Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 308 in window, 45490224 - 45490228, 5 bps 
B D                     Human  tggga
B D                     Chimp  tggga
B D                   Gorilla  tggga
B D                 Orangutan  tggga
B D                    Gibbon  tgaga
B D                    Rhesus  tggga
B D       Crab-eating macaque  tggga
B D                    Baboon  tggga
B D              Green monkey  tgtga
B D                  Marmoset  tggga
B D           Squirrel monkey  tggga
B D                  Bushbaby  tggga
B D                    Rabbit  ctagc
B D                     Horse  aca--
         David's myotis (bat)  tga--
B D                  Microbat  tga--
B D                    Tenrec  =====
      Lesser Egyptian jerboa  =====
B D                  Hedgehog  =====
         Cape elephant shrew  =====
B D                      Pika  NNNNN
B D                       Rat  =====
B D                     Mouse  =====
              Golden hamster  =====
B D                     Shrew  =====
B D           Chinese hamster  NNNNN
             Star-nosed mole  =====
                Prairie vole  =====
               Big brown bat  =====
B D                    Lizard  =====
B D                   Manatee  -----
B D                     Panda  =====
B D                   Ferret   -----
B D                       Dog  =====
B D              Atlantic cod  =====
          Southern platyfish  =====
                 Zebra mbuna  =====
B D              Nile tilapia  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
                 Spotted gar  =====
B D             X. tropicalis  =====
B D                 Zebrafish  =====
B D                Coelacanth  =====
  D               Rock pigeon  =====
B D        American alligator  -----
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
  D             Scarlet macaw  -----
B D                    Medaka  -----
  D              Mallard duck  =====
B D                 Tetraodon  =====
B D               Stickleback  =====
  D       Collared flycatcher  -----
B D                    Turkey  =====
B D                   Chicken  =====
B D                   Wallaby  =====
            Cape golden mole  =====
  D    Spiny softshell turtle  -----
  D  Chinese softshell turtle  =====
          Tibetan ground jay  =====
B D                Budgerigar  -----
  D          Peregrine falcon  -----
  D              Saker falcon  -----
  D                    Parrot  -----
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
B D               Zebra finch  =====
B D           Tasmanian devil  =====
  D            Painted turtle  -----
  D           Green seaturtle  =====
B D                   Dolphin  -----
B D                  Platypus  =====
B D                       Cow  =====
               Domestic goat  =====
B D                     Sheep  =====
            Tibetan antelope  =====
                Killer whale  -----
B D                   Megabat  =====
B D                       Pig  =====
B D                 Armadillo  -----
B D                    Alpaca  =====
              Bactrian camel  =====
B D                   Opossum  =====
                Weddell seal  =====
                    Aardvark  -----
            Black flying-fox  -----
B D                  Squirrel  -----
B D                       Cat  -----
B D                  Elephant  =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
          Chinese tree shrew  =====
              Pacific walrus  -----
B D          White rhinoceros  =====

Inserts between block 1 and 2 in window
B D                    Horse 1bp
        David's myotis (bat) 1bp
B D                 Microbat 92bp

Alignment block 2 of 308 in window, 45490229 - 45490239, 11 bps 
B D                     Human  ccataggcacg
B D                     Chimp  ccataggcacg
B D                   Gorilla  ccataggcacg
B D                 Orangutan  ccacaggcacg
B D                    Gibbon  ccacaggcagg
B D                    Rhesus  ccacaggcacg
B D       Crab-eating macaque  ccacaggcacg
B D                    Baboon  ccacaggcacg
B D              Green monkey  ccacaggcacg
B D                  Marmoset  ccacaggtacg
B D           Squirrel monkey  ccacaggcatg
B D                  Bushbaby  ccataggta-g
B D                    Rabbit  cca---gcact
B D                     Horse  ccagaggcact
                 Weddell seal  ------ggacc
B D                    Tenrec  ===========
      Lesser Egyptian jerboa  ===========
B D                  Hedgehog  ===========
         Cape elephant shrew  ===========
B D                      Pika  NNNNNNNNNNN
B D                       Rat  ===========
B D                     Mouse  ===========
              Golden hamster  ===========
B D                     Shrew  ===========
B D           Chinese hamster  NNNNNNNNNNN
             Star-nosed mole  ===========
                Prairie vole  ===========
B D                  Microbat  ===========
        David's myotis (bat)  ===========
               Big brown bat  ===========
B D                    Lizard  ===========
B D                   Manatee  -----------
B D                     Panda  ===========
B D                   Ferret   -----------
B D                       Dog  ===========
B D              Atlantic cod  ===========
          Southern platyfish  ===========
                 Zebra mbuna  ===========
B D              Nile tilapia  ===========
         Pundamilia nyererei  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
                 Spotted gar  ===========
B D             X. tropicalis  ===========
B D                 Zebrafish  ===========
B D                Coelacanth  ===========
  D               Rock pigeon  ===========
B D        American alligator  -----------
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
  D             Scarlet macaw  -----------
B D                    Medaka  -----------
  D              Mallard duck  ===========
B D                 Tetraodon  ===========
B D               Stickleback  ===========
  D       Collared flycatcher  -----------
B D                    Turkey  ===========
B D                   Chicken  ===========
B D                   Wallaby  ===========
            Cape golden mole  ===========
  D    Spiny softshell turtle  -----------
  D  Chinese softshell turtle  ===========
          Tibetan ground jay  ===========
B D                Budgerigar  -----------
  D          Peregrine falcon  -----------
  D              Saker falcon  -----------
  D                    Parrot  -----------
B D       Medium ground finch  ===========
  D    White-throated sparrow  ===========
B D               Zebra finch  ===========
B D           Tasmanian devil  ===========
  D            Painted turtle  -----------
  D           Green seaturtle  ===========
B D                   Dolphin  -----------
B D                  Platypus  ===========
B D                       Cow  ===========
               Domestic goat  ===========
B D                     Sheep  ===========
            Tibetan antelope  ===========
                Killer whale  -----------
B D                   Megabat  ===========
B D                       Pig  ===========
B D                 Armadillo  -----------
B D                    Alpaca  ===========
              Bactrian camel  ===========
B D                   Opossum  ===========
                    Aardvark  -----------
            Black flying-fox  -----------
B D                  Squirrel  -----------
B D                       Cat  -----------
B D                  Elephant  ===========
B D                Guinea pig  ===========
            Brush-tailed rat  ===========
B D            Naked mole-rat  ===========
                  Chinchilla  ===========
          Chinese tree shrew  ===========
              Pacific walrus  -----------
B D          White rhinoceros  ===========

Inserts between block 2 and 3 in window
B D                    Horse 52bp

Alignment block 3 of 308 in window, 45490240 - 45490261, 22 bps 
B D                     Human  agccaccgtgcctggctaa--ttt
B D                     Chimp  agccaccgtgcctggctaa--ttt
B D                   Gorilla  agccaccgtgcctggctaa--ttt
B D                 Orangutan  agccaccgtgcctggctaa--ttt
B D                    Gibbon  agccaccatgcctggctaa--ttt
B D                    Rhesus  agccactgtgccaggctaa--ttt
B D       Crab-eating macaque  agccactgtgccaggctaa--ttt
B D                    Baboon  agccactgtgccaggctaa--ttt
B D              Green monkey  agctaccgtgccaggctaa--ttt
B D                  Marmoset  ggccaccgtgcccagctaa--ttt
B D           Squirrel monkey  agccaccatgcccagttaa--ttt
B D                  Bushbaby  tgccacaatatccagcaaagtttt
B D                    Rabbit  gaccattgaggctactgag--gag
B D                    Tenrec  ========================
      Lesser Egyptian jerboa  ========================
B D                  Hedgehog  ========================
         Cape elephant shrew  ========================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNN
B D                       Rat  ========================
B D                     Mouse  ========================
              Golden hamster  ========================
B D                     Shrew  ========================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNN
             Star-nosed mole  ========================
                Prairie vole  ========================
B D                  Microbat  ========================
        David's myotis (bat)  ========================
               Big brown bat  ========================
B D                    Lizard  ========================
B D                   Manatee  ------------------------
B D                     Panda  ========================
B D                   Ferret   ------------------------
B D                       Dog  ========================
B D              Atlantic cod  ========================
          Southern platyfish  ========================
                 Zebra mbuna  ========================
B D              Nile tilapia  ========================
         Pundamilia nyererei  ========================
       Burton's mouthbreeder  ========================
         Princess of Burundi  ========================
                 Spotted gar  ========================
B D             X. tropicalis  ========================
B D                 Zebrafish  ========================
B D                Coelacanth  ========================
  D               Rock pigeon  ========================
B D        American alligator  ------------------------
      Yellowbelly pufferfish  ========================
B D                      Fugu  ========================
  D             Scarlet macaw  ------------------------
B D                    Medaka  ------------------------
  D              Mallard duck  ========================
B D                 Tetraodon  ========================
B D               Stickleback  ========================
  D       Collared flycatcher  ------------------------
B D                    Turkey  ========================
B D                   Chicken  ========================
B D                   Wallaby  ========================
            Cape golden mole  ========================
  D    Spiny softshell turtle  ------------------------
  D  Chinese softshell turtle  ========================
          Tibetan ground jay  ========================
B D                Budgerigar  ------------------------
  D          Peregrine falcon  ------------------------
  D              Saker falcon  ------------------------
  D                    Parrot  ------------------------
B D       Medium ground finch  ========================
  D    White-throated sparrow  ========================
B D               Zebra finch  ========================
B D           Tasmanian devil  ========================
  D            Painted turtle  ------------------------
  D           Green seaturtle  ========================
B D                   Dolphin  ------------------------
B D                  Platypus  ========================
B D                       Cow  ========================
               Domestic goat  ========================
B D                     Sheep  ========================
            Tibetan antelope  ========================
                Killer whale  ------------------------
B D                   Megabat  ========================
B D                       Pig  ========================
B D                 Armadillo  ------------------------
B D                    Alpaca  ========================
              Bactrian camel  ========================
B D                   Opossum  ========================
                Weddell seal  ------------------------
                    Aardvark  ------------------------
            Black flying-fox  ------------------------
B D                  Squirrel  ------------------------
B D                       Cat  ------------------------
B D                  Elephant  ========================
B D                Guinea pig  ========================
            Brush-tailed rat  ========================
B D            Naked mole-rat  ========================
                  Chinchilla  ========================
          Chinese tree shrew  ========================
              Pacific walrus  ------------------------
B D          White rhinoceros  ========================
B D                     Horse  ========================

Alignment block 4 of 308 in window, 45490262 - 45490264, 3 bps 
B D                     Human  tta
B D                     Chimp  tta
B D                   Gorilla  tta
B D                 Orangutan  tta
B D                    Gibbon  tta
B D                    Rhesus  tta
B D       Crab-eating macaque  tta
B D                    Baboon  tta
B D              Green monkey  tta
B D                  Marmoset  tta
B D           Squirrel monkey  tta
B D                  Bushbaby  cta
B D                    Rabbit  tga
B D                   Dolphin  tag
                 Killer whale  tag
         David's myotis (bat)  -ta
                     Aardvark  --a
B D                    Tenrec  ===
      Lesser Egyptian jerboa  ===
B D                  Hedgehog  ===
         Cape elephant shrew  ===
B D                      Pika  NNN
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
B D                     Shrew  ===
B D           Chinese hamster  NNN
             Star-nosed mole  ===
                Prairie vole  ===
B D                  Microbat  ===
               Big brown bat  ===
B D                    Lizard  ===
B D                   Manatee  ---
B D                     Panda  ===
B D                   Ferret   ---
B D                       Dog  ===
B D              Atlantic cod  ===
          Southern platyfish  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
                 Spotted gar  ===
B D             X. tropicalis  ===
B D                 Zebrafish  ===
B D                Coelacanth  ===
  D               Rock pigeon  ===
B D        American alligator  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
  D             Scarlet macaw  ---
B D                    Medaka  ---
  D              Mallard duck  ===
B D                 Tetraodon  ===
B D               Stickleback  ===
  D       Collared flycatcher  ---
B D                    Turkey  ===
B D                   Chicken  ===
B D                   Wallaby  ===
            Cape golden mole  ===
  D    Spiny softshell turtle  ---
  D  Chinese softshell turtle  ===
          Tibetan ground jay  ===
B D                Budgerigar  ---
  D          Peregrine falcon  ---
  D              Saker falcon  ---
  D                    Parrot  ---
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ---
  D           Green seaturtle  ===
B D                  Platypus  ===
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
B D                   Megabat  ===
B D                       Pig  ===
B D                 Armadillo  ---
B D                    Alpaca  ===
              Bactrian camel  ===
B D                   Opossum  ===
                Weddell seal  ---
            Black flying-fox  ---
B D                  Squirrel  ---
B D                       Cat  ---
B D                  Elephant  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
          Chinese tree shrew  ===
              Pacific walrus  ---
B D          White rhinoceros  ===
B D                     Horse  ===

Inserts between block 4 and 5 in window
B D                   Rabbit 1bp

Alignment block 5 of 308 in window, 45490265 - 45490267, 3 bps 
B D                     Human  ttt
B D                     Chimp  ttt
B D                   Gorilla  ttt
B D                 Orangutan  ttt
B D                    Gibbon  ttt
B D                    Rhesus  ttt
B D       Crab-eating macaque  ttt
B D                    Baboon  ttt
B D              Green monkey  ttt
B D                  Marmoset  ttt
B D           Squirrel monkey  ttt
B D                  Bushbaby  ttt
B D                   Dolphin  ttt
                 Killer whale  ttt
                 Weddell seal  ttt
         David's myotis (bat)  ttt
                     Aardvark  ttt
B D                    Tenrec  ===
      Lesser Egyptian jerboa  ===
B D                  Hedgehog  ===
         Cape elephant shrew  ===
B D                      Pika  NNN
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
B D                     Shrew  ===
B D           Chinese hamster  NNN
             Star-nosed mole  ===
                Prairie vole  ===
B D                  Microbat  ===
               Big brown bat  ===
B D                    Lizard  ===
B D                    Rabbit  ===
B D                   Manatee  ---
B D                     Panda  ===
B D                   Ferret   ---
B D                       Dog  ===
B D              Atlantic cod  ===
          Southern platyfish  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
                 Spotted gar  ===
B D             X. tropicalis  ===
B D                 Zebrafish  ===
B D                Coelacanth  ===
  D               Rock pigeon  ===
B D        American alligator  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
  D             Scarlet macaw  ---
B D                    Medaka  ---
  D              Mallard duck  ===
B D                 Tetraodon  ===
B D               Stickleback  ===
  D       Collared flycatcher  ---
B D                    Turkey  ===
B D                   Chicken  ===
B D                   Wallaby  ===
            Cape golden mole  ===
  D    Spiny softshell turtle  ---
  D  Chinese softshell turtle  ===
          Tibetan ground jay  ===
B D                Budgerigar  ---
  D          Peregrine falcon  ---
  D              Saker falcon  ---
  D                    Parrot  ---
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ---
  D           Green seaturtle  ===
B D                  Platypus  ===
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
B D                   Megabat  ===
B D                       Pig  ===
B D                 Armadillo  ---
B D                    Alpaca  ===
              Bactrian camel  ===
B D                   Opossum  ===
            Black flying-fox  ---
B D                  Squirrel  ---
B D                       Cat  ---
B D                  Elephant  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
          Chinese tree shrew  ===
              Pacific walrus  ---
B D          White rhinoceros  ===
B D                     Horse  ===

Inserts between block 5 and 6 in window
B D             Green monkey 1bp
                Weddell seal 1bp
        David's myotis (bat) 1bp

Alignment block 6 of 308 in window, 45490268 - 45490269, 2 bps 
B D                     Human  tt-
B D                     Chimp  tt-
B D                   Gorilla  tt-
B D                 Orangutan  tt-
B D                    Gibbon  tt-
B D                    Rhesus  tt-
B D       Crab-eating macaque  tt-
B D                    Baboon  tt-
B D              Green monkey  tt-
B D                  Marmoset  tt-
B D           Squirrel monkey  tt-
B D                  Bushbaby  tt-
B D                  Squirrel  tt-
B D                    Rabbit  cc-
B D                   Dolphin  t--
                 Killer whale  t--
                 Weddell seal  c--
                     Aardvark  -ta
B D                    Tenrec  ===
      Lesser Egyptian jerboa  ===
B D                  Hedgehog  ===
         Cape elephant shrew  ===
B D                      Pika  NNN
B D                       Rat  ===
B D                     Mouse  ===
              Golden hamster  ===
B D                     Shrew  ===
B D           Chinese hamster  NNN
             Star-nosed mole  ===
                Prairie vole  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
               Big brown bat  ===
B D                    Lizard  ===
B D                   Manatee  ---
B D                     Panda  ===
B D                   Ferret   ---
B D                       Dog  ===
B D              Atlantic cod  ===
          Southern platyfish  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
                 Spotted gar  ===
B D             X. tropicalis  ===
B D                 Zebrafish  ===
B D                Coelacanth  ===
  D               Rock pigeon  ===
B D        American alligator  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
  D             Scarlet macaw  ---
B D                    Medaka  ---
  D              Mallard duck  ===
B D                 Tetraodon  ===
B D               Stickleback  ===
  D       Collared flycatcher  ---
B D                    Turkey  ===
B D                   Chicken  ===
B D                   Wallaby  ===
            Cape golden mole  ===
  D    Spiny softshell turtle  ---
  D  Chinese softshell turtle  ===
          Tibetan ground jay  ===
B D                Budgerigar  ---
  D          Peregrine falcon  ---
  D              Saker falcon  ---
  D                    Parrot  ---
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ---
  D           Green seaturtle  ===
B D                  Platypus  ===
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
B D                   Megabat  ===
B D                       Pig  ===
B D                 Armadillo  ---
B D                    Alpaca  ===
              Bactrian camel  ===
B D                   Opossum  ===
            Black flying-fox  ---
B D                       Cat  ---
B D                  Elephant  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
          Chinese tree shrew  ===
              Pacific walrus  ---
B D          White rhinoceros  ===
B D                     Horse  ===

Inserts between block 6 and 7 in window
B D                  Dolphin 2bp
                Killer whale 2bp
                Weddell seal 1bp

Alignment block 7 of 308 in window, 45490270 - 45490279, 10 bps 
B D                     Human  agaagagatg
B D                     Chimp  agaagagatg
B D                   Gorilla  agaagagatg
B D                 Orangutan  agtagagatg
B D                    Gibbon  agtagagatg
B D                    Rhesus  agtagagatg
B D       Crab-eating macaque  agtagagatg
B D                    Baboon  agtagagatg
B D              Green monkey  agtagagatg
B D                  Marmoset  agtagacata
B D           Squirrel monkey  agtagacatg
B D                  Bushbaby  agtagagaca
B D                  Squirrel  tacagagaaa
B D                    Rabbit  agcagatgga
B D                     Horse  ggaaaaaaag
                     Aardvark  aaaaaaga--
B D                    Tenrec  ==========
      Lesser Egyptian jerboa  ==========
B D                  Hedgehog  ==========
         Cape elephant shrew  ==========
B D                      Pika  NNNNNNNNNN
B D                       Rat  ==========
B D                     Mouse  ==========
              Golden hamster  ==========
B D                     Shrew  ==========
B D           Chinese hamster  NNNNNNNNNN
             Star-nosed mole  ==========
                Prairie vole  ==========
B D                  Microbat  ==========
        David's myotis (bat)  ==========
               Big brown bat  ==========
B D                    Lizard  ==========
B D                   Manatee  ----------
B D                     Panda  ==========
B D                   Ferret   ----------
B D                       Dog  ==========
B D              Atlantic cod  ==========
          Southern platyfish  ==========
                 Zebra mbuna  ==========
B D              Nile tilapia  ==========
         Pundamilia nyererei  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
                 Spotted gar  ==========
B D             X. tropicalis  ==========
B D                 Zebrafish  ==========
B D                Coelacanth  ==========
  D               Rock pigeon  ==========
B D        American alligator  ----------
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
  D             Scarlet macaw  ----------
B D                    Medaka  ----------
  D              Mallard duck  ==========
B D                 Tetraodon  ==========
B D               Stickleback  ==========
  D       Collared flycatcher  ----------
B D                    Turkey  ==========
B D                   Chicken  ==========
B D                   Wallaby  ==========
            Cape golden mole  ==========
  D    Spiny softshell turtle  ----------
  D  Chinese softshell turtle  ==========
          Tibetan ground jay  ==========
B D                Budgerigar  ----------
  D          Peregrine falcon  ----------
  D              Saker falcon  ----------
  D                    Parrot  ----------
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
B D               Zebra finch  ==========
B D           Tasmanian devil  ==========
  D            Painted turtle  ----------
  D           Green seaturtle  ==========
B D                   Dolphin  ==========
B D                  Platypus  ==========
B D                       Cow  ==========
               Domestic goat  ==========
B D                     Sheep  ==========
            Tibetan antelope  ==========
                Killer whale  ==========
B D                   Megabat  ==========
B D                       Pig  ==========
B D                 Armadillo  ----------
B D                    Alpaca  ==========
              Bactrian camel  ==========
B D                   Opossum  ==========
                Weddell seal  ==========
            Black flying-fox  ----------
B D                       Cat  ----------
B D                  Elephant  ==========
B D                Guinea pig  ==========
            Brush-tailed rat  ==========
B D            Naked mole-rat  ==========
                  Chinchilla  ==========
          Chinese tree shrew  ==========
              Pacific walrus  ----------
B D          White rhinoceros  ==========

Inserts between block 7 and 8 in window
B D                 Squirrel 3bp
B D                   Rabbit 2bp

Alignment block 8 of 308 in window, 45490280 - 45490284, 5 bps 
B D                     Human  aggtc
B D                     Chimp  aggtc
B D                   Gorilla  aggtc
B D                 Orangutan  aggtc
B D                    Gibbon  aggtc
B D                    Rhesus  aggtc
B D       Crab-eating macaque  aggtc
B D                    Baboon  aggtc
B D              Green monkey  aggtc
B D                  Marmoset  tggct
B D           Squirrel monkey  aggcc
B D                  Bushbaby  gggt-
B D                       Rat  aagtc
B D                    Rabbit  acctc
B D                     Horse  aagac
B D                    Tenrec  =====
      Lesser Egyptian jerboa  =====
B D                  Hedgehog  =====
         Cape elephant shrew  =====
B D                      Pika  NNNNN
B D                     Mouse  =====
              Golden hamster  =====
B D                     Shrew  =====
B D           Chinese hamster  NNNNN
             Star-nosed mole  =====
                Prairie vole  =====
B D                  Microbat  =====
        David's myotis (bat)  =====
               Big brown bat  =====
B D                    Lizard  =====
B D                   Manatee  -----
B D                     Panda  =====
B D                   Ferret   -----
B D                       Dog  =====
B D              Atlantic cod  =====
          Southern platyfish  =====
                 Zebra mbuna  =====
B D              Nile tilapia  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
                 Spotted gar  =====
B D             X. tropicalis  =====
B D                 Zebrafish  =====
B D                Coelacanth  =====
  D               Rock pigeon  =====
B D        American alligator  -----
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
  D             Scarlet macaw  -----
B D                    Medaka  -----
  D              Mallard duck  =====
B D                 Tetraodon  =====
B D               Stickleback  =====
  D       Collared flycatcher  -----
B D                    Turkey  =====
B D                   Chicken  =====
B D                   Wallaby  =====
            Cape golden mole  =====
  D    Spiny softshell turtle  -----
  D  Chinese softshell turtle  =====
          Tibetan ground jay  =====
B D                Budgerigar  -----
  D          Peregrine falcon  -----
  D              Saker falcon  -----
  D                    Parrot  -----
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
B D               Zebra finch  =====
B D           Tasmanian devil  =====
  D            Painted turtle  -----
  D           Green seaturtle  =====
B D                   Dolphin  =====
B D                  Platypus  =====
B D                       Cow  =====
               Domestic goat  =====
B D                     Sheep  =====
            Tibetan antelope  =====
                Killer whale  =====
B D                   Megabat  =====
B D                       Pig  =====
B D                 Armadillo  -----
B D                    Alpaca  =====
              Bactrian camel  =====
B D                   Opossum  =====
                Weddell seal  =====
                    Aardvark  -----
            Black flying-fox  -----
B D                  Squirrel  =====
B D                       Cat  -----
B D                  Elephant  =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
          Chinese tree shrew  =====
              Pacific walrus  -----
B D          White rhinoceros  =====

Inserts between block 8 and 9 in window
B D                   Rabbit 12bp

Alignment block 9 of 308 in window, 45490285 - 45490324, 40 bps 
B D                     Human  tcactatgtt-ggccaggct-g-tctt--gaactctagagcgcaa
B D                     Chimp  tcactatgtt-ggccaggct-g-tctt--gaactctagagcgcaa
B D                   Gorilla  tcattatgtt-ggccaggct-g-tctt--gaactctagagcgcaa
B D                 Orangutan  tcactatgtt-ggccaggct-g-tctt--gaactccagagcgcaa
B D                    Gibbon  tcactatgtt-ggccaggct-g-tctt--gaactccagagcgcaa
B D                    Rhesus  tcactatgtt-agccaggct-g-tctt--gaactcttgagcccaa
B D       Crab-eating macaque  tcactatgtt-agccaggct-g-tctt--gaactcctgagcccaa
B D                    Baboon  tcaccatgtt-agccaggct-g-tctt--gaactcctgagcccaa
B D              Green monkey  tcactatgtt-ggccagcct-g-tctt--gaactcctgagcccaa
B D                  Marmoset  tcactatgttaggccatgct-g-tctt--gaactcctgagcttaa
B D           Squirrel monkey  tcactatgttaggccatgct-g-tctt--gaactcctgagcttaa
B D                  Bushbaby  --attctctt-gctcaggctgg-tctc--aaactcctgagctcaa
B D                  Squirrel  -----------------------tcct--gacctctgg-------
                 Prairie vole  ctactaagtt-tgacagcct-gagctt--gattcctgtaacctac
B D                       Rat  -----------tgacaatgt-gagttt--gattcttggaacccac
B D                    Rabbit  tccctctctc-tgtaactct-gctcttcagatacataaaataaat
B D                     Horse  -----------------------------tggcagcagatgttag
B D                    Tenrec  =============================================
      Lesser Egyptian jerboa  =============================================
B D                  Hedgehog  =============================================
         Cape elephant shrew  =============================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Mouse  =============================================
              Golden hamster  =============================================
B D                     Shrew  =============================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Star-nosed mole  =============================================
B D                  Microbat  =============================================
        David's myotis (bat)  =============================================
               Big brown bat  =============================================
B D                    Lizard  =============================================
B D                   Manatee  ---------------------------------------------
B D                     Panda  =============================================
B D                   Ferret   ---------------------------------------------
B D                       Dog  =============================================
B D              Atlantic cod  =============================================
          Southern platyfish  =============================================
                 Zebra mbuna  =============================================
B D              Nile tilapia  =============================================
         Pundamilia nyererei  =============================================
       Burton's mouthbreeder  =============================================
         Princess of Burundi  =============================================
                 Spotted gar  =============================================
B D             X. tropicalis  =============================================
B D                 Zebrafish  =============================================
B D                Coelacanth  =============================================
  D               Rock pigeon  =============================================
B D        American alligator  ---------------------------------------------
      Yellowbelly pufferfish  =============================================
B D                      Fugu  =============================================
  D             Scarlet macaw  ---------------------------------------------
B D                    Medaka  ---------------------------------------------
  D              Mallard duck  =============================================
B D                 Tetraodon  =============================================
B D               Stickleback  =============================================
  D       Collared flycatcher  ---------------------------------------------
B D                    Turkey  =============================================
B D                   Chicken  =============================================
B D                   Wallaby  =============================================
            Cape golden mole  =============================================
  D    Spiny softshell turtle  ---------------------------------------------
  D  Chinese softshell turtle  =============================================
          Tibetan ground jay  =============================================
B D                Budgerigar  ---------------------------------------------
  D          Peregrine falcon  ---------------------------------------------
  D              Saker falcon  ---------------------------------------------
  D                    Parrot  ---------------------------------------------
B D       Medium ground finch  =============================================
  D    White-throated sparrow  =============================================
B D               Zebra finch  =============================================
B D           Tasmanian devil  =============================================
  D            Painted turtle  ---------------------------------------------
  D           Green seaturtle  =============================================
B D                   Dolphin  =============================================
B D                  Platypus  =============================================
B D                       Cow  =============================================
               Domestic goat  =============================================
B D                     Sheep  =============================================
            Tibetan antelope  =============================================
                Killer whale  =============================================
B D                   Megabat  =============================================
B D                       Pig  =============================================
B D                 Armadillo  ---------------------------------------------
B D                    Alpaca  =============================================
              Bactrian camel  =============================================
B D                   Opossum  =============================================
                Weddell seal  =============================================
                    Aardvark  ---------------------------------------------
            Black flying-fox  ---------------------------------------------
B D                       Cat  ---------------------------------------------
B D                  Elephant  =============================================
B D                Guinea pig  =============================================
            Brush-tailed rat  =============================================
B D            Naked mole-rat  =============================================
                  Chinchilla  =============================================
          Chinese tree shrew  =============================================
              Pacific walrus  ---------------------------------------------
B D          White rhinoceros  =============================================

Inserts between block 9 and 10 in window
                Prairie vole 17bp
B D                      Rat 17bp
B D                   Rabbit 9bp
B D                    Horse 24bp

Alignment block 10 of 308 in window, 45490325 - 45490350, 26 bps 
B D                     Human  gtgatcttcccacc----------------------ttggcctcccaa-
B D                     Chimp  gtgatcttcccacc----------------------ttggcctcccaa-
B D                   Gorilla  gtgatcttcccaccttggcctcccaaagtgttgggattggcctcccaa-
B D                 Orangutan  gtgatcttcccacc----------------------ttggcctcccaa-
B D                    Gibbon  gtgatcttcccacc----------------------ttggcctcccaa-
B D                    Rhesus  gtgatctgcccgcc----------------------ttggcctcccaa-
B D       Crab-eating macaque  gtgatctgcccgcc----------------------ttggcctcccaa-
B D                    Baboon  gtgatctgcccgcc----------------------ttggcctcccaa-
B D              Green monkey  gtgatctgcccacc----------------------ttggcctcccaa-
B D                  Marmoset  gtgatcctcccacc----------------------ctggctttccaa-
B D           Squirrel monkey  gtgatcctcccacc----------------------ctggctttccaa-
B D                  Bushbaby  gcaatccatctgcc----------------------tttgcctcccag-
B D                  Squirrel  ----------------------------------------tctaa----
       Lesser Egyptian jerboa  gtgaccccc---------------------------ctgctctaa----
                 Prairie vole  atgtctcctataag----------------------ttgtcctct----
B D                       Rat  atgactcctgtaag----------------------ttgttctaa----
B D                    Rabbit  aagttttctcaatc----------------------ctggtctaa----
B D                   Dolphin  ---------------------------------------------gga-
                 Killer whale  ---------------------------------------------gga-
B D                     Horse  ---------------------------------------------aaa-
                 Weddell seal  ---------------------------------------------gaa-
                     Aardvark  ----------cact----------------------ttgccctgcttaa
B D                    Tenrec  =================================================
B D                  Hedgehog  =================================================
         Cape elephant shrew  =================================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Mouse  =================================================
              Golden hamster  =================================================
B D                     Shrew  =================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Star-nosed mole  =================================================
B D                  Microbat  =================================================
        David's myotis (bat)  =================================================
               Big brown bat  =================================================
B D                    Lizard  =================================================
B D                   Manatee  -------------------------------------------------
B D                     Panda  =================================================
B D                   Ferret   -------------------------------------------------
B D                       Dog  =================================================
B D              Atlantic cod  =================================================
          Southern platyfish  =================================================
                 Zebra mbuna  =================================================
B D              Nile tilapia  =================================================
         Pundamilia nyererei  =================================================
       Burton's mouthbreeder  =================================================
         Princess of Burundi  =================================================
                 Spotted gar  =================================================
B D             X. tropicalis  =================================================
B D                 Zebrafish  =================================================
B D                Coelacanth  =================================================
  D               Rock pigeon  =================================================
B D        American alligator  -------------------------------------------------
      Yellowbelly pufferfish  =================================================
B D                      Fugu  =================================================
  D             Scarlet macaw  -------------------------------------------------
B D                    Medaka  -------------------------------------------------
  D              Mallard duck  =================================================
B D                 Tetraodon  =================================================
B D               Stickleback  =================================================
  D       Collared flycatcher  -------------------------------------------------
B D                    Turkey  =================================================
B D                   Chicken  =================================================
B D                   Wallaby  =================================================
            Cape golden mole  =================================================
  D    Spiny softshell turtle  -------------------------------------------------
  D  Chinese softshell turtle  =================================================
          Tibetan ground jay  =================================================
B D                Budgerigar  -------------------------------------------------
  D          Peregrine falcon  -------------------------------------------------
  D              Saker falcon  -------------------------------------------------
  D                    Parrot  -------------------------------------------------
B D       Medium ground finch  =================================================
  D    White-throated sparrow  =================================================
B D               Zebra finch  =================================================
B D           Tasmanian devil  =================================================
  D            Painted turtle  -------------------------------------------------
  D           Green seaturtle  =================================================
B D                  Platypus  =================================================
B D                       Cow  =================================================
               Domestic goat  =================================================
B D                     Sheep  =================================================
            Tibetan antelope  =================================================
B D                   Megabat  =================================================
B D                       Pig  =================================================
B D                 Armadillo  -------------------------------------------------
B D                    Alpaca  =================================================
              Bactrian camel  =================================================
B D                   Opossum  =================================================
            Black flying-fox  -------------------------------------------------
B D                       Cat  -------------------------------------------------
B D                  Elephant  =================================================
B D                Guinea pig  =================================================
            Brush-tailed rat  =================================================
B D            Naked mole-rat  =================================================
                  Chinchilla  =================================================
          Chinese tree shrew  =================================================
              Pacific walrus  -------------------------------------------------
B D          White rhinoceros  =================================================

Inserts between block 10 and 11 in window
B D                    Horse 26bp
                Weddell seal 10bp

Alignment block 11 of 308 in window, 45490351 - 45490361, 11 bps 
B D                     Human  attgtt--------------------------------------------gggac
B D                     Chimp  attgtt--------------------------------------------gggac
B D                   Gorilla  agtgtt--------------------------------------------gggac
B D                 Orangutan  agtgtt--------------------------------------------gggat
B D                    Gibbon  agtgtt--------------------------------------------gggat
B D                    Rhesus  agtgtt--------------------------------------------gggat
B D       Crab-eating macaque  agtgtt--------------------------------------------gggat
B D                    Baboon  agtgtt--------------------------------------------gggat
B D              Green monkey  agtgtt--------------------------------------------gggat
B D                  Marmoset  agtg-t--------------------------------------------gggat
B D           Squirrel monkey  agtgct--------------------------------------------ggggt
B D                  Bushbaby  aatgct--------------------------------------------aggat
B D                  Squirrel  ----------------------------------------------------atg
       Lesser Egyptian jerboa  ----------------------------------------------------atg
                 Prairie vole  ---------------------------------------------------gacc
B D                       Rat  ---------------------------------------------------gact
B D                    Rabbit  ----------------------------------------------------atg
B D                       Pig  attgct-----------------------------------gtggctgt------
B D                     Horse  agtgcttaagttcacacgctctgcttcggcagcccagggttttgccagtttggat
                 Weddell seal  actact-------------------------------------------------
                     Aardvark  attcct----------------------------------------------gat
B D                    Tenrec  =======================================================
B D                  Hedgehog  =======================================================
         Cape elephant shrew  =======================================================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Mouse  =======================================================
              Golden hamster  =======================================================
B D                     Shrew  =======================================================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Star-nosed mole  =======================================================
B D                  Microbat  =======================================================
        David's myotis (bat)  =======================================================
               Big brown bat  =======================================================
B D                    Lizard  =======================================================
B D                   Manatee  -------------------------------------------------------
B D                     Panda  =======================================================
B D                   Ferret   -------------------------------------------------------
B D                       Dog  =======================================================
B D              Atlantic cod  =======================================================
          Southern platyfish  =======================================================
                 Zebra mbuna  =======================================================
B D              Nile tilapia  =======================================================
         Pundamilia nyererei  =======================================================
       Burton's mouthbreeder  =======================================================
         Princess of Burundi  =======================================================
                 Spotted gar  =======================================================
B D             X. tropicalis  =======================================================
B D                 Zebrafish  =======================================================
B D                Coelacanth  =======================================================
  D               Rock pigeon  =======================================================
B D        American alligator  -------------------------------------------------------
      Yellowbelly pufferfish  =======================================================
B D                      Fugu  =======================================================
  D             Scarlet macaw  -------------------------------------------------------
B D                    Medaka  -------------------------------------------------------
  D              Mallard duck  =======================================================
B D                 Tetraodon  =======================================================
B D               Stickleback  =======================================================
  D       Collared flycatcher  -------------------------------------------------------
B D                    Turkey  =======================================================
B D                   Chicken  =======================================================
B D                   Wallaby  =======================================================
            Cape golden mole  =======================================================
  D    Spiny softshell turtle  -------------------------------------------------------
  D  Chinese softshell turtle  =======================================================
          Tibetan ground jay  =======================================================
B D                Budgerigar  -------------------------------------------------------
  D          Peregrine falcon  -------------------------------------------------------
  D              Saker falcon  -------------------------------------------------------
  D                    Parrot  -------------------------------------------------------
B D       Medium ground finch  =======================================================
  D    White-throated sparrow  =======================================================
B D               Zebra finch  =======================================================
B D           Tasmanian devil  =======================================================
  D            Painted turtle  -------------------------------------------------------
  D           Green seaturtle  =======================================================
B D                   Dolphin  -------------------------------------------------------
B D                  Platypus  =======================================================
B D                       Cow  =======================================================
               Domestic goat  =======================================================
B D                     Sheep  =======================================================
            Tibetan antelope  =======================================================
                Killer whale  -------------------------------------------------------
B D                   Megabat  =======================================================
B D                 Armadillo  -------------------------------------------------------
B D                    Alpaca  =======================================================
              Bactrian camel  =======================================================
B D                   Opossum  =======================================================
            Black flying-fox  -------------------------------------------------------
B D                       Cat  -------------------------------------------------------
B D                  Elephant  =======================================================
B D                Guinea pig  =======================================================
            Brush-tailed rat  =======================================================
B D            Naked mole-rat  =======================================================
                  Chinchilla  =======================================================
          Chinese tree shrew  =======================================================
              Pacific walrus  -------------------------------------------------------
B D          White rhinoceros  =======================================================

Inserts between block 11 and 12 in window
                    Aardvark 2bp

Alignment block 12 of 308 in window, 45490362 - 45490377, 16 bps 
B D                     Human  tataggtg---tgaaccac
B D                     Chimp  tataggtg---tgaaccac
B D                   Gorilla  tatagatg---tgaaccac
B D                 Orangutan  tataggtg---tgaaccac
B D                    Gibbon  tataggtg---tgaaccac
B D                    Rhesus  tataggtg---tgaaccac
B D       Crab-eating macaque  tataggtg---tgaaccac
B D                    Baboon  tataggtg---tgaaccac
B D              Green monkey  tataggtg---tgaaccac
B D                  Marmoset  tataggtg---taaaccac
B D           Squirrel monkey  tataggtg---taaaccac
B D                  Bushbaby  tacaggtc---tgagccac
B D                  Squirrel  attaag-------------
       Lesser Egyptian jerboa  accaggta---tatag---
                 Prairie vole  tctatgtg---tgcacaat
B D                       Rat  tccatgta---tgcacaat
B D                    Rabbit  actaagta---ta------
B D                       Pig  ----ggca---taggcttg
B D                     Horse  cctgggta---cagacatg
                 Weddell seal  ----ggtc---caaataa-
             Cape golden mole  tatatgag---tgagccaa
                     Aardvark  tttattagtcattatccag
B D                    Tenrec  ===================
B D                  Hedgehog  ===================
         Cape elephant shrew  ===================
B D                      Pika  NNNNNNNNNNNNNNNNNNN
B D                     Mouse  ===================
              Golden hamster  ===================
B D                     Shrew  ===================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNN
             Star-nosed mole  ===================
B D                  Microbat  ===================
        David's myotis (bat)  ===================
               Big brown bat  ===================
B D                    Lizard  ===================
B D                   Manatee  -------------------
B D                     Panda  ===================
B D                   Ferret   -------------------
B D                       Dog  ===================
B D              Atlantic cod  ===================
          Southern platyfish  ===================
                 Zebra mbuna  ===================
B D              Nile tilapia  ===================
         Pundamilia nyererei  ===================
       Burton's mouthbreeder  ===================
         Princess of Burundi  ===================
                 Spotted gar  ===================
B D             X. tropicalis  ===================
B D                 Zebrafish  ===================
B D                Coelacanth  ===================
  D               Rock pigeon  ===================
B D        American alligator  -------------------
      Yellowbelly pufferfish  ===================
B D                      Fugu  ===================
  D             Scarlet macaw  -------------------
B D                    Medaka  -------------------
  D              Mallard duck  ===================
B D                 Tetraodon  ===================
B D               Stickleback  ===================
  D       Collared flycatcher  -------------------
B D                    Turkey  ===================
B D                   Chicken  ===================
B D                   Wallaby  ===================
  D    Spiny softshell turtle  -------------------
  D  Chinese softshell turtle  ===================
          Tibetan ground jay  ===================
B D                Budgerigar  -------------------
  D          Peregrine falcon  -------------------
  D              Saker falcon  -------------------
  D                    Parrot  -------------------
B D       Medium ground finch  ===================
  D    White-throated sparrow  ===================
B D               Zebra finch  ===================
B D           Tasmanian devil  ===================
  D            Painted turtle  -------------------
  D           Green seaturtle  ===================
B D                   Dolphin  -------------------
B D                  Platypus  ===================
B D                       Cow  ===================
               Domestic goat  ===================
B D                     Sheep  ===================
            Tibetan antelope  ===================
                Killer whale  -------------------
B D                   Megabat  ===================
B D                 Armadillo  -------------------
B D                    Alpaca  ===================
              Bactrian camel  ===================
B D                   Opossum  ===================
            Black flying-fox  -------------------
B D                       Cat  -------------------
B D                  Elephant  ===================
B D                Guinea pig  ===================
            Brush-tailed rat  ===================
B D            Naked mole-rat  ===================
                  Chinchilla  ===================
          Chinese tree shrew  ===================
              Pacific walrus  -------------------
B D          White rhinoceros  ===================

Inserts between block 12 and 13 in window
B D                      Rat 4bp
B D                   Rabbit 9bp
B D                      Pig 2bp
B D                    Horse 5bp

Alignment block 13 of 308 in window, 45490378 - 45490378, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                  Squirrel  t
                 Prairie vole  a
B D                     Mouse  t
B D                       Rat  t
B D                    Rabbit  t
             Cape golden mole  t
                     Aardvark  t
B D                    Tenrec  =
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                      Pika  N
              Golden hamster  =
B D                     Shrew  =
B D           Chinese hamster  N
             Star-nosed mole  =
B D                  Microbat  =
        David's myotis (bat)  =
               Big brown bat  =
B D                    Lizard  =
B D                   Manatee  -
B D                     Panda  =
B D                   Ferret   -
B D                       Dog  =
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D             X. tropicalis  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  =
B D        American alligator  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
  D             Scarlet macaw  -
B D                    Medaka  -
  D              Mallard duck  =
B D                 Tetraodon  =
B D               Stickleback  =
  D       Collared flycatcher  -
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  -
  D          Peregrine falcon  -
  D              Saker falcon  -
  D                    Parrot  -
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
B D           Tasmanian devil  =
  D            Painted turtle  -
  D           Green seaturtle  =
B D                   Dolphin  -
B D                  Platypus  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  -
B D                   Megabat  =
B D                       Pig  =
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                Weddell seal  -
            Black flying-fox  -
B D                       Cat  -
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  -
B D          White rhinoceros  =
B D                     Horse  =

Alignment block 14 of 308 in window, 45490379 - 45490380, 2 bps 
B D                     Human  gt
B D                     Chimp  gt
B D                   Gorilla  gt
B D                 Orangutan  gt
B D                    Gibbon  gt
B D                    Rhesus  gt
B D       Crab-eating macaque  gt
B D                    Baboon  gt
B D              Green monkey  gt
B D                  Marmoset  gt
B D           Squirrel monkey  gt
B D                  Bushbaby  gt
B D                  Squirrel  gt
                 Prairie vole  gc
B D                     Mouse  gc
B D                       Rat  gt
B D                    Rabbit  gt
B D                       Pig  a-
B D                     Horse  gc
B D                   Ferret   gt
                 Weddell seal  gt
                     Aardvark  at
B D                    Tenrec  ==
      Lesser Egyptian jerboa  --
B D                  Hedgehog  ==
         Cape elephant shrew  ==
B D                      Pika  NN
              Golden hamster  ==
B D                     Shrew  ==
B D           Chinese hamster  NN
             Star-nosed mole  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
               Big brown bat  ==
B D                    Lizard  ==
B D                   Manatee  --
B D                     Panda  ==
B D                       Dog  ==
B D              Atlantic cod  ==
          Southern platyfish  ==
                 Zebra mbuna  ==
B D              Nile tilapia  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
                 Spotted gar  ==
B D             X. tropicalis  ==
B D                 Zebrafish  ==
B D                Coelacanth  ==
  D               Rock pigeon  ==
B D        American alligator  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
  D             Scarlet macaw  --
B D                    Medaka  --
  D              Mallard duck  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
  D       Collared flycatcher  --
B D                    Turkey  ==
B D                   Chicken  ==
B D                   Wallaby  ==
            Cape golden mole  --
  D    Spiny softshell turtle  --
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  --
  D          Peregrine falcon  --
  D              Saker falcon  --
  D                    Parrot  --
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
B D           Tasmanian devil  ==
  D            Painted turtle  --
  D           Green seaturtle  ==
B D                   Dolphin  --
B D                  Platypus  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Killer whale  --
B D                   Megabat  ==
B D                 Armadillo  --
B D                    Alpaca  ==
              Bactrian camel  ==
B D                   Opossum  ==
            Black flying-fox  --
B D                       Cat  --
B D                  Elephant  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
              Pacific walrus  --
B D          White rhinoceros  ==

Inserts between block 14 and 15 in window
B D                    Horse 33bp

Alignment block 15 of 308 in window, 45490381 - 45490387, 7 bps 
B D                     Human  atgtggc
B D                     Chimp  atgtggc
B D                   Gorilla  atgtggc
B D                 Orangutan  atgtggc
B D                    Gibbon  atatggc
B D                    Rhesus  atgtggc
B D       Crab-eating macaque  atgtggc
B D                    Baboon  atgtggc
B D              Green monkey  atgtggc
B D                  Marmoset  acctggc
B D           Squirrel monkey  acctggc
B D                  Bushbaby  a------
B D                  Squirrel  ataactt
                 Prairie vole  atgtg--
B D                     Mouse  atgtg--
B D                       Rat  atgtg--
B D                    Rabbit  agc----
B D                       Pig  atgtagc
B D                     Horse  ccacaac
B D                       Dog  atataac
B D                   Ferret   atataac
                 Weddell seal  atataac
             Cape golden mole  ------g
                     Aardvark  atctgag
B D                    Tenrec  =======
      Lesser Egyptian jerboa  -------
B D                  Hedgehog  =======
         Cape elephant shrew  =======
B D                      Pika  NNNNNNN
              Golden hamster  =======
B D                     Shrew  =======
B D           Chinese hamster  NNNNNNN
             Star-nosed mole  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
               Big brown bat  =======
B D                    Lizard  =======
B D                   Manatee  -------
B D                     Panda  =======
B D              Atlantic cod  =======
          Southern platyfish  =======
                 Zebra mbuna  =======
B D              Nile tilapia  =======
         Pundamilia nyererei  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
                 Spotted gar  =======
B D             X. tropicalis  =======
B D                 Zebrafish  =======
B D                Coelacanth  =======
  D               Rock pigeon  =======
B D        American alligator  -------
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
  D             Scarlet macaw  -------
B D                    Medaka  -------
  D              Mallard duck  =======
B D                 Tetraodon  =======
B D               Stickleback  =======
  D       Collared flycatcher  -------
B D                    Turkey  =======
B D                   Chicken  =======
B D                   Wallaby  =======
  D    Spiny softshell turtle  -------
  D  Chinese softshell turtle  =======
          Tibetan ground jay  =======
B D                Budgerigar  -------
  D          Peregrine falcon  -------
  D              Saker falcon  -------
  D                    Parrot  -------
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
B D               Zebra finch  =======
B D           Tasmanian devil  =======
  D            Painted turtle  -------
  D           Green seaturtle  =======
B D                   Dolphin  -------
B D                  Platypus  =======
B D                       Cow  =======
               Domestic goat  =======
B D                     Sheep  =======
            Tibetan antelope  =======
                Killer whale  -------
B D                   Megabat  =======
B D                 Armadillo  -------
B D                    Alpaca  =======
              Bactrian camel  =======
B D                   Opossum  =======
            Black flying-fox  -------
B D                       Cat  -------
B D                  Elephant  =======
B D                Guinea pig  =======
            Brush-tailed rat  =======
B D            Naked mole-rat  =======
                  Chinchilla  =======
          Chinese tree shrew  =======
              Pacific walrus  -------
B D          White rhinoceros  =======

Inserts between block 15 and 16 in window
B D                      Pig 1bp

Alignment block 16 of 308 in window, 45490388 - 45490388, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Squirrel  a
B D                       Pig  c
B D                     Horse  t
B D                       Dog  c
B D                   Ferret   c
                 Weddell seal  c
B D                  Microbat  t
             Cape golden mole  c
                     Aardvark  c
B D                    Tenrec  =
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                      Pika  N
B D                       Rat  -
B D                     Mouse  -
              Golden hamster  =
B D                     Shrew  =
B D           Chinese hamster  N
             Star-nosed mole  =
                Prairie vole  -
        David's myotis (bat)  =
               Big brown bat  =
B D                    Lizard  =
B D                    Rabbit  -
B D                   Manatee  -
B D                     Panda  =
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D             X. tropicalis  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  =
B D        American alligator  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
  D             Scarlet macaw  -
B D                    Medaka  -
  D              Mallard duck  =
B D                 Tetraodon  =
B D               Stickleback  =
  D       Collared flycatcher  -
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  -
  D          Peregrine falcon  -
  D              Saker falcon  -
  D                    Parrot  -
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
B D           Tasmanian devil  =
  D            Painted turtle  -
  D           Green seaturtle  =
B D                   Dolphin  -
B D                  Platypus  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
                Killer whale  -
B D                   Megabat  =
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
            Black flying-fox  -
B D                       Cat  -
B D                  Bushbaby  -
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  -
B D          White rhinoceros  =

Alignment block 17 of 308 in window, 45490389 - 45490389, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Squirrel  -t
B D                       Pig  -t
B D                     Horse  -a
B D                       Dog  -t
B D                   Ferret   -t
                 Weddell seal  -t
B D                   Megabat  -t
B D                  Microbat  -t
             Cape golden mole  a-
                     Aardvark  c-
B D                    Tenrec  ==
      Lesser Egyptian jerboa  --
B D                  Hedgehog  ==
         Cape elephant shrew  ==
B D                      Pika  NN
B D                       Rat  --
B D                     Mouse  --
              Golden hamster  ==
B D                     Shrew  ==
B D           Chinese hamster  NN
             Star-nosed mole  ==
                Prairie vole  --
        David's myotis (bat)  ==
               Big brown bat  ==
B D                    Lizard  ==
B D                    Rabbit  --
B D                   Manatee  --
B D                     Panda  ==
B D              Atlantic cod  ==
          Southern platyfish  ==
                 Zebra mbuna  ==
B D              Nile tilapia  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
                 Spotted gar  ==
B D             X. tropicalis  ==
B D                 Zebrafish  ==
B D                Coelacanth  ==
  D               Rock pigeon  ==
B D        American alligator  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
  D             Scarlet macaw  --
B D                    Medaka  --
  D              Mallard duck  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
  D       Collared flycatcher  --
B D                    Turkey  ==
B D                   Chicken  ==
B D                   Wallaby  ==
  D    Spiny softshell turtle  --
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  --
  D          Peregrine falcon  --
  D              Saker falcon  --
  D                    Parrot  --
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
B D           Tasmanian devil  ==
  D            Painted turtle  --
  D           Green seaturtle  ==
B D                   Dolphin  --
B D                  Platypus  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Killer whale  --
B D                 Armadillo  --
B D                    Alpaca  ==
              Bactrian camel  ==
B D                   Opossum  ==
            Black flying-fox  --
B D                       Cat  --
B D                  Bushbaby  --
B D                  Elephant  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
              Pacific walrus  --
B D          White rhinoceros  ==

Inserts between block 17 and 18 in window
B D                      Pig 14bp
B D                  Megabat 1bp
B D                 Microbat 1bp

Alignment block 18 of 308 in window, 45490390 - 45490402, 13 bps 
B D                     Human  aactt-aaactttc-------
B D                     Chimp  aactt-aaactttc-------
B D                   Gorilla  aactt-aaactttc-------
B D                 Orangutan  aactt-caactttc-------
B D                    Gibbon  aactt-aaactttc-------
B D                    Rhesus  aacttaaaacttta-------
B D       Crab-eating macaque  aacttaaaacttta-------
B D                    Baboon  aacttaaaacttta-------
B D              Green monkey  aactt-aaacttta-------
B D                  Marmoset  aagtt-gaactttt-------
B D           Squirrel monkey  aagtt-aaactttc-------
B D                  Squirrel  aa-------------------
B D                       Pig  ----------cctg-------
B D                   Megabat  ----------actt-------
         David's myotis (bat)  ----------actt-------
B D                  Microbat  ----------actt-------
             Cape golden mole  --------aacttataatgcc
                     Aardvark  --------aactaa-------
B D                    Tenrec  =====================
      Lesser Egyptian jerboa  ---------------------
B D                  Hedgehog  =====================
         Cape elephant shrew  =====================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNN
B D                       Rat  ---------------------
B D                     Mouse  ---------------------
              Golden hamster  =====================
B D                     Shrew  =====================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNN
             Star-nosed mole  =====================
                Prairie vole  ---------------------
               Big brown bat  =====================
B D                    Lizard  =====================
B D                    Rabbit  ---------------------
B D                   Manatee  ---------------------
B D                     Panda  =====================
B D                   Ferret   ---------------------
B D                       Dog  ---------------------
B D              Atlantic cod  =====================
          Southern platyfish  =====================
                 Zebra mbuna  =====================
B D              Nile tilapia  =====================
         Pundamilia nyererei  =====================
       Burton's mouthbreeder  =====================
         Princess of Burundi  =====================
                 Spotted gar  =====================
B D             X. tropicalis  =====================
B D                 Zebrafish  =====================
B D                Coelacanth  =====================
  D               Rock pigeon  =====================
B D        American alligator  ---------------------
      Yellowbelly pufferfish  =====================
B D                      Fugu  =====================
  D             Scarlet macaw  ---------------------
B D                    Medaka  ---------------------
  D              Mallard duck  =====================
B D                 Tetraodon  =====================
B D               Stickleback  =====================
  D       Collared flycatcher  ---------------------
B D                    Turkey  =====================
B D                   Chicken  =====================
B D                   Wallaby  =====================
  D    Spiny softshell turtle  ---------------------
  D  Chinese softshell turtle  =====================
          Tibetan ground jay  =====================
B D                Budgerigar  ---------------------
  D          Peregrine falcon  ---------------------
  D              Saker falcon  ---------------------
  D                    Parrot  ---------------------
B D       Medium ground finch  =====================
  D    White-throated sparrow  =====================
B D               Zebra finch  =====================
B D           Tasmanian devil  =====================
  D            Painted turtle  ---------------------
  D           Green seaturtle  =====================
B D                   Dolphin  ---------------------
B D                  Platypus  =====================
B D                       Cow  =====================
               Domestic goat  =====================
B D                     Sheep  =====================
            Tibetan antelope  =====================
                Killer whale  ---------------------
B D                 Armadillo  ---------------------
B D                    Alpaca  =====================
              Bactrian camel  =====================
B D                   Opossum  =====================
                Weddell seal  ---------------------
            Black flying-fox  ---------------------
B D                       Cat  ---------------------
B D                  Bushbaby  ---------------------
B D                  Elephant  =====================
B D                Guinea pig  =====================
            Brush-tailed rat  =====================
B D            Naked mole-rat  =====================
                  Chinchilla  =====================
          Chinese tree shrew  =====================
              Pacific walrus  ---------------------
B D          White rhinoceros  =====================
B D                     Horse  ---------------------

Alignment block 19 of 308 in window, 45490403 - 45490414, 12 bps 
B D                     Human  aaaactttcttc
B D                     Chimp  aaaactttcttc
B D                   Gorilla  aaaactttcttc
B D                 Orangutan  aaaagtttcttc
B D                    Gibbon  aaaagtttcttc
B D                    Rhesus  aaaagtttctcc
B D       Crab-eating macaque  aaaagtttctcc
B D                    Baboon  aaaagtttctcc
B D              Green monkey  aaaagtttctcc
B D                  Marmoset  caaagtttcttc
B D           Squirrel monkey  aaaagtttcttc
B D                  Bushbaby  -----------c
B D                  Squirrel  -------tcttg
B D                     Mouse  ----------cc
B D                       Rat  --------ctcc
B D                       Pig  ggaacttccata
B D                     Horse  gaaggacccaca
B D                       Dog  aaaaatttcata
B D                   Ferret   aaaaatttcata
                 Weddell seal  aaaaatttcata
B D                   Megabat  aaaaatttc---
         David's myotis (bat)  aaaaacttcat-
B D                  Microbat  aaaaacttcat-
             Cape golden mole  aaaagtgt----
B D                    Tenrec  aaaa---t----
      Lesser Egyptian jerboa  ------------
B D                  Hedgehog  ============
         Cape elephant shrew  ============
B D                      Pika  NNNNNNNNNNNN
              Golden hamster  ============
B D                     Shrew  ============
B D           Chinese hamster  NNNNNNNNNNNN
             Star-nosed mole  ============
                Prairie vole  ------------
               Big brown bat  ============
B D                    Lizard  ============
B D                    Rabbit  ------------
B D                   Manatee  ------------
B D                     Panda  ============
B D              Atlantic cod  ============
          Southern platyfish  ============
                 Zebra mbuna  ============
B D              Nile tilapia  ============
         Pundamilia nyererei  ============
       Burton's mouthbreeder  ============
         Princess of Burundi  ============
                 Spotted gar  ============
B D             X. tropicalis  ============
B D                 Zebrafish  ============
B D                Coelacanth  ============
  D               Rock pigeon  ============
B D        American alligator  ------------
      Yellowbelly pufferfish  ============
B D                      Fugu  ============
  D             Scarlet macaw  ------------
B D                    Medaka  ------------
  D              Mallard duck  ============
B D                 Tetraodon  ============
B D               Stickleback  ============
  D       Collared flycatcher  ------------
B D                    Turkey  ============
B D                   Chicken  ============
B D                   Wallaby  ============
  D    Spiny softshell turtle  ------------
  D  Chinese softshell turtle  ============
          Tibetan ground jay  ============
B D                Budgerigar  ------------
  D          Peregrine falcon  ------------
  D              Saker falcon  ------------
  D                    Parrot  ------------
B D       Medium ground finch  ============
  D    White-throated sparrow  ============
B D               Zebra finch  ============
B D           Tasmanian devil  ============
  D            Painted turtle  ------------
  D           Green seaturtle  ============
B D                   Dolphin  ------------
B D                  Platypus  ============
B D                       Cow  ============
               Domestic goat  ============
B D                     Sheep  ============
            Tibetan antelope  ============
                Killer whale  ------------
B D                 Armadillo  ------------
B D                    Alpaca  ============
              Bactrian camel  ============
B D                   Opossum  ============
                    Aardvark  ------------
            Black flying-fox  ------------
B D                       Cat  ------------
B D                  Elephant  ============
B D                Guinea pig  ============
            Brush-tailed rat  ============
B D            Naked mole-rat  ============
                  Chinchilla  ============
          Chinese tree shrew  ============
              Pacific walrus  ------------
B D          White rhinoceros  ============

Inserts between block 19 and 20 in window
B D                      Pig 15bp
B D                      Dog 6bp
B D                  Ferret  6bp
                Weddell seal 6bp

Alignment block 20 of 308 in window, 45490415 - 45490416, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                 Orangutan  cc
B D                    Gibbon  cc
B D                    Rhesus  cc
B D       Crab-eating macaque  cc
B D                    Baboon  cc
B D              Green monkey  cc
B D                  Marmoset  cc
B D           Squirrel monkey  cc
B D                  Bushbaby  cc
B D                  Squirrel  cg
B D                     Mouse  cc
B D                       Rat  cc
B D                       Pig  cc
B D                     Horse  ac
B D                       Cat  cc
             Cape golden mole  tc
B D                    Tenrec  tt
                     Aardvark  -t
      Lesser Egyptian jerboa  --
B D                  Hedgehog  ==
         Cape elephant shrew  ==
B D                      Pika  NN
              Golden hamster  ==
B D                     Shrew  ==
B D           Chinese hamster  NN
             Star-nosed mole  ==
                Prairie vole  --
B D                  Microbat  --
        David's myotis (bat)  --
               Big brown bat  ==
B D                    Lizard  ==
B D                    Rabbit  --
B D                   Manatee  --
B D                     Panda  ==
B D                   Ferret   ==
B D                       Dog  ==
B D              Atlantic cod  ==
          Southern platyfish  ==
                 Zebra mbuna  ==
B D              Nile tilapia  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
                 Spotted gar  ==
B D             X. tropicalis  ==
B D                 Zebrafish  ==
B D                Coelacanth  ==
  D               Rock pigeon  ==
B D        American alligator  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
  D             Scarlet macaw  --
B D                    Medaka  --
  D              Mallard duck  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
  D       Collared flycatcher  --
B D                    Turkey  ==
B D                   Chicken  ==
B D                   Wallaby  ==
  D    Spiny softshell turtle  --
  D  Chinese softshell turtle  ==
          Tibetan ground jay  ==
B D                Budgerigar  --
  D          Peregrine falcon  --
  D              Saker falcon  --
  D                    Parrot  --
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D               Zebra finch  ==
B D           Tasmanian devil  ==
  D            Painted turtle  --
  D           Green seaturtle  ==
B D                   Dolphin  --
B D                  Platypus  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
                Killer whale  --
B D                   Megabat  --
B D                 Armadillo  --
B D                    Alpaca  ==
              Bactrian camel  ==
B D                   Opossum  ==
                Weddell seal  ==
            Black flying-fox  --
B D                  Elephant  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
              Pacific walrus  --
B D          White rhinoceros  ==

Alignment block 21 of 308 in window, 45490417 - 45490417, 1 bps 
B D                     Human  t---
B D                     Chimp  t---
B D                   Gorilla  t---
B D                 Orangutan  t---
B D                    Gibbon  t---
B D                    Rhesus  t---
B D       Crab-eating macaque  t---
B D                    Baboon  t---
B D              Green monkey  t---
B D                  Marmoset  t---
B D           Squirrel monkey  ttta
B D                  Bushbaby  t---
B D                       Pig  t---
B D                       Cow  t---
B D                     Horse  t---
B D                       Cat  t---
             Cape golden mole  t---
B D                    Tenrec  t---
                     Aardvark  g---
      Lesser Egyptian jerboa  ----
B D                  Hedgehog  ====
         Cape elephant shrew  ====
B D                      Pika  NNNN
B D                       Rat  ----
B D                     Mouse  ----
              Golden hamster  ====
B D                     Shrew  ====
B D           Chinese hamster  NNNN
             Star-nosed mole  ====
                Prairie vole  ----
B D                  Microbat  ----
        David's myotis (bat)  ----
               Big brown bat  ====
B D                    Lizard  ====
B D                    Rabbit  ----
B D                   Manatee  ----
B D                     Panda  ====
B D                   Ferret   ====
B D                       Dog  ====
B D              Atlantic cod  ====
          Southern platyfish  ====
                 Zebra mbuna  ====
B D              Nile tilapia  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
                 Spotted gar  ====
B D             X. tropicalis  ====
B D                 Zebrafish  ====
B D                Coelacanth  ====
  D               Rock pigeon  ====
B D        American alligator  ----
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
  D             Scarlet macaw  ----
B D                    Medaka  ----
  D              Mallard duck  ====
B D                 Tetraodon  ====
B D               Stickleback  ====
  D       Collared flycatcher  ----
B D                    Turkey  ====
B D                   Chicken  ====
B D                   Wallaby  ====
  D    Spiny softshell turtle  ----
  D  Chinese softshell turtle  ====
          Tibetan ground jay  ====
B D                Budgerigar  ----
  D          Peregrine falcon  ----
  D              Saker falcon  ----
  D                    Parrot  ----
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
B D               Zebra finch  ====
B D           Tasmanian devil  ====
  D            Painted turtle  ----
  D           Green seaturtle  ====
B D                   Dolphin  ----
B D                  Platypus  ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ====
                Killer whale  ----
B D                   Megabat  ----
B D                 Armadillo  ----
B D                    Alpaca  ====
              Bactrian camel  ====
B D                   Opossum  ====
                Weddell seal  ====
            Black flying-fox  ----
B D                  Squirrel  ----
B D                  Elephant  ====
B D                Guinea pig  ====
            Brush-tailed rat  ====
B D            Naked mole-rat  ====
                  Chinchilla  ====
          Chinese tree shrew  ====
              Pacific walrus  ----
B D          White rhinoceros  ====

Alignment block 22 of 308 in window, 45490418 - 45490420, 3 bps 
B D                     Human  aaa
B D                     Chimp  aaa
B D                   Gorilla  aaa
B D                 Orangutan  aaa
B D                    Gibbon  aaa
B D                    Rhesus  aaa
B D       Crab-eating macaque  aaa
B D                    Baboon  aaa
B D              Green monkey  aaa
B D                  Marmoset  aaa
B D           Squirrel monkey  ggg
B D                       Pig  aaa
B D                       Cow  aaa
B D                     Horse  aaa
B D                       Cat  aaa
             Cape golden mole  att
B D                    Tenrec  gat
                     Aardvark  agg
B D        American alligator  aaa
      Lesser Egyptian jerboa  ---
B D                  Hedgehog  ===
         Cape elephant shrew  ===
B D                      Pika  NNN
B D                       Rat  ---
B D                     Mouse  ---
              Golden hamster  ===
B D                     Shrew  ===
B D           Chinese hamster  NNN
             Star-nosed mole  ===
                Prairie vole  ---
B D                  Microbat  ---
        David's myotis (bat)  ---
               Big brown bat  ===
B D                    Lizard  ===
B D                    Rabbit  ---
B D                   Manatee  ---
B D                     Panda  ===
B D                   Ferret   ===
B D                       Dog  ===
B D              Atlantic cod  ===
          Southern platyfish  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
                 Spotted gar  ===
B D             X. tropicalis  ===
B D                 Zebrafish  ===
B D                Coelacanth  ===
  D               Rock pigeon  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
  D             Scarlet macaw  ---
B D                    Medaka  ---
  D              Mallard duck  ===
B D                 Tetraodon  ===
B D               Stickleback  ===
  D       Collared flycatcher  ---
B D                    Turkey  ===
B D                   Chicken  ===
B D                   Wallaby  ===
  D    Spiny softshell turtle  ---
  D  Chinese softshell turtle  ===
          Tibetan ground jay  ===
B D                Budgerigar  ---
  D          Peregrine falcon  ---
  D              Saker falcon  ---
  D                    Parrot  ---
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ---
  D           Green seaturtle  ===
B D                   Dolphin  ---
B D                  Platypus  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
                Killer whale  ---
B D                   Megabat  ---
B D                 Armadillo  ---
B D                    Alpaca  ===
              Bactrian camel  ===
B D                   Opossum  ===
                Weddell seal  ===
            Black flying-fox  ---
B D                  Squirrel  ---
B D                  Bushbaby  ---
B D                  Elephant  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
          Chinese tree shrew  ===
              Pacific walrus  ---
B D          White rhinoceros  ===

Alignment block 23 of 308 in window, 45490421 - 45490421, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                       Pig  a
B D                       Cow  g
B D                     Sheep  a
B D                     Horse  a
B D                       Cat  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D        American alligator  g
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                      Pika  N
B D                       Rat  -
B D                     Mouse  -
              Golden hamster  =
B D                     Shrew  =
B D           Chinese hamster  N
             Star-nosed mole  =
                Prairie vole  -
B D                  Microbat  -
        David's myotis (bat)  -
               Big brown bat  =
B D                    Lizard  =
B D                    Rabbit  -
B D                   Manatee  -
B D                     Panda  =
B D                   Ferret   =
B D                       Dog  =
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D             X. tropicalis  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
  D             Scarlet macaw  -
B D                    Medaka  -
  D              Mallard duck  =
B D                 Tetraodon  =
B D               Stickleback  =
  D       Collared flycatcher  -
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  -
  D          Peregrine falcon  -
  D              Saker falcon  -
  D                    Parrot  -
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
B D           Tasmanian devil  =
  D            Painted turtle  -
  D           Green seaturtle  =
B D                   Dolphin  -
B D                  Platypus  =
               Domestic goat  =
            Tibetan antelope  =
                Killer whale  -
B D                   Megabat  -
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                Weddell seal  =
            Black flying-fox  -
B D                  Squirrel  -
B D                  Bushbaby  -
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
          Chinese tree shrew  =
              Pacific walrus  -
B D          White rhinoceros  =

Inserts between block 23 and 24 in window
B D                      Cow 8bp
B D                    Horse 21bp

Alignment block 24 of 308 in window, 45490422 - 45490422, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
                   Chinchilla  a
B D                    Rabbit  a
B D                     Horse  g
B D          White rhinoceros  a
B D                       Cat  a
B D                     Panda  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
             Cape golden mole  a
B D                    Tenrec  g
                     Aardvark  a
B D        American alligator  a
      Lesser Egyptian jerboa  -
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                      Pika  N
B D                       Rat  -
B D                     Mouse  -
              Golden hamster  =
B D                     Shrew  =
B D           Chinese hamster  N
             Star-nosed mole  =
                Prairie vole  -
B D                  Microbat  -
        David's myotis (bat)  -
B D                    Lizard  =
B D                   Manatee  -
B D                   Ferret   =
B D                       Dog  =
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D             X. tropicalis  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
  D             Scarlet macaw  -
B D                    Medaka  -
  D              Mallard duck  =
B D                 Tetraodon  =
B D               Stickleback  =
  D       Collared flycatcher  -
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
  D    Spiny softshell turtle  -
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  -
  D          Peregrine falcon  -
  D              Saker falcon  -
  D                    Parrot  -
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
B D           Tasmanian devil  =
  D            Painted turtle  -
  D           Green seaturtle  =
B D                   Dolphin  -
B D                  Platypus  =
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  -
            Tibetan antelope  =
                Killer whale  -
B D                       Pig  -
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                Weddell seal  =
B D                  Squirrel  -
B D                  Bushbaby  -
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
          Chinese tree shrew  =
              Pacific walrus  -

Inserts between block 24 and 25 in window
B D                      Cat 7bp

Alignment block 25 of 308 in window, 45490423 - 45490430, 8 bps 
B D                     Human  gttttaag-
B D                     Chimp  gttttaag-
B D                   Gorilla  gttttaag-
B D                 Orangutan  gttttaag-
B D                    Gibbon  gttttaag-
B D                    Rhesus  gttttaag-
B D       Crab-eating macaque  gttttaag-
B D                    Baboon  gttttaag-
B D              Green monkey  gttttaag-
B D                  Marmoset  gttttgag-
B D           Squirrel monkey  gttttgag-
B D                  Squirrel  gcttgtaa-
       Lesser Egyptian jerboa  -cttacaa-
                 Prairie vole  -tacacaa-
B D                     Mouse  acacacaa-
B D                       Rat  atacacaa-
                   Chinchilla  gcttttta-
B D                    Rabbit  gcttttag-
B D                       Pig  ------a--
B D                       Cow  gtttttag-
B D                     Sheep  ggttttag-
                Domestic goat  gtttttag-
B D                     Horse  gctttgag-
B D          White rhinoceros  gtttttag-
B D                       Cat  attcttag-
B D                       Dog  ------ag-
B D                   Ferret   ------ag-
B D                     Panda  gcttttag-
               Pacific walrus  gctttcag-
                 Weddell seal  ------ag-
             Black flying-fox  gttttggg-
B D                   Megabat  gtttttgg-
                Big brown bat  gtttctag-
         David's myotis (bat)  gtttttag-
B D                  Microbat  gtttttag-
             Cape golden mole  -catttac-
B D                    Tenrec  -tttatag-
                     Aardvark  -tttata--
B D        American alligator  -----gaaa
B D                  Hedgehog  =========
         Cape elephant shrew  =========
B D                      Pika  NNNNNNNNN
              Golden hamster  =========
B D                     Shrew  =========
B D           Chinese hamster  NNNNNNNNN
             Star-nosed mole  =========
B D                    Lizard  =========
B D                   Manatee  ---------
B D              Atlantic cod  =========
          Southern platyfish  =========
                 Zebra mbuna  =========
B D              Nile tilapia  =========
         Pundamilia nyererei  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
                 Spotted gar  =========
B D             X. tropicalis  =========
B D                 Zebrafish  =========
B D                Coelacanth  =========
  D               Rock pigeon  =========
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
  D             Scarlet macaw  ---------
B D                    Medaka  ---------
  D              Mallard duck  =========
B D                 Tetraodon  =========
B D               Stickleback  =========
  D       Collared flycatcher  ---------
B D                    Turkey  =========
B D                   Chicken  =========
B D                   Wallaby  =========
  D    Spiny softshell turtle  ---------
  D  Chinese softshell turtle  =========
          Tibetan ground jay  =========
B D                Budgerigar  ---------
  D          Peregrine falcon  ---------
  D              Saker falcon  ---------
  D                    Parrot  ---------
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
B D               Zebra finch  =========
B D           Tasmanian devil  =========
  D            Painted turtle  ---------
  D           Green seaturtle  =========
B D                   Dolphin  ---------
B D                  Platypus  =========
            Tibetan antelope  =========
                Killer whale  ---------
B D                 Armadillo  ---------
B D                    Alpaca  =========
              Bactrian camel  =========
B D                   Opossum  =========
B D                  Bushbaby  ---------
B D                  Elephant  =========
B D                Guinea pig  =========
            Brush-tailed rat  =========
B D            Naked mole-rat  =========
          Chinese tree shrew  =========

Alignment block 26 of 308 in window, 45490431 - 45490431, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  t
                 Prairie vole  a
B D                     Mouse  a
B D                       Rat  a
                   Chinchilla  a
B D                    Rabbit  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  a
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D        American alligator  g
  D    Spiny softshell turtle  g
B D                    Tenrec  -
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                      Pika  N
              Golden hamster  =
B D                     Shrew  =
B D           Chinese hamster  N
             Star-nosed mole  =
B D                    Lizard  =
B D                   Manatee  -
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D             X. tropicalis  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
  D             Scarlet macaw  -
B D                    Medaka  -
  D              Mallard duck  =
B D                 Tetraodon  =
B D               Stickleback  =
  D       Collared flycatcher  -
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
            Cape golden mole  -
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  -
  D          Peregrine falcon  -
  D              Saker falcon  -
  D                    Parrot  -
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
B D           Tasmanian devil  =
  D            Painted turtle  -
  D           Green seaturtle  =
B D                   Dolphin  -
B D                  Platypus  =
B D                       Cow  -
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  =
                Killer whale  -
B D                       Pig  -
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                    Aardvark  -
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
          Chinese tree shrew  =

Alignment block 27 of 308 in window, 45490432 - 45490432, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  c
B D                  Squirrel  g
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D                     Mouse  t
B D                       Rat  t
                   Chinchilla  g
B D                    Rabbit  a
B D                       Pig  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
             Cape golden mole  t
B D                    Tenrec  a
B D        American alligator  g
  D    Spiny softshell turtle  g
B D                  Hedgehog  =
         Cape elephant shrew  =
B D                      Pika  N
              Golden hamster  =
B D                     Shrew  =
B D           Chinese hamster  N
             Star-nosed mole  =
B D                    Lizard  =
B D                   Manatee  -
B D              Atlantic cod  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
                 Spotted gar  =
B D             X. tropicalis  =
B D                 Zebrafish  =
B D                Coelacanth  =
  D               Rock pigeon  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
  D             Scarlet macaw  -
B D                    Medaka  -
  D              Mallard duck  =
B D                 Tetraodon  =
B D               Stickleback  =
  D       Collared flycatcher  -
B D                    Turkey  =
B D                   Chicken  =
B D                   Wallaby  =
  D  Chinese softshell turtle  =
          Tibetan ground jay  =
B D                Budgerigar  -
  D          Peregrine falcon  -
  D              Saker falcon  -
  D                    Parrot  -
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
B D           Tasmanian devil  =
  D            Painted turtle  -
  D           Green seaturtle  =
B D                   Dolphin  -
B D                  Platypus  =
                Killer whale  -
B D                 Armadillo  -
B D                    Alpaca  =
              Bactrian camel  =
B D                   Opossum  =
                    Aardvark  -
B D                  Elephant  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
          Chinese tree shrew  =

Alignment block 28 of 308 in window, 45490433 - 45490436, 4 bps 
B D                     Human  aaa-a
B D                     Chimp  aaa-a
B D                   Gorilla  aaa-a
B D                 Orangutan  aaa-a
B D                    Gibbon  aaa-a
B D                    Rhesus  aaa-a
B D       Crab-eating macaque  aaa-a
B D                    Baboon  aaa-a
B D              Green monkey  aaa-a
B D                  Marmoset  aaa-a
B D           Squirrel monkey  aaa-a
B D                  Bushbaby  taa-a
B D                  Squirrel  aaa-a
       Lesser Egyptian jerboa  ttg-g
                 Prairie vole  aaa-a
B D                     Mouse  aaa-a
B D                       Rat  aaa-a
                   Chinchilla  aaa-a
B D                    Rabbit  aaa-a
B D                       Pig  aaa-a
B D                   Dolphin  aaa-a
                 Killer whale  aaa-a
             Tibetan antelope  gaa-a
B D                       Cow  aaa-a
B D                     Sheep  aaa-a
                Domestic goat  aaa-a
B D                     Horse  gaa-a
B D          White rhinoceros  aaa-a
B D                       Cat  aaaga
B D                       Dog  aaa-a
B D                   Ferret   aaa-a
B D                     Panda  aaa-a
               Pacific walrus  --a-a
                 Weddell seal  aaa-a
             Black flying-fox  aaa-a
B D                   Megabat  aaa-a
                Big brown bat  aaa-a
         David's myotis (bat)  aaa-a
B D                  Microbat  aaa-a
             Cape golden mole  -at-a
B D                    Tenrec  -aa-a
B D                 Armadillo  aaa-a
B D        American alligator  aaa-a
  D    Spiny softshell turtle  aaa-a
B D                  Hedgehog  =====
         Cape elephant shrew  =====
B D                      Pika  NNNNN
              Golden hamster  =====
B D                     Shrew  =====
B D           Chinese hamster  NNNNN
             Star-nosed mole  =====
B D                    Lizard  =====
B D                   Manatee  -----
B D              Atlantic cod  =====
          Southern platyfish  =====
                 Zebra mbuna  =====
B D              Nile tilapia  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
                 Spotted gar  =====
B D             X. tropicalis  =====
B D                 Zebrafish  =====
B D                Coelacanth  =====
  D               Rock pigeon  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
  D             Scarlet macaw  -----
B D                    Medaka  -----
  D              Mallard duck  =====
B D                 Tetraodon  =====
B D               Stickleback  =====
  D       Collared flycatcher  -----
B D                    Turkey  =====
B D                   Chicken  =====
B D                   Wallaby  =====
  D  Chinese softshell turtle  =====
          Tibetan ground jay  =====
B D                Budgerigar  -----
  D          Peregrine falcon  -----
  D              Saker falcon  -----
  D                    Parrot  -----
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
B D               Zebra finch  =====
B D           Tasmanian devil  =====
  D            Painted turtle  -----
  D           Green seaturtle  =====
B D                  Platypus  =====
B D                    Alpaca  =====
              Bactrian camel  =====
B D                   Opossum  =====
                    Aardvark  -----
B D                  Elephant  =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
          Chinese tree shrew  =====

Inserts between block 28 and 29 in window
B D       American alligator 1bp

Alignment block 29 of 308 in window, 45490437 - 45490445, 9 bps 
B D                     Human  aaa------------ttgata---
B D                     Chimp  aaa------------ttgata---
B D                   Gorilla  aaa------------ttgata---
B D                 Orangutan  aaa------------ttgata---
B D                    Gibbon  aaa------------ctgata---
B D                    Rhesus  aaa------------ttgata---
B D       Crab-eating macaque  aaa------------ttgata---
B D                    Baboon  aaa------------ttgata---
B D              Green monkey  aaa------------ttgata---
B D                  Marmoset  aaa------------ttgata---
B D           Squirrel monkey  aaa------------ttgata---
B D                  Bushbaby  aag------------ttggta---
B D                  Squirrel  aaa------------ctggca---
       Lesser Egyptian jerboa  taa------------ct-------
                 Prairie vole  tat---------------------
B D                     Mouse  taa---------------------
B D                       Rat  taa---------------------
                   Chinchilla  gaa------------acggca---
B D                    Rabbit  caa------------ttagca---
B D                       Pig  aaa---------------------
B D                   Dolphin  aag------------ttggta---
                 Killer whale  aag------------ttggta---
             Tibetan antelope  aat------------ttggta---
B D                       Cow  aag------------ttggta---
B D                     Sheep  acg------------ttggta---
                Domestic goat  aag------------ttggta---
B D                     Horse  aaggaaaaataaaatcttaag---
B D          White rhinoceros  aag------------ttggta---
B D                       Cat  agt------------ttgtag---
B D                       Dog  agt------------ttatag---
B D                   Ferret   agt------------ttgtag---
B D                     Panda  agc------------ctgtag---
               Pacific walrus  agt------------ctgtag---
                 Weddell seal  agt------------ttatag---
             Black flying-fox  aag------------ttggta---
B D                   Megabat  aag------------ttggta---
                Big brown bat  aag------------ttggta---
         David's myotis (bat)  aag------------ttggtt---
B D                  Microbat  aag------------ttggtt---
             Cape golden mole  aaa------------tttaat---
B D                    Tenrec  aga------------gtaatt---
B D                 Armadillo  aat------------ttgatg---
B D        American alligator  ---------------caaacaa--
  D            Painted turtle  ---------------aaaatgaaa
B D                  Hedgehog  ========================
         Cape elephant shrew  ========================
B D                      Pika  NNNNNNNNNNNNNNNNNNNNNNNN
              Golden hamster  ========================
B D                     Shrew  ========================
B D           Chinese hamster  NNNNNNNNNNNNNNNNNNNNNNNN
             Star-nosed mole  ========================
B D                    Lizard  ========================
B D                   Manatee  ------------------------
B D              Atlantic cod  ========================
          Southern platyfish  ========================
                 Zebra mbuna  ========================
B D              Nile tilapia  ========================
         Pundamilia nyererei  ========================
       Burton's mouthbreeder  ========================
         Princess of Burundi  ========================
                 Spotted gar  ========================
B D             X. tropicalis  ========================
B D                 Zebrafish  ========================
B D                Coelacanth  ========================
  D               Rock pigeon  ========================
      Yellowbelly pufferfish  ========================
B D                      Fugu  ========================
  D             Scarlet macaw  ------------------------
B D                    Medaka  ------------------------
  D              Mallard duck  ========================
B D                 Tetraodon  ========================
B D               Stickleback  ========================
  D       Collared flycatcher  ------------------------
B D                    Turkey  ========================
B D                   Chicken  ========================
B D                   Wallaby  ========================
  D    Spiny softshell turtle  ------------------------
  D  Chinese softshell turtle  ========================
          Tibetan ground jay  ========================
B D                Budgerigar  ------------------------
  D          Peregrine falcon  ------------------------
  D              Saker falcon  ------------------------
  D                    Parrot  ------------------------
B D       Medium ground finch  ========================
  D    White-throated sparrow  ========================
B D               Zebra finch  ========================
B D           Tasmanian devil  ========================
  D           Green seaturtle  ========================
B D                  Platypus  ========================
B D                    Alpaca  ========================
              Bactrian camel  ========================
B D                   Opossum  ========================
                    Aardvark  ------------------------
B D                  Elephant  ========================
B D                Guinea pig  ========================
            Brush-tailed rat  ========================
B D            Naked mole-rat  ========================
          Chinese tree shrew  ========================

Inserts between block 29 and 30 in window
  D           Painted turtle 3bp

Alignment block 30 of 308 in window, 45490446 - 45490448, 3 bps 
B D                     Human  gct
B D                     Chimp  gct
B D                   Gorilla  gct
B D                 Orangutan  gct
B D                    Gibbon  gct
B D                    Rhesus  gct
B D       Crab-eating macaque  gct
B D                    Baboon  gct
B D              Green monkey  gct
B D                  Marmoset  gtt
B D           Squirrel monkey  gtt
B D                  Bushbaby  g-t
           Chinese tree shrew  gct
B D                  Squirrel  -gt
       Lesser Egyptian jerboa  --t
B D                   Dolphin  gtt
                 Killer whale  gtt
             Tibetan antelope  gtt
B D                       Cow  gtt
B D                     Sheep  gtt
                Domestic goat  gtt
B D                     Horse  gaa
B D          White rhinoceros  gtt
B D                       Cat  tt-
B D                       Dog  tta
B D                   Ferret   ttt
B D                     Panda  ttt
               Pacific walrus  ttt
                 Weddell seal  ttt
             Black flying-fox  gtt
B D                   Megabat  gtt
                Big brown bat  gtt
         David's myotis (bat)  gtt
B D                  Microbat  gtt
             Cape golden mole  atg
B D                    Tenrec  att
B D                 Armadillo  gtc
                  Spotted gar  gtt
B D                  Hedgehog  ===
         Cape elephant shrew  ===
B D                      Pika  NNN
B D                       Rat  ---
B D                     Mouse  ---
              Golden hamster  ===
B D                     Shrew  ===
B D           Chinese hamster  NNN
             Star-nosed mole  ===
                Prairie vole  ---
B D                    Lizard  ===
B D                    Rabbit  ---
B D                   Manatee  ---
B D              Atlantic cod  ===
          Southern platyfish  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D             X. tropicalis  ===
B D                 Zebrafish  ===
B D                Coelacanth  ===
  D               Rock pigeon  ===
B D        American alligator  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
  D             Scarlet macaw  ---
B D                    Medaka  ---
  D              Mallard duck  ===
B D                 Tetraodon  ===
B D               Stickleback  ===
  D       Collared flycatcher  ---
B D                    Turkey  ===
B D                   Chicken  ===
B D                   Wallaby  ===
  D    Spiny softshell turtle  ---
  D  Chinese softshell turtle  ===
          Tibetan ground jay  ===
B D                Budgerigar  ---
  D          Peregrine falcon  ---
  D              Saker falcon  ---
  D                    Parrot  ---
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
B D           Tasmanian devil  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                  Platypus  ===
B D                       Pig  ---
B D                    Alpaca  ===
              Bactrian camel  ===
B D                   Opossum  ===
                    Aardvark  ---
B D                  Elephant  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ---

Inserts between block 30 and 31 in window
            Black flying-fox 1bp
            Cape golden mole 9bp
B D                   Tenrec 1bp
B D                Armadillo 1bp

Alignment block 31 of 308 in window, 45490449 - 45490458, 10 bps 
B D                     Human  taag---aaaaaa
B D                     Chimp  taag---aaaaaa
B D                   Gorilla  taag---aaaaaa
B D                 Orangutan  taag---aaaaaa
B D                    Gibbon  taagaa-aaaaaa
B D                    Rhesus  taag---aaaaaa
B D       Crab-eating macaque  taag---aaaaaa
B D                    Baboon  taag---aaaaaa
B D              Green monkey  taag---aaaaaa
B D                  Marmoset  taag---aaaaaa
B D           Squirrel monkey  taag---aaaaaa
B D                  Bushbaby  taaa---aaaaaa
           Chinese tree shrew  taag---------
B D                  Squirrel  taaa---aaaaaa
       Lesser Egyptian jerboa  tagg---gaaaag
                 Prairie vole  -atg---caaaaa
B D                     Mouse  -ata---caaaac
B D                       Rat  -atg---aacaac
                   Chinchilla  -gtt---caaaa-
B D                    Rabbit  -gtt---taaa--
B D                       Pig  taaa---caaaaa
B D                    Alpaca  taaa---taaaaa
               Bactrian camel  taaa---taaaaa
B D                   Dolphin  ---a---caaaaa
                 Killer whale  ---a---caaaaa
             Tibetan antelope  ---a---gaaaaa
B D                       Cow  ---a---gaaaaa
B D                     Sheep  ---a---gaaaaa
                Domestic goat  ---a---gaaaaa
B D                     Horse  -------aaaaaa
B D          White rhinoceros  -------aaaaaa
B D                       Cat  --------aaaaa
B D                       Dog  -------aaaaaa
B D                   Ferret   --------aaaaa
B D                     Panda  -------aaaaaa
               Pacific walrus  -------aaaaaa
                 Weddell seal  -------aaaaaa
             Black flying-fox  ---aaaaaaaaaa
B D                   Megabat  ---aaaaaaaaaa
                Big brown bat  -----aaaaaaaa
         David's myotis (bat)  -------aaaaaa
B D                  Microbat  -------aaaaaa
             Cape golden mole  ttaa----aaata
B D                    Tenrec  ttag--------a
B D                 Armadillo  ttag---aaaaaa
B D        American alligator  ---a---caaaaa
  D            Painted turtle  aaag---gaataa
  D    Spiny softshell turtle  ---g---gaatca
                  Spotted gar  taac---caaaac
B D                  Hedgehog  =============
         Cape elephant shrew  =============
B D                      Pika  NNNNNNNNNNNNN
              Golden hamster  =============
B D                     Shrew  =============
B D           Chinese hamster  NNNNNNNNNNNNN
             Star-nosed mole  =============
B D                    Lizard  =============
B D                   Manatee  -------------
B D              Atlantic cod  =============
          Southern platyfish  =============
                 Zebra mbuna  =============
B D              Nile tilapia  =============
         Pundamilia nyererei  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D             X. tropicalis  =============
B D                 Zebrafish  =============
B D                Coelacanth  =============
  D               Rock pigeon  =============
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
  D             Scarlet macaw  -------------
B D                    Medaka  -------------
  D              Mallard duck  =============
B D                 Tetraodon  =============
B D               Stickleback  =============
  D       Collared flycatcher  -------------
B D                    Turkey  =============
B D                   Chicken  =============
B D                   Wallaby  =============
  D  Chinese softshell turtle  =============
          Tibetan ground jay  =============
B D                Budgerigar  -------------
  D          Peregrine falcon  -------------
  D              Saker falcon  -------------
  D                    Parrot  -------------
B D       Medium ground finch  =============
  D    White-throated sparrow  =============
B D               Zebra finch  =============
B D           Tasmanian devil  =============
  D           Green seaturtle  =============
B D                  Platypus  =============
B D                   Opossum  =============
                    Aardvark  -------------
B D                  Elephant  =============
B D                Guinea pig  =============
            Brush-tailed rat  =============
B D            Naked mole-rat  =============

Inserts between block 31 and 32 in window
B D                 Squirrel 7bp
      Lesser Egyptian jerboa 15bp
                Prairie vole 6bp
B D                    Mouse 8bp
B D                      Rat 8bp
B D       American alligator 1bp
  D           Painted turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 32 of 308 in window, 45490459 - 45490466, 8 bps 
B D                     Human  aa-tctagt
B D                     Chimp  aa-tctagt
B D                   Gorilla  aa-tctagt
B D                 Orangutan  aa-tctagt
B D                    Gibbon  aa-tctagt
B D                    Rhesus  aa-tctagt
B D       Crab-eating macaque  aa-tctagt
B D                    Baboon  aa-tctagt
B D              Green monkey  aa-tctagt
B D                  Marmoset  aagtctagt
B D           Squirrel monkey  aa-tctagt
B D                  Bushbaby  aa-tttagt
           Chinese tree shrew  -a-gatagt
B D                  Squirrel  aa-ctagtt
       Lesser Egyptian jerboa  ca-tctatc
                 Prairie vole  aa-tgtagc
               Golden hamster  aa-tgtagc
B D                     Mouse  aa-tgtagc
B D                       Rat  aa-tgtagg
                   Chinchilla  aa-cctagc
B D                    Rabbit  aa-tatagt
B D                       Pig  aa-acttat
B D                    Alpaca  aa-tctcat
               Bactrian camel  aa-tctcat
B D                   Dolphin  aa-tcttat
                 Killer whale  aa-tcttat
             Tibetan antelope  ----cttat
B D                       Cow  ----cttat
B D                     Sheep  ----cttat
                Domestic goat  ----cttat
B D                     Horse  aa-tctagt
B D          White rhinoceros  ca-tctagt
B D                       Cat  ta-tcttat
B D                       Dog  aa-tcttat
B D                   Ferret   ag-tcttgt
B D                     Panda  aa-tcttgt
               Pacific walrus  aa-tcttgt
                 Weddell seal  aa-tcttgt
             Black flying-fox  aa-tctcag
B D                   Megabat  aa-tctcag
                Big brown bat  aa-tctc--
         David's myotis (bat)  aa-tctc--
B D                  Microbat  aa-tctc--
             Cape golden mole  aa-actatt
B D                    Tenrec  aa-gttatc
B D                 Armadillo  aa-tctagt
B D        American alligator  aa-tgaga-
  D            Painted turtle  ag-tgagg-
  D    Spiny softshell turtle  ag-cagag-
                  Spotted gar  aa-ggt---
B D                  Hedgehog  =========
         Cape elephant shrew  =========
B D                      Pika  NNNNNNNNN
B D                     Shrew  =========
B D           Chinese hamster  NNNNNNNNN
             Star-nosed mole  =========
B D                    Lizard  =========
B