)  agagagatttatggcacca-accctg--c-----------atcctc--tgca
B D                  Microbat  agagagatttatggcacca-accctg--c-----------atcctc--tgca
B D                  Hedgehog  agagagatttatggccccc-acactg--c-----------atcctc--tgca
B D                     Shrew  agaaagatttatggcccccaacaccg--a-----------gtcctc--tgca
              Star-nosed mole  ag--agatttatggcgccc-acactg--c-----------accctc--tgca
B D                  Elephant  agagagatttat-gcccca-actctgcat-----------atcccc--tgca
          Cape elephant shrew  agagagatttatggtccca-accctg--t-----------atcctc--tgca
B D                   Manatee  agagagatttatggttcca-gctctg--t-----------atcctc--tgca
             Cape golden mole  agagagatttatggcccca-actctg--c-----------atcctc--tgca
B D                    Tenrec  agagagatttatggcccta-actctg--c-----------atcccc--ttcg
                     Aardvark  agagagatttatagcccca-actctg--c-----------atcctc--tgca
B D                 Armadillo  agagagatttatgacccca-actctg--c-----------atcctc--tgca
B D                   Opossum  --------------ccctg-tttccc--ttcactgt----cttctc--tg--
B D           Tasmanian devil  --ggagatttatggcccca-actccc--tgta--------ttcctc--tg--
B D                  Platypus  -gggaagtgtaaaa---tg-agccgg--c-----------gacgtt--gtc-
  D               Rock pigeon  --------------------gcttcc--cgggctctttgaaccccc--tccc
B D               Zebra finch  --------------------ggcttc--c-----------acctct------
  D             Scarlet macaw  --------------------attttc--c-----------acccctttttgc
B D                    Turkey  --------------------tctttc--c-----------atccct------
B D        American alligator  ----------------------tttc--c-----------atcccc--tccc
B D             X. tropicalis  ctaccaattgcttcccctg-gctctc--t-----------actcct--ag--
B D                Coelacanth  ------acacacatactca-gcctca--t-----------gtgttt--tacc
B D                 Zebrafish  -----attttcctcctcca-cccttt--c-----------ttcctc--c---
  D            Painted turtle  ====================================================
  D           Green seaturtle  ====================================================
B D                    Lizard  ====================================================
  D          Peregrine falcon  ====================================================
  D              Saker falcon  ====================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ====================================================

Inserts between block 6 and 7 in window
B D                      Pig 3bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 1043bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 12bp
B D                      Dog 1bp
B D                  Ferret  3bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 8bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
  D              Rock pigeon 5bp
B D              Zebra finch 4bp
  D            Scarlet macaw 5bp
B D       American alligator 5bp

Alignment block 7 of 1399 in window, 53759206 - 53759216, 11 bps 
B D                     Human  tt-c------c---ccc---------c------------------------a-gc-
B D                     Chimp  ttcc------c---ccc---------c------------------------a-gc-
B D                   Gorilla  ttcc------c---ccc---------c------------------------a-gc-
B D                 Orangutan  ttcc------c---ccc---------c------------------------a-gc-
B D                    Gibbon  ttcc------c---ccc---------c------------------------a-gg-
B D                    Rhesus  ttcc------c---ccc---------a------------------------a-gc-
B D       Crab-eating macaque  ttcc------c---ccc---------a------------------------a-gc-
B D                    Baboon  ttcc------c---ccc---------a------------------------a-gc-
B D              Green monkey  ttcc------c---ccc---------a------------------------a-gc-
B D                  Marmoset  tt-c------c---ccc---------c------------------------a-gc-
B D           Squirrel monkey  tt-c------c---ccc---------c------------------------a-gc-
B D                  Bushbaby  tt--------c---ccc---------c------------------------a-gc-
           Chinese tree shrew  tt-c------c---ccc---------c------------------------a-gc-
B D                  Squirrel  tt--------ccccccc---------c------------------------a-gc-
       Lesser Egyptian jerboa  tt--------c---ccc---------c------------------------a-gc-
                 Prairie vole  tt--------c---ccc---------c------------------------a-gc-
B D           Chinese hamster  tt--------c---ccc---------c------------------------t-gc-
               Golden hamster  tt--------c--tccc---------c------------------------t-gc-
B D                     Mouse  tt--------c--ccct---------c------------------------a-gc-
B D                       Rat  tc--------c--cccc---------c------------------------a-gc-
B D            Naked mole-rat  ta--------c---ccc-------------------------------------c-
B D                Guinea pig  tt--------t---tcc---------c------------------------a-gc-
                   Chinchilla  tt--------t---tcc---------c------------------------a-gc-
             Brush-tailed rat  tt--------t---tcc---------c------------------------a-gc-
B D                    Rabbit  gt--------c---ccc-------ccc------------------------a-gg-
B D                      Pika  gt--------c---ccc---ccatccc------------------------a-gg-
B D                       Pig  cc--------c---ccc---------c------------------------a-gc-
B D                    Alpaca  cc--------c---ccc---------c------------------------a-gc-
               Bactrian camel  cc--------c---ccc---------cccccnnnnnnnnnnnnnnnnnnnna-gc-
B D                   Dolphin  tc--------c---ccc---------c------------------------a-gc-
                 Killer whale  tc--------c---ccc---------c------------------------a-gc-
             Tibetan antelope  tc--------c---ccc---------c------------------------a-gc-
B D                       Cow  tc--------c---ccc---------c------------------------a-gc-
B D                     Sheep  tc--------c---ccc---------c------------------------a-gc-
                Domestic goat  tc--------c---ccc---------c------------------------a-gc-
B D                     Horse  tc--------t---ccc---------c------------------------a-gc-
B D          White rhinoceros  cc--------c---ccc---------c------------------------a-gc-
B D                       Cat  cc--------c---ccc---------c------------------------a-gc-
B D                       Dog  tc--------c---ccc---------c------------------------a-gc-
B D                   Ferret   cc--------c---ccc---------c------------------------a-gc-
B D                     Panda  tc--------c---ccc---------c------------------------a-gc-
               Pacific walrus  tc--------c---ccc---------c------------------------a-gc-
                 Weddell seal  tc--------c---ccc---------c------------------------a-gc-
             Black flying-fox  tc--------c---ccc---------c------------------------a-gc-
                Big brown bat  tc--------c---ccc---------c------------------------a-gc-
         David's myotis (bat)  tc--------c---ccc---------c------------------------a-gc-
B D                  Microbat  tc--------c---ccc---------c------------------------a-gc-
B D                  Hedgehog  tg--------c---ccc----------------------------------a-gc-
B D                     Shrew  tc--------c---ccc---------t------------------------a-gc-
              Star-nosed mole  cc--------c---ccc---------c------------------------a-gc-
B D                  Elephant  tc--------t---ccc---------c------------------------a-gc-
          Cape elephant shrew  ttccc---cac---ccc---------c------------------------a-gc-
B D                   Manatee  tc--------c---ccc---------c------------------------a-gc-
             Cape golden mole  tc--------c---ccc---------c------------------------a-gc-
B D                    Tenrec  tc--------c---ccc---------c------------------------a-gc-
                     Aardvark  tc--------c---ccc---------c------------------------a-gc-
B D                 Armadillo  tc--------c---ccc---------c------------------------a-gc-
B D                   Opossum  tt--------c---ttt---------c------------------------a-tc-
B D           Tasmanian devil  tc--------c---ctt---------c------------------------a-gc-
B D                  Platypus  tc--------c---cct---------c------------------------acgc-
  D               Rock pigeon  ct--------t---ccctgc------------------------------------
B D               Zebra finch  tt--------c---ccccg-------------------------------------
  D             Scarlet macaw  tt--------c---tcctgt------------------------------------
B D                    Turkey  ----------c---ccc---------------------------------------
B D        American alligator  ct--------c---ttc---------------------------------------
B D             X. tropicalis  tt--------c---cct---------c------------------------a-cg-
B D                Coelacanth  ----gtcatac---ctc---------t-----------------------------
B D                 Zebrafish  --------tac---acc---------c------------------------t-gtc
  D            Painted turtle  ========================================================
  D           Green seaturtle  ========================================================
B D                    Lizard  ========================================================
  D          Peregrine falcon  ========================================================
  D              Saker falcon  ========================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ========================================================

Inserts between block 7 and 8 in window
B D              Zebra finch 4bp
  D            Scarlet macaw 7bp
B D            X. tropicalis 1bp

Alignment block 8 of 1399 in window, 53759217 - 53759288, 72 bps 
B D                     Human  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                     Chimp  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                   Gorilla  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                 Orangutan  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                    Gibbon  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                    Rhesus  cctgggccagtt------c----ttttcgt-tac----ctg---atgatta--tctgggggccctgg---
B D       Crab-eating macaque  cctgggccagtt------c----ttttcgt-tac----ctg---atgatta--tctgggggccctgg---
B D                    Baboon  cctgggccagtt------c----ttttcat-tac----ctg---atgatta--tctgggggccctgg---
B D              Green monkey  cctgggccagtt------c----ttttcat-tac----ctg---atgatta--tctgggggccctgg---
B D                  Marmoset  cctgggccagtt------c----ttttcat-tac----ctg---atgatta--tctgggggccctgg---
B D           Squirrel monkey  cctgggccagtt------c----ttttcat-tac----ctg---atgatta--tctgggggccctgg---
B D                  Bushbaby  cctgagccagtt------c----ttttcgt-tac----ctg---gtgatta--tctgggggccctgg---
           Chinese tree shrew  cctgggccagtt------c----tttttac-tac----ctg---gtgatta--tccgggggccctgg---
B D                  Squirrel  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
       Lesser Egyptian jerboa  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
                 Prairie vole  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggagccctgg---
B D           Chinese hamster  cctgggccagtt------c----ttttcat-tac----cta---gtgatta--tctgggggccctgg---
               Golden hamster  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                     Mouse  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                       Rat  cctgggccagtt------c----ttttcat-tac----cta---gtgatta--tctgggggccctgg---
B D            Naked mole-rat  cccccgcccgtt------c----ttttcat-tac----ctg---gtgatta--tctggagcccctgg---
B D                Guinea pig  cccaagccagtt------c----tttgcat-tac----ctg---gtgatta--tctgggggccctgg---
                   Chinchilla  cccaagccagtt------c----ttttcat-tac----ctg---ctgatta--tctggggcccctgg---
             Brush-tailed rat  cccaggccagtt------c----ttttcat-tac----ctg---gtgatta--tctggggcccctgg---
B D                    Rabbit  cacgagccagtt------c----tgttcat-tac----ctg---gtgatta--tctgggggcccggg---
B D                      Pika  cctgagccagct------c----tgctcat-tac----ctg---gtgatta--tctg-------------
B D                       Pig  cttgggccaggt------c----ttttcgt-tac----ctg---gtgatta--tctgggggccctgg---
B D                    Alpaca  cctgggccagct------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
               Bactrian camel  cctgggccagct------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                   Dolphin  cctgggccggtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
                 Killer whale  cctgggccggtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
             Tibetan antelope  cctgggccagta------c----ttttcat-tac----ctg---gtgatta--tctgtgggccctgg---
B D                       Cow  cctgggccagta------c----ttttcat-tac----ctg---gtgatta--tcttcgggccctgg---
B D                     Sheep  cctgggccagta------c----ttttcat-tac----ctg---gtgatta--tctgcgggccctgg---
                Domestic goat  cctgggccagta------c----ttttcat-tac----ctg---gtgatta--tctgcgggccctgg---
B D                     Horse  cctgggccaggt------c----ttttcat-tac----cta---gtgatta--tctgggggccctgg---
B D          White rhinoceros  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggtgctgg---
B D                       Cat  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                       Dog  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                   Ferret   cctgggcgagtt------c----ttttcat-tac----ctc---gtgatta--tctgggggccctgg---
B D                     Panda  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
               Pacific walrus  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggctctgg---
                 Weddell seal  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
             Black flying-fox  cctggaccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
                Big brown bat  cctggaccagct------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
         David's myotis (bat)  cctggaccggct------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                  Microbat  cctggaccagct------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                  Hedgehog  cctgggcccgtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                     Shrew  cctgggcttgtt------c----tcatcat-tac----ctg---gtgatta--tctgggggccctgg---
              Star-nosed mole  cctgggccggtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccctgg---
B D                  Elephant  c-tgggccagtt------c----ttttcac-tac----ctg---gtgatta--tctgggagccatgg---
          Cape elephant shrew  cgtgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccatgg---
B D                   Manatee  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccatgg---
             Cape golden mole  cctgggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccatgg---
B D                    Tenrec  cctgggccagtt------c----ttttcat-tac----ttg---gtgatta--tctgggggctctgg---
                     Aardvark  cctaggccagtt------c----ttttcat-tac----ctg---gtgatta--tctgggggccatgg---
B D                 Armadillo  cctgggccagtt------c----tttttat-tac-----tg---gtgatta--tctgggggccctgc---
B D                   Opossum  tcttccccttct------cccttttttcct-tca----ctgtcttctactc--tctctgtgtc-tct---
B D           Tasmanian devil  cctgggccagct------c----ttttcat-tac----ctg---gtgatta--tttgggggcc-tgg---
B D                  Platypus  tctctacccgtc------c----ttgccttctgc----ctg---gctggga---ctgtgggccccgggcc
B D               Zebra finch  tccctctctttc-------------tcttt-ttc---tctc---ctcattt------------tcac---
  D             Scarlet macaw  tccatgtctctc------c----tgtcctc-tcc---tccc---gccattt--tctg------tcat---
B D                    Turkey  tccgtcccactt------a----catcctt-tccctgtccc---accattgcctctg------ttct---
B D        American alligator  ------cctctt------c----ctccctt-ctt---tctt---accctct---cta------tcca---
B D             X. tropicalis  cccctaccaatt------g----cttcccc-tgg----ctc---tctac----tcctagttccct-----
B D                Coelacanth  cctgaatcagtgactgaac----tgattat-tgc-accctg---gtg------tcctgggtcacagt---
B D                 Zebrafish  ttcttccccttt------t----cctcctc-ctc----ctc---ccgtttt--cctcactgccctcc---
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================

                        Human  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                        Chimp  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                      Gorilla  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                    Orangutan  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                       Gibbon  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                       Rhesus  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
          Crab-eating macaque  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                       Baboon  ---catt--t-ccc-c-ct------gcc----tccc---acc--ct---ct
                 Green monkey  ---catt--t-tcc-c-ca------gcc----tccc---acc--ct---ct
                     Marmoset  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
              Squirrel monkey  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                     Bushbaby  ---catt--t-ccc-c-ca------gct----tcct---acc--tt---ct
           Chinese tree shrew  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                     Squirrel  ---catt--t-ccc-c-ca------gcc----tccc---act--ct---ct
       Lesser Egyptian jerboa  ---catt--t-ccc-c-ta------gtc----tccc---acc--ct----t
                 Prairie vole  ---catt--t-ccc-c--a------gcc----tctc---acc--ct----t
              Chinese hamster  ---catt--t-ccc-c--a------gcc----tccc---acc--ct----t
               Golden hamster  ---catt--t-ccc-c--a------gcc----cccc---acc--ct----t
                        Mouse  ---catt--t-ccc-c--a------gcc----tccc---acc--ct----t
                          Rat  ---catt--t-ccc-c--a------gcc----tccc---acc--ct----t
               Naked mole-rat  ---catt--t-ccc-ccca------gtc----tccc---acc--ct---tt
                   Guinea pig  ---catt--t-ccc-ccca------gtc----tccc---acc--ct---ct
                   Chinchilla  ---catt--t-ccc-ccca------gtc----tccc---acc--ct---ct
             Brush-tailed rat  ---catt--tcccc-ccca------gtc----tccc---acc--ct---ct
                       Rabbit  ---catt--t-ccc-a------------------------cc--ct---cc
                         Pika  ------c--t-ccc-a------------------------cc--cc---cc
                          Pig  ---catt--t-ccc-c-ca------gcc-----ccc---acc--ct---ct
                       Alpaca  ---catt--t-ccc-c-tg------ccc-----ccc---acc--ct---ct
               Bactrian camel  ---catt--t-ccc-c-tg------ccc-----ccc---acc--ct---ct
                      Dolphin  ---catt--t-ccc-c-ca------gcc-----tcc---acc--ct---ct
                 Killer whale  ---catt--t-ccc-c-ca------gcc-----tcc---acc--ct---ct
             Tibetan antelope  ---catt--t-ccc-c-ca------gcc-----ccc---acc--ct---ct
                          Cow  ---catt--t-ccc-c-ca------gcc-----ccc---acc--ct---ct
                        Sheep  ---catt--t-ccc-c-ca------gcc-----ccc---acc--tt---ct
                Domestic goat  ---catt--t-ccc-c-ca------gcc-----ccc---acc--ct---ct
                        Horse  ---catt--t-ccc-t-cc------atc----tccc---acc--ct---ct
             White rhinoceros  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                          Cat  ---catt--tcccc-c-ca------gcc----tccc---acc--ct---ct
                          Dog  ---catt--t-ccc-c-ca------gcc----tccc---accctct---ct
                      Ferret   ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                        Panda  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---cc
               Pacific walrus  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                 Weddell seal  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
             Black flying-fox  ---catg--t-ccc-c-ca------gcc----tccc---acc--cc---ct
                Big brown bat  ---catg--t-ccc-c-ca------gcc----tccc---acc--cc---ct
         David's myotis (bat)  ---catg--t-ccc-c-ca------gcc----gccc---acc--cc---ct
                     Microbat  ---catg--t-ccc-c-ca------gcc----tccc---acc--cc---ct
                     Hedgehog  ---catt----ccc-c-tg------gcc----tccc---ac----t---ct
                        Shrew  ---cattccc-tcc-c-ca------gcc----cccc---aca--at---tt
              Star-nosed mole  ---catt--t-tcc-c-ca------gcc----cccc---acc--ct---cc
                     Elephant  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
          Cape elephant shrew  ---catt--t-ccc-c-ca------gcc----tccc---acc--tt---ct
                      Manatee  ---catt--t-cct-c-ca------gcc----tccc---acc--ct---ct
             Cape golden mole  ---catt--t-ccc-c-ca------gcc----tccc---acc--ct---ct
                       Tenrec  ---catt--c-ccc-c-ca------gcc----tccc---acc--ct---ct
                     Aardvark  ---tatt--t-ccc-c-ca------gcc----tcct---acc--ct---ct
                    Armadillo  ---catt--c-ccc-c-ca------ccccacttccc---acc--ct---ct
                      Opossum  ---catc--t-ctc-t-ct------tcc----ccct---act--cc---ct
              Tasmanian devil  ---catt--t-ccc-c-ca------gcc----cccc---acc--ct---ct
                     Platypus  gccctcc--t-cct-c-cg------ccc----ttcc---ccg--ct---ct
                  Zebra finch  ---tgtt--t-ccc-c-tg------ctt----ttcc---cct--cc---ct
                Scarlet macaw  ---ggct--t-ccc-c-tc------atc----ttct---ccc--cc---tt
                       Turkey  ---gttt--c-tcc-c-cc------ttg----cttc---cct--ct---at
           American alligator  ---catt--c-ctc-c-ct------tcc----accc---gtt--ca---ct
                X. tropicalis  ---cact--t-ccc-c-taccaattgct----tcccctggct--ct---ct
                   Coelacanth  ---cttg--t-gta-c-aa------acc----aacc---aca--ccaaact
                    Zebrafish  ---catt--t-tccac-ct------ccc----tatc---ttc--ct---ct
               Painted turtle  ===================================================
              Green seaturtle  ===================================================
                       Lizard  ===================================================
             Peregrine falcon  ===================================================
                 Saker falcon  ===================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ===================================================

Alignment block 9 of 1399 in window, 53759289 - 53759291, 3 bps 
B D                     Human  acc
B D                     Chimp  acc
B D                   Gorilla  acc
B D                 Orangutan  acc
B D                    Gibbon  acc
B D                    Rhesus  acc
B D       Crab-eating macaque  acc
B D                    Baboon  acc
B D              Green monkey  acc
B D                  Marmoset  acc
B D           Squirrel monkey  acc
B D                  Bushbaby  acc
           Chinese tree shrew  acc
B D                  Squirrel  acc
       Lesser Egyptian jerboa  acc
                 Prairie vole  acc
B D           Chinese hamster  acc
               Golden hamster  acc
B D                     Mouse  acc
B D                       Rat  acc
B D            Naked mole-rat  acc
B D                Guinea pig  acc
                   Chinchilla  acc
             Brush-tailed rat  gcc
B D                    Rabbit  gcc
B D                      Pika  acc
B D                       Pig  acc
B D                    Alpaca  acc
               Bactrian camel  acc
B D                   Dolphin  acc
                 Killer whale  acc
             Tibetan antelope  gcc
B D                       Cow  gcc
B D                     Sheep  gcc
                Domestic goat  gcc
B D                     Horse  acc
B D          White rhinoceros  acc
B D                       Cat  acc
B D                       Dog  ccc
B D                   Ferret   acc
B D                     Panda  acc
               Pacific walrus  acc
                 Weddell seal  acc
             Black flying-fox  acc
                Big brown bat  aca
         David's myotis (bat)  aca
B D                  Microbat  aca
B D                  Hedgehog  gcc
B D                     Shrew  gcc
              Star-nosed mole  acc
B D                  Elephant  acc
          Cape elephant shrew  acc
B D                   Manatee  acc
             Cape golden mole  act
B D                    Tenrec  agc
                     Aardvark  acc
B D                 Armadillo  acc
B D           Tasmanian devil  acc
B D               Zebra finch  atc
  D             Scarlet macaw  cac
B D                    Turkey  ctc
B D        American alligator  ctc
B D             X. tropicalis  act
B D                Coelacanth  acc
B D                 Zebrafish  act
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                   Megabat  NNN
  D  Chinese softshell turtle  ===

Inserts between block 9 and 10 in window
B D              Zebra finch 1bp
  D            Scarlet macaw 1bp
B D       American alligator 4bp

Alignment block 10 of 1399 in window, 53759292 - 53759292, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                      Pika  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  t
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  t
                 Weddell seal  c
             Black flying-fox  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  c
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  c
B D           Tasmanian devil  c
B D               Zebra finch  c
  D             Scarlet macaw  c
B D        American alligator  c
B D             X. tropicalis  c
B D                Coelacanth  c
B D                 Zebrafish  c
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Megabat  N
  D  Chinese softshell turtle  =

Inserts between block 10 and 11 in window
B D              Zebra finch 11bp
B D       American alligator 193bp
B D               Coelacanth 15bp

Alignment block 11 of 1399 in window, 53759293 - 53759296, 4 bps 
B D                     Human  agca
B D                     Chimp  agca
B D                   Gorilla  agca
B D                 Orangutan  agca
B D                    Gibbon  agca
B D                    Rhesus  agca
B D       Crab-eating macaque  agca
B D                    Baboon  agca
B D              Green monkey  agca
B D                  Marmoset  agca
B D           Squirrel monkey  agca
B D                  Bushbaby  agca
           Chinese tree shrew  agca
B D                  Squirrel  agca
       Lesser Egyptian jerboa  agca
                 Prairie vole  agca
B D           Chinese hamster  agca
               Golden hamster  agca
B D                     Mouse  agca
B D                       Rat  agca
B D            Naked mole-rat  agca
B D                Guinea pig  agca
                   Chinchilla  agca
             Brush-tailed rat  agca
B D                    Rabbit  cgca
B D                      Pika  --cc
B D                       Pig  agca
B D                    Alpaca  ggca
               Bactrian camel  ggca
B D                   Dolphin  agca
                 Killer whale  agca
             Tibetan antelope  agca
B D                       Cow  agca
B D                     Sheep  agca
                Domestic goat  agca
B D                     Horse  agca
B D          White rhinoceros  agca
B D                       Cat  agca
B D                       Dog  agca
B D                   Ferret   agca
B D                     Panda  agca
               Pacific walrus  agca
                 Weddell seal  agca
             Black flying-fox  agca
                Big brown bat  agca
         David's myotis (bat)  agca
B D                  Microbat  agca
B D                  Hedgehog  agca
B D                     Shrew  agca
              Star-nosed mole  agca
B D                  Elephant  agca
          Cape elephant shrew  agca
B D                   Manatee  agta
             Cape golden mole  agca
B D                    Tenrec  agca
                     Aardvark  agca
B D                 Armadillo  agca
B D           Tasmanian devil  agaa
B D               Zebra finch  ggca
B D             X. tropicalis  ggct
B D                Coelacanth  agaa
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D        American alligator  ====
B D                    Lizard  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D                   Megabat  NNNN
  D  Chinese softshell turtle  ====

Alignment block 12 of 1399 in window, 53759297 - 53759449, 153 bps 
B D                     Human  gg-----cagtg--------------aacagcatagggag--aaagg----------------------a
B D                     Chimp  gg-----cagtg--------------aacagcacagggag--aaagg----------------------a
B D                   Gorilla  gg-----cagtg--------------aacagcacagggag--aaagg----------------------a
B D                 Orangutan  gg-----cagtg--------------aacagcacagggag--aaagg----------------------a
B D                    Gibbon  gg-----cagtg--------------aacagcacagagag--aaagg----------------------a
B D                    Rhesus  gg-----cagtg--------------aacagcacagggag--aaagg----------------------a
B D       Crab-eating macaque  gg-----cagtg--------------aacagcacagggag--aaagg----------------------a
B D                    Baboon  gg-----cagtg--------------aacagcacagggag--aaagg----------------------a
B D              Green monkey  gg-----cagtg--------------aacagcacagggag--aaagg----------------------a
B D                  Marmoset  gg-----cagtg--------------aacagcagagggag--aaagg----------------------a
B D           Squirrel monkey  gg-----ctgtg--------------aacagcagagggag--aaagg----------------------a
B D                  Bushbaby  gg-----cagtg--------------aatagcacaaggga--agagg----------------------g
           Chinese tree shrew  -g-----cagca--------------aacagtacaggcag--acagg----------------------g
B D                  Squirrel  gg-----cagtg--------------aacagcacagggag--aaagg----------------------g
       Lesser Egyptian jerboa  gg--------c----------------acagcatagggag--aaagg----------------------g
                 Prairie vole  gg-----cagc----------------acagcacaaggaa--gaaag----------------------g
B D           Chinese hamster  ggcagcacagc----------------acagcacagggag--aaagg----------------------g
               Golden hamster  gg-----cagc----------------acagcacagggag--aaagg----------------------g
B D                     Mouse  gg-cttacagc----------------gcagcacaggga-------------------------------
B D                       Rat  gg-----cagc----------------acagcacagggag--aaagg----------------------g
B D            Naked mole-rat  gg-----cagtg--------------aacaatgcagggag--aaagt-----------------------
B D                Guinea pig  gg-----cactg--------------aatagtgcagggag--aaaga-----------------------
                   Chinchilla  gg-----cagtg--------------agcagagcagggag--aaagg-----------------------
             Brush-tailed rat  gg-----cagtg--------------aacagtgcagggag--aaagt-----------------------
B D                    Rabbit  gg-----cactg--------------aacagcacggggag--agaag----------------------g
B D                      Pika  gg-----cacttcccccagcccccccatcaacacagagaa--agaag----------------------g
B D                       Pig  gg-----caggg--------------gagagcacagggag--aaaag----------------------g
B D                    Alpaca  gg-----cagta--------------gaaagcacagggag--aaagg----------------------g
               Bactrian camel  gg-----cagta--------------gaaagcacagggag--aaagg----------------------g
B D                   Dolphin  gg-----cagtg--------------gatagcacggggag--aaagg----------------------g
                 Killer whale  gg-----cagtg--------------gatagcacggggag--aaagg----------------------g
             Tibetan antelope  gg-----cagtg--------------gatagcg-ggggag--aaagg----------------------g
B D                       Cow  gg-----cagtg--------------gatagcc-ggggag--aaagg----------------------g
B D                     Sheep  gg-----cagtg--------------gatagcg-ggggag--aaagg----------------------g
                Domestic goat  gg-----cagtg--------------gatagca-ggggag--aaagg----------------------g
B D                     Horse  gg-----cagtg--------------aatagcgcagggag--aaagg----------------------g
B D          White rhinoceros  gg-----cagtg--------------aatcgcacagggag--aaa-g----------------------g
B D                       Cat  gg-----cagtg--------------aatagcacagggag--aaagg----------------------g
B D                       Dog  gg-----cggtg--------------aatagcagggggag--aaagg----------------------g
B D                   Ferret   gg-----cagtg--------------aatagtacagggag--aaagg----------------------g
B D                     Panda  gg-----cagtg--------------aatagcatagggag--aaagg----------------------g
               Pacific walrus  ag-----cagtg--------------aatagcacagggag--aaagg----------------------g
                 Weddell seal  gg-----cagtg--------------aatagcacagggag--aaagg----------------------g
             Black flying-fox  gg-----cagtg--------------aatagcacaggaag--agagg----------------------g
                Big brown bat  gg-----cagtg--------------aatagcatagggag--aaagg----------------------g
         David's myotis (bat)  gg-----cagtg--------------aatagcataggggg--aaagg----------------------g
B D                  Microbat  gg-----cagtg--------------aatagcatagggag--aaagg----------------------g
B D                  Hedgehog  gg-----cgatg--------------aacagtgcacg-ag--aaagg----------------------g
B D                     Shrew  ag-----cagag--------------aatagcactgg---------------------------------
              Star-nosed mole  gg-----cagtt--------------cacagcacagg--------ga----------------------g
B D                  Elephant  gg-----cagtg--------------aacagcacagggag--gaagg----------------------g
          Cape elephant shrew  gg-----cagtg--------------aacagcaca-ggag--aatag----------------------g
B D                   Manatee  gg-----cagtg--------------aacagcacagggag--aaaag----------------------g
             Cape golden mole  gg-----cagtg--------------aacagcacaaggag--aaagg----------------------g
B D                    Tenrec  gg-----cagtg--------------cacagcac--gggg--aaagg----------------------g
                     Aardvark  gg-----tagtg--------------aacagcacagggag--aaagg----------------------g
B D                 Armadillo  gg-----cagtg--------------aacagcacagggag--aaagg----------------------g
B D           Tasmanian devil  gg-----caatg--------------agctatatggggag--ggggg----------------------g
B D             X. tropicalis  ga-----gagt---------------cactgcaaagggaaccagatg----------------------g
B D                Coelacanth  tg-----cagtg--------------tctagtgtttcaaa--caaggcttgagaaccatctctggtggtg
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================

                        Human  -gaaggga-----ttgctctt-ggg-------------ac--cagag-gc-aaggacatggagaccc---
                        Chimp  -gaaggga-----ttgctctt-ggg-------------acaagagag-gc-aaggacatggagaccc---
                      Gorilla  -gaaggga-----ttgctctt-ggg-------------ac--cagag-gc-aaggacatggagaccc---
                    Orangutan  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                       Gibbon  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                       Rhesus  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacacggagaccc---
          Crab-eating macaque  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacacggagaccc---
                       Baboon  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacacggagaccc---
                 Green monkey  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacacggagaccc---
                     Marmoset  -gaaggga-----ttgctcttgggg-------------ac--cagat-gc-aaggacatggagaccc---
              Squirrel monkey  -gaaggga-----ttgctctc-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                     Bushbaby  -gaaggga-----atgctcct-ggg-------------ac--cagat-gc-aaggatgtggggaccc---
           Chinese tree shrew  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                     Squirrel  -gaaggga-----ttgctctt-ggg-------------cc--cagat-gc-aaggacatggagaccc---
       Lesser Egyptian jerboa  -gaaggga-----ttgctctt-ggg-------------cc--cagat-gc-aaggacacagagaccc---
                 Prairie vole  -gaaagga-----ttgctctt-ggg-------------cc--cagactgc-aaggacacagagaccc---
              Chinese hamster  -gaaagga-----ttgctctt-ggg-------------cc--cagactgc-aaggacacagagaccc---
               Golden hamster  -gaaagga-----ttgctctt-ggg-------------cc--cacgctgc-aaggacacagagaccc---
                        Mouse  -gaaagga-----ttgctctt-ggg-------------cc--cagac-ac-aaggacacagagaccc---
                          Rat  ggaaagga-----ttgctctt-ggg-------------cc--cagac-gc-aaggacacagagaccc---
               Naked mole-rat  -gaagggg-----ttgatctt-ggg-------------cc--cagat-gc-aaggacatggagaccc---
                   Guinea pig  -gaaggcg-----ttggtctt-ggg-------------cc--gagat-gc-aaggacatggagaccc---
                   Chinchilla  -gaagggg-----ctgctctt-ggg-------------cc--cagat-gc-aaggacacggagaccc---
             Brush-tailed rat  -gaagggg-----ttgctcttgggg-------------cc--cagat-gc-aaggacacggagaccc---
                       Rabbit  -cgaggga-----ttgctcct-gggccccccaccccgccc--cgcgt-gc-aaggaca-cgggaccc---
                         Pika  -ccagggg-----ttgctctt-gggtgttccccccaaccc--ca-gt--c-aagcacaccgggaccc---
                          Pig  -gaaggga-----cggttctt-ggg-------------ac--cagat-gc-aaggacatggagcccc---
                       Alpaca  -gacagga-----ttgctttt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
               Bactrian camel  -gacaggg-----ttgctttt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                      Dolphin  -gaaggga-----ttactctt-ggg-------------ac--cagat-gc-aaggacgtggagaccc---
                 Killer whale  -gaaggga-----ttactctt-ggg-------------ac--cagat-gc-aaggacgtggagaccc---
             Tibetan antelope  -gaaggga-----ttgctctt-ggg-------------ac--cagct-gc-aaggacgtg--gaccc---
                          Cow  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gcaaaggacgtg--gaccc---
                        Sheep  -gaaggga-----ttgctttt-ggg-------------ac--cagat-gc-aaggacgtg--gaccc---
                Domestic goat  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggatggg--gaccc---
                        Horse  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
             White rhinoceros  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                          Cat  -gaaggga-----ttgctctc-ggg-------------ac--cagat-gc-aaggacacggagaccc---
                          Dog  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                      Ferret   -gaaggga-----tagctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                        Panda  -gaaggga-----tagctctt-ggg-------------ac--cagat-gc-aaggacatagagaccc---
               Pacific walrus  -gaaggga-----gagctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                 Weddell seal  -gaaggga-----gagctctt-ggg-------------ac--cagat-gc-aaggacatggagatcc---
             Black flying-fox  -gaagaga-----ttgctctt-ggg-------------ac--cagat-gc-aagggcatggagaccc---
                Big brown bat  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
         David's myotis (bat)  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                     Microbat  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
                     Hedgehog  -ggagaaa-----ttgctctt-ggg-------------cc--caaat-ac-aaggacacagggaccc---
                        Shrew  --caggga-----tggcttct-ggg-------------gc--tagat-gc-aaggacatggggaccc---
              Star-nosed mole  -caaggga-----tcgctctc-ggg-------------ag--gaggt-gc-aaggacgcggggacccccc
                     Elephant  -gaaggga-----ttgctctt-tgg-------------ac--caaat-gc-aaggacatggagaccc---
          Cape elephant shrew  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggatatggagaccc---
                      Manatee  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
             Cape golden mole  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggatatggagaccc---
                       Tenrec  -gaagggg-----ttg-tctc-ggg-------------ac--cagat-gc-aaggacatggggaccc---
                     Aardvark  -gaaggga-----ttgctctt-ggg-------------ac--cagat-gc-aaggatatggagaccc---
                    Armadillo  -gaaggga-----cagctctt-ggg-------------ac--cagat-gc-aaggacatggagaccc---
              Tasmanian devil  -atgggaa----------ctt-ggg-------------ac--cagat-gc-aaggacaggaggatcc---
                X. tropicalis  -gtcgggtcataccagtacta-tgg-------------gc--cacat-ac------tacagagagca---
                   Coelacanth  -gtggtgg-----ttgttggg-ggg-------------gg--ggagt-ga-aacg-tatggagacag---
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================

                        Human  ----------------------t-------ccccctgtg-cc-gcccttctttccctcaagcag------
                        Chimp  ----------------------t-------ccccctgtg-cc-gcccttctttccctcaagcag------
                      Gorilla  ----------------------t-------ccccctgtg-cc-tcccttctttccctcaagcag------
                    Orangutan  ----------------------t-------ccccctgtg-cc-gcccttctttccctcaagc-g------
                       Gibbon  ----------------------t-------ccccctgtg-cc-gcccttctttccctcaagcag------
                       Rhesus  ----------------------t-------ccccctgtg-cc-gcccttctttccctcaagcag------
          Crab-eating macaque  ----------------------t-------ccccctgtg-cc-gcccttctttccctcaagcag------
                       Baboon  ----------------------t-------ccccctgtg-cc-gcccttctttccctcaagcag------
                 Green monkey  ----------------------t-------ccccctgtg-cc-gcccttctttccctcaagcag------
                     Marmoset  ----------------------t-------ccccctgtg-cc-gcccttctttccctcaagcag------
              Squirrel monkey  ----------------------t-------ccccctgtg-cc-gcccctctttccctcaagcag------
                     Bushbaby  ----------------------t-------ccccctgtgccc-gcccttctttccctcaagcag------
           Chinese tree shrew  ----------------------t-------ccccctgtg-cctgcccttctttccctcaagcag------
                     Squirrel  ----------------------t-------ccccctgtgccc-gccctccttcccctcaagcag------
       Lesser Egyptian jerboa  ----------------------tcccccctccccccgtg-cc-gccgtcctttcccttaagcag------
                 Prairie vole  ----------------------t-------ccccctgtg-cc-g-ccttc-ttccctccagcag------
              Chinese hamster  ----------------------tc------ccccctgtg-cc-gcccttcttcccctccagcag------
               Golden hamster  ----------------------t-------ccccctgtg-cc-gcccttc-ccccctccagcag------
                        Mouse  ----------------------t-------ccccctgtg-cc-gccctccttcccctccagcag------
                          Rat  ----------------------t-------ccccctgtg-cc-gccctccttcccctccagcag------
               Naked mole-rat  ----------------------t-------ccccctgtgccc-accctccttcccct-aagctg------
                   Guinea pig  ----------------------t-------cccg-tgtgccc-accctctttcccctcaagcag------
                   Chinchilla  ----------------------t-------cccc--gtgccc-gccccccttccctttgagtag------
             Brush-tailed rat  ----------------------t-------ccccctgtgccc-accctccttcccttcaagcag------
                       Rabbit  ----------------------t-------ccccc-gtgccc-gcccctcctgccctgaagcag------
                         Pika  ----------------------t-------ccccctgtgccc-gcccttgcttccctcaagcag------
                          Pig  ----------------------t-------ccccctgcaccc-gcccttcgttccctccggcag------
                       Alpaca  ----------------------t-------ccccccgcaccc-gcccttctttccctccggcag------
               Bactrian camel  ----------------------t-------ccccctgcaccc-gcccttctttccctccggcag------
                      Dolphin  ----------------------t-------ccccctgcaccc-gcccttctttccctccagcag------
                 Killer whale  ----------------------t-------ccccctgcaccc-gcccttctttccctccagcag------
             Tibetan antelope  ----------------------t-------ccccctgtaccc-gcccttctttccctccagcag------
                          Cow  ----------------------t-------ccccctgtaccc-gcccttctttccctccagcac------
                        Sheep  ----------------------t-------ccccctggaccc-gcccttctttccctccagcag------
                Domestic goat  ----------------------t-------ccccctggaccc-gcccttgtttccctccagcag------
                        Horse  ----------------------t-------ccccctgcagcc-accctcctttccctcaagcag------
             White rhinoceros  ----------------------t-------ccccctgcaccc-gcccttctttccctcaagcag------
                          Cat  ----------------------t-------cccccttcaccc-gcccttctttccctcaagcag------
                          Dog  ----------------------t--------cccctgcaccc-gcccttctttccctcaagcag------
                      Ferret   ----------------------t-------cccccagcaccc-gcccttctttccctgaagcag------
                        Panda  ----------------------t-------ccccctgcaccc-gcccttctttccctgaagcag------
               Pacific walrus  ----------------------t-------ccccctgcaccc-gcccttctttccctgaagcag------
                 Weddell seal  ----------------------t-------ccccctgcaccc-gcccttctttccctgaagcag------
             Black flying-fox  ----------------------t-------ccccctgctccc-gcccttctttccctcaagcag------
                Big brown bat  ----------------------t-------ccccctacacct-gcccttctttccctcaagcag------
         David's myotis (bat)  ----------------------t-------ccccctacacct-gcccttctttccctcaagcag------
                     Microbat  ----------------------t-------ccccctacacct-gcccttctttccctcaagcag------
                     Hedgehog  ----------------------t-------ccctctgcaccc-tccctttttcccctcaagcaa------
                        Shrew  ----------------------t-------ccccctgcaccc-accctgccgtccctccggcag------
              Star-nosed mole  ctgcacccgccggtggggaccac-------ccccccgcaccc-gccct-cattccctcaagcag------
                     Elephant  ----------------------t-------ccccctgtaccc-acccttctttccctcaagcag------
          Cape elephant shrew  ----------------------t--------cccctgtaccc-gcccttctttccctcaagcag------
                      Manatee  ----------------------t-------ccccctgcaccc-gcccttctttccctcaagcag------
             Cape golden mole  ----------------------t-------ccctcggtaccc-gcccttctttcccttaagcag------
                       Tenrec  ----------------------t-------ccctctgcaccc-gcccttctttccctcaggcag------
                     Aardvark  ----------------------t-------ccccctgtaccc-gcccttctttgcctcaagcag------
                    Armadillo  ----------------------tc------ccccccgggccc-gcccttctttccctcaagcag------
              Tasmanian devil  ----------------------t-------ccccc-----ac-ttccacccccaccacaagcag------
                X. tropicalis  ----------------------c-------agcaccgagccc-a------gttcccacaatgcc------
                   Coelacanth  ----------------------t-------cacctcaca-ga-atactccagtccttaaggtagttcctg
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================

                        Human  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                        Chimp  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                      Gorilla  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                    Orangutan  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                       Gibbon  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                       Rhesus  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
          Crab-eating macaque  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                       Baboon  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                 Green monkey  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                     Marmoset  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
              Squirrel monkey  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                     Bushbaby  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggacgacag
           Chinese tree shrew  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                     Squirrel  --------------tgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
       Lesser Egyptian jerboa  --------------tgcacatctgggaaaat---ccca--gct----ccagg-ca----ggggaagacag
                 Prairie vole  --------------tgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacaa
              Chinese hamster  --------------tgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacaa
               Golden hamster  --------------tgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacaa
                        Mouse  --------------tgcacatctgggaaaat---ccca--gct----cgagg-ca----ggggaaggcaa
                          Rat  --------------tgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaaggcaa
               Naked mole-rat  --------------tgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaaaacag
                   Guinea pig  --------------tgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                   Chinchilla  --------------tgcacatctgggaaaat---ccca--gct----cgagg-ca----agcgaagacag
             Brush-tailed rat  --------------tgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                       Rabbit  --------------tgcacatctgggaaaat---ccca--gct----tgagg-ca----gggg-agacgg
                         Pika  --------------tgcacatctgggaaaat---cccagcgct----tgggg-ca----gggg-agacag
                          Pig  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                       Alpaca  -------------atgcacatctgggaaaat---ccca--gct----tgagt-ca----ggggaagacag
               Bactrian camel  -------------atgcacatctgggaaaat---ccca--gct----tgagt-ca----gggaaagacag
                      Dolphin  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                 Killer whale  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
             Tibetan antelope  -------------atgcacagctgggaaaac---ccca--gct----tgcag-ca----ggggaagacag
                          Cow  -------------atgcacagctgggaaaac---ccca--gct----tgcag-ca----ggggaagacag
                        Sheep  -------------atgcacagctgggaaaac---ccca--gct----tgcag-ca----ggggaagacag
                Domestic goat  -------------atgcacagctgggaaaac---ccca--gct----tgcag-ca----ggggaagacag
                        Horse  -------------atgcacatctgggaaaat---cctg--gct----tgagg-ca----ggggaagacag
             White rhinoceros  -------------atgcacatctgggaaagt---ccca--gct----tgagg-ca----ggggaagacag
                          Cat  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                          Dog  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca-----gggaagacag
                      Ferret   -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                        Panda  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
               Pacific walrus  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                 Weddell seal  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
             Black flying-fox  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----agggaagacag
                Big brown bat  -------------atgcacatctgggaaaac---ccca--gct----tgagg-ca----ggggaagacag
         David's myotis (bat)  -------------atgcacatctgggaaaac---ccca--gct----tgagg-ca----ggggaagacag
                     Microbat  -------------atgcacatctgggaaaac---ccca--gct----tgagg-ca----ggggaagacag
                     Hedgehog  -------------atgcacatctgggaaaat---ccca--gct----ttaga-ca-----gggaagacag
                        Shrew  -------------atgtacatctgggaaaat---ccca--gct----tgaggcca-----gaaaagacag
              Star-nosed mole  -------------atgcacatctgggaaaat---ccca--gct----cgagg-ca-----gggaaggcgg
                     Elephant  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
          Cape elephant shrew  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggacggcag
                      Manatee  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
             Cape golden mole  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----gggaaagacag
                       Tenrec  -------------acgcacatctgggaaacc---ccca--gct----tgggg-catggcggggaagacag
                     Aardvark  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
                    Armadillo  -------------atgcacatctgggaaaat---ccca--gct----tgagg-ca----ggggaagacag
              Tasmanian devil  -------------atgggcatctgggaaaat---ccca--gct----tgagg-ca--ggggggaagacag
                X. tropicalis  -------------atgcacacttgtgttgatttcctcc--tcc----tcaga-ac----atgcaaggcat
                   Coelacanth  ctacacacttgatttgttcgtatgtagaagt---attg--gctggtctgaaa-ca----gcaaaagacgg
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================

                        Human  cttagga
                        Chimp  cttagga
                      Gorilla  cttagga
                    Orangutan  cttagga
                       Gibbon  cttagga
                       Rhesus  cttagga
          Crab-eating macaque  cttagga
                       Baboon  cttagga
                 Green monkey  cttagga
                     Marmoset  catagga
              Squirrel monkey  catagga
                     Bushbaby  cttagga
           Chinese tree shrew  cccagga
                     Squirrel  cccagga
       Lesser Egyptian jerboa  cctaggt
                 Prairie vole  cctaggg
              Chinese hamster  cctaggg
               Golden hamster  cctaggg
                        Mouse  cctaggg
                          Rat  cctaggg
               Naked mole-rat  cctagga
                   Guinea pig  cctggga
                   Chinchilla  cctagga
             Brush-tailed rat  cctaaga
                       Rabbit  cccagga
                         Pika  cccggga
                          Pig  cctagga
                       Alpaca  cctagga
               Bactrian camel  cctagga
                      Dolphin  cctagga
                 Killer whale  cctagga
             Tibetan antelope  cctagga
                          Cow  cctagga
                        Sheep  cctagga
                Domestic goat  cctagga
                        Horse  cctagga
             White rhinoceros  cctagga
                          Cat  cctagga
                          Dog  cctagga
                      Ferret   cctagga
                        Panda  cctagga
               Pacific walrus  cctagga
                 Weddell seal  cctagga
             Black flying-fox  cctagga
                Big brown bat  cccagca
         David's myotis (bat)  cccagca
                     Microbat  cccagca
                     Hedgehog  cccagga
                        Shrew  cctagga
              Star-nosed mole  cctagga
                     Elephant  cctagga
          Cape elephant shrew  cccaaga
                      Manatee  cctagga
             Cape golden mole  cccagga
                       Tenrec  cccagga
                     Aardvark  cctagga
                    Armadillo  cccagga
              Tasmanian devil  tccagaa
                X. tropicalis  catggga
                   Coelacanth  a------
               Painted turtle  =======
              Green seaturtle  =======
           American alligator  =======
                       Lizard  =======
             Peregrine falcon  =======
                 Saker falcon  =======
                      Megabat  NNNNNNN
     Chinese softshell turtle  =======

Alignment block 13 of 1399 in window, 53759450 - 53759595, 146 bps 
B D                     Human  ctgttggag--cagacataaatcaagcaccc-agatg------------------c---ccctccc-ct-
B D                     Chimp  ctgttggag--cagacataaatcaagcaccc-agatg------------------c---ccctccc-ct-
B D                   Gorilla  ctgttggag--cggacataaatcaagcaccc-agatg------------------c---ccctccc-ct-
B D                 Orangutan  ctgttggag--cagacataaatcaaacaccc-agatg------------------c---ctctccc-ct-
B D                    Gibbon  ctgttgcag--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
B D                    Rhesus  ctgttggag--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
B D       Crab-eating macaque  ctgttggag--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
B D                    Baboon  ctgttggag--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
B D              Green monkey  ctgttggag--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
B D                  Marmoset  ctgttggaa--cagacataaatcaaacaccc-agatg---------------cccc---cccaccc-cg-
B D           Squirrel monkey  ctgttggaa--cagacataaatcaaacaccc-agatgcccaccccccccccccccc---cccaccc-cgc
B D                  Bushbaby  ctgttggaa--cagatataaatcaaacactc-agatc------------------c---ccctccc-ct-
           Chinese tree shrew  ctgttggaa--cagacataaatcaaataccc-agatg------------------c---ccctccc-ct-
B D                  Squirrel  ctgttggaa--cagacataaatcaaacaccc-tgatg------------------c---c-ctccc-ct-
       Lesser Egyptian jerboa  ctgttggaa--cacacataaatcaagcaccc-agatg------------------c---ccctccc-ct-
                 Prairie vole  ttgttggaa--cagacataaatcaaatgccc-agttg------------------c---ccctccc-c--
B D           Chinese hamster  ttgttggaa--cagacataaatcaaataccc-agatg------------------c---ccctccc-ct-
               Golden hamster  ctgttggaa--cagatataaatcaaataccc-agatg------------------c---ccctccc-ct-
B D                     Mouse  ttgttggaa--cagatataaatcaagtaccc-agatg------------------c---ctctccc-ct-
B D                       Rat  ttgttggaa--cagacataaatcaagtaccc-agatg------------------c---cgctccc-ct-
B D            Naked mole-rat  ctgttggaa--cagacataaatcaaacactc-agatg------------------c---tcctccc-ct-
B D                Guinea pig  ctgttggaa--cagacataaatcaaacatcc-agaag------------------c---ccctccc-ct-
                   Chinchilla  ctgctggaa--cagacataaatcaaacaccc-agatg------------------t---ccctccc-ct-
             Brush-tailed rat  ctgttggaa--cagacataaatcaaatgccc-ggatg------------------c---ccctcccttt-
B D                    Rabbit  ctgttggaa--gcgacataaatcaaagagcc-agatg------------------c---tgccccg-ct-
B D                      Pika  cggctggaa--ctgacataaatcaagctccc-agatg------------------c---t----------
B D                       Pig  ctgttggaa--caggcataaatcaaacgccc-agagg------------------c---ccgtccc-ct-
B D                    Alpaca  tcgttggaa--cagacataaatcaaacgccc-agatg------------------c---ccctccc-cg-
               Bactrian camel  tcgttggaa--cagacataaatcaaacaccc-agatg------------------c---ccctccc-cg-
B D                   Dolphin  ctgttggaa--cagacataaatcaaacgcac-aaatg------------------c---ccctccc-ct-
                 Killer whale  ctgttggaa--cagacataaatcaaacgtgc-aaatg------------------c---ccctccc-ct-
             Tibetan antelope  ctgttggaa--caggcataaatcaaacaccc-agaag------------------c---ccctccc-ca-
B D                       Cow  ctgttggaa--cagacataaatcaaacaccc-agaag------------------c---ccctccc-ca-
B D                     Sheep  ctgcgggaa--caggcataaatcaaacaccc-agaag------------------c---ctctccc-ca-
                Domestic goat  ctgcgggaa--caggcataaatcaaacaccc-agaag------------------c---ccctccc-ca-
B D                     Horse  ctgttgga------acataaatcaaacaccc-agatg------------------c---ccctccc-ct-
B D          White rhinoceros  ctgttggaa--cagacataaatcacacaccc-agctg------------------c---ccctccc-ct-
B D                       Cat  ctgttggaa--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
B D                       Dog  ctgctggaa--cagacataaatcaaacaccc-agctg------------------c---ccctccc-ct-
B D                   Ferret   ctgttggaa--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
B D                     Panda  ctgttggaa--cggacataaatcaaacaccc-agatg------------------c---ccctccc-tt-
               Pacific walrus  ctgttggaa--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
                 Weddell seal  ctgttggaa--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
             Black flying-fox  ctgttggaa--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
                Big brown bat  cggttggaa--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
         David's myotis (bat)  ctgctggaa--cagacataaatcaaacaccc-agatg------------------c---tcctccc-c--
B D                  Microbat  ctgctggaa--cagacataaatcaaacaccc-agatg------------------c---tcctccc-ct-
B D                  Hedgehog  ctgctgaaa--cagacataaatcaaacaccc-aggtg------------------c---ccctccc-ct-
B D                     Shrew  ctgcaggag--cagacataaatcaagcaccc-agaag------------------c---ccctccc-tg-
              Star-nosed mole  ctgttggaa--cggacataaatcaa--cccc-agatg------------------c---cccccca-cg-
B D                  Elephant  ctgttggaa--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
          Cape elephant shrew  ctgttggaa--cagacataaatcaaacaccc-agctg------------------c---ccct-cc-ct-
B D                   Manatee  ctgttggaa--cagacataaatcaaacaccc-agatg------------------c---ccctccc-ct-
             Cape golden mole  ctgttggaa--cagatataaatcaaataccc-agata------------------c---ccctccc-ct-
B D                    Tenrec  ctgctgga----agacataaatcacacactc-caagg------------------c---cccgccc-c--
                     Aardvark  ctgttggaa--cagacataaatcaaacaccc-agatg------------------c---ccttccc-ct-
B D                 Armadillo  ctgttggag--gagacataaatcaaaaaccc-agatg------------------c---ccct-cc-ct-
B D           Tasmanian devil  ctgctagca--tat-cataaatcaaaaagtcaagttg------------------c---tcctccc-tt-
B D                Coelacanth  ccacagaaaggaaggcaaaaacagaagactg-acgtg------------------cattctcctcc-tt-
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================

                        Human  -actgttc-tgtcattagagc--------------catccttccaattcctgcc--t------gtctc--
                        Chimp  -actgttc-tgtcattagagc--------------catccttccaattcctgcc--t------gtctc--
                      Gorilla  -actgttc-tgtcattagagc--------------catccttccaattcctgcc--t------gtctc--
                    Orangutan  -actgttc-tgtcattacagc--------------catccttccaattcctgcc--t------gtctc--
                       Gibbon  -actgttc-tgtcattacagc--------------catccttccaattcctgcc--t------gtctc--
                       Rhesus  -actgttc-tgtcattacagc--------------catccttccaattcctgcc--t------gtctc--
          Crab-eating macaque  -actgttc-tgtcattacagc--------------catccttccaattcctgcc--t------gtctc--
                       Baboon  -actgttc-tgtcattacagc--------------catccttccaattcctgcc--t------gtctc--
                 Green monkey  -actgttc-tgtcattacagc--------------catccttccaattcctgcc--t------gtctc--
                     Marmoset  -actgttc-tgccatgacagc--------------catccttctaattcctgcc--t------gtctc--
              Squirrel monkey  cactgttc-tgtcatgacagc--------------catccttctaattcctgcc--t------gtctc--
                     Bushbaby  -gctgttc-tgtcattagagc--------------catccttccaattcctgcc--t------gtctc--
           Chinese tree shrew  -actgatc-tgtcgttacagc--------------catccttccaattcttgcc--t------gtctc--
                     Squirrel  -accgttc-tgtccttacagc--------------catccttccaatgcctgcc--t------gtctc--
       Lesser Egyptian jerboa  -actgttc-cgtccttacaac--------------catccttccaatgcctgcc--t------gtctc--
                 Prairie vole  -accaccc-tttcctcaca----------------cgt-cttccaatgcctgcc--t------agtcg--
              Chinese hamster  -accaccc-tgtcctcgaagc--------------cgt-cttccaatgcctgcc---------atttc--
               Golden hamster  -accaccc-tgtcctcgcaga--------------cat-cttccaatgcctgcc--t------atttc--
                        Mouse  -accaccc-tatccttacagc--------------cat-cttccaatg-ctgcc--t------atttc--
                          Rat  -accatcc-tatccttacagc--------------cat-cttccaacgcctgcc--t------atttc--
               Naked mole-rat  --ctgttc-tgtccttgcagc--------------catccttccaatgcctgcc--t------gtctc--
                   Guinea pig  --ctgttc-tgtccttgcagc--------------catccttccaatgcctgcc--c------atctc--
                   Chinchilla  --ctgttc-tgtccttgcagc--------------catccttccaatgcctgcc--g------gtctg--
             Brush-tailed rat  --ctgttc-tgtccttgcagc--------------catccttctgatgcctgcc--t------gtctc--
                       Rabbit  ------gc-ctgccctgcagc--------------cag-cctcccatgcctgcc--t------gtcgc--
                         Pika  ------------ccctgca----------------ctg-cctgccatggctatc--t------gcagc--
                          Pig  -cctgttc-tgtcagcacagc--------------cct--------------cc--t------gtctc--
                       Alpaca  -actgttc-tgtcatcacagc--------------catccttccaatttctgcc--t------gtctc--
               Bactrian camel  -actgttc-tgtcattacagc--------------catccttccaatttctgcc--t------gtctc--
                      Dolphin  -actgttc-tgtcattacaga--------------catccttccaattcctgcc--t------gtctc--
                 Killer whale  -actgttc-tgtcattacaga--------------catccttccaattcctgcc--t------gtctc--
             Tibetan antelope  -actgttc-tgtcattgcagc--------------catcctcccagttcctgcc--t------gtctc--
                          Cow  -actgttc-tgtcattgcagc--------------catccttccagttcctgcc--t------gtctc--
                        Sheep  -actgttc-tgtcattgcagc--------------catccttccagttcctgcc--t------gtctc--
                Domestic goat  -actgttc-tgtcattgcagc--------------catccttccagttcctgcc--t------gtctc--
                        Horse  -actgttc-tgtctttacagc--------------cgtctctccaattccttccaat------tcctc--
             White rhinoceros  -actgttc-tgtcattacagc--------------catccttccaatgcccgcc--t------gtctc--
                          Cat  -actgttc-tgtcattacagc--------------catccttccaattcctgcc--t------gtctc--
                          Dog  -acggttc-tgtcattgcagc--------------catcctttcaactcctgcc--t------gtctc--
                      Ferret   -accgtgc-tgtcattacagc--------------catgcttccaattcctgcc--t------gtctc--
                        Panda  -actgttc-tgtcatcacagc--------------catccttccaattcctgcc--t------gtctc--
               Pacific walrus  -actgttc-tgtcattacagc--------------catccttccaattcctgcc--t------gtctt--
                 Weddell seal  -actgttc-tgtcattacagc--------------catccttccaattcctgcc--t------gtctc--
             Black flying-fox  -actgctc-tgtcattacagc--------------catctttccaactgctgcc--t------gtctc--
                Big brown bat  -tcggttc-tgtcatcacagc--------------cattgttccaactcctgcc--t------gtctg--
         David's myotis (bat)  -tctgttc-tgtcattacagc--------------cattgttccaattcctgcc--t------gtctg--
                     Microbat  -tctgttc-tgtcattacagc--------------cattgttccaattcctgcc--t------gtctg--
                     Hedgehog  -cctgctc-tgtcattccaga--------------catcttccccattccagcc--t------gtctc--
                        Shrew  -acggttc-tgtcattaccgc--------------catccttcccggtcccgct--g------ctctc--
              Star-nosed mole  -------t-tgtcattacagc--------------catcctgcccgcgcctgca--t------gtccc--
                     Elephant  -actgttt-tgtcattacagc--------------catcgttccaatccctgct--t------gtctc--
          Cape elephant shrew  -gctgttc-tgtcattaaggc--------------catagttttaattcctgtc--t------gtctc--
                      Manatee  -actgttt-tgtcattacagc--------------catctttccaaatcctgct--t------gtctc--
             Cape golden mole  -actgttc-tgtcattacagc--------------catctttccaattcctgcc--t------gtctc--
                       Tenrec  -accgttc-tgtcctgacag---------------cgccctttcaattcctgcc--tatctccatctc--
                     Aardvark  -actgttc-tgtcattacagc--------------catcgttccaattcctgcc--t------gtctcct
                    Armadillo  -actgttc-tgtcattacaac--------------catccctccaattcctgtc--t------gtctg--
              Tasmanian devil  -cccattcttgtcactacatcttctattgaaggttcacccttcccttttttgac--t------ttttg--
                   Coelacanth  -gtgacac-ttttactaaaaa--------------cgtttcctggttttgtgcc--a------tatcc--
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================

                        Human  -ctttgcct-ctaggca---tcc-tg---gc-----tctatag---tcttg--actgggg--cc------
                        Chimp  -ctttgcct-ctaggca---tcc-tg---gc-----tctgtag---acttg--actgggg--cc------
                      Gorilla  -ctttgcct-ctaggca---tcc-tg---gc-----tctgtag---tcttg--actgggg--cc------
                    Orangutan  -ctttgcct-ctaggca---tcc-tg---gc-----tctgtag---tcttg--actgggg--cc------
                       Gibbon  -ctttgcct-ctaggca---tcc-tg---gc-----tctgtgg---tcttg--actgggg--cc------
                       Rhesus  -ctttgcct-ctaggca---tct-tg---gc-----tctgtag---tcttg--actgggg--cc------
          Crab-eating macaque  -ctttgcct-ctaggca---tct-tg---gc-----tctgtag---tcttg--actgggg--cc------
                       Baboon  -ctttgcct-ctaggca---tcc-tg---gc-----tctgtag---tcttg--actgggg--cc------
                 Green monkey  -ctttgcct-ctaggca---tcc-tg---gc-----tctgtag---tcttg--actgggg--cc------
                     Marmoset  -ctttgcct-ctaggca---ttc-tg---gc-----tctgtag---tcttg--actgggg--cc------
              Squirrel monkey  -ctttgcct-ctaggca---ttc-tg---gc-----tctgtag---tcttg--actgggg--cc------
                     Bushbaby  -ctttgcct-ctaggcc---ttg-tg---gc-----tctgtat---tcttg--actcggg--ct------
           Chinese tree shrew  -ctttgcct-ccaggag---ttc-tg---gc-----tctgtag---tcttg--actaggg--cc------
                     Squirrel  -ctttgcct-ctgggag---ttc-tg---gc-----tctatag---tctaa--accaggg--cc------
       Lesser Egyptian jerboa  -ctttgcct-ttgcaag----tt-gg---gc-----tctgcag---tctga--actgggg--cc------
                 Prairie vole  -ctttgcct-ccgagaa---ttt-gg---gc-----tctgcag---tccaa--actgggg--cc------
              Chinese hamster  -ctttgcct-ctgaaga-------------------tctgcag---tctga--actgggg--ct------
               Golden hamster  -ctttgcct-ctgaaga---ttt-gg---gc-----tctgcag---tctga--actgggg--ct------
                        Mouse  -ctttgctt-ctcagaa---ttt-gg---tc-----tcggcag---cctga--actgggc--tg------
                          Rat  -ctttgcct-ctgagaa---ttt-gg---tc-----tctgcag---tctga--actgggg--ca------
               Naked mole-rat  -ctgtgcct-ctgggag---ctt-tg---gc-----tctgtca---tccaa--agtggga--ac------
                   Guinea pig  -ctgtgcct-ctggccg---ctc-tg---gt-----tctgtca---cccac--cgtgggg--cc------
                   Chinchilla  -ctgtgcct-ctgggag---ctt-tc---gc-----tctgtca---cccgg--agtgggg--cc------
             Brush-tailed rat  -ctgtgcct-gtgggag---ctt-tg---gc-----tctgtca---tccag--cacgggggacc------
                       Rabbit  -cttcgccc-gggagga---cttggg---gc-----tctagtg---------------------------
                         Pika  -cttcgccc-tgg--------tt--g---gc-----tctaggg---cagga-----ggcg--tc------
                          Pig  -cttggcct-ctaggaa---ttt-tg---gt-----tctgtac---ccttg--gctgggg--cc------
                       Alpaca  -cttcgcct-ctaggaa---ttt-ta---gt-----tctgtac---ccttg--gctggga--cc------
               Bactrian camel  -cttcgcct-ctaggaa---ttt-ta---gt-----tctgtac---ccttg--gctgggg--cc------
                      Dolphin  -ctttgcct-ctaggaa---ttt-tg---gt-----tctgtac---ccttg--gctgggg--cc------
                 Killer whale  -ctttgcct-ctaggaa---ttt-tg---gt-----tctgtac---ccttg--gctgggg--cc------
             Tibetan antelope  -ccttgcct-ctgggaa---ttt-gg---gt-----tctgtac---ccttg--actggga--cc------
                          Cow  -ccttgcct-ctaggaa---ttt-gg---gt-----tctgtac---ccttg--actggga--cc------
                        Sheep  -ccttgcct-ctaggaa---ttt-gg---gt-----tctgtac---ccttg--actggga--cc------
                Domestic goat  -ccttgcct-ctaggaa---ttt-gg---gt-----tctgtac---ccttg--actgcga--cc------
                        Horse  -ctttgcct-ctaggaa---ttt-tg---gc-----tctggag---tctgg--gctgggg--cc------
             White rhinoceros  -ctttgcct-ctaggaa---ttt-tg---gc-----tctgtcg---tcttg--gctgggg--cc------
                          Cat  -ctttgccc-ctaggaa---ttt-tg---gc-----tccgtag---tcctg--gct-ggg--cc------
                          Dog  -ctttgcct-ctaggac---ttt-tg---gc-----tctgtcg---tctag--gct-ggg--cc------
                      Ferret   -ctctgcct-ctaggaa---ttt-tg---gc-----tttatag---tcttg--gct-ggg--cc------
                        Panda  -ctttgcct-ctaggaa---ttt-tg---gc-----tctgtag---tcttg--gct-ggg--cc------
               Pacific walrus  -ctttgcct-ctaggaa---ttt-tg---gc-----tctggag---tcttg--cct-ggg--cc------
                 Weddell seal  -ctttgcct-ctaggaa---ttt-tg---gc-----tctgtag---tcttg--cct-ggg--cc------
             Black flying-fox  -ctttgcct-ctaggaa---ttt-tg---gc-----tccgcag---tcttg--gctgggg--cc------
                Big brown bat  -cgttgcct-ctaggaa---ttt-tg---gc-----tctgtcg---tcttg--gctgggg--cc------
         David's myotis (bat)  -ctttgcct-ctaggaa---ttt-tg---gc-----tctgtag---tcttg--gctgggg--cc------
                     Microbat  -ctttgcct-ctaggaa---ttt-tg---gc-----tctgtag---tcttg--gctgggg--cc------
                     Hedgehog  -ctgtgccg-ccgag--------------gc-----tctgtgg---ccttg--gcagagg--cc------
                        Shrew  -cc-tggcgtctgagga---ttt-tgcctgc-----actg-gg---gcttg--gctgggg--cc------
              Star-nosed mole  -ct-ttctg-ctaacag---ctg-tg---gc-----tctgtgg---tcttg--gctgggc--cc------
                     Elephant  -ctttgcct-caaggaa--tttt-tg---gc-----tctgttg---tcttg--actggga--cc------
          Cape elephant shrew  -ctttgctt-acaggag--tttc-tg---gt-----tccatat---tctta--actgggt--cc------
                      Manatee  -ctttgcct-ctagaaa--tttt-tg---gc-----tctgttg---tcttg--actggga--tc------
             Cape golden mole  -ctttgccc-ctagga----ctt-tt---tg-----actgtag---ttttg--actggaa--cc------
                       Tenrec  -ctttgcct-caggag----ctt-gg---gc-----tctctag---tcttg--actggga--cc------
                     Aardvark  tctttgcct-ctaggagtttttt-tg---cc-----tctatag---tctta--actggga--cc------
                    Armadillo  -ctttgcct-ctaggag---ttt-tg---gc-----tctgtct---tcttg--accgggg--cc------
              Tasmanian devil  -tgtgatct-------g---tac-tg---tc-----tccttacttttcctg--tctaggg--gctgatta
                   Coelacanth  -cccccccc-ccaggtg---tca-ta---ctgaccatctgtgt---actgggtactgagt--cc------
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================

                        Human  ac-tca--------tc------cactaccc
                        Chimp  ac-tca--------tc------cactaccc
                      Gorilla  ac-tca--------tc------cactaccc
                    Orangutan  ac-tca--------tc------cactaccc
                       Gibbon  ac-tca--------tc------cactaccc
                       Rhesus  ac-tca--------tc------cactaccc
          Crab-eating macaque  ac-tca--------tc------cactaccc
                       Baboon  ac-tca--------tc------cactaccc
                 Green monkey  ac-tca--------tc------cactaccc
                     Marmoset  ac-tca--------tc------cactaccc
              Squirrel monkey  ac-tca--------tc------cactaccc
                     Bushbaby  ac-tca--------tc------cactcctc
           Chinese tree shrew  ac-tca--------gc------cact-ccc
                     Squirrel  ac-ttg--------tccaatg-cctagctc
       Lesser Egyptian jerboa  ac-ttattcactgcccaccat-tgctgccc
                 Prairie vole  gc-tca--------cctggactcctcatcc
              Chinese hamster  gt-tca--------cctggac-cctcatcc
               Golden hamster  gc-tca--------cctggac-cctcatcc
                        Mouse  gc-tta--------cca-----tcatgtcc
                          Rat  gc-gcc--------cca-----tcatgtcc
               Naked mole-rat  ac-tca--------gc------cactgccc
                   Guinea pig  ag-tca--------gc------ccctgctc
                   Chinchilla  ag-tca--------gc------cactgccc
             Brush-tailed rat  at-tca--------gc------cactgtcc
                       Rabbit  ---cca--------c-------ccct----
                         Pika  gc-cca--------c-------ccctgccc
                          Pig  ac-tca--------tc------cactaacc
                       Alpaca  ac--ca--------tc------cactaccc
               Bactrian camel  ac--ca--------tc------tactaccc
                      Dolphin  aa-tca--------tc------cagtatcc
                 Killer whale  ac-tca--------tc------cagtatcc
             Tibetan antelope  ccctcg--------tc------cactgcct
                          Cow  ccttcg--------tc------cactaccc
                        Sheep  ccctca--------tc------cactgcct
                Domestic goat  ccctcg--------tc------cactgccc
                        Horse  ac-tca--------tc------tgctaccc
             White rhinoceros  ac-tcg--------tc------cactaccc
                          Cat  ac-tca--------cc------cactaccc
                          Dog  cc-tct--------tc------cactgccc
                      Ferret   ac-tca--------tc------cactgccc
                        Panda  ac-tcatctg----tc------cactgccc
               Pacific walrus  ac-tca--------tt------cgctgccc
                 Weddell seal  ac-tca--------tt------cactgccc
             Black flying-fox  ac-tca--------tc------cactaccc
                Big brown bat  ac-tca--------tc------cactcccc
         David's myotis (bat)  ac-tca--------tc------tactaccc
                     Microbat  ac-tca--------tc------taccaccc
                     Hedgehog  gc-tcg--------cc------cactgccc
                        Shrew  ac-tca--------gc------c---gccc
              Star-nosed mole  a-----------------------------
                     Elephant  ac-tca--------tt------cactcctt
          Cape elephant shrew  tc-tca--------tt------ccctcccc
                      Manatee  ac-tca--------tt------cactcccc
             Cape golden mole  ac-tca--------tt------cactcccc
                       Tenrec  tc-tca--------gt------cactcccc
                     Aardvark  ac-tca--------tt------cactcccc
                    Armadillo  ac-tta--------ct------cactgccc
              Tasmanian devil  gc-tcc--------tc------atccaccc
                   Coelacanth  gc-tgt--------at------tggtaccc
               Painted turtle  ==============================
              Green seaturtle  ==============================
           American alligator  ==============================
                       Lizard  ==============================
             Peregrine falcon  ==============================
                 Saker falcon  ==============================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ==============================

Alignment block 14 of 1399 in window, 53759596 - 53759619, 24 bps 
B D                     Human  agcgtagtg-ccaggctcaaaggag
B D                     Chimp  agcgtagtg-ccaggcacaaaggag
B D                   Gorilla  agcgtagtg-ccagacacaaaggag
B D                 Orangutan  agcatagtg-ccaggcacaaaggag
B D                    Gibbon  agcgtagtg-ccaggcccaaaggag
B D                    Rhesus  agcgtagtg-ccaggcacaaaggag
B D       Crab-eating macaque  agcgtagtg-ccaggcacaaaggag
B D                    Baboon  agcgtagtg-ccaggcacaaaggag
B D              Green monkey  agcgtagtg-ccaggcacaaaggag
B D                  Marmoset  agcatcgtg-ccaggcacaaaggag
B D           Squirrel monkey  agcatcgtg-tcaggcacaaaggag
B D                  Bushbaby  agcacagtg-cccaggacaaaggag
           Chinese tree shrew  agcctagtg-cca-gcacaaaagag
B D                  Squirrel  agt--------------ccatggag
       Lesser Egyptian jerboa  aca--------------tagaaaa-
                 Prairie vole  a------------------------
B D           Chinese hamster  agg--------------ctgagga-
               Golden hamster  agg--------------ctgagga-
B D                     Mouse  agg--------------atgagga-
B D                       Rat  agg--------------atgagga-
B D            Naked mole-rat  agtgtgggg-ccttgcactaaggag
B D                Guinea pig  agc-tggtg-tcttgtaccaaggag
                   Chinchilla  tgcgtagtg-tcttgcaccaaggag
             Brush-tailed rat  tgcatagtg-tcttgcaccaaggag
B D                    Rabbit  --------------gcgcgactgag
B D                      Pika  agtccggag-cccagcacgatggag
B D                       Pig  agcatagtg-cttggaacccaggag
B D                    Alpaca  agcctagtg-cttgggacaaaggag
               Bactrian camel  agcctagtg-cttgggacaaaggag
B D                   Dolphin  agcatagtg-cctgaaacaaaggag
                 Killer whale  agcatagtg-cctgaaacaaaggag
             Tibetan antelope  ggcgtagtg-tctgggataaaggag
B D                       Cow  ggcatagtg-tctggaataaaggag
B D                     Sheep  ggcgtagtg-tctggaataaaggag
                Domestic goat  ggcgtagtg-tctggaataaaggag
B D                     Horse  agcagggtg-cctggaaccaaggag
B D          White rhinoceros  agcatggtg-cctggaaccaaagag
B D                       Cat  agcgtagtg-cctggaacaaaggag
B D                       Dog  acaatagcg-cctgggacaaaggac
B D                   Ferret   agaataggg-cctggaataaaggag
B D                     Panda  agaataggg-cctggaacaaaggag
               Pacific walrus  agaataggg-cctggaacaaaggag
                 Weddell seal  agaatagtg-cctggaacaaaggag
             Black flying-fox  agcatagcg-ctcgaaacaaaggag
                Big brown bat  agcaaaggg-cctggaacaaaggag
         David's myotis (bat)  aggatcgtg-cctggaacaaaggaa
B D                  Microbat  agcatcgtg-cctggaacaaaggag
B D                  Hedgehog  ggcatgaca-cctggcactgtggag
B D                     Shrew  agcactgcc-cctggaaca-aggaa
              Star-nosed mole  ggcagaggg-cctgggacagaggag
B D                  Elephant  agcatagtg-cctggcacaaaagg-
          Cape elephant shrew  agtctggtg-tgtggcacaaatgg-
B D                   Manatee  agcataggg-cctggtacaaaggg-
             Cape golden mole  agcttattg-cctgctacaaaggg-
B D                    Tenrec  ggcctagtgtccccctgcaaagtgg
                     Aardvark  ggaatagtg-cctgaca--------
B D                 Armadillo  agcatagtg-cctggcacaaaagg-
B D           Tasmanian devil  aaattgggg-attggtatgagggag
  D            Painted turtle  =========================
  D           Green seaturtle  =========================
B D        American alligator  =========================
B D                    Lizard  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  =========================

Inserts between block 14 and 15 in window
B D                   Tenrec 12bp
B D          Tasmanian devil 9986bp

Alignment block 15 of 1399 in window, 53759620 - 53759763, 144 bps 
B D                     Human  gt-gctcagt-----t-aatgccctt---ggtccatgt------ct-aat-aga---gaagcactatcgc
B D                     Chimp  gt-gctcagt-----t-aatgccctt---ggtccatgt------ct-aat-aga---gaagcactatcgc
B D                   Gorilla  gt-gctcagt-----t-aatgccctt---ggtccatgt------ct-aat-aga---gaagcactatcgc
B D                 Orangutan  gt-gctcagt-----t-aatgccctt---ggtccatgt------ct-aat-aga---gaagcactatggc
B D                    Gibbon  gt-gctcagt-----t-aatgccctt---ggttcatgt------ct-aat-aga---gaagcactgtggc
B D                    Rhesus  gt-gctcagt-----t-aatgccctt---ggtccatgt------ct-aat-aga---gaagcactatggc
B D       Crab-eating macaque  gt-gctcagt-----t-aatgccctt---ggtccatgt------ct-aat-aga---gaagcactatggc
B D                    Baboon  gt-gctcagt-----t-aatgccctt---ggtccatgt------ct-aat-aga---gaagcactat---
B D              Green monkey  gt-gctcagt-----t-aatgccctt---ggtccatgt------ct-aat-aga---gaagcactatggc
B D                  Marmoset  gt-gctcagt-----t-aataccctt---ggcccatgt------ct-aat-aga---gaagcactagagc
B D           Squirrel monkey  gt-gctcagt-----t-aatgccctt---ggcccaggt------ct-aac-aga---gaagcactagagc
B D                  Bushbaby  gt-gctcagt-----t-aatgccctt---ggtccacgt------ca-aat-aga---gaagtgata-ggc
           Chinese tree shrew  gt-gctcaat-----t-aaggacctc---ggtccatgt------ct-aat-gca---tatgcagtagggc
B D                  Squirrel  gt-gctcaat-----t-aatgtccttaa-agttaatgt------ct-agc-aga---agagtgttagggt
       Lesser Egyptian jerboa  gt-gcccagc--taat-aatgccttt---ggtccatga------cttaac-aca---gactc-ttacggc
                 Prairie vole  ------cagc-----c-aaagtcctt---gatccacgg------ct--ac-tga---gaagc-ctagggt
B D           Chinese hamster  gt-cctcagc-----t-aatgtcctt---ggtccac-----------------------agc-ttagcac
               Golden hamster  gc-ccttagc-----t-aatgtcctt---ggtccac-----------------------agc-ttagcgc
B D                     Mouse  gt-tcttagc-----t-aatgtcctt---gatccatag------ct-aac-taa---gaagc-ttagggt
B D                       Rat  gt-ccttagc-----t-aatgtcctt---gatccatag------ct-aac-tga---gaagc-ttagggt
B D            Naked mole-rat  at-gctcagt-----t-aatgccctt---ggtccatgt------ct-aac-gga-----agtgggagggc
B D                Guinea pig  gt-gctcatt-----t-aatggcttt---ggtacacat------tg-aac-tga---gaagtgggaggac
                   Chinchilla  gt-gctcagc-----t-gatggcctt---ggtccacgt------ct-aac-agaagtgggaggggagggc
             Brush-tailed rat  gt-gctcagt-----t-cct-gtttt---gggccatgt------ct-aat-aga---gaagtgggagggc
B D                    Rabbit  gg-gccc-----------atgccctg--------------------------------------------
B D                      Pika  gg-tcac--t-----t-gctgccctt--------------------------------------------
B D                       Pig  gt-gctcagt-----t-aatgct---------c-atgc------ct-gat-gga---gacgcatgagggc
B D                    Alpaca  gt-actcaat-----t-aatgct---------ccatgc------tg-gat-gga---gatgcattagggg
               Bactrian camel  gt-gctcaat-----t-aatgct---------ccatgc------cg-gat-gga---gatgcattagggg
B D                   Dolphin  gc-gctcagt-----taaatgct---------ctatgc------cc-ggcagga---gacgcgttagggc
                 Killer whale  gc-gctcaat-----t-aatgct---------ctatgc------ct-ggcagga---gacgcgttagggc
             Tibetan antelope  gt-gttc----------agtgct---------ctatgc------ct-gat-gga---ggtgtattagggc
B D                       Cow  gt-gttcaat-----t-aatgct---------ctatgc------ct-gat-gga---gacgtattagggc
B D                     Sheep  gt-gttcaat-----t-aatgct---------ctatgc------ct-gat-gga---ggcgtattagggc
                Domestic goat  gt-gttcaat-----t-aatgct---------ctatgc------ct-gat-gga---ggcgtattagggc
B D                     Horse  ct-gctcaat-----t-aatgcccct---ggtcaaagc------c----t-gga---gtcgtgtttgggc
B D          White rhinoceros  gt-gctcagt-----t-aatgccctt---ggtccatgc------ct-aat-gga---gtcgtgttcgggc
B D                       Cat  gt-gctcagt-----t-aataccttt---tgtccatgc------ct-aat-gga---gatgtgtt-gggc
B D                       Dog  gt-gctcagc-----t-aatgccttt---ggtccatgc------ct-gat-gga---ggcgtgtgacggc
B D                   Ferret   gt-gctcctt-----t-aatgccttt---ggtccgtgc------ct-cac-gga---gatgtgtgagagc
B D                     Panda  gt-gctcagt-----t-aatgccttt---ggtccatgc------ct-aat-gga---gatgtgtgagagc
               Pacific walrus  gt-gctcagt-----t-aatgccttt---ggtccatgc------ct-cat-gga---gatgtgtgagggc
                 Weddell seal  gt-gctcaat-----t-aatgccttt---ggtccatgc------ct-cat-gga---gatgtgtgagggc
             Black flying-fox  gt-gttcaat-----t-agtgct---------tcatgc------ct-aat-g--------------gtgc
                Big brown bat  gt-gctcaac-----t-aatgcc---------ccacgc------ct-cct-gga---gatgcattagggc
         David's myotis (bat)  gt-gctcaat-----t-aatgcc---------ccacgc------ct-aat-gga---gccgcattagggc
B D                  Microbat  gt-gctcaat-----g-aatgct---------ccacgc------cc-aat-gga---gccgcattagggc
B D                  Hedgehog  gc-actcagt-----t-accagcctt---ggtccacgcctgatagc-ggt-gtg---gtagagagggggc
B D                     Shrew  g--actcggt-----t-cacggccct---ggcccgtg-------ac-cgt-ggg---ggtgcg-cagggc
              Star-nosed mole  g--gctcagtgatgcc-ctccgtcct---ggtgagtg-------gg-gtg-ggg---gttggg-gagggt
B D                  Elephant  gt-gcttaat-----t-aatgctctt---ggtcaatgt------ct-aaa-gga---ga--cattagggc
          Cape elephant shrew  gt-gctcagc-----t-aatgccctt---gatcaatgt------ct-gat-gga---ga--cgttaaggc
B D                   Manatee  gt-gctcaat-----t-aatgccctt---ggtcaatgt------ct-aat-gga---ga--cattagggc
             Cape golden mole  at-gctcagt-----t-aatgtcctc---tgtcaatgt------ct-aat-gga---ga--cattaggac
B D                    Tenrec  gt-gttcagt-----g-aatgtcctt---ggtcaatgt------ct-aat-gga---ga--aatatgggt
                     Aardvark  ------tagt-----t-aatgccctt---ggtcaatgt------ct-agt-gga---gc--cattagagc
B D                 Armadillo  gtcgctcagt-----t-aatgccctc----atctatgt------cc-aat-gga---gaagagttagggg
B D           Tasmanian devil  at-actcagc-----t-cctcactttccttttcttcat------gt-acc-aga---ttagctctaaaga
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================

                        Human  aaa----gtca--------at-gtg-atgttta-gg--ttt----ttctcagttggcaattctt------
                        Chimp  aaa----gtca--------at-gcg-atgttta-gg--ttt----ttctcagttggcaattctt------
                      Gorilla  aaa----gtca--------at-gtg-atgttta-gg--ttt----ttctcagttggcaattctt------
                    Orangutan  aaa----gtca--------at-gtg-atgttta-gg--ttt----ttctcagttggcaattctt------
                       Gibbon  aaa----atca--------at-gtg-atgttta-gg--ttt----ttctcagttggcaattctt------
                       Rhesus  aaa----gtca--------at-gtg-gtgttta-gg--tgt----ttctcaggtggcaattctt------
          Crab-eating macaque  aaa----gtca--------at-gtg-gtgttta-gg--tgt----ttctcaggtggcaattctt------
                       Baboon  -------gtca--------at-gtg-gtgttta-gg--tgt----ttctcaggtggcaattctt------
                 Green monkey  aaa----gtca--------at-gtg-gtgttta-gg--ttt----ttctcaggtggcaattctt------
                     Marmoset  aag----gtca--------at-gtg-atgttta-gg--ttt----ttctcagtaggcaattctt------
              Squirrel monkey  aag----gtca--------at-gtg-atgttta-gg--gtt----ttctcagtgggcaattctt------
                     Bushbaby  agg----gcca--------at-gtg-aatttta-gg--ttt----ccttcagctgacagttctt------
           Chinese tree shrew  agg----gtcc--------at-gtgttttttta-gg--ttt----ttctcagtgggt--ttctt------
                     Squirrel  agg----gtca--------gt-gga-attttta-gg--att----ttctt-ggttgagtc--tt------
       Lesser Egyptian jerboa  agg----gtta--------gt-gtg-attgtcc-t------------------cagaggatctt------
                 Prairie vole  agg----gcca--------gc-gtg-gtttacc-ag--gtt-----cctc-actcgagga----------
              Chinese hamster  agg----gtca--------gc-c-a-gtttatc-ag--ctt-----cctc-act---gga----------
               Golden hamster  agg----gtca--------gc-ctg-gtttatc-ag--ctt-----cctc-acttgaggg----------
                        Mouse  agg----gtca--------gt-gtg-gtttatc-ag--act------------tggaggt----------
                          Rat  agg----gtca--------gt-gtg-gtttatc-ag--act------------tggaggt----------
               Naked mole-rat  agg----gtca--------ct-atg-attttta-gg--ttt----tccta-gttggag-ggctt------
                   Guinea pig  agt----gtca--------ctatag-attttta-ga--ttt----tccta-gttggaggggctt------
                   Chinchilla  ggg----gtca--------ct-ctg-attttta-gg--ttt----tccta-gctggaggggctt------
             Brush-tailed rat  agg----gtca--------ct-cgg-attttta-gg--ttt----tccta-gttgcagaagctt------
                       Rabbit  ----------------------ggg-attctcg-gg--tct----ccctt-ggtggtg------------
                         Pika  ----------------------gga-gttctca-gg--gtt----tcctt-ggtggcag-----------
                          Pig  agg----gtca-----------gtg-ctttttc-ggctttc----tcctcggttggaggttctt------
                       Alpaca  aag----gtca-------------g-agtttta-gg--ttt----tcctgttttggaggttctt------
               Bactrian camel  aag----gtca-----------ctg-agtttta-gg--ttt----tcctcttttggaggttctt------
                      Dolphin  agg----gtca-----------atg-acttttc-gc--ttt----tcctcagttggaggttctt------
                 Killer whale  agg----gtca-----------atg-acttttc-gg--ttt----tcctcagttggaggttctt------
             Tibetan antelope  agg----gtcg-----------gtg-gctttgc-gg--ttt----tcttcagttgggaatcctt------
                          Cow  agg----gtcg-----------gtg-gctttga-gg--ttt----tcttcagctgggagtcctt------
                        Sheep  agg----gtcg-----------gtg-gctttgc-gg--ttt----tcttcagttgggagtcctt------
                Domestic goat  agg----gttg-----------gtg-gctttgc-gg--ttt----tcttcagttgggagtcctt------
                        Horse  agg----gaca--------at-gtg-atcttca-gg--ctt----tcctcagctgggggctctt------
             White rhinoceros  agg----gtca--------at-gcg-atcttca-gg--ttt----tccttggttggtggttctt------
                          Cat  agg----gtcc--------at-gca-attttaa-gg--ttt----tcctcagttggaggttctt------
                          Dog  aag----gtca--------at-gcg-attttta-gg--ttt----tcctcagttggaggttctt------
                      Ferret   agg----gtca--------at-gtc-attttca-gg--ttt----tcctcagttagaggttctt------
                        Panda  agg----gtca--------at-gtg-attttta-gg--ttt----tcctcagttggaggttttt------
               Pacific walrus  agg----gtca--------at-gta-atttgta-gg--ttt----tcctcagttggaggttctt------
                 Weddell seal  agg----gtca--------at-gtc-atttgta-gg--ttt----tcctcagttggaggttctt------
             Black flying-fox  agg----gtcg--------at-gtg-attttta-tg--ttt----tcctca---gtttcctctt------
                Big brown bat  agg----gtca--------at-gtg-atgttta-gg--ttt----tcctca-ttggaggttctt------
         David's myotis (bat)  agg----gtgt--------at-gtg-attttta-gg--ttt----tcctca-tcggaggttctt------
                     Microbat  agg----gtct--------at-gtg-attttta-gg--ttt----ccctca-tcggaggttctt------
                     Hedgehog  a------------------ct-gtg-actggca-gg--ttt----ttctcagctg-gagttctt------
                        Shrew  agg----gccacatgttctgt-ggg-attggct-cc--ctt----gt---------gagttctt------
              Star-nosed mole  a------------------gt-ggg-------------ctt----tt---------ggggtcttgcagag
                     Elephant  tag----gtca--------at-aca-a-tttta-gg--ttt----tcctcagttggaggttctt------
          Cape elephant shrew  cag----atca--------at-aga-a-ctgta-gg--ctt----accttagttggggattctt------
                      Manatee  tag----gtca--------at-aca-a-tttta-gg--ttt----tcctcagttggaggttctt------
             Cape golden mole  ttg----atca--------at-gca-a-ttgta-g----------ttctcagttggaggttctt------
                       Tenrec  gag----gcca--------at-aca-g-cttta-gg--gtcccccccaccagttggaggttctt------
                     Aardvark  tag----gtca--------tt-aca-a-tttta-gg--ttt----tcctcagttggtggttctt------
                    Armadillo  agg----caca--------ag-gca-attttta-gg--ttt----tcctcagatg----ttctt------
              Tasmanian devil  aagtcttgctg--------at-act-atctccacag--tat----ctcttggat--taatcccc------
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================

                        Human  -t-------------------gt--gaga--tctgg-ag--ca---a------------ttctctc----
                        Chimp  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctctc----
                      Gorilla  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctctc----
                    Orangutan  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctctc----
                       Gibbon  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctctc----
                       Rhesus  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctctc----
          Crab-eating macaque  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctctc----
                       Baboon  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctgtc----
                 Green monkey  -t-------------------ct--ggga--tctgg-ag--ca---a------------ttctctc----
                     Marmoset  -t-------------------ct--gaga--tctgg-ag--ca---g------------ttctctc----
              Squirrel monkey  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctctc----
                     Bushbaby  -t-------------------ct--gcgg-----------------------------------------
           Chinese tree shrew  -ttctctttcttttttcccccct--gcga--tctgg-ac--aattta------------tttttct----
                     Squirrel  -t-------------------ct--gaga--ctggg-ag--cc---a------------ttctttc----
       Lesser Egyptian jerboa  -t-------------------ct--gaga--tgtgg-ag--aa---a------------t----------
                 Prairie vole  -g-------------------ct--tagc--tgtgg-gg--aa---a------------ttctctt----
              Chinese hamster  -g-------------------ct--gagc--tgtgg-gg--aa---a------------ttctctt----
               Golden hamster  -g-------------------ct--gagc--tgtgg-gg--ga---a------------ttctctt----
                        Mouse  -g-------------------ct--gagc--catgg-ggg-aa---t------------ttcaatt----
                          Rat  -g-------------------ct--gagc--catgg-gggaaa---t------------ttctctt----
               Naked mole-rat  -t-------------------tt--gag------------------a-----------tttttttc----
                   Guinea pig  -t-------------------tt--gagt--tctga-aa--tc---a-------tttttttttttt----
                   Chinchilla  -t-------------------tt--gagt--tctga-ag--tg---a------------ttttgtc----
             Brush-tailed rat  -t-------------------tt--gagt--tctga-ag--tg---a-----------tttttttc----
                       Rabbit  ---------------------------------gcg-gg--ct---c------------ttcaccc----
                         Pika  -t-------------------tt--cctt--ctgca-gg--tg---t------------catctcc----
                          Pig  -t-------------------ct--gaga--tcggg-ag--ca---g------------ctccttc----
                       Alpaca  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctttc----
               Bactrian camel  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctttc----
                      Dolphin  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctttc----
                 Killer whale  -t-------------------ct--gaga--tctgg-ag--ca---a------------ttctttc----
             Tibetan antelope  -t-------------------ct--gaga--tctgg-ag--cg---g------------ttctttc----
                          Cow  -t-------------------ct--gaga--tctgg-aa--ca---g------------ttctttc----
                        Sheep  -t-------------------ct--gaga--tctgg-ag--cg---g------------ttctttc----
                Domestic goat  -t-------------------ct--gaga--tctgg-ag--cg---g------------ttctttc----
                        Horse  -t-------------------cc--gaga--tctgg-gg--ca---a------------ttccttc----
             White rhinoceros  -t-------------------ct--gaga--tctgg-gg--ca---a------------ttctttc----
                          Cat  -t-------------------ct--ggga--tctgg-gg--ca---a------------tccttcc----
                          Dog  -t-------------------ct--gaga--tctgg-aa--ca---a------------ttctttc----
                      Ferret   -t-------------------ct--gaga--tctga-ag--ca---a------------tcctttc----
                        Panda  -t-------------------ct--gaga--tctga-ag--ca---a------------tcctttc----
               Pacific walrus  -c-------------------ct--gaga--tctgg-gg--ca---a------------ttctttc----
                 Weddell seal  -t-------------------ct--gaga--tctga-ag--ca---a------------tcctttctttt
             Black flying-fox  -t-------------------ct--gaga--tctag-ag--ca---g------------ttctttc----
                Big brown bat  -t-------------------ct--gaga--gctgg-ag--ca---a------------ttctccc----
         David's myotis (bat)  -t-------------------ct--gaga--gctgg-aa--ca---a------------ttctttc----
                     Microbat  -t-------------------ctgagaga--gctgg-ag--ca---a------------ttctttc----
                     Hedgehog  -t-------------------ct--acaa--tctgg-ag--ca---acgttttcttttttgtttca----
                        Shrew  -t-------------------ct--ctga------------------------------------c----
              Star-nosed mole  at-------------------tt--ctgagatcgga-ag--cg---a----------------ttc----
                     Elephant  -t-------------------ct--gaga--tgtggcca--ca---a------------ttccttt----
          Cape elephant shrew  -t-------------------ct--gaga--gctggcca--ca---a------------ttccttt----
                      Manatee  -c-------------------ct--gaga--tctggcca--ca---a------------ttccctg----
             Cape golden mole  -t-------------------ct--gaga--actggcaa--ca---g------------ttccttt----
                       Tenrec  -a-------------------ct--gaga--tctggcca--ca---g------------ttccttt----
                     Aardvark  -t-------------------tt--gaga--tgtggccg--ca---g------------ttccttt----
                    Armadillo  -t-------------------ct--gaga--tccgagcg--ca---a------------ttcc-tc----
              Tasmanian devil  -a-------------------ct--caca--t-----ag--cc---a------------ctgtcct----
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================

                        Human  -------------------tgctttaatt-------ccaa----ta------t---tatg-----tc---
                        Chimp  -------------------tgctttaact-------ccaa----ta------t---tatg-----tc---
                      Gorilla  -------------------tgctttaatt-------ccaa----ta------t---tatg-----tc---
                    Orangutan  -------------------tgctctaatt-------ccag----ta------t---tatg-----tc---
                       Gibbon  -------------------tgctctaatt-------ccaa----ta------t---tatg-----tc---
                       Rhesus  -------------------tgctctaatt-------tcaa----ta------t---tatg-----tc---
          Crab-eating macaque  -------------------tgctctaatt-------tcaa----ta------t---tatg-----tc---
                       Baboon  -------------------tgctctaatt-------ccaa----ta------t---tatg-----tc---
                 Green monkey  -------------------ttctctaatt-------ccaa----ta------t---tatg-----tc---
                     Marmoset  -------------------tgctctgatt-------ccaa----ta------t---tctg-----tc---
              Squirrel monkey  -------------------tgctctgatt-------ccaa----ta------t---tctg-----tc---
                     Bushbaby  ------------------------taatt-------tcaa----ta------c---tctg-----tc---
           Chinese tree shrew  -------------------ttcttttttt-------agaa----tt------a---tcta-----tt---
                     Squirrel  -------------------tgctctaatt-------ttaa----ta------c---tctg-----tc---
       Lesser Egyptian jerboa  ----------------------------t-------tcag----ta------g---tgtg-----tc---
                 Prairie vole  -------------------tgctgtaggt-------tcag----tg------t---tcca-----tc---
              Chinese hamster  -------------------tgctgtaagt-------ccag----ta------t---tttg-----tc---
               Golden hamster  -------------------tgctgtaagt-------c---------------t---tctg-----tc---
                        Mouse  -------------------tgctcttagt-------ccag----ta------t---ttgg-----tc---
                          Rat  -------------------tgctcttagt-------cctg----ta------t---tcaa-----tc---
               Naked mole-rat  -------------------tgtgccaaat-------tcaa----ta------c---tctt-----tt---
                   Guinea pig  -------------------tgctctaaat-------tcaa----ta------t---tctt-----ta---
                   Chinchilla  -------------------tgctctaaat-------tcag----tc------c---tctt-----ta---
             Brush-tailed rat  -------------------tgctgtaaat-------tcag----tg------c---tctt-----ta---
                       Rabbit  -------------------tgctct------------cag----tg------t---tctg-----tc---
                         Pika  -------------------tgctccactt-------gcag----tg------t---gctt-----ac---
                          Pig  -------------------tgctgcagtg-------tccg----tg------c---tctg----------
                       Alpaca  -------------------tgctccaatg-------tcaa----tg------c---tctgtcttc-----
               Bactrian camel  -------------------tgctccaatg-------tcaa----tg------c---tctgtcttc-----
                      Dolphin  -------------------tactccaatg-------tcagtatctg------t---ttta----------
                 Killer whale  -------------------tactccaatg-------tcagtatctg------t---ttta----------
             Tibetan antelope  -------------------tgctccagtg-------gcag----tg------c---tcta----------
                          Cow  -------------------tgccccagtg-------tcag----tg------c---tgta----------
                        Sheep  -------------------tgctacagtg-------gcag----tg------c---tcta----------
                Domestic goat  -------------------tgctccagtg-------gcag----tg------c---tctg----------
                        Horse  -------------------tgctccagct-------tcaa----tg------c---tctg-----gc---
             White rhinoceros  -------------------tgctccaatt-------tcaa----ag------c---tctg-----tc---
                          Cat  -------------------tgctccaatt-------tcaa----tt------c---tctg-----tc---
                          Dog  -------------------cgctccagtt-------tcaa----tg------c---t--g-----tc---
                      Ferret   -------------------ttctccaatt-------tcga----tg------t---tctg-----tc---
                        Panda  -------------------tgctccaatt-------tcaa----tg------c---tgtg-----tc---
               Pacific walrus  -------------------tgctccaagt-------tcaa----tg------c---tctg-----tc---
                 Weddell seal  ttcttttttcttttttttttattcttatg-------ttaa----tc------c---ccat-----acatt
             Black flying-fox  -------------------tgcttcaatt-------tcca----tg------c---tctg-----cc---
                Big brown bat  -------------------ggctccagtt-------tcca----tatactttc---catg-----tc---
         David's myotis (bat)  -------------------ggctccagtt-------tcaa----catagtttc---aatg-----tc---
                     Microbat  -------------------ggctccagtt-------tcaa----tatagtttc---aatg-----tc---
                     Hedgehog  -------------------tgttctggtgctctgacttag----ta------t---cccc-----t----
                        Shrew  -------------------tgttctggtg-------tcgg----ta------t---tcca-----t----
              Star-nosed mole  -------------------tgctccagtt-------tcga----gg------c---tccc-----t----
                     Elephant  -------------------tgctccaatt-------tcag----ta------ctactctg-----tc---
          Cape elephant shrew  -------------------tgccccaatt-------tcgt----ta------ctac---------tc---
                      Manatee  -------------------tgctccaatt-------tcaa----ta------ctactctg-----tc---
             Cape golden mole  -------------------tgctccaatt-------tcaa----ca------a-----------------
                       Tenrec  -------------------ccctgccatt-------tcaa----ta------atactctg-----tc---
                     Aardvark  -------------------tgctgcaatt-------tcag----ta------ctactctg-----tc---
                    Armadillo  -------------------tgccttaatt-------ccag----cc------a---tctg-----gc---
              Tasmanian devil  -------------------agttcaagtt-attaccaccg----ca------t---cctt----------
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================

                        Human  ------t---tag--t
                        Chimp  ------t---tag--t
                      Gorilla  ------t---tag--t
                    Orangutan  ------t---tag--t
                       Gibbon  ------t---tgg--t
                       Rhesus  ------t---tag--t
          Crab-eating macaque  ------t---tag--t
                       Baboon  ------t---tag--t
                 Green monkey  ------t---tag--t
                     Marmoset  ------t---tag--t
              Squirrel monkey  ------t---tag--t
                     Bushbaby  ------t---ttg--t
           Chinese tree shrew  ------t---tga--t
                     Squirrel  ------t---tag---
       Lesser Egyptian jerboa  ------ttagtag---
                 Prairie vole  ------t---tag---
              Chinese hamster  ------t---tag---
               Golden hamster  ------t---tag---
                        Mouse  ------t---tag---
                          Rat  ------t---tag---
               Naked mole-rat  ------g---tat---
                   Guinea pig  ------g---tgt---
                   Chinchilla  ------g---tat---
             Brush-tailed rat  ------g---cat---
                       Rabbit  ------c---tgg---
                         Pika  ------t---tgg---
                          Pig  ----------------
                       Alpaca  ----------------
               Bactrian camel  ----------------
                      Dolphin  ----------------
                 Killer whale  ----------------
             Tibetan antelope  ----------------
                          Cow  ----------------
                        Sheep  ----------------
                Domestic goat  ----------------
                        Horse  ------c---cag---
             White rhinoceros  ------c---cag---
                          Cat  ------t---tag---
                          Dog  ------t---tag---
                      Ferret   ------t---tag-t-
                        Panda  ------t---tag---
               Pacific walrus  ------t---tag---
                 Weddell seal  acatcat---tagt--
             Black flying-fox  ------t---tag---
                Big brown bat  ------t---tag---
         David's myotis (bat)  ------t---tag---
                     Microbat  ------t---tag---
                     Hedgehog  ----------------
                        Shrew  ----------------
              Star-nosed mole  ----------------
                     Elephant  ------t---tag---
          Cape elephant shrew  ------t---tag---
                      Manatee  ------t---tag---
             Cape golden mole  ----------tag---
                       Tenrec  ------t---tag---
                     Aardvark  ------t---tag---
                    Armadillo  ------t---tag---
              Tasmanian devil  ----------------
               Painted turtle  ================
              Green seaturtle  ================
           American alligator  ================
                       Lizard  ================
             Peregrine falcon  ================
                 Saker falcon  ================
                      Megabat  NNNNNNNNNNNNNNNN
     Chinese softshell turtle  ================

Inserts between block 15 and 16 in window
                Weddell seal 223bp
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 16 of 1399 in window, 53759764 - 53759776, 13 bps 
B D                     Human  atataattagtat
B D                     Chimp  atataattagtat
B D                   Gorilla  atataattagtat
B D                 Orangutan  atataattagtat
B D                    Gibbon  atataattagtat
B D                    Rhesus  atataattagtat
B D       Crab-eating macaque  atataattagtat
B D                    Baboon  atataattagtat
B D              Green monkey  atataattagtat
B D                  Marmoset  atataattagtat
B D           Squirrel monkey  atataattagtat
B D                  Bushbaby  atatatt---tat
           Chinese tree shrew  ctattattattat
B D                  Squirrel  -tataattagtat
       Lesser Egyptian jerboa  ----aattagtat
                 Prairie vole  ----agttaatat
B D           Chinese hamster  ----aattagtat
               Golden hamster  ----aattaatat
B D                     Mouse  ----aattaatat
B D                       Rat  ----aataaataa
B D            Naked mole-rat  ----aattagtat
B D                Guinea pig  ----aaatagtat
             Brush-tailed rat  ----agttagtag
B D                    Rabbit  -tgtcgttagtgt
B D                      Pika  -tgtagttagtgt
B D                       Pig  ----acttggtac
B D                    Alpaca  atatagttagtag
               Bactrian camel  atatagttagtaa
B D                   Dolphin  atacagttagtat
                 Killer whale  atacagttagtat
             Tibetan antelope  atgtaggcagtat
B D                       Cow  atatagtcagtat
B D                     Sheep  atataggcagtat
                Domestic goat  ctataggcagtat
B D                     Horse  -tatggttactat
B D          White rhinoceros  -catagatagtct
B D                       Cat  -tatagttagtat
B D                       Dog  ---tagtcagtgt
B D                   Ferret   -----------at
B D                     Panda  -tatagttaatat
               Pacific walrus  -tatagttagtat
                 Weddell seal  gtatagttagtat
             Black flying-fox  -tatagttagtat
                Big brown bat  -tatagtgggtgt
         David's myotis (bat)  -tatagtttgtat
B D                  Microbat  -tatagtttgtat
B D                  Hedgehog  ----------tct
B D                     Shrew  ------------c
              Star-nosed mole  ------------c
B D                  Elephant  --atagttaccat
          Cape elephant shrew  --agagttcccat
B D                   Manatee  --atagttactat
             Cape golden mole  --gtagttactgt
B D                    Tenrec  --atcattactgt
                     Aardvark  --atagttaacat
B D                 Armadillo  --a----ccttag
B D           Tasmanian devil  ggataattagaac
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D        American alligator  =============
                  Chinchilla  -------------
B D                    Lizard  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
B D                   Megabat  NNNNNNNNNNNNN
  D  Chinese softshell turtle  =============

Inserts between block 16 and 17 in window
          Chinese tree shrew 197bp

Alignment block 17 of 1399 in window, 53759777 - 53759777, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  c
B D                  Bushbaby  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  g
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  g
             Black flying-fox  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  t
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D           Tasmanian devil  a
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
          Chinese tree shrew  =
B D                   Megabat  N
  D  Chinese softshell turtle  =

Inserts between block 17 and 18 in window
            Tibetan antelope 38bp
B D                      Cow 64bp
B D                    Sheep 38bp
               Domestic goat 38bp

Alignment block 18 of 1399 in window, 53759778 - 53759786, 9 bps 
B D                     Human  gactctact
B D                     Chimp  gactctgct
B D                   Gorilla  gactctact
B D                 Orangutan  gactctact
B D                    Gibbon  gactgtgct
B D                    Rhesus  gactctact
B D       Crab-eating macaque  gactctact
B D                    Baboon  gactctact
B D              Green monkey  gactctact
B D                  Marmoset  gactctact
B D           Squirrel monkey  gactctact
B D                  Bushbaby  gattctgtc
B D                  Squirrel  cattatatg
       Lesser Egyptian jerboa  gattctata
                 Prairie vole  ga-------
B D           Chinese hamster  ggctttcta
               Golden hamster  ggctctcta
B D                     Mouse  tgctctgta
B D                       Rat  agctctgta
B D            Naked mole-rat  gatcataag
B D                Guinea pig  gcctgcaag
                   Chinchilla  gactgaaag
             Brush-tailed rat  gactgaaag
B D                    Rabbit  gat--tctg
B D                      Pika  gcctgtctg
B D                       Pig  gactctccc
B D                    Alpaca  gattctacc
               Bactrian camel  aattctacc
B D                   Dolphin  gactccaac
                 Killer whale  gactccaac
B D                     Horse  gaccctctc
B D          White rhinoceros  gactctatc
B D                       Cat  gactccatc
B D                       Dog  gactctgtc
B D                   Ferret   gcttctgtc
B D                     Panda  gactccatc
               Pacific walrus  gactccatc
                 Weddell seal  gactccatc
             Black flying-fox  ga--ctact
                Big brown bat  gaatctacc
         David's myotis (bat)  gaatctacc
B D                  Microbat  gaatctacc
B D                  Hedgehog  gactctacc
B D                     Shrew  ga----gcc
              Star-nosed mole  gatgccacc
B D                  Elephant  g--------
          Cape elephant shrew  g--------
B D                   Manatee  g--------
             Cape golden mole  g--------
B D                    Tenrec  g--------
                     Aardvark  g--------
B D                 Armadillo  g--------
B D           Tasmanian devil  gactcctta
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D        American alligator  =========
B D                    Lizard  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
          Chinese tree shrew  =========
B D                   Megabat  NNNNNNNNN
  D  Chinese softshell turtle  =========
               Domestic goat  =========
B D                     Sheep  =========
            Tibetan antelope  =========
B D                       Cow  =========

Inserts between block 18 and 19 in window
      Lesser Egyptian jerboa 2bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                   Rabbit 2bp
B D                     Pika 2bp
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                 Hedgehog 2bp
B D                    Shrew 2bp
             Star-nosed mole 2bp

Alignment block 19 of 1399 in window, 53759787 - 53759794, 8 bps 
B D                     Human  tcc--a--gagt
B D                     Chimp  tcc--a--gagt
B D                   Gorilla  tcc--a--gagt
B D                 Orangutan  tcc--a--gggt
B D                    Gibbon  tcc--a--ggga
B D                    Rhesus  tcct-a--gggt
B D       Crab-eating macaque  tcct-a--gggt
B D                    Baboon  tcct-a--gggt
B D              Green monkey  tctt-a--gggt
B D                  Marmoset  tccc-a--cggt
B D           Squirrel monkey  tccc-a--cggt
B D                  Bushbaby  tcttca--gagt
           Chinese tree shrew  -ctc-a--gggt
B D                  Squirrel  -----a--gg-c
       Lesser Egyptian jerboa  gct--a--gg-a
                 Prairie vole  -cc--a--gg-c
B D           Chinese hamster  tcc--a--gg-c
               Golden hamster  tcc--a--gg-c
B D                     Mouse  tcc--a--gg-t
B D                       Rat  tcc--a--gg-t
B D            Naked mole-rat  ttc--a--gggt
B D                Guinea pig  tcc--a--gggt
                   Chinchilla  tcc--a--gggc
             Brush-tailed rat  tcc--a--ggag
B D                    Rabbit  tct--gcggg-t
B D                      Pika  cct--a------
B D                       Pig  ttc--a--cggt
B D                    Alpaca  ttt--a--gggt
               Bactrian camel  ttt--a--gggt
B D                   Dolphin  ttc--a--gggt
                 Killer whale  ttc--a--gggt
B D                     Horse  ttc--a--gggt
B D          White rhinoceros  ttc--a--ggat
B D                       Cat  ttg--a--cggt
B D                       Dog  ttc--c--gtgt
B D                   Ferret   ctt--g--tggt
B D                     Panda  ctt--g--cagt
               Pacific walrus  ttt--g--cggt
                 Weddell seal  ttt--g--aggt
             Black flying-fox  ttc--a--gggt
                Big brown bat  ttc--c--gggt
         David's myotis (bat)  ttc--c--gggt
B D                  Microbat  ttt--c--gggt
B D                  Hedgehog  ttc--a--gggt
B D                     Shrew  gt------gagc
              Star-nosed mole  gcc--a--gagc
B D           Tasmanian devil  tca--a--tcat
  D            Painted turtle  ============
  D           Green seaturtle  ============
B D        American alligator  ============
B D                    Lizard  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
            Cape golden mole  ------------
         Cape elephant shrew  ------------
B D                   Manatee  ------------
                    Aardvark  ------------
B D                  Elephant  ------------
B D                    Tenrec  ------------
B D                   Megabat  NNNNNNNNNNNN
  D  Chinese softshell turtle  ============
               Domestic goat  ============
B D                     Sheep  ============
            Tibetan antelope  ============
B D                 Armadillo  ------------
B D                       Cow  ============

Alignment block 20 of 1399 in window, 53759795 - 53759825, 31 bps 
B D                     Human  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D                     Chimp  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D                   Gorilla  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D                 Orangutan  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D                    Gibbon  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D                    Rhesus  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D       Crab-eating macaque  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D                    Baboon  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D              Green monkey  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D                  Marmoset  cttgcctc---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D           Squirrel monkey  ctagcttt---t-acccttct----------------------cct-------c-ccc-------t-ct-
B D                  Bushbaby  cccgc-tg---t-accc-tct----------------------cct-------c-ccc-------t-ct-
           Chinese tree shrew  cttgcttc---t-accctttt----------------------cct-------c-ccc-------gact-
B D                  Squirrel  atcttgcc---t-cagctctt----------------------ctcc------t-ttc-------t-gt-
       Lesser Egyptian jerboa  --taatgcccac-acccttct----------------------ctcc------t-tt-------------
                 Prairie vole  cccgctgc---t-agccttct----------------------ttct------c-tcc-------t-ct-
B D           Chinese hamster  ctcaatgc---t-atcctcct----------------------ct--------t-ttc-------t-ct-
               Golden hamster  cccaccgc---t-accctcct----------------------ctc-------t-tcc-------t-ct-
B D                     Mouse  c-cattgc---c-agccttct----------------------ccc------------------------
B D                       Rat  ctcactgc---c-acccttct----------------------ccc------------------------
B D            Naked mole-rat  cctgcctc---t-actctcct----------------------ccc---------ttc-------c-ct-
B D                Guinea pig  cctgcctg---t-actctcct----------------------ccc---------ttc-------c-ct-
                   Chinchilla  cctgcctc---t-cctctcct----------------------ccc---------ttc-------c-tt-
             Brush-tailed rat  cctgcctc---t-gctctctt----------------------ccc---------tcc-------c-tt-
B D                    Rabbit  cctacctc---t-ctccttgc----------------------tctc------t-gcc-------c-cg-
B D                      Pika  -acacctc---a-cccctggc----------------------cccc------gaggc-------c-tg-
B D                       Pig  cctgccgt---g-accttctc----------------------ctc-------g-cct-------c-tc-
B D                    Alpaca  cctgcctt---g-accctctc----------------------ctc-------c-cct-------c-cc-
               Bactrian camel  cctgcctt---g-accctctc----------------------ctc-------c-cct-------c-cc-
B D                   Dolphin  cctgtctt---g-accctctc----------------------ctc-------c-cct-------t-cc-
                 Killer whale  cctgtctt---g-accctctc----------------------ctc-------c-cct-------t-cc-
B D                     Horse  cctgcctc---t-acgcttct----------------------cct-------c-ccc-------c-ct-
B D          White rhinoceros  cctgctgc---t-acccttct----------------------cgt-------c-ccc-------t-ct-
B D                       Cat  cctgccgc---t-atcctcct----------------------ctc-------c-cct-------c-cc-
B D                       Dog  cctgccgc---c-atccgtct----------------------ctc-------c-cct-------g-cc-
B D                   Ferret   cc--------------cttct----------------------ctc-------c-cct-------c-cc-
B D                     Panda  cctgccgc---c-acgcttct----------------------ctc-------c-tct-------c-cc-
               Pacific walrus  cccgccac---c-acccttct----------------------ttc-------c-cct-------c-cc-
                 Weddell seal  cccgccac---c-acccctct----------------------ttc-------c-cct-------c-cc-
             Black flying-fox  cctgcctt---tatccctctt----------------------ttc-------c-tct-------c-tt-
                Big brown bat  cccgcctc---t-cccctcct----------------------cct-------c-cct-------c-cc-
         David's myotis (bat)  cccgcctc---t-cccctcct------------------cctccct-------c-cct-------c-cc-
B D                  Microbat  cccgcctc---t-cccctcct----------------------cct-------c-cct-------c-cc-
B D                  Hedgehog  cttgtctc---c-accccctg----------------------ccc-------t-cct-------c-cc-
B D                     Shrew  ctagaccc---t-cctccccc----------------------tgc-------t-cct-------g-ccc
              Star-nosed mole  ct-gtctc---t-gtcctcct----------------------ccc-------t-cct-------t-cc-
B D                  Elephant  ttagcccc---t-acctctgccggtcctg--ctaccccc-------------------------------
          Cape elephant shrew  tcaatccc---c-acctctgttgggc--------------------------------------------
B D                   Manatee  ttagccca---t-acctctgctgggtcctgcctactctc-------------------------------
             Cape golden mole  ttaatccc---t-acctctga-------------------------------------------------
B D                    Tenrec  ttagcccc---t-acctctgc-------------------------------------------------
                     Aardvark  ttagcccc---t-acctttgccaggt--------------------------------------------
B D                 Armadillo  atagactc---t-acctcttcagggt--------------------------------------------
B D           Tasmanian devil  cctgtctc---a-atctcttt----------------------gct-------c-cccaatccag-----
B D        American alligator  ctttcttc---t-acctccct----------------------cctcctgtctc-ccc------------
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                       Cow  ======================================================================

                        Human  -----c-tcg
                        Chimp  -----c-tcg
                      Gorilla  -----c-tcg
                    Orangutan  -----c-tcg
                       Gibbon  -----c-tcg
                       Rhesus  -----c-tcg
          Crab-eating macaque  -----c-tcg
                       Baboon  -----c-tcg
                 Green monkey  -----c-tcg
                     Marmoset  -----c-tca
              Squirrel monkey  -----c-tcg
                     Bushbaby  -----a-tca
           Chinese tree shrew  -----c-cca
                     Squirrel  -----c-cca
       Lesser Egyptian jerboa  ----------
                 Prairie vole  -----t-cct
              Chinese hamster  -----t-cc-
               Golden hamster  -----t-cct
                        Mouse  ----------
                          Rat  ----------
               Naked mole-rat  -----c-cca
                   Guinea pig  -----c-tca
                   Chinchilla  -----c-cca
             Brush-tailed rat  -----c-ccg
                       Rabbit  -----t-cgc
                         Pika  -----t-ctc
                          Pig  -----t-cg-
                       Alpaca  -----t-ct-
               Bactrian camel  -----t-ct-
                      Dolphin  -----t-cc-
                 Killer whale  -----t-cc-
                        Horse  -----c-cc-
             White rhinoceros  ---cac-cc-
                          Cat  -----t-cc-
                          Dog  -----t-cc-
                      Ferret   -----t-ac-
                        Panda  -----t-cc-
               Pacific walrus  -----t-cc-
                 Weddell seal  -----t-cc-
             Black flying-fox  -----tccc-
                Big brown bat  -----tccc-
         David's myotis (bat)  -----tccc-
                     Microbat  -----tccc-
                     Hedgehog  ----------
                        Shrew  ttc-------
              Star-nosed mole  -tt-------
                     Elephant  ----------
          Cape elephant shrew  ----------
                      Manatee  ----------
             Cape golden mole  ----------
                       Tenrec  ----------
                     Aardvark  ----------
                    Armadillo  ----------
              Tasmanian devil  ----------
           American alligator  ----------
               Painted turtle  ==========
              Green seaturtle  ==========
                       Lizard  ==========
             Peregrine falcon  ==========
                 Saker falcon  ==========
                      Megabat  NNNNNNNNNN
     Chinese softshell turtle  ==========
                Domestic goat  ==========
                        Sheep  ==========
             Tibetan antelope  ==========
                          Cow  ==========

Inserts between block 20 and 21 in window
B D                      Pig 149bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 21 of 1399 in window, 53759826 - 53759855, 30 bps 
B D                     Human  -cctccacc-ccagtc-tttctttcatctc-----att
B D                     Chimp  -cctccacc-ccagtc-tttctttcatctc-----att
B D                   Gorilla  -cctccacc-ccagtc-tttctttcatctc-----att
B D                 Orangutan  -cctccacc-ccagtc-tttctttcatctc-----att
B D                    Gibbon  -cctccacc-ccagtc-tttctttcatctc-----att
B D                    Rhesus  -cctccacc-ccagtc-tttctttcatctc-----gtt
B D       Crab-eating macaque  -cctccacc-ccagtc-tttctttcatctc-----gtt
B D                    Baboon  -cctccacc-ccagtc-tttctttcatctc-----gtt
B D              Green monkey  -cctccacc-ccagtc-tttctttcatctc-----att
B D                  Marmoset  -cctccacc-ccagtc-tttctttcatctt-----gtt
B D           Squirrel monkey  -cctccacc-ccagtcttttctttcatctc-----gtt
B D                  Bushbaby  -tgtccact-ccagtc-tttcttgcaggta-----att
           Chinese tree shrew  -cctgcacc-ccagtc-ttttgtt--------------
B D                  Squirrel  -tctccact-ccagtc-ttccctcccgtga-----att
       Lesser Egyptian jerboa  -ctctacct-cccgct-ttcc-tgcaaata-----att
                 Prairie vole  -cctcaact-tcagct-tttcctgaaccta-----att
B D           Chinese hamster  -cctccact-cccttt-ttccatgaaccca-----att
               Golden hamster  -cctccact-ccagtt-ttccacgaaccta-----att
B D                     Mouse  -cctcctct-tcagct-tacc-tgcatcta-----att
B D                       Rat  -cctcctct-tcagtt-ttcc-tgcatcca-----att
B D            Naked mole-rat  -ccttcact-ctggtc-tttctagcaccta-----att
B D                Guinea pig  -cctccact-cctgtc-tttcaagcaccta-----att
                   Chinchilla  -cctccgct-cccttc-tttctagcaccca-----att
             Brush-tailed rat  -cctttacc-catgcc-ttcctagcaccca-----aat
B D                    Rabbit  -cctgttgc-tgggtc-cttctcgctccct-----gtg
B D                      Pika  -tctcttcc-c--act-cctccttctccccactaagtg
B D                       Pig  -cctccacc-ccagtc-tttgctgtaccta-----att
B D                    Alpaca  -tctccacc-ccagtc-tttactgcacctc-----gtt
               Bactrian camel  -tctccacc-gcagtc-tttactgcacctc-----att
B D                   Dolphin  -tctccacc-ccagtc-tttactgcaccta-----act
                 Killer whale  -tctccacc-ccagtc-tttactgcaccta-----act
B D                     Horse  -cctcca-g-ccagtc-tccactgcgccta-----a--
B D          White rhinoceros  -cctccacc-ccagtc-tgtactgcaccta-----atg
B D                       Cat  -cctccacc-ccagtc-tttaccacacctg-----att
B D                       Dog  -cctgcacc-cca----------------------act
B D                   Ferret   -c--ccacc-cta----------------------att
B D                     Panda  -actccacc-cta----------------------att
               Pacific walrus  -cctctacc-c---------------------------
                 Weddell seal  -cctctacc-cta----------------------atg
             Black flying-fox  -tctccact-ctagtc-gtgtgtgcaccta-----att
                Big brown bat  -cctccacg-ccagcc-gtgtccacaccta-----atg
         David's myotis (bat)  -cctccact-ccaatc-gtgcccacacctg-----atg
B D                  Microbat  -cctccact-ccaatc-atgtccacacccg-----atg
B D                  Hedgehog  ----------ccag-c-ttttctatgccac---tggtt
B D                     Shrew  -cctgcacctccactg-ccctctgcgccac-----acc
              Star-nosed mole  -cctgcgcc-ccagtc-ttctctgtacctc-----atc
B D                  Elephant  -tcctcact-ccagtc-tttcctgcaccta-----att
          Cape elephant shrew  --ccctatt-ccagtcttttcctaaatcca-----att
B D                   Manatee  -tcctcacc-ctaatc-tttcctgaaccta-----act
             Cape golden mole  -----cacc-tcatcc-tttcctgcaccta-----att
B D                    Tenrec  -----cacc-ccagac-tttcctgtcccta-----act
                     Aardvark  --ccccatc-ccaagc-tttcttgcaccta-----att
B D                 Armadillo  ---------------c-ttgcctctacc----------
B D           Tasmanian devil  -cctccatt-caactg-cttaaaacatcta-----act
B D        American alligator  ttttccatc-ccctcc-ttttctcttcccc-----ct-
  D            Painted turtle  ======================================
  D           Green seaturtle  ======================================
B D                    Lizard  ======================================
  D          Peregrine falcon  ======================================
  D              Saker falcon  ======================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================
               Domestic goat  ======================================
B D                     Sheep  ======================================
            Tibetan antelope  ======================================
B D                       Cow  ======================================

Alignment block 22 of 1399 in window, 53759856 - 53759856, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  g
B D                      Pika  a
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
B D          White rhinoceros  c
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   g
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
                Big brown bat  t
         David's myotis (bat)  g
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D        American alligator  t
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
          Chinese tree shrew  -
B D                   Megabat  N
  D  Chinese softshell turtle  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D                     Horse  -
B D                 Armadillo  -
B D                       Cow  =

Inserts between block 22 and 23 in window
B D       American alligator 90bp

Alignment block 23 of 1399 in window, 53759857 - 53759936, 80 bps 
B D                     Human  a----gggtg-tagaggatta-gcagccctattgagtcaa---ggcagcagtactcctttcccttga-ga
B D                     Chimp  a----gggtg-tagaggatta-gcagccctattgagtcaa---ggcagcagtactcctttcccttga-ga
B D                   Gorilla  a----gggtg-tagaggatta-gcagccctattgagtcaa---ggcagcagtactcctttcccttga-ga
B D                 Orangutan  a----gggtg-tagaggatta-gcagccctattgagtcaa---ggcagcagtacccctttcccttga-ga
B D                    Gibbon  a----gggtg-tagaggatta-gcagccctattgagtaaa---ggcagcagtacccctttcccttga-ga
B D                    Rhesus  a----ggttg-tagaggatta-gcagccctattgagtaaa---ggcagccatgcccctttcccttga-ga
B D       Crab-eating macaque  a----ggttg-tagaggatca-gcagccctattgagtaaa---ggcagccatgcccctttcccttga-ga
B D                    Baboon  a----ggttg-tagaggatta-gcagccctattgagtaaa---ggcagccatgcccctttcccttga-ga
B D              Green monkey  a----ggttg-tagaggatta-gcagccctattgagtaaa---ggcagccatgcccctttcccttga-ga
B D                  Marmoset  a----gggtc-tagaggatta-gcagcactattgagaaaa---ggcagcagtgcccctttccctgga-ga
B D           Squirrel monkey  a----gggtc-tagaggatta-gcagcactatcgagaaaa---ggcaacagtgcccctttccctgga-ga
B D                  Bushbaby  a----gggggttagaggatta-gcagcactatcgagtcca---ggcagcagtgcccctgtcccttga-ga
           Chinese tree shrew  --------tc-t---------------------------------------tgctcctttgccttga-aa
B D                  Squirrel  a----ggggt-taaaggacta-gcagcatcagcaagtaaa---ggcaatggtgcc---------------
       Lesser Egyptian jerboa  a----gggct-taaaggactc-acagccatatcatgtaaa---ggcaatggtgcct--------tgg-ga
                 Prairie vole  a----gggtt-taaaggtccccacaggaccatcatgtaaa---gaca--ggtgcct--------tga-g-
B D           Chinese hamster  g----gggtt-taaagttctctacaggaccatcatgaaaa---ggca--ggtgccc--------tga-ga
               Golden hamster  g----gggtt-taaagttctctacaggaccatcacggaaa---ggca--ggtgccc--------tga-ta
B D                     Mouse  a----gcgtt-taaaggtctccacaggaccatcgtgtaaa---ggcagtggtgcct--------tgg-ga
B D                       Rat  a----gggtt-tgaaggtctccacaggaccagggt---------gcagtggtgcat--------tgg-ga
B D            Naked mole-rat  a----gggtt---aaggatta-gcagcactgttcattaaa---ggcaatggtgctt--------------
B D                Guinea pig  a----gggtt---aaggatta-gcagcactgtccattaaa---ggcaacagggcct--------------
                   Chinchilla  a----gggtc---aaggatta-gcagcactgtgcattaaa---ggtgacagggcct--------------
             Brush-tailed rat  a----gggtt---aaaggtta-gc-tcactgtgcattaag---ggctacagggcct--------------
B D                    Rabbit  a----gggtc-tgccggattg-gccgccctctcgggacga---ggca---gagcccttgt-ccctga-gg
B D                      Pika  g----ggttc-agacaagctg-gcag------------------------gtgcacctgg-ccttga-ga
B D                       Pig  a----gggtt-tagaggagca-gcagacccatcacgtaaa---ggcaggggtgcccccttttcttga-aa
B D                    Alpaca  a----gggtt-taaaggaata-gcagcactgccaggtaaa---ggcaggggtgcccctttttcttga-ga
               Bactrian camel  a----gggtt-taaaggaata-gcagcactgccaggtaaa---ggcaggggtgcctctttttcttga-ga
B D                   Dolphin  a----gggtt-tagaggaata-gcagtactgtcaagtaaa---ggcaggggcacccctttttctcga-ga
                 Killer whale  a----gggtt-tagaggaata-gcagtactgtcaagtaaa---ggcaggggcacccctttttctcga-ga
B D                     Horse  --------------------c-tcagcactatcaagtaaa---ggcagtggtgccccttttccttga-ga
B D          White rhinoceros  a----gggtt-tagaggaatc-tcagcactatcaagtaaa---gacaatggtgccccttttccttga-ga
B D                       Cat  a----gggtg-tagaagaatc-tcagcactaccaagtaaa---ggcagtggtgccccctttccctga-ca
B D                       Dog  a----gggtt-cagaggaatc-tcagcactatcaggtgag---ggcagcggtgccccttt-ccctga-ga
B D                   Ferret   a----gggtt-tagaggaatc-tcagtgctatcaagtaaa---ggcagtgttgccccttttccctga-ga
B D                     Panda  a----gggtt-tagaggaatc-tcagcactatcaagcaaa---ggcagtgatgcccttttcccctga-ga
               Pacific walrus  g----gggtt-tagaggaatc-tcagcactatcgagtaaa---gtcagtggtgccccttttccctga-ga
                 Weddell seal  a----gggtt-tagaggaatc-tcagcactatcaagtaaa---gtcagtggtgccccttttccctga-ga
             Black flying-fox  a----gggtt-tagaggaata-gtggcact-----ataaa---ggccatggtgcccctttttctcga-ga
                Big brown bat  a----gggtt-tagaggaata-gggacactgtcacataaa---ggcagtggtgtcccctttcctcga-gg
         David's myotis (bat)  a----gggtt-t--aggaata-gtgaccctatcacataaa---ggcagtggtgtcccctttcctcga-ga
B D                  Microbat  g----gggtt-tagaggaata-gtgacactatcacataaa---ggcagtggtgacccctttccttga-ga
B D                  Hedgehog  a----gggtt-tagagaaact-gtaacactgttgagtcaa---ggc--tgctgctccttgtccttga-gg
B D                     Shrew  aatttaggct-ttgaagaaca-ggggtgc--ccaagcggccgaggcagtggggctctttggcctgga-ga
              Star-nosed mole  a----gggtg-cagaggggca-gtggcacaatcaagaggc---ggc-ttgctgcttcttgttctcat-gg
B D                  Elephant  a----gggtt-cagaggattg-actgcaccatcaagtaaa---ggtggcaatgttcctttctcatgaggg
          Cape elephant shrew  a----gagtt-taaaagagta-gctgcaccacgaaataaa---ggcagtgatgtttctgtctcctga-gt
B D                   Manatee  a----gggtt-gagaggatta-actgcaccatcaaataaa---ggcaatgatgttcctttttcatga-gg
             Cape golden mole  a----gggtt-tagaggatta-actgcaccatcaagtaaa---ggcagtgctgttcctttcttgtga-gg
B D                    Tenrec  a----gggtt-gggaggatca-actatgccatcaagtgga---ggcagggacgtccctttcccaaga-gg
                     Aardvark  a----taatt-tagaagatta-gctacaccatcaagtaaa---ggcagtgacgttcctttctcaaaa-gg
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
B D                       Cow  ======================================================================

                        Human  ccagtggctt-------ct----tga-----gctga
                        Chimp  ccagtggctt-------ct----tga-----gctga
                      Gorilla  ccagtggctt-------ct----tga-----gctga
                    Orangutan  ccagtggctt-------ct----tga-----gctga
                       Gibbon  ccagtggctt-------ct----tga-----gctga
                       Rhesus  ccagtggctt-------ct----tga-----gctga
          Crab-eating macaque  ccagtggctt-------ct----tga-----gctga
                       Baboon  ccagtggctt-------ct----tga-----gctga
                 Green monkey  ccagtggctt-------ct----tga-----gctga
                     Marmoset  ccagtggctt-------ct----tga-----gt-ga
              Squirrel monkey  ccggtggctt-------ct----tga-----gtgga
                     Bushbaby  ccaatagcta-------ct----tga-----gccta
           Chinese tree shrew  tccatggcta-------ct----tga-----gctga
                     Squirrel  tctttcccttgaaaagatc----tga----------
       Lesser Egyptian jerboa  cccattgctt-------cc-----------------
                 Prairie vole  tctatggctt-------cc----aga----------
              Chinese hamster  cctatggctt-------cc----tga----------
               Golden hamster  cctatggctt-------cctgattga----------
                        Mouse  cccatggctt-------cc----tga----------
                          Rat  cccatggctt-------cc----tga----------
               Naked mole-rat  -------ctt-------tt----tct----------
                   Guinea pig  -------ctt-------tt----tct----------
                   Chinchilla  -------ctt-------cc----tct----------
             Brush-tailed rat  -------ctt-------tt----tct----------
                       Rabbit  ctagcccctg-------ct----caggctgc-----
                         Pika  ccaatggctc-------cc----agagcgga-----
                          Pig  ctgacggctt-------cc----tgg-----gctga
                       Alpaca  ccaatgcctt-------cc----tgg-----gctga
               Bactrian camel  ccaatgcctt-------cc----tgg-----gctga
                      Dolphin  ccgacggctt-------ct----tgg-----gctga
                 Killer whale  ccgacggctt-------ct----tgg-----gctga
                        Horse  ccaatggctt-------ct----tgg-----gctga
             White rhinoceros  ccgatggctt-------ct----tgg-----gctga
                          Cat  ctgttggctt-------ct----tgg-----gccac
                          Dog  ccagtggctt-------tc----tgg-----gccaa
                      Ferret   cccatggctt-------tt----tgg-----gccaa
                        Panda  ctgatggctt-------tt----tgg-----gtcga
               Pacific walrus  ccgatggctt-------tt----tgg-----gccaa
                 Weddell seal  ctgatggctt-------tt----tgg-----gccaa
             Black flying-fox  ccaaaggctt-------ct----cga-----gctga
                Big brown bat  ccaatgcctt-------ct----tgg-----gctgg
         David's myotis (bat)  ccgatggctt-------ct----tgg-----gctga
                     Microbat  ccagtggctt-------ct----tgg-----gctga
                     Hedgehog  cca-cggctg-------ct----tga-----gctga
                        Shrew  ccaatggcgc-------ct----tgg-----gctgg
              Star-nosed mole  ccgtcggcct-------gc----cag-----gccgg
                     Elephant  ctgatgac-t-------tt----tga-----ggtga
          Cape elephant shrew  ctgatgactt-------tt----tga-----gataa
                      Manatee  ctgatgac-t-------tt----tga-----ggtga
             Cape golden mole  ctggtgactt-------tt----tga-----gggta
                       Tenrec  ctggtggc----------c----tga-----ggtga
                     Aardvark  cttatgac-t-------tt----tga-----ggtga
              Tasmanian devil  ====================================
               Painted turtle  ====================================
              Green seaturtle  ====================================
           American alligator  ====================================
                       Lizard  ====================================
             Peregrine falcon  ====================================
                 Saker falcon  ====================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ====================================
                Domestic goat  ====================================
                        Sheep  ====================================
             Tibetan antelope  ====================================
                    Armadillo  ------------------------------------
                          Cow  ====================================

Inserts between block 23 and 24 in window
B D                     Pika 633bp

Alignment block 24 of 1399 in window, 53759937 - 53760087, 151 bps 
B D                     Human  tcact----------t-gtccattcagccctt-agtctctatg-ccga-ctccacctattccgtccctgg
B D                     Chimp  tcact----------t-gtccattcagccctt-agtctctatg-ccga-ctccacctattccgtccctgg
B D                   Gorilla  tcact----------t-ggccactcagccctt-agtctctatg-ccga-ctccatctattccatccctgg
B D                 Orangutan  tcact----------t-gtccattcagctctt-agtctctatg-ccga-ctccacctattccatccctgg
B D                    Gibbon  tcact----------t-gtccattcagccctt-agtctctagg-ctga-ctccacctattccgtccctgg
B D                    Rhesus  tcact----------g-gtccattcggccctc-aatctctatg-ccga-ccccacctgttctgtccctgg
B D       Crab-eating macaque  tcact----------g-gtccattcggccctc-aatctctatg-ccta-ccccacctgttctgtccctgg
B D                    Baboon  tcact----------g-gtccattcggccctc-aatctctatg-ccga-ccccacctgttctgtccctgg
B D              Green monkey  tcact----------g-gtccattcggccctc-aatctctatg-ccaa-ccccacctgttctgtccctgg
B D                  Marmoset  tcgct----------t-ggccattcagccctc-agtctctgca-tggg-ccccacctgttccaaccctgg
B D           Squirrel monkey  tcgct----------c-ggccattcagccctc-agtctctaca-tggg-ccccacctgttccgtccctgg
B D                  Bushbaby  tcacttgtc------t-gtccactcagccctc-agtctctaag-tggg-ccctacctcctccatctctga
           Chinese tree shrew  tcact----------t-gtccattcagc-ctc-agactctaag-tagg-ccccgctttctccacccctag
B D                  Squirrel  tctct----------t-gtctgttcagcagtc-agtctctaag-tagg-c-------------cccacct
       Lesser Egyptian jerboa  -agct----------g-gtctctggtgcattc-tgtct----a--------------------cccaaca
                 Prairie vole  ttgtt----------t-gttcatggggctccc-agtctcgaag-tcag-ct-ca----tctcacccccca
B D           Chinese hamster  tggct----------t-gtcccctgggtaccc-aatctctaag-tcag-ctcca----tttcacccctca
               Golden hamster  tggct----------t-ctcccctgggccctc-aatctctaag-tcgg-ctcca----tttcac------
B D                     Mouse  ttgct----------t-gtctgctgggccccc-agtctctgag-tcag-ct------------cctgtca
B D                       Rat  tggct----------t-gtctgctgggccccc-agtctctgagttcag-ct------------cccatca
B D            Naked mole-rat  tggct----------t-tt-------------------------taag-ct------------ac-----
B D                Guinea pig  tggct----------t-ct-------------------------tgga-ct------------g------
                   Chinchilla  tggct----------t-ct-------------------------tgag-ct------------ac-----
             Brush-tailed rat  tgact----------t-ct-------------------------tgag-ct------------ac-----
B D                    Rabbit  tggct----------t-gt-------------------------ccac-tt------------ccctgac
B D                       Pig  tcatt----------t-ggccatgcagccctc-agtttctaag-tcag-ccctacctgctccacccctgc
B D                    Alpaca  tcact----------t-gtccatccagccctc-agcttctaag-tcggctcccaccatccctacccctgc
               Bactrian camel  tcact----------t-gtccatccagccctc-agcttctaag-tcggcccctgccatccctacctctgc
B D                   Dolphin  tcact----------t-gtccatccagccctc-agttcctaag-ttg--ccttaccttctccacctctgc
                 Killer whale  tcact----------t-gtccatccagccctc-agttcctaag-tgg--ccttaccttctccacctctgc
B D                     Horse  tctct----------t-gtccattcagccctc-agtctctaag-tagg--cccaccttctgcatccctga
B D          White rhinoceros  tcact----------t-gtccattcagccctc-agtctttaag-tagg-tcccaccttctgcatccctga
B D                       Cat  tcact----------t-gtgcatttagccctc-ggtctctaaa-tagg-ccccaccttctccatctctga
B D                       Dog  tcacc----------t-gtgcactcagccctcgggtggctgag-tagg-ccccaccttctccatttcgga
B D                   Ferret   ctgca----------t-gtgtattcagccc------------------------ccttctccttttctg-
B D                     Panda  tcact----------t-gggcattcagctctt-ggtctctaag-taag-ccccaccttccccatctctga
               Pacific walrus  tcact----------t-gtgcattcagccctc-ggtctctaag-tagg-tcccaccgtctccatctctga
                 Weddell seal  tcact----------t-gtgcattcagccctc-ggtctctaag-tagg-ccccatcttctccatctctga
             Black flying-fox  tcact----------t-gtccattcagccccc-agtctttaag-tagg-ccccacctcctccatctctga
                Big brown bat  tcgct----------t-tcccgttcag-cctc-agtctctaag-cagg-ctccaccttctccatccctgg
         David's myotis (bat)  tcact----------t---ccattcagccctc-agtttct-ag-tagg-ctccgccttctccatccctgg
B D                  Microbat  tcact----------t---ccattcagccctc-agtttct-cg-tagg-cgccaccttctccatccctgg
B D                  Hedgehog  tcact----------g-gctcatttggccttc-ggtctctga-------cgcc-----------------
B D                     Shrew  tggcttgtgcttcgag-gcccg--tcgctctc-gctc------------cctc-----------------
              Star-nosed mole  tgct-----------g-gccc----cgccccc-tccc------------cggt-----------------
B D                  Elephant  tcact----------t-gtccat---------------------tcag-ccccaggttctccatccctga
          Cape elephant shrew  tcttt----------t-gcctcc---------------------tcag-tgccaccttctccatccctga
B D                   Manatee  tcact----------t-gtccat---------------------tcag-ccctaccttctccatccctgg
             Cape golden mole  tcact----------t-gtccat---------------------tcat-cccaaccttctctattcaag-
B D                    Tenrec  tagct----------tcgctctt---------------------tccc-ccactccctgtctgttccaga
                     Aardvark  tcact----------t-gtccat---------------------tcag-ccctaccttctccatccctga
B D                 Armadillo  ---ct----------t-ctcc------------------------------------tccccatccccaa
B D                      Pika  ======================================================================
B D           Tasmanian devil  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                       Cow  ======================================================================

                        Human  gagt--ccagtctcgt----c------tgtttgaagattgac-atc---agggaaagaggagat------
                        Chimp  gagt--ccagtctcgt----c------tgtttgaagattgac-atc---agggaaggaggagat------
                      Gorilla  gagt--ccagtctcat----c------tgtttgaagattgac-atc---agggaaggaggagac------
                    Orangutan  gagt--ccagtctcgt----c------tgtttgaagattgac-atc---agggaaggaggagat------
                       Gibbon  gagt--ccagtctcgt----c------tgtttgaagattgac-atc---agggaaggaggagat------
                       Rhesus  gagc--ccagtctcgt----c------tgtttgaagattgac-gtc---aggaaaggaggagat------
          Crab-eating macaque  gagc--ccagtctcgt----c------tgtttgaagattgac-gtc---aggaaaggaggagat------
                       Baboon  gagt--ccagtctcgt----c------tgtttgaagattgac-gtc---aggaaaggaggagag------
                 Green monkey  gagt--ccagtctcgt----c------tgtttgaagactgac-gtc---aggaaaggaggagat------
                     Marmoset  cagt--cctgtcttgt----t------tatttgaagattgac-atc---aggaaaggaggggat------
              Squirrel monkey  cagt--cctgcctcat----c------tatttgaagattgac-atc---aggaaaggaggagat------
                     Bushbaby  ctgt--tcattctcac----c------tgtttgaagattaac-att-cagggaagggaggtgat------
           Chinese tree shrew  cagt--tcacaggc-t----c------tgtctgaagattaactttc---aaggatggaggaggt------
                     Squirrel  tgtc---------cac----ctt----tgtttgaagatcaac-ata-c-atggaaggaggaaat------
       Lesser Egyptian jerboa  ggtc--acaaccttac----ctgcttttctttgaagactaga-gtt-c-tgggaaggaggtgat------
                 Prairie vole  ggtc--ctaccctcac----ca-----tatttgaaggt---g-gtt-t-ctggagggag-----------
              Chinese hamster  ggtc--ccagcctcat----cag----tgattgaaggt---a-gtt-t-ctggaaggaggcaat------
               Golden hamster  ---c--ccagcctcac----cag----tgtttgaaggt---a-gtt-t-ctggaaggaggcaat------
                        Mouse  ggtc--atggcctcac----cag----tgttt--------------------gatggaggcagt------
                          Rat  ggtc--acagactggc----cag----tgttt--------------------gatggaggcact------
               Naked mole-rat  ---------------------------tgtttgaagattaat-att-c-aaggaaggag---at------
                   Guinea pig  ---------------------------tgtttgaagattagc-act-t-agagaaggag---gt------
                   Chinchilla  ---------------------------tgtttgaagattaac-act-c-cggggaggag---at------
             Brush-tailed rat  ---------------------------catttgaagattgac-act-c-agggaaggag---at------
                       Rabbit  agta--ccagtcttac----cct----tgtttggcaattacc-atc-t-ggggaaggcggacac------
                          Pig  cagttcacagactttc----ctc----tattggaagattaac-att-c-tggaaaggaagaggc------
                       Alpaca  caattcacagcattgc----ctc----tgtttgaagagtaac-gtt-c-tgggaaggaggaggc------
               Bactrian camel  caattcacagcattgc----ctc----tgtttgaagagtaac-gtt-c-tgggaaggaggaggc------
                      Dolphin  cagtttacagacttgc----ctc----tgtttgaagattaac-att-t-tgggaaggagcaggc------
                 Killer whale  cagtttacagacttgc----ctc----agtttgaagattaac-att-t-tgggaaggagcaggc------
                        Horse  cagctcacagtgttgc----ctc----tgtttgaagattaat-gtt-c-tgggaaggaggaggc------
             White rhinoceros  cagctcgaagtcttgt----ctc----tgtttgaagattaat-gat-c-tgggaaggaggaggc------
                          Cat  ------gaattcttgc----ttc----tgtttgaagactaag-gct-c-agggaaggaggaggc------
                          Dog  ------gaattcttgc----ctc----tgtttgaagattaag-gtt-c-tgggaaggaggaggc------
                      Ferret   ---------ttcttga----ctc----tgtttgaaga--agg-atcac-tgggaagtagaaggc------
                        Panda  ------gaagtcgtgc----ctc----tgtttgaaga--agg-attgc-tgggaaggaggaggc------
               Pacific walrus  ------gaattctcac----ctc--------tgaag---agg-attgg-tgggaaggaggaggc------
                 Weddell seal  ------gaattctcgc----ctc--------tgaaga--agg-attgg-tgggaaggaggaggc------
             Black flying-fox  cagttcacagtcttgc----ct--------ttgaagattaac-gtg-c-tgggatggaggagga------
                Big brown bat  ctgctcac------------ct---------------------------tgggacggaggaggc------
         David's myotis (bat)  cagctcacagccttgcctctctc----tgtgtgatggttaac-att-c-tgggatggaggaggc------
                     Microbat  cagctcacagccttgc----ctc----tgtgtgatggttaac-att-c-tgggatggaggaggc------
                     Hedgehog  ------acagacctgc----gtc----tgcttgtaggtgagc-att-c-c-----------agctgggag
                        Shrew  ------tctgacgggc----ct------gcttgcagaggagc-ttt-c-t-----------ggc------
              Star-nosed mole  ------ccagtctggc----ctc----cgtttggagatgaac-atc-c-t------------gc------
                     Elephant  cagttcatagtctctc----tta----tgtttgagaattaac-atc-c-agggaaggaggaggt------
          Cape elephant shrew  tacttcacagtcacat----ctc----tgggtgataattgat-act-t-agggaaagagtagat------
                      Manatee  cagttcacagtctcag----ctc----tgtttgagaattaac-atc-c-agggaaggaagaggt------
             Cape golden mole  ----------tctcac----ccc----tgtttgagaattaac-ata-c-agggaatgaggaggt------
                       Tenrec  ga--------gctcac----t------------ggcacacac-atc-c-agggaaggaggaggc------
                     Aardvark  catttcacagtctcac----ctc----tg----ggaattaac-atc-c-agggaaggagga---------
                    Armadillo  cagttgggtgtctctc----t-----------gaagat--------------gaaggaaggggc------
                         Pika  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                          Cow  ======================================================================

                        Human  --accttcc--------tttgg------------tcacc-------------------------------
                        Chimp  --accttcc--------tttgg------------tcacc-------------------------------
                      Gorilla  --accttcc--------tttgg------------tcacc-------------------------------
                    Orangutan  --accttcc--------tttgg------------tcacc-------------------------------
                       Gibbon  --accttcc--------tttgg------------tcacc-------------------------------
                       Rhesus  --accttcc--------tttgg------------tcacc-------------------------------
          Crab-eating macaque  --accttcc--------tttgg------------tcacc-------------------------------
                       Baboon  --accttcc--------tttgg------------tcacc-------------------------------
                 Green monkey  --accttcc--------tttgg------------tcacc-------------------------------
                     Marmoset  --accttcc--------tt---------------------------------------------------
              Squirrel monkey  --gccttcc--------tt---------------------------------------------------
                     Bushbaby  --accaccc--------tctgg------------ttacc-------------------------------
           Chinese tree shrew  --accttccagggcacgtgtgc------------tcaccagagaaacagaaaggtgaagagagagggaga
                     Squirrel  --gccttcc--------tatgg------------ccatg-------------------------------
       Lesser Egyptian jerboa  --accctcc--------tatgg------------ctatg-------------------------------
                 Prairie vole  ---------------------g------------tccca-------------------------------
              Chinese hamster  --ccctttc--------tatag------------tccca-------------------------------
               Golden hamster  --ctctttc--------tgtcg------------tccct-------------------------------
                        Mouse  --ccctttc--------tacag------------tccca-------------------------------
                          Rat  --ccttttc--------tacag------------tccca-------------------------------
               Naked mole-rat  --accttcc--------tatgg------------tcata-------------------------------
                   Guinea pig  --cccttcc--------tatgg------------cctta-------------------------------
                   Chinchilla  --accttcg--------catgg------------tcttg-------------------------------
             Brush-tailed rat  --accgttg--------aaagg------------tttta-------------------------------
                       Rabbit  --agcgtcc--------ttggg------------gcgtg-------------------------------
                          Pig  --acctttc--------ttcgg------------tcat--------------------------------
                       Alpaca  --atcttcc--------tttgg--------------ac--------------------------------
               Bactrian camel  --accttcc--------tttgg--------------ac--------------------------------
                      Dolphin  --accttcc--------tttgg------------tcac--------------------------------
                 Killer whale  --accttcc--------tttgg------------tcac--------------------------------
                        Horse  --accttcc--------tctgg------------tcac--------------------------------
             White rhinoceros  --accttcc--------tctgg------------tcac--------------------------------
                          Cat  --accttcc--------tctgg------------tcgc--------------------------------
                          Dog  --actttcc--------tttgg------------tcac--------------------------------
                      Ferret   --actttcc--------tttgg------------tcac--------------------------------
                        Panda  --accttcc--------tttgg------------tcac--------------------------------
               Pacific walrus  --actttcc--------tttgg------------tcac--------------------------------
                 Weddell seal  --actttcc--------tttgg------------tcac--------------------------------
             Black flying-fox  --actttcc--------tctgg------------tcac--------------------------------
                Big brown bat  --cccttcc--------tctgg------------ccac--------------------------------
         David's myotis (bat)  --accttcc--------tttgg------------tccc--------------------------------
                     Microbat  --accttcc--------tttgg------------tcac--------------------------------
                     Hedgehog  ctgccttcc--------ctggagggtctggaagtcctc--------------------------------
                        Shrew  --agcttcc--------ctggg------------tcac--------------------------------
              Star-nosed mole  --gtcatct--------ttgg---------------cc--------------------------------
                     Elephant  --accttcc--------tttgg------------tcatc-------------------------------
          Cape elephant shrew  --aagtcca--------ctaga------------ttgtc-------------------------------
                      Manatee  --accttcc--------cttgg------------tcatc-------------------------------
             Cape golden mole  --accatct--------tttga------------tcatc-------------------------------
                       Tenrec  --cccttcc--------tctca------------tcatc-------------------------------
                     Aardvark  -------------------tgg------------tcatc-------------------------------
                    Armadillo  --acctccc--------tt---------------------------------------------------
                         Pika  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                          Cow  ======================================================================

                        Human  --------------------------------t---gtttca----------------------------
                        Chimp  --------------------------------t---gtttca----------------------------
                      Gorilla  --------------------------------t---gtttca----------------------------
                    Orangutan  --------------------------------t---gtttca----------------------------
                       Gibbon  --------------------------------t---gtttcg----------------------------
                       Rhesus  --------------------------------t---gtttca----------------------------
          Crab-eating macaque  --------------------------------t---gtttca----------------------------
                       Baboon  --------------------------------t---gtttca----------------------------
                 Green monkey  --------------------------------t---gtttca----------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  --------------------------------t---gtatca----------------------------
           Chinese tree shrew  gggagaaagcaccctctaatggggtatggtcat---gttgcaatcccccctcctccatttctccatcctg
                     Squirrel  --------------------------------t---gtctca----------------------------
       Lesser Egyptian jerboa  --------------------------------a---acttca----------------------------
                 Prairie vole  --------------------------------c---agttca----------------------------
              Chinese hamster  --------------------------------ctatatttca----------------------------
               Golden hamster  --------------------------------ctatatttca----------------------------
                        Mouse  --------------------------------c---atttca----------------------------
                          Rat  --------------------------------c---atttca----------------------------
               Naked mole-rat  --------------------------------t---gtttca----------------------------
                   Guinea pig  --------------------------------t---gtttcc----------------------------
                   Chinchilla  --------------------------------t---gtttca----------------------------
             Brush-tailed rat  --------------------------------t---gtttca----------------------------
                       Rabbit  --------------------------------a---gtttca----------------------------
                          Pig  --------------------------------t---gtttcc----------------------------
                       Alpaca  --------------------------------t---agttaa----------------------------
               Bactrian camel  --------------------------------t---agttaa----------------------------
                      Dolphin  --------------------------------t---atttca----------------------------
                 Killer whale  --------------------------------t---atttca----------------------------
                        Horse  --------------------------------t---gtttca----------------------------
             White rhinoceros  --------------------------------t---gtttca----------------------------
                          Cat  --------------------------------t---ctttca----------------------------
                          Dog  --------------------------------t---gtttca----------------------------
                      Ferret   --------------------------------t---gtttca----------------------------
                        Panda  --------------------------------t---gtttca----------------------------
               Pacific walrus  --------------------------------t---gtttca----------------------------
                 Weddell seal  --------------------------------t---gtttca----------------------------
             Black flying-fox  --------------------------------t---gtttta----------------------------
                Big brown bat  --------------------------------t---gtttca----------------------------
         David's myotis (bat)  --------------------------------t---gtttca----------------------------
                     Microbat  --------------------------------t---gtttcc----------------------------
                     Hedgehog  --------------------------------c---cctgtg----------------------------
                        Shrew  --------------------------------t---gccgca----------------------------
              Star-nosed mole  --------------------------------t---gacgca----------------------------
                     Elephant  --------------------------------t---gtgtca----------------------------
          Cape elephant shrew  --------------------------------c---atgtca----------------------------
                      Manatee  --------------------------------t---gtttta----------------------------
             Cape golden mole  --------------------------------t---gtttca----------------------------
                       Tenrec  --------------------------------t---atttca----------------------------
                     Aardvark  --------------------------------t---gtttca----------------------------
                    Armadillo  --------------------------------t---gcagga----------------------------
                         Pika  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                          Cow  ======================================================================

                        Human  ---gggccttgg----------------------------------------------------------
                        Chimp  ---gggtcttgg----------------------------------------------------------
                      Gorilla  ---gggtcttgg----------------------------------------------------------
                    Orangutan  ---gggtcttgg----------------------------------------------------------
                       Gibbon  ---gggtcttgg----------------------------------------------------------
                       Rhesus  ---gggtcttgg----------------------------------------------------------
          Crab-eating macaque  ---gggtcttgg----------------------------------------------------------
                       Baboon  ---gggtcttgg----------------------------------------------------------
                 Green monkey  ---gggtcttgg----------------------------------------------------------
                     Marmoset  ---gggtcttgg----------------------------------------------------------
              Squirrel monkey  ---gggtcttgg----------------------------------------------------------
                     Bushbaby  ---aggtcttgg----------------------------------------------------------
           Chinese tree shrew  tagggatcttgggcatgcactaacacctgtctgctgcgttcttcaaaccgcagggtcaggacctgagccc
                     Squirrel  ---gggtctaag----------------------------------------------------------
       Lesser Egyptian jerboa  ---gggtcttgg----------------------------------------------------------
                 Prairie vole  ---ggcctttgg----------------------------------------------------------
              Chinese hamster  ---gggttttgg----------------------------------------------------------
               Golden hamster  ---gggttttgg----------------------------------------------------------
                        Mouse  ---gggattcag----------------------------------------------------------
                          Rat  ---gggattcgg----------------------------------------------------------
               Naked mole-rat  ---gggtcttgg----------------------------------------------------------
                   Guinea pig  ---tggttttgg----------------------------------------------------------
                   Chinchilla  ---gggtctt-g----------------------------------------------------------
             Brush-tailed rat  ---gcgtcttgg----------------------------------------------------------
                       Rabbit  ---gggtctaga----------------------------------------------------------
                          Pig  ---gagtcttgg----------------------------------------------------------
                       Alpaca  ---gagtcttgg----------------------------------------------------------
               Bactrian camel  ---gagtcttgg----------------------------------------------------------
                      Dolphin  ---gagtcttgg----------------------------------------------------------
                 Killer whale  ---gagtcttgg----------------------------------------------------------
                        Horse  ---ggg-cttgg----------------------------------------------------------
             White rhinoceros  ---gggtcttgg----------------------------------------------------------
                          Cat  ---gcatgttgg----------------------------------------------------------
                          Dog  ---gagttttgg----------------------------------------------------------
                      Ferret   ---gggtcttgg----------------------------------------------------------
                        Panda  ---gggtcttgg----------------------------------------------------------
               Pacific walrus  ---gggtcttgg----------------------------------------------------------
                 Weddell seal  ---gggtcttgg----------------------------------------------------------
             Black flying-fox  ---ggttctcag----------------------------------------------------------
                Big brown bat  ---gggtcttgg----------------------------------------------------------
         David's myotis (bat)  ---gggtcttgg----------------------------------------------------------
                     Microbat  ---gggtcttgg----------------------------------------------------------
                     Hedgehog  ----gctccctg----------------------------------------------------------
                        Shrew  ---ggctctttg----------------------------------------------------------
              Star-nosed mole  ----gctcctcg----------------------------------------------------------
                     Elephant  ---aagtcttag----------------------------------------------------------
          Cape elephant shrew  ---gggtcttgg----------------------------------------------------------
                      Manatee  ---gggtcttag----------------------------------------------------------
             Cape golden mole  ---ggatcttgg----------------------------------------------------------
                       Tenrec  ---gggtcttgg----------------------------------------------------------
                     Aardvark  ---gggtcttgg----------------------------------------------------------
                    Armadillo  ---gggtcttgg----------------------------------------------------------
                         Pika  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                          Cow  ======================================================================

                        Human  -------------------------------------------------------------------aag
                        Chimp  -------------------------------------------------------------------aag
                      Gorilla  -------------------------------------------------------------------aag
                    Orangutan  -------------------------------------------------------------------aag
                       Gibbon  -------------------------------------------------------------------aag
                       Rhesus  -------------------------------------------------------------------aat
          Crab-eating macaque  -------------------------------------------------------------------aat
                       Baboon  -------------------------------------------------------------------aat
                 Green monkey  -------------------------------------------------------------------aat
                     Marmoset  -------------------------------------------------------------------aag
              Squirrel monkey  -------------------------------------------------------------------aag
                     Bushbaby  -------------------------------------------------------------------aag
           Chinese tree shrew  gtgattagccttgtaggagctggctgcccctgatccaagtgccccaggacacagaccacctgtctccaag
                     Squirrel  -------------------------------------------------------------------aag
       Lesser Egyptian jerboa  -------------------------------------------------------------------aaa
                 Prairie vole  -------------------------------------------------------------------aag
              Chinese hamster  -------------------------------------------------------------------aaa
               Golden hamster  -------------------------------------------------------------------aaa
                        Mouse  -------------------------------------------------------------------ac-
                          Rat  -------------------------------------------------------------------ac-
               Naked mole-rat  -------------------------------------------------------------------aag
                   Guinea pig  -------------------------------------------------------------------atg
                   Chinchilla  -------------------------------------------------------------------aag
             Brush-tailed rat  -------------------------------------------------------------------aag
                       Rabbit  -------------------------------------------------------------------acg
                          Pig  -------------------------------------------------------------------aag
                       Alpaca  -------------------------------------------------------------------aag
               Bactrian camel  -------------------------------------------------------------------aag
                      Dolphin  -------------------------------------------------------------------aag
                 Killer whale  -------------------------------------------------------------------aag
                        Horse  -------------------------------------------------------------------aag
             White rhinoceros  -------------------------------------------------------------------aag
                          Cat  -------------------------------------------------------------------aag
                          Dog  -------------------------------------------------------------------aaa
                      Ferret   -------------------------------------------------------------------aaa
                        Panda  -------------------------------------------------------------------aaa
               Pacific walrus  -------------------------------------------------------------------aaa
                 Weddell seal  -------------------------------------------------------------------aaa
             Black flying-fox  -------------------------------------------------------------------aag
                Big brown bat  -------------------------------------------------------------------aag
         David's myotis (bat)  -------------------------------------------------------------------aag
                     Microbat  -------------------------------------------------------------------aag
                     Hedgehog  -------------------------------------------------------------------cag
                        Shrew  -------------------------------------------------------------------ggg
              Star-nosed mole  -------------------------------------------------------------------aag
                     Elephant  -------------------------------------------------------------------aac
          Cape elephant shrew  -------------------------------------------------------------------aag
                      Manatee  -------------------------------------------------------------------aag
             Cape golden mole  -------------------------------------------------------------------aag
                       Tenrec  -------------------------------------------------------------------aag
                     Aardvark  -------------------------------------------------------------------gag
                    Armadillo  -------------------------------------------------------------------aag
                         Pika  ======================================================================
              Tasmanian devil  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
     Chinese softshell turtle  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                          Cow  ======================================================================

                        Human  cc--c-ta-ctgttt-
                        Chimp  cc--c-ta-ctgttt-
                      Gorilla  cc--c-ta-ctgttt-
                    Orangutan  cc--c-ta-ctgttt-
                       Gibbon  cc--c-ta-ctgttt-
                       Rhesus  cc--c-ta-ctgttt-
          Crab-eating macaque  cc--c-ta-ctgttt-
                       Baboon  cc--c-ta-ctgttt-
                 Green monkey  cc--c-ta-ctgttt-
                     Marmoset  cc--c-tt-cttttt-
              Squirrel monkey  cc--c-tt-cttttt-
                     Bushbaby  at--c-t-----ttc-
           Chinese tree shrew  cc--c-ta-ct-tta-
                     Squirrel  cc-------tttgtg-
       Lesser Egyptian jerboa  accca-aa-aagttt-
                 Prairie vole  cc-----a-tgtttt-
              Chinese hamster  cc-----a-tgtttt-
               Golden hamster  cc-----a-tgtttt-
                        Mouse  ct-----a-tgcttt-
                          Rat  ct-----g-ggtttt-
               Naked mole-rat  cc--t-ta-cttgtt-
                   Guinea pig  tc--t-ta-cttttt-
                   Chinchilla  cc--t-ta-cttttt-
             Brush-tailed rat  cc--c-ta-cttttt-
                       Rabbit  tc--c-ca-ctttgt-
                          Pig  ct--t-ga-cgtttt-
                       Alpaca  cc--c-tg-cttttg-
               Bactrian camel  cc--c-tg-cttttg-
                      Dolphin  cc--ctta-cttttt-
                 Killer whale  cc--c-ta-cttttt-
                        Horse  ct--c-ta-cttttt-
             White rhinoceros  cc--c-ta-cttttt-
                          Cat  cc--c-ta-cgtttt-
                          Dog  cc--c-ta-attctt-
                      Ferret   cc--c-ta-cttttt-
                        Panda  cc--c-ta-cttttt-
               Pacific walrus  cc--c-ta-cttttt-
                 Weddell seal  cc--c-ta-cttttt-
             Black flying-fox  cc--c-ta-cttttt-
                Big brown bat  ct--c-ta-tttttt-
         David's myotis (bat)  ct--c-ta-tttttt-
                     Microbat  ct--c-ta-tttttt-
                     Hedgehog  gc--t-gt-ctatg--
                        Shrew  a---------------
              Star-nosed mole  cc--c-ca-ctctgt-
                     Elephant  cc--c-gactttttct
          Cape elephant shrew  cc--c-aa-ttttctt
                      Manatee  cc--c-gactttttct
             Cape golden mole  cc--a-ga-ctctttt
                       Tenrec  cc--t-ga-ctttctt
                     Aardvark  ct--g-accttttttt
                    Armadillo  ca--c-ta--cgtttt
                         Pika  ================
              Tasmanian devil  ================
               Painted turtle  ================
              Green seaturtle  ================
           American alligator  ================
                       Lizard  ================
             Peregrine falcon  ================
                 Saker falcon  ================
                      Megabat  NNNNNNNNNNNNNNNN
     Chinese softshell turtle  ================
                Domestic goat  ================
                        Sheep  ================
             Tibetan antelope  ================
                          Cow  ================

Inserts between block 24 and 25 in window
B D                  Dolphin 50bp
                Killer whale 117bp
B D                      Cat 2bp
B D                      Dog 6bp
B D                  Ferret  11bp
B D                    Panda 235bp
              Pacific walrus 401bp
                Weddell seal 413bp

Alignment block 25 of 1399 in window, 53760088 - 53760105, 18 bps 
B D                     Human  gaa-tatc--tc----------cattccaga
B D                     Chimp  gaa-tatc--tc----------cattccaga
B D                   Gorilla  gaa-tatc--tc----------cattccaga
B D                 Orangutan  gaa-tatc--tc----------cattccaga
B D                    Gibbon  gaa-tatc--tc----------cattccaga
B D                    Rhesus  gaa-tatc--tc----------cattccaga
B D       Crab-eating macaque  gaa-tatc--tc----------cattccaga
B D                    Baboon  gaa-tatc--tc----------cattccaga
B D              Green monkey  gaa-tatc--tc----------cattccaga
B D                  Marmoset  aaa-tatc--tc----------cattccaga
B D           Squirrel monkey  gaa-tatc--tc----------cattccaga
B D                  Bushbaby  aga-tatc--tc----------cattctagg
           Chinese tree shrew  gaa-tgtc--tc----------cattctaga
B D                  Squirrel  aaa-aatc--tc----------cattctaga
       Lesser Egyptian jerboa  gaa-agtt--tt----------ctttctaga
                 Prairie vole  gaa-agtc--tc----------cagagtagg
B D           Chinese hamster  taa-agtc--tt----------cagagtaga
               Golden hamster  taa-ggtc--tt----------cagagtaga
B D                     Mouse  gaa-agtc--tc----------cagagcaga
B D                       Rat  ga-----------------------------
B D            Naked mole-rat  gaa-tgtg--tg----------tgttctaga
B D                Guinea pig  gaa-tgtc--tg----------cattctaga
                   Chinchilla  gga-tgtc--tg----------cagtctagt
             Brush-tailed rat  gaa-agtc--tg----------cattctaga
B D                    Rabbit  cacttgtg--tc----------caccctgga
B D                       Pig  gaa-tgtc--ta-------------------
B D                    Alpaca  gaa-tgtc--ta-------------------
               Bactrian camel  gaa-tgtc--ta-------------------
B D                   Dolphin  gcc-tctc--ccattgcgga-----------
                 Killer whale  gat-cttc--ccggaccggg-----------
B D                     Horse  gaa-tggc--ta-------------------
B D          White rhinoceros  gaa-tgtc--ta-------------------
B D                       Cat  --a-tgtc--ta-------------------
B D                       Dog  --a-gatt--ta-------------------
B D                   Ferret   --a-gatt--ta-------------------
             Black flying-fox  gaa-tgtc--ta-------------------
                Big brown bat  gaa-cgcc--tc-------------------
         David's myotis (bat)  gaa-cgcc--ta-------------------
B D                  Microbat  gaa-cgcc--ta-------------------
B D                  Hedgehog  tag-ggcc--tc--------ca---------
B D                     Shrew  gaa-cgtc--cc--------ca---------
              Star-nosed mole  gaa-tgtctatc--------ca---------
B D                  Elephant  gaa-tgtc--ta----------gattttaga
          Cape elephant shrew  gaa-catc--ta----------gattctaga
B D                   Manatee  gaa-tgtc--ta----------gattctagg
             Cape golden mole  gaa-tgtc--ta----------gaatctaga
B D                    Tenrec  gaa-ggtc---a----------gatcctggt
                     Aardvark  gaa-tgtc--ta----------gattctaga
B D                 Armadillo  aaa-tatc--ta----------gattctaga
B D                      Pika  ===============================
B D           Tasmanian devil  ===============================
  D            Painted turtle  ===============================
  D           Green seaturtle  ===============================
B D        American alligator  ===============================
B D                    Lizard  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ===============================
B D                     Panda  ===============================
               Domestic goat  ===============================
B D                     Sheep  ===============================
            Tibetan antelope  ===============================
              Pacific walrus  ===============================
                Weddell seal  ===============================
B D                       Cow  ===============================

Inserts between block 25 and 26 in window
B D                  Dolphin 173bp
                Killer whale 89bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Dog 185bp
B D                  Ferret  11bp

Alignment block 26 of 1399 in window, 53760106 - 53760107, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  ta
B D                  Squirrel  aa
       Lesser Egyptian jerboa  ga
                 Prairie vole  ga
B D           Chinese hamster  ga
               Golden hamster  ga
B D                     Mouse  ga
B D            Naked mole-rat  ca
B D                Guinea pig  ca
                   Chinchilla  ca
             Brush-tailed rat  ca
B D                    Rabbit  ga
B D                       Pig  gt
B D                    Alpaca  ga
               Bactrian camel  ga
B D                   Dolphin  ga
                 Killer whale  ga
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  ga
B D                       Dog  ga
B D                   Ferret   ga
B D                     Panda  ga
               Pacific walrus  ga
                 Weddell seal  ga
             Black flying-fox  ga
                Big brown bat  ga
         David's myotis (bat)  ga
B D                  Microbat  ga
B D                  Elephant  gc
          Cape elephant shrew  tc
B D                   Manatee  gc
             Cape golden mole  gc
B D                    Tenrec  gc
                     Aardvark  gt
B D                 Armadillo  ga
B D                  Hedgehog  --
B D                      Pika  ==
B D                     Shrew  --
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                   Megabat  NN
  D  Chinese softshell turtle  ==
B D                       Rat  --
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
             Star-nosed mole  --
B D                       Cow  ==

Inserts between block 26 and 27 in window
B D                  Ferret  197bp

Alignment block 27 of 1399 in window, 53760108 - 53760139, 32 bps 
B D                     Human  gc--aggaaactc--tgtag-------------------gcaggg-----a---ctatatctt
B D                     Chimp  gc--aggaaactc--tgtag-------------------gcaggg-----a---ctatatctt
B D                   Gorilla  gc--aggaaactc--tgtag-------------------gcaggg-----a---ctatatctt
B D                 Orangutan  gc--aggaagctc--tgtag-------------------gcaggg-----a---ctatatctt
B D                    Gibbon  gc--aggaaactc--tgtaa-------------------gcaggg-----a---ctatatctt
B D                    Rhesus  gc--aggaaactc--agtag-------------------gcaggg-----a---ctatatctt
B D       Crab-eating macaque  gc--aggaaactc--agtag-------------------gcaggg-----a---ctatatctt
B D                    Baboon  gc--aggaaactc--tgtag-------------------gcaggg-----a---ctatatctt
B D              Green monkey  gc--aggaaactc--tgtag-------------------gcaggg-----a---ctatatctt
B D                  Marmoset  gc--aggaaactc--tgtag-------------------gcaggg-----a---ctgtatctt
B D           Squirrel monkey  gc--aggaaactc--tgtag-------------------gcaggg-----a---ctgtatctt
B D                  Bushbaby  gc--aggatgctg--tctag-------------------gcaggg-----a---ccatgtctt
           Chinese tree shrew  gc--aggaaacac--cctag-------------------gcaggg-----a---ctatatctt
B D                  Squirrel  gc--aggaggccc--tgtaa-------------------gcaggg-----t---ttgtatctt
       Lesser Egyptian jerboa  ac--agggagcta--tgca--------------------gcaggg-----a---ct-------
                 Prairie vole  tc--aggaagctg--tcctg-------------------gcaagg-----a---ct-------
B D           Chinese hamster  gc--aggaagctg--tccag-------------------gtaggg-----a---ct-------
               Golden hamster  gc--atgaagctg--tccag-------------------gcaggg-----a---ct-------
B D                     Mouse  aaacaggaagctg--tccaa-------------------gcaggg-----a---ct-------
B D                       Rat  ----agaaaacta--tccat-------------------gcaggg-----a---ct-------
B D            Naked mole-rat  gt--aggaagct---cttgg-------------------gcaggg-----a---ctgtatctt
B D                Guinea pig  gc--aggaagct---cctgg-------------------gcaggg-----a---ctgtatctt
                   Chinchilla  gc--aggaagct---cctgg-------------------acacgg-----a---ctgtatcct
             Brush-tailed rat  gt--aggaagct---cctgg-------------------acaaggactgaa---ctgtatctt
B D                    Rabbit  ac--agaagcctg--cct---------------------gcaggg-----a---ct-gatctt
B D                       Pig  gc--aggaagctc--tccgggaaagaatgtagagatacagcaggg-----t---ctgtatc--
B D                    Alpaca  gc--aggaagccc--tccag-------------------gcaagg-----a---ctatttc--
               Bactrian camel  gc--aggaagccc--tccag-------------------gcaagg-----a---ctatatc--
B D                   Dolphin  gc--aggaagctc--tctag-------------------gcaggg-----a---ctgtagc--
                 Killer whale  gc--aggaagctc--tctag-------------------gcaggg-----a---ctgtagc--
B D                     Horse  gc--aggaagctc--tctag-------------------gcaggg-----a---ctatatctt
B D          White rhinoceros  gc--aggaaggtc--tctag-------------------gcaggg-----a---ctatatctt
B D                       Cat  gc--aggaacctc--tccgg-------------------gcaggg-----a---ctgtatctg
B D                       Dog  gc--aggaagctc--tggaa-------------------gtaggg-----a---gagcttcct
B D                   Ferret   gc--aggaagttc--tctag-------------------gtaggg-----a---ctgtatctt
B D                     Panda  gc--aggaagctc--tctag-------------------gtaggg-----a---tggtatctt
               Pacific walrus  gc--aggaagctc--tctag-------------------gtaggg-----a---ctgtatctt
                 Weddell seal  gc--aggaagctc--tctag-------------------ataggg-----a---ctgtatctt
             Black flying-fox  ac--aggaagctc--tctag-------------------gcaagg-----a---ctttatctt
                Big brown bat  gc--aggaagctc--tctag-------------------gaagtg-----a---ctgtctctt
         David's myotis (bat)  gc--aggaagctc--tctag-------------------gcaggg-----a---ctctatctt
B D                  Microbat  gc--aggaagctc--tccag-------------------gcaggg-----g---ctctatctt
B D                  Hedgehog  ------------------------------------------------------ctccacct-
B D                     Shrew  -------------------g-------------------ggtaga-----atgtctctgcctc
              Star-nosed mole  -------------------g-------------------gcgggg-----a---ctctacctt
B D                  Elephant  ac--aggaaacttgtggaag-------------------ggagag-----a---ctgtctctt
          Cape elephant shrew  ac--aggaagtttgtggaag-------------------gcagct-----g---ctatatatt
B D                   Manatee  ac--aggaagcttgtggaaa-------------------gcagag-----a---ctatatctt
             Cape golden mole  ac--atgaagcttgtggaag-------------------gcagag-----g---cta------
B D                    Tenrec  tg--aagacactcgtggaag-------------------gcagag-----a---caagatcct
                     Aardvark  gc--aggaagtttgtggaag-------------------gtagag-----g---ctatatctt
B D                 Armadillo  gc--aggaagcttgttgaag-------------------gcaggt-----g---ccatatctt
B D                      Pika  ===============================================================
B D           Tasmanian devil  ===============================================================
  D            Painted turtle  ===============================================================
  D           Green seaturtle  ===============================================================
B D        American alligator  ===============================================================
B D                    Lizard  ===============================================================
  D          Peregrine falcon  ===============================================================
  D              Saker falcon  ===============================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D  Chinese softshell turtle  ===============================================================
               Domestic goat  ===============================================================
B D                     Sheep  ===============================================================
            Tibetan antelope  ===============================================================
B D                       Cow  ===============================================================

Alignment block 28 of 1399 in window, 53760140 - 53760141, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  tt
           Chinese tree shrew  tt
B D                  Squirrel  tt
B D            Naked mole-rat  tt
B D                Guinea pig  tt
                   Chinchilla  tt
             Brush-tailed rat  tt
B D                    Rabbit  tt
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  ct
                 Killer whale  ct
B D                     Horse  tt
B D          White rhinoceros  tt
B D                       Cat  tt
B D                       Dog  tt
B D                   Ferret   tt
B D                     Panda  tt
               Pacific walrus  tc
                 Weddell seal  tt
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tt
B D                  Microbat  tt
B D                     Shrew  -c
              Star-nosed mole  -c
B D                  Elephant  tt
          Cape elephant shrew  tt
B D                   Manatee  tt
B D                    Tenrec  tt
                     Aardvark  tt
B D                 Armadillo  tt
B D                  Hedgehog  --
B D                      Pika  ==
              Golden hamster  --
B D           Tasmanian devil  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
      Lesser Egyptian jerboa  --
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
            Cape golden mole  --
B D           Chinese hamster  --
                Prairie vole  --
  D  Chinese softshell turtle  ==
B D                       Rat  --
B D                     Mouse  --
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D                       Cow  ==

Inserts between block 28 and 29 in window
B D                   Tenrec 1632bp

Alignment block 29 of 1399 in window, 53760142 - 53760177, 36 bps 
B D                     Human  tca-------tctttattt-cctccatc--------------acaataatca-atgagt
B D                     Chimp  tca-------tctttattt-cctccatc--------------acaataatca-atgagt
B D                   Gorilla  tca-------tctttatct-cctccatc--------------acaataatca-atgagt
B D                 Orangutan  tca-------tctttattt-cctccatc--------------acaataatca-atgagt
B D                    Gibbon  tca-------tttttattt-cctccatc--------------acaataatca-atgagt
B D                    Rhesus  tca-------tctttattt-cctccatc--------------acaataatca-atgagt
B D       Crab-eating macaque  tca-------tctttattt-cctccatc--------------acaataatca-atgagt
B D                    Baboon  tca-------tctttattt-cctccatc--------------acaataatca-atgagt
B D              Green monkey  tca-------tctttattt-cctccatc--------------acaataatca-atgagt
B D                  Marmoset  tca-------tctttattt-cctccatc--------------gcaataatca-atgagt
B D           Squirrel monkey  tca-------tctttattt-cctctatc--------------acaataatca-atgagt
B D                  Bushbaby  tca-------tctttattt-cctccatg--------------acaatgctcc-atgagc
           Chinese tree shrew  tca-------tctttattt-cctccacc--------------actatgctca-gtgact
B D                  Squirrel  tttttttgaatctgtactt-cctccacc--------------acaatgctca-ataaat
       Lesser Egyptian jerboa  ----------gtcttattt-acttcccc--------------acatggctca-ccaaat
                 Prairie vole  ----------tccttattt-cctggtcccctcag--------tgaatg-tag-gtgagt
B D           Chinese hamster  ----------tccttattt-cctgttccactca---------tgagtgctca-gtgaat
               Golden hamster  ----------tccttattt-cctgttccactca---------caagtgctca-gtgagt
B D                     Mouse  ----------tccttatct-gctgctcc--------------atggtgctcaggtgag-
B D                       Rat  ----------tctttatct-ccggctcc--------------atggcgctca-gtgag-
B D            Naked mole-rat  t-a-------tcttgattt-cctccacc--------------acagtgctca-atgagt
B D                Guinea pig  tca-------tcttgatat-cctccacc--------------acag--------tgagt
                   Chinchilla  tcc-------tcttggttt-cctccacc--------------acggtgctca-aggagt
             Brush-tailed rat  tca-------tcttaattt-tctccacc--------------ccagggctca-gtgaat
B D                    Rabbit  t---------tccttgtta-ccccctccccact---------gtgatgctac-ttggtt
B D                       Pig  tca-------tctttactt-cctctagc--------------aaaatacctg-gtgcat
B D                    Alpaca  tca-------tctctgttt-cctctagc--------------acaatactca-gcgcct
               Bactrian camel  tca-------tctctgttt-cctctagc--------------acaatactca-gcgcct
B D                   Dolphin  tca-------tctttattt-cctctagc--------------acaatactca-gtgcat
                 Killer whale  tca-------tctttattt-cctctagc--------------acaatactca-gtgcat
B D                     Horse  tca-------tattttttt-cctccagc--------------acaatgctca-acgcat
B D          White rhinoceros  tca-------tatttttttccctccagc--------------acaatgctca-acgcat
B D                       Cat  tc----------tttattt-cttgcagc--------------acaatgctca-atgcac
B D                       Dog  cc----------tttattt-cccccagc--------------acaaggct-g-atgcat
B D                   Ferret   tc----------tttattt-cctccagt--------------acaatgctca-atgcat
B D                     Panda  tc----------tttattt-cctccaac--------------acaatgctca-atgcat
               Pacific walrus  tc----------tttattt-cctccagc--------------acaatgctca-atgcat
                 Weddell seal  tc----------tttattt-cctctagc--------------acaatgctca-atgcat
             Black flying-fox  tca-------tctctattt-cctccagc--------------gc-------a-atgcat
B D                   Megabat  ttc-------tctctattt-cctccagc--------------gc-------a-atgcat
                Big brown bat  tca-------tatttattt-cctcccgc--------------ac-------a-aggcat
         David's myotis (bat)  tca-------tatttattt-cctccagc--------------ac-------a-atgcat
B D                  Microbat  tca-------tatttattt-cctccagc--------------ac-------g-aggcat
B D                  Hedgehog  -------------tcacta-cccccagccaaccaggcagcaggtactgctta-ggat--
B D                     Shrew  ggg----------tccttc-cctctggc--------------gtggtactca-gtcc--
              Star-nosed mole  tcg-------cttttattt-cttccagc--------------ttaatgctca-acgcat
B D                  Elephant  tca-------cctttgttt-tctccagc--------------ataatgttgg-atgtat
          Cape elephant shrew  ----------cctttatct-tttccaga--------------caaatgtcga-acacat
B D                   Manatee  tca-------tctttattt-tctcaagc--------------ataatgttga-gtgcat
             Cape golden mole  -ca-------tctttattt-tctccagc--------------ataaggctga-atgcat
                     Aardvark  cca-------tctttattt-tctccagc--------------acaatgttga-atgcat
B D                 Armadillo  tcc-------tccttattt-cctccagc--------------acaacactct-atgtgc
B D                      Pika  ===========================================================
B D           Tasmanian devil  ===========================================================
  D            Painted turtle  ===========================================================
  D           Green seaturtle  ===========================================================
B D        American alligator  ===========================================================
B D                    Lizard  ===========================================================
  D          Peregrine falcon  ===========================================================
  D              Saker falcon  ===========================================================
B D                    Tenrec  ===========================================================
  D  Chinese softshell turtle  ===========================================================
               Domestic goat  ===========================================================
B D                     Sheep  ===========================================================
            Tibetan antelope  ===========================================================
B D                       Cow  ===========================================================

Inserts between block 29 and 30 in window
B D                  Manatee 182bp
                    Aardvark 74bp

Alignment block 30 of 1399 in window, 53760178 - 53760179, 2 bps 
B D                     Human  -ag
B D                     Chimp  -ag
B D                   Gorilla  -ag
B D                 Orangutan  -ag
B D                    Gibbon  -ag
B D                    Rhesus  -at
B D       Crab-eating macaque  -at
B D                    Baboon  -at
B D              Green monkey  -at
B D                  Marmoset  -at
B D           Squirrel monkey  -at
B D                  Bushbaby  -at
           Chinese tree shrew  -at
B D                  Squirrel  -at
       Lesser Egyptian jerboa  -gt
                 Prairie vole  -at
B D           Chinese hamster  -at
               Golden hamster  -ac
B D                     Mouse  -at
B D                       Rat  -at
B D            Naked mole-rat  -at
B D                Guinea pig  -at
                   Chinchilla  -gt
             Brush-tailed rat  -at
B D                    Rabbit  -gt
B D                       Pig  -at
B D                    Alpaca  -at
               Bactrian camel  -at
B D                   Dolphin  -at
                 Killer whale  -at
B D                     Horse  -at
B D          White rhinoceros  -at
B D                       Cat  -at
B D                       Dog  -at
B D                   Ferret   -at
B D                     Panda  -at
               Pacific walrus  -at
                 Weddell seal  -at
             Black flying-fox  -at
B D                   Megabat  -at
                Big brown bat  -at
         David's myotis (bat)  -at
B D                  Microbat  -at
              Star-nosed mole  -a-
B D                  Elephant  -a-
          Cape elephant shrew  -t-
B D                   Manatee  -a-
             Cape golden mole  -g-
                     Aardvark  ag-
B D                 Armadillo  -a-
B D                  Hedgehog  ---
B D                      Pika  ===
B D                     Shrew  ---
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                    Tenrec  ===
  D  Chinese softshell turtle  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
B D                       Cow  ===

Inserts between block 30 and 31 in window
B D                 Elephant 1bp
         Cape elephant shrew 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 146bp
B D                Armadillo 1bp

Alignment block 31 of 1399 in window, 53760180 - 53760187, 8 bps 
B D                     Human  t-----cagtta---a
B D                     Chimp  t-----cagtta---a
B D                   Gorilla  t-----cagtta---a
B D                 Orangutan  t-----cagtta---a
B D                    Gibbon  t-----cagtta---a
B D                    Rhesus  t-----cagtta---a
B D       Crab-eating macaque  t-----cagtta---a
B D                    Baboon  t-----cagtta---a
B D              Green monkey  t-----cagtta---a
B D                  Marmoset  t-----cagtta---a
B D           Squirrel monkey  t-----cagtta---a
B D                  Bushbaby  t-----cagtta---a
           Chinese tree shrew  c-----tggtta---g
B D                  Squirrel  t-----cggtaa---a
       Lesser Egyptian jerboa  t-----ctgcta---a
                 Prairie vole  t-----ctgcta---a
B D           Chinese hamster  t-----ctgcta---a
               Golden hamster  t-----ctgctt---a
B D                     Mouse  t-----ctgctg---a
B D                       Rat  t-----ctgctg---a
B D            Naked mole-rat  t-----ccctta---g
B D                Guinea pig  c-----ccctta---g
                   Chinchilla  t-----cccata---g
             Brush-tailed rat  t-----cctttc---a
B D                    Rabbit  cacacactgttc---a
B D                       Pig  t-----cagtta---g
B D                    Alpaca  t-----tggtca---g
               Bactrian camel  t-----tggtta---g
B D                   Dolphin  t-----cactta---g
                 Killer whale  t-----cactta---g
B D                     Horse  t-----tggtta---g
B D          White rhinoceros  t-----cactta---g
B D                       Cat  t-----ctgtta---g
B D                       Dog  t-----ca-cta---g
B D                   Ferret   c-----aggtta---g
B D                     Panda  t-----cagtta---g
               Pacific walrus  t-----tagtta---g
                 Weddell seal  t-----taatta---g
             Black flying-fox  t-----cagtta---g
B D                   Megabat  t-----cagtta---g
                Big brown bat  t-----cagcta---g
         David's myotis (bat)  t-----cagtta---g
B D                  Microbat  t-----cagtta---g
B D                  Hedgehog  --------atta---g
B D                     Shrew  -------agttaaccg
              Star-nosed mole  -------agtta---g
B D                  Elephant  t-----aaatta---a
          Cape elephant shrew  t-----ccatta---a
B D                   Manatee  t-----caatta---g
             Cape golden mole  t-----caatta---a
                     Aardvark  t-----caatta---a
B D                 Armadillo  t-----ccatta---a
B D                      Pika  ================
B D           Tasmanian devil  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D        American alligator  ================
B D                    Lizard  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
B D                    Tenrec  ================
  D  Chinese softshell turtle  ================
               Domestic goat  ================
B D                     Sheep  ================
            Tibetan antelope  ================
B D                       Cow  ================

Inserts between block 31 and 32 in window
B D                 Elephant 220bp

Alignment block 32 of 1399 in window, 53760188 - 53760188, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  c
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  c
B D                Guinea pig  g
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  c
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  g
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  c
B D                   Manatee  c
             Cape golden mole  c
                     Aardvark  c
B D                 Armadillo  c
B D                      Pika  =
B D           Tasmanian devil  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
         Cape elephant shrew  -
B D                    Tenrec  =
  D  Chinese softshell turtle  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D                       Cow  =

Inserts between block 32 and 33 in window
            Cape golden mole 221bp

Alignment block 33 of 1399 in window, 53760189 - 53760203, 15 bps 
B D                     Human  atatgctgtgaatga
B D                     Chimp  atatgctgtgaatgc
B D