Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 907 in window, 169071705 - 169071816, 112 bps 
B D                   Human  tagagatggagtgcgtaggctggtc-ttgaattcccagcgtcaagtgatc-------cgcccaccttcgc
B D                   Chimp  tagagatggagtgcgtaggctggtc-ttgaattcccagcgtcaagtgatc-------cgcccaccttggc
B D               Orangutan  tagagatggagtgcgtagcctggtc-ttgaattcccagcatcaagtgatc-------cgcccgccttggc
B D                  Gibbon  tagcgatggagtgcataggctggtc-ttgaattcccagcatcaagtgatc-------cgcccgccttggc
B D                  Rhesus  tagagatggagtgcataggctggtctttgaattcccagcatcaagcgatc-------tgcctgccttggc
B D     Crab-eating macaque  tagagatggagtgcataggctggtctttgaattcccagcatcaagcgatc-------tgcctgccttggc
B D                  Baboon  tagagatggagtgcgtaggctggtctttgaactcccagcatcaagcgatc-------tgcctgccttggc
B D            Green monkey  tagagatggagtgtgtaggctggtctttgaactcccagcatcaagccatc-------tgcctgccttggc
B D                Marmoset  tagagatggagtgcctagactggtc-ttgaactcctgccatcaagtgatcccccaaccccccacctcagc
B D         Squirrel monkey  tagagatggagtgcctaggctggtc-ttgaactcctgctatcaagtgatcccccca-cccccacctcagc
                 Chinchilla  ----------------------------------------------------------------------
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ======================================================================
B D                 Gorilla  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D              Guinea pig  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================
B D          Naked mole-rat  ======================================================================
          Brush-tailed rat  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ----------------------------------------------------------------------
B D                   Sheep  ----------------------------------------------------------------------
          Tibetan antelope  ----------------------------------------------------------------------
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ----------------------------------------------------------------------
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D                     Cow  ======================================================================

                      Human  ctcccaaagtgctgggattatagcctgcacccagcctatacactaattaa
                      Chimp  ctcccaaagtgctgggattatagcctgcacccagcctatacactaattaa
                  Orangutan  ctcccaaagtgctgggattatagcccgcgcccagcctatacactaattaa
                     Gibbon  ctcccaaattgctgggattatagcccgcgcccagcctat--actaattaa
                     Rhesus  ctccctaagtgctgggattatagcctatgcccagcctatacactaattaa
        Crab-eating macaque  ctccctaagtgctgggattatagcctatgcccagcctatacactaattaa
                     Baboon  ctccctaagtgctgggattatagcctatgcccagcctatacactaattaa
               Green monkey  ctccctaagtgctgggattatagcctatgcccagcctatacactaattaa
                   Marmoset  ctcccaaagtgctgggattataccccatgcccagcctattcactaagtaa
            Squirrel monkey  cgcccaaagtgctgggattataccccatgcccagcctattcactaattaa
                 Chinchilla  --------------------------------------------------
                        Rat  ==================================================
               Prairie vole  ==================================================
             Golden hamster  ==================================================
                      Mouse  ==================================================
     Lesser Egyptian jerboa  ==================================================
                       Pika  ==================================================
                    Gorilla  ==================================================
               Weddell seal  ==================================================
                   Hedgehog  ==================================================
                 Guinea pig  ==================================================
                        Pig  ==================================================
                     Rabbit  ==================================================
           Cape golden mole  ==================================================
                   Aardvark  ==================================================
                    Megabat  ==================================================
                    Dolphin  ==================================================
            Tasmanian devil  ==================================================
                    Opossum  ==================================================
             Naked mole-rat  ==================================================
           Brush-tailed rat  ==================================================
        Cape elephant shrew  ==================================================
         Chinese tree shrew  ==================================================
                   Platypus  ==================================================
                    Manatee  ==================================================
                   Elephant  ==================================================
            Chinese hamster  ==================================================
                     Tenrec  ==================================================
                        Cat  ==================================================
                   Bushbaby  ==================================================
                    Ferret   ==================================================
            Star-nosed mole  ==================================================
              Domestic goat  --------------------------------------------------
                      Sheep  --------------------------------------------------
           Tibetan antelope  --------------------------------------------------
             Bactrian camel  ==================================================
                     Alpaca  ==================================================
             Pacific walrus  ==================================================
                      Panda  ==================================================
               Killer whale  ==================================================
                        Dog  ==================================================
           Black flying-fox  ==================================================
           White rhinoceros  ==================================================
                      Horse  ==================================================
                   Squirrel  ==================================================
                  Armadillo  --------------------------------------------------
       David's myotis (bat)  ==================================================
              Big brown bat  ==================================================
                   Microbat  ==================================================
                        Cow  ==================================================

Alignment block 2 of 907 in window, 169071817 - 169071832, 16 bps 
B D                   Human  aatatcaattttcttc
B D                   Chimp  aatatcaattttcttc
B D               Orangutan  aatatcaattttcttc
B D                  Gibbon  aatatcaattttcttc
B D                  Rhesus  aatatcagttttcttc
B D     Crab-eating macaque  aatatcagttttcttc
B D                  Baboon  aatatcatttttcttc
B D            Green monkey  aatatcagttttcttc
B D                Marmoset  aatatgaactttcttt
B D         Squirrel monkey  aatatgaactttcttt
B D              Guinea pig  aatatcagcattctta
                 Chinchilla  aatgtcagctttatta
B D                     Rat  ================
              Prairie vole  ================
            Golden hamster  ================
B D                   Mouse  ================
    Lesser Egyptian jerboa  ================
B D                    Pika  ================
B D                 Gorilla  ================
              Weddell seal  ================
B D                Hedgehog  ================
B D                     Pig  ================
B D                  Rabbit  ================
          Cape golden mole  ================
                  Aardvark  ================
B D                 Megabat  ================
B D                 Dolphin  ================
B D         Tasmanian devil  ================
B D                 Opossum  ================
B D          Naked mole-rat  ================
          Brush-tailed rat  ================
       Cape elephant shrew  ================
        Chinese tree shrew  ================
B D                Platypus  ================
B D                 Manatee  ================
B D                Elephant  ================
B D         Chinese hamster  ================
B D                  Tenrec  ================
B D                     Cat  ================
B D                Bushbaby  ================
B D                 Ferret   ================
           Star-nosed mole  ================
             Domestic goat  ----------------
B D                   Sheep  ----------------
          Tibetan antelope  ----------------
            Bactrian camel  ================
B D                  Alpaca  ================
            Pacific walrus  ================
B D                   Panda  ================
              Killer whale  ================
B D                     Dog  ================
          Black flying-fox  ================
B D        White rhinoceros  ================
B D                   Horse  ================
B D                Squirrel  ================
B D               Armadillo  ----------------
      David's myotis (bat)  ================
             Big brown bat  ================
B D                Microbat  ================
B D                     Cow  ================

Alignment block 3 of 907 in window, 169071833 - 169071874, 42 bps 
B D                   Human  atctgtaacattaagctctggaatcacctgagataatgtcca
B D                   Chimp  atctgtaacattaagctctggaatcacctgagataatgtcca
B D               Orangutan  atctgtaacattaagctctggaatcacctgagataatttcca
B D                  Gibbon  atctgtaacattaagctctggaatcgcctgagataatgtcca
B D                  Rhesus  atctgtaacattaagctctggaaccacctcagataatgtcca
B D     Crab-eating macaque  atctgtaacattaagctctggaaccacctcagataatgtcca
B D                  Baboon  atctgtaacattaagctctgcaatcacctcagataatgtcca
B D            Green monkey  atctgtaacattaagctctggaatcacctgagataatgtcca
B D                Marmoset  atccgtaacattaggctctggaatcacctgagataatatcca
B D         Squirrel monkey  ttccgtaacattaggctctggaatcacctgagataatgtcca
B D              Guinea pig  a-ctgtagcattatgctttggaatcatccaagataatgtcca
                 Chinchilla  a-ctacaacattaagctttggaatcacccaagataatgccca
           Tibetan antelope  atctataatagtaagttctggaatcacttgagataatgcaca
B D                   Sheep  atctataatagtaagttctggaatcacttgagataatgcaca
              Domestic goat  atctataatagtaagttctggaatcacttaagataatgcaca
B D                     Rat  ==========================================
              Prairie vole  ==========================================
            Golden hamster  ==========================================
B D                   Mouse  ==========================================
    Lesser Egyptian jerboa  ==========================================
B D                    Pika  ==========================================
B D                 Gorilla  ==========================================
              Weddell seal  ==========================================
B D                Hedgehog  ==========================================
B D                     Pig  ==========================================
B D                  Rabbit  ==========================================
          Cape golden mole  ==========================================
                  Aardvark  ==========================================
B D                 Megabat  ==========================================
B D                 Dolphin  ==========================================
B D         Tasmanian devil  ==========================================
B D                 Opossum  ==========================================
B D          Naked mole-rat  ==========================================
          Brush-tailed rat  ==========================================
       Cape elephant shrew  ==========================================
        Chinese tree shrew  ==========================================
B D                Platypus  ==========================================
B D                 Manatee  ==========================================
B D                Elephant  ==========================================
B D         Chinese hamster  ==========================================
B D                  Tenrec  ==========================================
B D                     Cat  ==========================================
B D                Bushbaby  ==========================================
B D                 Ferret   ==========================================
           Star-nosed mole  ==========================================
            Bactrian camel  ==========================================
B D                  Alpaca  ==========================================
            Pacific walrus  ==========================================
B D                   Panda  ==========================================
              Killer whale  ==========================================
B D                     Dog  ==========================================
          Black flying-fox  ==========================================
B D        White rhinoceros  ==========================================
B D                   Horse  ==========================================
B D                Squirrel  ==========================================
B D               Armadillo  ------------------------------------------
      David's myotis (bat)  ==========================================
             Big brown bat  ==========================================
B D                Microbat  ==========================================
B D                     Cow  ==========================================

Alignment block 4 of 907 in window, 169071875 - 169071915, 41 bps 
B D                   Human  tgcaagtgctctgtaaatgtgtaatagccccc------tatagaaat
B D                   Chimp  tgcaagtgctctgtaaatgtgtaatagccccc------tatagagat
B D               Orangutan  tgcaagtgctctgtaaatgtgtaatagccccc------tatagaaat
B D                  Gibbon  tgcaagtgctctgtaaatgtgtaatagccccc------tatagaaat
B D                  Rhesus  tgcaagtgctctgtaaatgtgtaatagccccc------tatagaaat
B D     Crab-eating macaque  tgcaagtgctctgtaaatgtgtaatagccccc------tataaaaat
B D                  Baboon  tgcaagtgctctgtaaatgtgtaatagccccc------tatagaaat
B D            Green monkey  tgcaagtgctctgtaaatgtgtaatagccccc------tatagaaat
B D              Guinea pig  taccagtcttttgtaa----------------------cacagaaat
                 Chinchilla  taacagtcttttgtaa----------------------cacagaaac
           Tibetan antelope  tgtaagtgctttgcaaaagtagaaacctcccccttcttcatagaagt
B D                   Sheep  tgtaagtgctttgcaaaagtagaaacctcccccttctgcatagaagt
              Domestic goat  tgtaagtgctttgcaaaagtagaaacctcccccttctccatagaagt
B D                     Rat  ===============================================
              Prairie vole  ===============================================
            Golden hamster  ===============================================
B D                   Mouse  ===============================================
    Lesser Egyptian jerboa  ===============================================
B D                    Pika  ===============================================
B D                 Gorilla  ===============================================
              Weddell seal  ===============================================
B D                Hedgehog  ===============================================
B D                     Pig  ===============================================
B D                  Rabbit  ===============================================
          Cape golden mole  ===============================================
                  Aardvark  ===============================================
B D                 Megabat  ===============================================
B D                 Dolphin  ===============================================
B D         Tasmanian devil  ===============================================
B D                 Opossum  ===============================================
B D          Naked mole-rat  ===============================================
          Brush-tailed rat  ===============================================
       Cape elephant shrew  ===============================================
        Chinese tree shrew  ===============================================
B D                Platypus  ===============================================
B D                 Manatee  ===============================================
B D                Elephant  ===============================================
B D         Chinese hamster  ===============================================
B D                  Tenrec  ===============================================
B D                     Cat  ===============================================
B D                Bushbaby  ===============================================
B D                 Ferret   ===============================================
           Star-nosed mole  ===============================================
            Bactrian camel  ===============================================
B D                  Alpaca  ===============================================
            Pacific walrus  ===============================================
B D                   Panda  ===============================================
              Killer whale  ===============================================
B D                     Dog  ===============================================
          Black flying-fox  ===============================================
B D        White rhinoceros  ===============================================
B D                   Horse  ===============================================
B D                Squirrel  ===============================================
B D               Armadillo  -----------------------------------------------
      David's myotis (bat)  ===============================================
             Big brown bat  ===============================================
B D                Microbat  ===============================================
B D         Squirrel monkey  -----------------------------------------------
B D                Marmoset  -----------------------------------------------
B D                     Cow  ===============================================

Inserts between block 4 and 5 in window
B D                  Sheep 286bp

Alignment block 5 of 907 in window, 169071916 - 169071918, 3 bps 
B D                   Human  tgt
B D                   Chimp  ggt
B D               Orangutan  ggt
B D                  Gibbon  ggt
B D                  Rhesus  ggt
B D     Crab-eating macaque  ggt
B D                  Baboon  ggt
B D            Green monkey  ggt
B D              Guinea pig  gtt
                 Chinchilla  act
           Tibetan antelope  ggc
              Domestic goat  ggc
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ===
B D                 Gorilla  ===
              Weddell seal  ===
B D                Hedgehog  ===
B D                     Pig  ===
B D                  Rabbit  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Megabat  ===
B D                 Dolphin  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
B D          Naked mole-rat  ===
          Brush-tailed rat  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Manatee  ===
B D                Elephant  ===
B D         Chinese hamster  ===
B D                  Tenrec  ===
B D                     Cat  ===
B D                Bushbaby  ===
B D                 Ferret   ===
           Star-nosed mole  ===
B D                   Sheep  ===
            Bactrian camel  ===
B D                  Alpaca  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D                Squirrel  ===
B D               Armadillo  ---
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ---
B D                Marmoset  ---
B D                     Cow  ===

Inserts between block 5 and 6 in window
          Tibetan antelope 265bp
             Domestic goat 300bp

Alignment block 6 of 907 in window, 169071919 - 169071939, 21 bps 
B D                   Human  aaattacggccgggtgctgtg
B D                   Chimp  aaattacggccgggcgctgtg
B D               Orangutan  aaattacggccaggcgctgtg
B D                  Gibbon  aaattacggccgggcactgtg
B D                  Rhesus  aaattatggccgggtgctgtg
B D     Crab-eating macaque  aaattatggccgggtgctgtg
B D                  Baboon  aaattatggccgagtgctgtg
B D            Green monkey  aaattatggccgggtgctgtg
B D              Guinea pig  gcg------------------
                 Chinchilla  gagcca--gcagggtgtggtg
B D                     Rat  =====================
              Prairie vole  =====================
            Golden hamster  =====================
B D                   Mouse  =====================
    Lesser Egyptian jerboa  =====================
B D                    Pika  =====================
B D                 Gorilla  =====================
              Weddell seal  =====================
B D                Hedgehog  =====================
B D                     Pig  =====================
B D                  Rabbit  =====================
          Cape golden mole  =====================
                  Aardvark  =====================
B D                 Megabat  =====================
B D                 Dolphin  =====================
B D         Tasmanian devil  =====================
B D                 Opossum  =====================
B D          Naked mole-rat  =====================
          Brush-tailed rat  =====================
       Cape elephant shrew  =====================
        Chinese tree shrew  =====================
B D                Platypus  =====================
B D                 Manatee  =====================
B D                Elephant  =====================
B D         Chinese hamster  =====================
B D                  Tenrec  =====================
B D                     Cat  =====================
B D                Bushbaby  =====================
B D                 Ferret   =====================
           Star-nosed mole  =====================
             Domestic goat  =====================
B D                   Sheep  =====================
          Tibetan antelope  =====================
            Bactrian camel  =====================
B D                  Alpaca  =====================
            Pacific walrus  =====================
B D                   Panda  =====================
              Killer whale  =====================
B D                     Dog  =====================
          Black flying-fox  =====================
B D        White rhinoceros  =====================
B D                   Horse  =====================
B D                Squirrel  =====================
B D               Armadillo  ---------------------
      David's myotis (bat)  =====================
             Big brown bat  =====================
B D                Microbat  =====================
B D         Squirrel monkey  ---------------------
B D                Marmoset  ---------------------
B D                     Cow  =====================

Alignment block 7 of 907 in window, 169071940 - 169071979, 40 bps 
B D                   Human  gctcacacctgtaatcccagcactttgggaagccgaggtg
B D                   Chimp  gctcacacctgtaatcccagcactttgggaagccgaggtg
B D               Orangutan  gctcacacctgtaatcccagcactttgggaagccaatgtg
B D                  Gibbon  gctcacacctgtaatcccagcactttgggaagccaaggtg
B D                  Rhesus  actcacacctgtaatcccagcactttgggaggccaaagtg
B D     Crab-eating macaque  actcacacctgtaatcccagcactttgggaggccgaggtg
B D                  Baboon  actcacacctgtaatcccagtactttgggaggccgaggtg
B D            Green monkey  actcacacctgtaatcccagcactttgggaggctgaggtg
                 Chinchilla  gtgcatgtctataatcctagcac-tcaggaggctgaggca
B D                     Rat  ========================================
              Prairie vole  ========================================
            Golden hamster  ========================================
B D                   Mouse  ========================================
    Lesser Egyptian jerboa  ========================================
B D                    Pika  ========================================
B D                 Gorilla  ========================================
              Weddell seal  ========================================
B D                Hedgehog  ========================================
B D              Guinea pig  ----------------------------------------
B D                     Pig  ========================================
B D                  Rabbit  ========================================
          Cape golden mole  ========================================
                  Aardvark  ========================================
B D                 Megabat  ========================================
B D                 Dolphin  ========================================
B D         Tasmanian devil  ========================================
B D                 Opossum  ========================================
B D          Naked mole-rat  ========================================
          Brush-tailed rat  ========================================
       Cape elephant shrew  ========================================
        Chinese tree shrew  ========================================
B D                Platypus  ========================================
B D                 Manatee  ========================================
B D                Elephant  ========================================
B D         Chinese hamster  ========================================
B D                  Tenrec  ========================================
B D                     Cat  ========================================
B D                Bushbaby  ========================================
B D                 Ferret   ========================================
           Star-nosed mole  ========================================
             Domestic goat  ========================================
B D                   Sheep  ========================================
          Tibetan antelope  ========================================
            Bactrian camel  ========================================
B D                  Alpaca  ========================================
            Pacific walrus  ========================================
B D                   Panda  ========================================
              Killer whale  ========================================
B D                     Dog  ========================================
          Black flying-fox  ========================================
B D        White rhinoceros  ========================================
B D                   Horse  ========================================
B D                Squirrel  ========================================
B D               Armadillo  ----------------------------------------
      David's myotis (bat)  ========================================
             Big brown bat  ========================================
B D                Microbat  ========================================
B D         Squirrel monkey  ----------------------------------------
B D                Marmoset  ----------------------------------------
B D                     Cow  ========================================

Inserts between block 7 and 8 in window
B D                 Rhesus 60bp

Alignment block 8 of 907 in window, 169071980 - 169072045, 66 bps 
B D                   Human  gccagatcacgaggtcaagagatcgagaccatcctggccaacatggtgaaaccctgtctctactaa
B D                   Chimp  gccggatcatgaggtcaagagattgagaccatcctggccaacatggtgaaaccctgtctctactaa
B D               Orangutan  gccggatcacgaggtcaagagatcgagaccatcctggccaacatggtgaaaccctgtctctactaa
B D                  Gibbon  gccagatcacgaagtcaagggatcgagaccatcctggccaacatgatgaaaccctgtctctactaa
B D     Crab-eating macaque  gccggatcacaaggtcaagagatcgagaacatcctagctaacatggtgaaaccctgtctctactaa
B D                  Baboon  gccggatcacaaggtcaagagatcgagaacatcctggctaacatggtgaaaccctgtctctactaa
B D            Green monkey  gccggatcacaaggtcaagagatcgagaacatcctggctaacatggtgaaatcctgtctctgctaa
                 Chinchilla  ggaggatt-----gtcatgagtttgaggccagcctgtactacacagtgagttcaaggccaaatgaa
B D                     Rat  ==================================================================
              Prairie vole  ==================================================================
            Golden hamster  ==================================================================
B D                   Mouse  ==================================================================
    Lesser Egyptian jerboa  ==================================================================
B D                    Pika  ==================================================================
B D                 Gorilla  ==================================================================
              Weddell seal  ==================================================================
B D                Hedgehog  ==================================================================
B D              Guinea pig  ------------------------------------------------------------------
B D                     Pig  ==================================================================
B D                  Rabbit  ==================================================================
          Cape golden mole  ==================================================================
                  Aardvark  ==================================================================
B D                 Megabat  ==================================================================
B D                 Dolphin  ==================================================================
B D                  Rhesus  ==================================================================
B D         Tasmanian devil  ==================================================================
B D                 Opossum  ==================================================================
B D          Naked mole-rat  ==================================================================
          Brush-tailed rat  ==================================================================
       Cape elephant shrew  ==================================================================
        Chinese tree shrew  ==================================================================
B D                Platypus  ==================================================================
B D                 Manatee  ==================================================================
B D                Elephant  ==================================================================
B D         Chinese hamster  ==================================================================
B D                  Tenrec  ==================================================================
B D                     Cat  ==================================================================
B D                Bushbaby  ==================================================================
B D                 Ferret   ==================================================================
           Star-nosed mole  ==================================================================
             Domestic goat  ==================================================================
B D                   Sheep  ==================================================================
          Tibetan antelope  ==================================================================
            Bactrian camel  ==================================================================
B D                  Alpaca  ==================================================================
            Pacific walrus  ==================================================================
B D                   Panda  ==================================================================
              Killer whale  ==================================================================
B D                     Dog  ==================================================================
          Black flying-fox  ==================================================================
B D        White rhinoceros  ==================================================================
B D                   Horse  ==================================================================
B D                Squirrel  ==================================================================
B D               Armadillo  ------------------------------------------------------------------
      David's myotis (bat)  ==================================================================
             Big brown bat  ==================================================================
B D                Microbat  ==================================================================
B D         Squirrel monkey  ------------------------------------------------------------------
B D                Marmoset  ------------------------------------------------------------------
B D                     Cow  ==================================================================

Alignment block 9 of 907 in window, 169072046 - 169072048, 3 bps 
B D                   Human  gaa
B D                   Chimp  gaa
B D               Orangutan  gaa
B D                  Gibbon  gaa
B D     Crab-eating macaque  gaa
B D                  Baboon  gaa
B D            Green monkey  gaa
                 Chinchilla  aga
           Brush-tailed rat  aaa
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ===
B D                 Gorilla  ===
              Weddell seal  ===
B D                Hedgehog  ===
B D              Guinea pig  ---
B D                     Pig  ===
B D                  Rabbit  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Megabat  ===
B D                 Dolphin  ===
B D                  Rhesus  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
B D          Naked mole-rat  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Manatee  ===
B D                Elephant  ===
B D         Chinese hamster  ===
B D                  Tenrec  ===
B D                     Cat  ===
B D                Bushbaby  ===
B D                 Ferret   ===
           Star-nosed mole  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Bactrian camel  ===
B D                  Alpaca  ===
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
          Black flying-fox  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D                Squirrel  ===
B D               Armadillo  ---
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ---
B D                Marmoset  ---
B D                     Cow  ===

Alignment block 10 of 907 in window, 169072049 - 169072054, 6 bps 
B D                   Human  tacaaa
B D                   Chimp  tacaaa
B D               Orangutan  tacaaa
B D                  Gibbon  tacaaa
B D                  Rhesus  tacaaa
B D     Crab-eating macaque  tacaaa
B D                  Baboon  tacaaa
B D            Green monkey  tacaaa
                 Chinchilla  aagaaa
           Brush-tailed rat  tactga
B D                     Rat  ======
              Prairie vole  ======
            Golden hamster  ======
B D                   Mouse  ======
    Lesser Egyptian jerboa  ======
B D                    Pika  ======
B D                 Gorilla  ======
              Weddell seal  ======
B D                Hedgehog  ======
B D              Guinea pig  ------
B D                     Pig  ======
B D                  Rabbit  ======
          Cape golden mole  ======
                  Aardvark  ======
B D                 Megabat  ======
B D                 Dolphin  ======
B D         Tasmanian devil  ======
B D                 Opossum  ======
B D          Naked mole-rat  ======
       Cape elephant shrew  ======
        Chinese tree shrew  ======
B D                Platypus  ======
B D                 Manatee  ======
B D                Elephant  ======
B D         Chinese hamster  ======
B D                  Tenrec  ======
B D                     Cat  ======
B D                Bushbaby  ======
B D                 Ferret   ======
           Star-nosed mole  ======
             Domestic goat  ======
B D                   Sheep  ======
          Tibetan antelope  ======
            Bactrian camel  ======
B D                  Alpaca  ======
            Pacific walrus  ======
B D                   Panda  ======
              Killer whale  ======
B D                     Dog  ======
          Black flying-fox  ======
B D        White rhinoceros  ======
B D                   Horse  ======
B D                Squirrel  ======
B D               Armadillo  ------
      David's myotis (bat)  ======
             Big brown bat  ======
B D                Microbat  ======
B D         Squirrel monkey  ------
B D                Marmoset  ------
B D                     Cow  ======

Inserts between block 10 and 11 in window
                Chinchilla 58bp

Alignment block 11 of 907 in window, 169072055 - 169072056, 2 bps 
B D                   Human  ac
B D                   Chimp  ac
B D               Orangutan  ac
B D                  Gibbon  ac
B D                  Rhesus  aa
B D     Crab-eating macaque  ac
B D                  Baboon  ac
B D            Green monkey  ac
           Brush-tailed rat  gc
B D                     Rat  ==
              Prairie vole  ==
            Golden hamster  ==
B D                   Mouse  ==
    Lesser Egyptian jerboa  ==
B D                    Pika  ==
B D                 Gorilla  ==
              Weddell seal  ==
B D                Hedgehog  ==
B D              Guinea pig  --
B D                     Pig  ==
B D                  Rabbit  ==
          Cape golden mole  ==
                  Aardvark  ==
B D                 Megabat  ==
B D                 Dolphin  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
B D          Naked mole-rat  ==
                Chinchilla  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                 Manatee  ==
B D                Elephant  ==
B D         Chinese hamster  ==
B D                  Tenrec  ==
B D                     Cat  ==
B D                Bushbaby  ==
B D                 Ferret   ==
           Star-nosed mole  ==
             Domestic goat  ==
B D                   Sheep  ==
          Tibetan antelope  ==
            Bactrian camel  ==
B D                  Alpaca  ==
            Pacific walrus  ==
B D                   Panda  ==
              Killer whale  ==
B D                     Dog  ==
          Black flying-fox  ==
B D        White rhinoceros  ==
B D                   Horse  ==
B D                Squirrel  ==
B D               Armadillo  --
      David's myotis (bat)  ==
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  --
B D                Marmoset  --
B D                     Cow  ==

Alignment block 12 of 907 in window, 169072057 - 169072144, 88 bps 
B D                   Human  ttagctgggagtgatggcgcacacctgtagtcccagctactcaggaggctgaggcaggagaacca-cttg
B D                   Chimp  ttagctgggagtgatggcgcacacctgtagtcccagctactcaggaggctgaggcaggagaacca-cttg
B D               Orangutan  ttagctgggagtgatggcacacacctgtagtcccagctactcaggaaggtgaggcaggaaaatca-cttg
B D                  Gibbon  ttagctgggagtgatggcgcacacctgtagtcccagctactcaggaggctgaggcaggagaatca-cttg
B D                  Rhesus  ttagctgggcagagtggcacatgcctgtgctcctagctactcaggagactaaggtaggatgattg-cttg
B D     Crab-eating macaque  ttagctgggagtggtggcgtacacctgtagtctcagctactcaggaggctgaggcaggagaatcc-cttg
B D                  Baboon  ttagctggtagtggtggcgtacacctgtagtcccagctactcaggaggctgaggcaggagaatcc-cttg
B D            Green monkey  ttagctgtgagtggtggcgtacacctgtagtcccagctactcaggaggctgaggcaggagaatcc-cttg
B D              Guinea pig  ctagctgggtatggtgatatacgcctataatcccagc-actcaggaggctgaggcaggaggattgccacc
           Brush-tailed rat  -tagcagggtatggtgacagatgcctatagtccttgc-actcaggaggctgaggcagaaggatca-tatg
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ======================================================================
B D                 Gorilla  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================
B D          Naked mole-rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ----------------------------------------------------------------------
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ----------------------------------------------------------------------
B D                Marmoset  ----------------------------------------------------------------------
B D                     Cow  ======================================================================

                      Human  aacccgggaggcggaggtt
                      Chimp  aacccgggaggtggaggtt
                  Orangutan  aacccgggaggcaaaggtt
                     Gibbon  aacccgggaggcggaggtt
                     Rhesus  agcccaggag---------
        Crab-eating macaque  aacccaggaggcaaaggtt
                     Baboon  aacccaggaggcaaagggt
               Green monkey  aacccaggaggcaaaggtt
                 Guinea pig  agccc--------------
           Brush-tailed rat  agttt--------------
                        Rat  ===================
               Prairie vole  ===================
             Golden hamster  ===================
                      Mouse  ===================
     Lesser Egyptian jerboa  ===================
                       Pika  ===================
                    Gorilla  ===================
               Weddell seal  ===================
                   Hedgehog  ===================
                        Pig  ===================
                     Rabbit  ===================
           Cape golden mole  ===================
                   Aardvark  ===================
                    Megabat  ===================
                    Dolphin  ===================
            Tasmanian devil  ===================
                    Opossum  ===================
             Naked mole-rat  ===================
                 Chinchilla  ===================
        Cape elephant shrew  ===================
         Chinese tree shrew  ===================
                   Platypus  ===================
                    Manatee  ===================
                   Elephant  ===================
            Chinese hamster  ===================
                     Tenrec  ===================
                        Cat  ===================
                   Bushbaby  ===================
                    Ferret   ===================
            Star-nosed mole  ===================
              Domestic goat  ===================
                      Sheep  ===================
           Tibetan antelope  ===================
             Bactrian camel  ===================
                     Alpaca  ===================
             Pacific walrus  ===================
                      Panda  ===================
               Killer whale  ===================
                        Dog  ===================
           Black flying-fox  ===================
           White rhinoceros  ===================
                      Horse  ===================
                   Squirrel  ===================
                  Armadillo  -------------------
       David's myotis (bat)  ===================
              Big brown bat  ===================
                   Microbat  ===================
            Squirrel monkey  -------------------
                   Marmoset  -------------------
                        Cow  ===================

Alignment block 13 of 907 in window, 169072145 - 169072182, 38 bps 
B D                   Human  gcagtgagccaagatcttgccac----tg-----------------------------------------
B D                   Chimp  gcagtgagccaagatcttgccac----tg-----------------------------------------
B D               Orangutan  gcagtgagccaagattttgcccc----tg-----------------------------------------
B D                  Gibbon  gcagtgagccaagatcttgccac----tg-----------------------------------------
B D                  Rhesus  -----gggctcag---------------gnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
B D     Crab-eating macaque  gcagtgagctgagattgcactac----tg-----------------------------------------
B D                  Baboon  gcagtgagctgagattgcgccac----cg-----------------------------------------
B D            Green monkey  gcagtgagctgagattgcactac----cg-----------------------------------------
B D              Guinea pig  -----aaattgtgcttgtgctacatagtg-----------------------------------------
           Brush-tailed rat  -----gaggccagcctgcagcacatagtg-----------------------------------------
           Tibetan antelope  tcacggagctaagatc---caaa----tg-----------------------------------------
B D                     Rat  ======================================================================
              Prairie vole  ======================================================================
            Golden hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                    Pika  ======================================================================
B D                 Gorilla  ======================================================================
              Weddell seal  ======================================================================
B D                Hedgehog  ======================================================================
B D                     Pig  ======================================================================
B D                  Rabbit  ======================================================================
          Cape golden mole  ======================================================================
                  Aardvark  ======================================================================
B D                 Megabat  ======================================================================
B D                 Dolphin  ======================================================================
B D         Tasmanian devil  ======================================================================
B D                 Opossum  ======================================================================
B D          Naked mole-rat  ======================================================================
                Chinchilla  ======================================================================
       Cape elephant shrew  ======================================================================
        Chinese tree shrew  ======================================================================
B D                Platypus  ======================================================================
B D                 Manatee  ======================================================================
B D                Elephant  ======================================================================
B D         Chinese hamster  ======================================================================
B D                  Tenrec  ======================================================================
B D                     Cat  ======================================================================
B D                Bushbaby  ======================================================================
B D                 Ferret   ======================================================================
           Star-nosed mole  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
            Bactrian camel  ======================================================================
B D                  Alpaca  ======================================================================
            Pacific walrus  ======================================================================
B D                   Panda  ======================================================================
              Killer whale  ======================================================================
B D                     Dog  ======================================================================
          Black flying-fox  ======================================================================
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
B D                Squirrel  ======================================================================
B D               Armadillo  ----------------------------------------------------------------------
      David's myotis (bat)  ======================================================================
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D         Squirrel monkey  ----------------------------------------------------------------------
B D                Marmoset  ----------------------------------------------------------------------
B D                     Cow  ======================================================================

                      Human  -----------------cactccagcctgg
                      Chimp  -----------------cactccagcctgg
                  Orangutan  -----------------ccatccagcctgg
                     Gibbon  -----------------cactccagcctgg
                     Rhesus  nnnnnnnnnnnnnnnnnta-----------
        Crab-eating macaque  -----------------cactccagcctgg
                     Baboon  -----------------aactccagcctgg
               Green monkey  -----------------cactccagcctgg
                 Guinea pig  -----------------agttcaaggccag
           Brush-tailed rat  -----------------atttcaagaccag
           Tibetan antelope  -----------------cctcctggccaga
                        Rat  ==============================
               Prairie vole  ==============================
             Golden hamster  ==============================
                      Mouse  ==============================
     Lesser Egyptian jerboa  ==============================
                       Pika  ==============================
                    Gorilla  ==============================
               Weddell seal  ==============================
                   Hedgehog  ==============================
                        Pig  ==============================
                     Rabbit  ==============================
           Cape golden mole  ==============================
                   Aardvark  ==============================
                    Megabat  ==============================
                    Dolphin  ==============================
            Tasmanian devil  ==============================
                    Opossum  ==============================
             Naked mole-rat  ==============================
                 Chinchilla  ==============================
        Cape elephant shrew  ==============================
         Chinese tree shrew  ==============================
                   Platypus  ==============================
                    Manatee  ==============================
                   Elephant  ==============================
            Chinese hamster  ==============================
                     Tenrec  ==============================
                        Cat  ==============================
                   Bushbaby  ==============================
                    Ferret   ==============================
            Star-nosed mole  ==============================
              Domestic goat  ==============================
                      Sheep  ==============================
             Bactrian camel  ==============================
                     Alpaca  ==============================
             Pacific walrus  ==============================
                      Panda  ==============================
               Killer whale  ==============================
                        Dog  ==============================
           Black flying-fox  ==============================
           White rhinoceros  ==============================
                      Horse  ==============================
                   Squirrel  ==============================
                  Armadillo  ------------------------------
       David's myotis (bat)  ==============================
              Big brown bat  ==============================
                   Microbat  ==============================
            Squirrel monkey  ------------------------------
                   Marmoset  ------------------------------
                        Cow  ==============================

Inserts between block 13 and 14 in window
B D             Guinea pig 7bp
          Brush-tailed rat 7bp

Alignment block 14 of 907 in window, 169072183 - 169072189, 7 bps 
B D                   Human  c--acagag
B D                   Chimp  c--acagag
B D               Orangutan  ccaccaaag
B D                  Gibbon  c--acagag
B D     Crab-eating macaque  c--accgag
B D                  Baboon  c--accgag
B D            Green monkey  c--accgag
B D         Chinese hamster  --cacacag
B D              Guinea pig  --tatatag
           Brush-tailed rat  --tatacag
B D                     Rat  =========
              Prairie vole  =========
            Golden hamster  =========
B D                   Mouse  =========
    Lesser Egyptian jerboa  =========
B D                    Pika  =========
B D                 Gorilla  =========
              Weddell seal  =========
B D                Hedgehog  =========
B D                     Pig  =========
B D                  Rabbit  =========
          Cape golden mole  =========
                  Aardvark  =========
B D                 Megabat  =========
B D                 Dolphin  =========
B D                  Rhesus  ---------
B D         Tasmanian devil  =========
B D                 Opossum  =========
B D          Naked mole-rat  =========
                Chinchilla  =========
       Cape elephant shrew  =========
        Chinese tree shrew  =========
B D                Platypus  =========
B D                 Manatee  =========
B D                Elephant  =========
B D                  Tenrec  =========
B D                     Cat  =========
B D                Bushbaby  =========
B D                 Ferret   =========
           Star-nosed mole  =========
             Domestic goat  =========
B D                   Sheep  =========
          Tibetan antelope  ---------
            Bactrian camel  =========
B D                  Alpaca  =========
            Pacific walrus  =========
B D                   Panda  =========
              Killer whale  =========
B D                     Dog  =========
          Black flying-fox  =========
B D        White rhinoceros  =========
B D                   Horse  =========
B D                Squirrel  =========
B D               Armadillo  ---------
      David's myotis (bat)  =========
             Big brown bat  =========
B D                Microbat  =========
B D         Squirrel monkey  ---------
B D                Marmoset  ---------
B D                     Cow  =========

Alignment block 15 of 907 in window, 169072190 - 169072203, 14 bps 
B D                   Human  agagactccatct--------c
B D                   Chimp  agagactccatct--------c
B D               Orangutan  agagactccatct--------c
B D                  Gibbon  agagactccgtct--------c
B D                  Rhesus  ------tcta-----------a
B D     Crab-eating macaque  agagactctatct--------a
B D                  Baboon  agagactccatct--------a
B D            Green monkey  agagactccatctaaaaaaaaa
B D         Chinese hamster  taggactttatat---------
B D              Guinea pig  caaaaccctgtct--------t
           Brush-tailed rat  caagaccctgtct--------c
B D                   Sheep  aatgcctcctggc--------c
B D                     Rat  ======================
              Prairie vole  ======================
            Golden hamster  ======================
B D                   Mouse  ======================
    Lesser Egyptian jerboa  ======================
B D                    Pika  ======================
B D                 Gorilla  ======================
              Weddell seal  ======================
B D                Hedgehog  ======================
B D                     Pig  ======================
B D                  Rabbit  ======================
          Cape golden mole  ======================
                  Aardvark  ======================
B D                 Megabat  ======================
B D                 Dolphin  ======================
B D         Tasmanian devil  ======================
B D                 Opossum  ======================
B D          Naked mole-rat  ======================
                Chinchilla  ======================
       Cape elephant shrew  ======================
        Chinese tree shrew  ======================
B D                Platypus  ======================
B D                 Manatee  ======================
B D                Elephant  ======================
B D                  Tenrec  ======================
B D                     Cat  ======================
B D                Bushbaby  ======================
B D                 Ferret   ======================
           Star-nosed mole  ======================
             Domestic goat  ======================
          Tibetan antelope  ----------------------
            Bactrian camel  ======================
B D                  Alpaca  ======================
            Pacific walrus  ======================
B D                   Panda  ======================
              Killer whale  ======================
B D                     Dog  ======================
          Black flying-fox  ======================
B D        White rhinoceros  ======================
B D                   Horse  ======================
B D                Squirrel  ======================
B D               Armadillo  ----------------------
      David's myotis (bat)  ======================
             Big brown bat  ======================
B D                Microbat  ======================
B D         Squirrel monkey  ----------------------
B D                Marmoset  ----------------------
B D                     Cow  ======================

Inserts between block 15 and 16 in window
B D                  Sheep 3bp

Alignment block 16 of 907 in window, 169072204 - 169072218, 15 bps 
B D                   Human  aaaaaaaaaaaaaaa
B D                   Chimp  aaaaaaaaaaaaaaa
B D               Orangutan  agaaaaaaaaaaaaa
B D                  Gibbon  aaaaaaaaaaaaaaa
B D                  Rhesus  aaaaaaaaaaaaagg
B D     Crab-eating macaque  aaaaaaaaaaaaagg
B D                  Baboon  aaaaaaaaaaaaagg
B D            Green monkey  aaaaaaaaaaaaagg
B D         Chinese hamster  -----aaccagaaaa
B D              Guinea pig  aaaaaaacaaagaaa
                 Chinchilla  -----aagaaagaaa
           Brush-tailed rat  -aaaaaaataagaag
           Tibetan antelope  aaaccaaaacataaa
B D                   Sheep  aaaccaaaacataaa
              Domestic goat  aaaccaaaacataaa
B D                     Rat  ===============
              Prairie vole  ===============
            Golden hamster  ===============
B D                   Mouse  ===============
    Lesser Egyptian jerboa  ===============
B D                    Pika  ===============
B D                 Gorilla  ===============
              Weddell seal  ===============
B D                Hedgehog  ===============
B D                     Pig  ===============
B D                  Rabbit  ===============
          Cape golden mole  ===============
                  Aardvark  ===============
B D                 Megabat  ===============
B D                 Dolphin  ===============
B D         Tasmanian devil  ===============
B D                 Opossum  ===============
B D          Naked mole-rat  ===============
       Cape elephant shrew  ===============
        Chinese tree shrew  ===============
B D                Platypus  ===============
B D                 Manatee  ===============
B D                Elephant  ===============
B D                  Tenrec  ===============
B D                     Cat  ===============
B D                Bushbaby  ===============
B D                 Ferret   ===============
           Star-nosed mole  ===============
            Bactrian camel  ===============
B D                  Alpaca  ===============
            Pacific walrus  ===============
B D                   Panda  ===============
              Killer whale  ===============
B D                     Dog  ===============
          Black flying-fox  ===============
B D        White rhinoceros  ===============
B D                   Horse  ===============
B D                Squirrel  ===============
B D               Armadillo  ---------------
      David's myotis (bat)  ===============
             Big brown bat  ===============
B D                Microbat  ===============
B D         Squirrel monkey  ---------------
B D                Marmoset  ---------------
B D                     Cow  ===============

Inserts between block 16 and 17 in window
B D        Chinese hamster 3bp
B D             Guinea pig 18bp
                Chinchilla 11bp
          Brush-tailed rat 18bp

Alignment block 17 of 907 in window, 169072219 - 169072223, 5 bps 
B D                   Human  aaaag
B D                   Chimp  aaaaa
B D               Orangutan  tagaa
B D                  Gibbon  aaaga
B D                  Rhesus  aaaag
B D     Crab-eating macaque  aaaag
B D                  Baboon  aaaag
B D            Green monkey  aaaag
           Tibetan antelope  acaga
B D                   Sheep  acaga
              Domestic goat  acaaa
B D                     Rat  =====
              Prairie vole  =====
            Golden hamster  =====
B D                   Mouse  =====
    Lesser Egyptian jerboa  =====
B D                    Pika  =====
B D                 Gorilla  =====
              Weddell seal  =====
B D                Hedgehog  =====
B D              Guinea pig  =====
B D                     Pig  =====
B D                  Rabbit  =====
          Cape golden mole  =====
                  Aardvark  =====
B D                 Megabat  =====
B D                 Dolphin  =====
B D         Tasmanian devil  =====
B D                 Opossum  =====
B D          Naked mole-rat  =====
          Brush-tailed rat  =====
                Chinchilla  =====
       Cape elephant shrew  =====
        Chinese tree shrew  =====
B D                Platypus  =====
B D                 Manatee  =====
B D                Elephant  =====
B D         Chinese hamster  =====
B D                  Tenrec  =====
B D                     Cat  =====
B D                Bushbaby  =====
B D                 Ferret   =====
           Star-nosed mole  =====
            Bactrian camel  =====
B D                  Alpaca  =====
            Pacific walrus  =====
B D                   Panda  =====
              Killer whale  =====
B D                     Dog  =====
          Black flying-fox  =====
B D        White rhinoceros  =====
B D                   Horse  =====
B D                Squirrel  =====
B D               Armadillo  -----
      David's myotis (bat)  =====
             Big brown bat  =====
B D                Microbat  =====
B D         Squirrel monkey  -----
B D                Marmoset  -----
B D                     Cow  =====

Inserts between block 17 and 18 in window
B D           Green monkey 1bp

Alignment block 18 of 907 in window, 169072224 - 169072224, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D         Chinese hamster  g
B D          Naked mole-rat  a
B D              Guinea pig  a
           Brush-tailed rat  a
           Tibetan antelope  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                 Gorilla  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  =
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D                 Dolphin  =
B D         Tasmanian devil  =
B D                 Opossum  =
                Chinchilla  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                 Manatee  =
B D                Elephant  =
B D                  Tenrec  =
B D                     Cat  =
B D                Bushbaby  =
B D                 Ferret   =
           Star-nosed mole  =
            Bactrian camel  =
B D                  Alpaca  =
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
B D                     Dog  =
          Black flying-fox  =
B D        White rhinoceros  =
B D                Squirrel  =
B D               Armadillo  -
      David's myotis (bat)  =
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  -
B D                Marmoset  -
B D                     Cow  =

Inserts between block 18 and 19 in window
B D                  Chimp 5bp
B D                 Rhesus 5bp
B D    Crab-eating macaque 5bp
B D                 Baboon 5bp
B D           Green monkey 5bp
B D        Chinese hamster 5bp
B D         Naked mole-rat 5bp
B D             Guinea pig 5bp
          Brush-tailed rat 6bp

Alignment block 19 of 907 in window, 169072225 - 169072225, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D         Chinese hamster  a
B D          Naked mole-rat  g
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  g
           Tibetan antelope  g
B D                   Sheep  g
              Domestic goat  g
B D                   Horse  a
B D                 Megabat  g
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                 Gorilla  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  =
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Dolphin  =
B D                  Gibbon  -
B D         Tasmanian devil  =
B D                 Opossum  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                 Manatee  =
B D                Elephant  =
B D                  Tenrec  =
B D                     Cat  =
B D                Bushbaby  =
B D                 Ferret   =
B D               Orangutan  -
           Star-nosed mole  =
            Bactrian camel  =
B D                  Alpaca  =
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
B D                     Dog  =
          Black flying-fox  =
B D        White rhinoceros  =
B D                Squirrel  =
B D               Armadillo  -
      David's myotis (bat)  =
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  -
B D                Marmoset  -
B D                     Cow  =

Alignment block 20 of 907 in window, 169072226 - 169072231, 6 bps 
B D                   Human  agat----at
B D                   Chimp  agat----at
B D               Orangutan  ---------t
B D                  Gibbon  --------at
B D                  Rhesus  agaa----at
B D     Crab-eating macaque  agaa----at
B D                  Baboon  agaa----at
B D            Green monkey  agaa----at
B D         Chinese hamster  acat----gc
B D          Naked mole-rat  aaac----ac
B D              Guinea pig  aaattaacac
                 Chinchilla  agat----ac
           Brush-tailed rat  acaa----ac
B D                     Pig  agaa----at
B D                  Alpaca  agaa----at
             Bactrian camel  agaa----at
B D                 Dolphin  agaa----at
               Killer whale  agaa----at
           Tibetan antelope  caat----at
B D                   Sheep  caat------
              Domestic goat  caat----at
B D                   Horse  agaa----at
B D        White rhinoceros  agaa----at
B D                     Cat  agaa----at
B D                   Panda  agaa----at
             Pacific walrus  agaa----at
               Weddell seal  agaa----at
B D                 Megabat  agaa----ag
B D                 Manatee  agaa----at
B D                     Rat  ==========
              Prairie vole  ==========
            Golden hamster  ==========
B D                   Mouse  ==========
    Lesser Egyptian jerboa  ==========
B D                    Pika  ==========
B D                 Gorilla  ==========
B D                Hedgehog  ==========
B D                  Rabbit  ==========
          Cape golden mole  ==========
                  Aardvark  ==========
B D         Tasmanian devil  ==========
B D                 Opossum  ==========
       Cape elephant shrew  ==========
        Chinese tree shrew  ==========
B D                Platypus  ==========
B D                Elephant  ==========
B D                  Tenrec  ==========
B D                Bushbaby  ==========
B D                 Ferret   ==========
           Star-nosed mole  ==========
B D                     Dog  ==========
          Black flying-fox  ==========
B D                Squirrel  ==========
B D               Armadillo  ----------
      David's myotis (bat)  ==========
             Big brown bat  ==========
B D                Microbat  ==========
B D         Squirrel monkey  ----------
B D                Marmoset  ----------
B D                     Cow  ==========

Alignment block 21 of 907 in window, 169072232 - 169072233, 2 bps 
B D                   Human  -tg
B D                   Chimp  -tg
B D               Orangutan  -gg
B D                  Gibbon  -gg
B D                  Rhesus  -gg
B D     Crab-eating macaque  -gg
B D                  Baboon  -gg
B D            Green monkey  -gg
B D          Naked mole-rat  -tg
B D              Guinea pig  -tg
                 Chinchilla  -tg
           Brush-tailed rat  -tg
B D                     Pig  -gc
B D                  Alpaca  -gc
             Bactrian camel  -gc
B D                 Dolphin  -gc
               Killer whale  -gc
           Tibetan antelope  -tt
              Domestic goat  -tt
B D                   Horse  -gc
B D        White rhinoceros  -gc
B D                     Cat  -gc
B D                   Panda  -gc
             Pacific walrus  -gc
               Weddell seal  -gc
B D                 Megabat  -tc
B D                 Manatee  -g-
                   Aardvark  tg-
B D                     Rat  ===
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ===
B D                    Pika  ===
B D                 Gorilla  ===
B D                Hedgehog  ===
B D                  Rabbit  ===
          Cape golden mole  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                Elephant  ===
B D         Chinese hamster  ---
B D                  Tenrec  ===
B D                Bushbaby  ===
B D                 Ferret   ===
           Star-nosed mole  ===
B D                   Sheep  ---
B D                     Dog  ===
          Black flying-fox  ===
B D                Squirrel  ===
B D               Armadillo  ---
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ---
B D                Marmoset  ---
B D                     Cow  ===

Inserts between block 21 and 22 in window
B D                Megabat 1bp

Alignment block 22 of 907 in window, 169072234 - 169072236, 3 bps 
B D                   Human  -taa
B D                   Chimp  -taa
B D               Orangutan  -taa
B D                  Gibbon  -taa
B D                  Rhesus  -taa
B D     Crab-eating macaque  -taa
B D                  Baboon  -taa
B D            Green monkey  -taa
B D         Chinese hamster  -taa
             Golden hamster  -taa
B D                   Mouse  -taa
B D                     Rat  -taa
B D          Naked mole-rat  ---g
B D              Guinea pig  ---g
                 Chinchilla  ---g
           Brush-tailed rat  ---t
B D                     Pig  -tga
B D                  Alpaca  -tga
             Bactrian camel  -tga
B D                 Dolphin  -tga
               Killer whale  -tga
           Tibetan antelope  -taa
              Domestic goat  -taa
B D                   Horse  -tga
B D        White rhinoceros  -tga
B D                     Cat  -tag
B D                     Dog  -taa
B D                   Panda  -taa
             Pacific walrus  -taa
               Weddell seal  -taa
B D                 Megabat  -taa
B D                 Manatee  cta-
                   Aardvark  tta-
              Prairie vole  ====
    Lesser Egyptian jerboa  ====
B D                    Pika  ====
B D                 Gorilla  ====
B D                Hedgehog  ====
B D                  Rabbit  ====
          Cape golden mole  ====
B D         Tasmanian devil  ====
B D                 Opossum  ====
       Cape elephant shrew  ====
        Chinese tree shrew  ====
B D                Platypus  ====
B D                Elephant  ====
B D                  Tenrec  ====
B D                Bushbaby  ====
B D                 Ferret   ====
           Star-nosed mole  ====
B D                   Sheep  ----
          Black flying-fox  ====
B D                Squirrel  ====
B D               Armadillo  ----
      David's myotis (bat)  ====
             Big brown bat  ====
B D                Microbat  ====
B D         Squirrel monkey  ----
B D                Marmoset  ----
B D                     Cow  ====

Inserts between block 22 and 23 in window
          Tibetan antelope 60bp
             Domestic goat 65bp

Alignment block 23 of 907 in window, 169072237 - 169072237, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D         Chinese hamster  a
             Golden hamster  a
B D                   Mouse  g
B D                     Rat  a
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  a
B D                     Pig  g
B D                  Alpaca  g
             Bactrian camel  g
B D                 Dolphin  g
               Killer whale  g
B D                   Sheep  a
B D                   Horse  g
B D        White rhinoceros  g
B D                     Cat  g
B D                     Dog  g
B D                   Panda  g
             Pacific walrus  g
               Weddell seal  g
B D                 Megabat  g
B D                 Manatee  a
                   Aardvark  a
              Prairie vole  =
    Lesser Egyptian jerboa  =
B D                    Pika  =
B D                 Gorilla  =
B D                Hedgehog  =
B D                  Rabbit  =
          Cape golden mole  =
B D         Tasmanian devil  =
B D                 Opossum  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                Elephant  =
B D                  Tenrec  =
B D                Bushbaby  =
B D                 Ferret   =
           Star-nosed mole  =
             Domestic goat  =
          Tibetan antelope  =
          Black flying-fox  =
B D                Squirrel  =
B D               Armadillo  -
      David's myotis (bat)  =
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  -
B D                Marmoset  -
B D                     Cow  =

Alignment block 24 of 907 in window, 169072238 - 169072239, 2 bps 
B D                   Human  tt
B D                   Chimp  tt
B D               Orangutan  tt
B D                  Gibbon  tt
B D                  Rhesus  tt
B D     Crab-eating macaque  tt
B D                  Baboon  tt
B D            Green monkey  tt
B D                Squirrel  tc
     Lesser Egyptian jerboa  tt
B D         Chinese hamster  tt
             Golden hamster  tt
B D                   Mouse  tt
B D                     Rat  ct
B D          Naked mole-rat  ct
B D              Guinea pig  ct
                 Chinchilla  ct
           Brush-tailed rat  tt
B D                     Pig  tt
B D                  Alpaca  tt
             Bactrian camel  tt
B D                 Dolphin  tt
               Killer whale  tc
B D                   Sheep  tt
B D                   Horse  tt
B D        White rhinoceros  tt
B D                     Cat  tt
B D                     Dog  tt
B D                   Panda  tt
             Pacific walrus  tt
               Weddell seal  tt
B D                 Megabat  g-
B D                 Manatee  gt
                   Aardvark  tg
              Prairie vole  ==
B D                    Pika  ==
B D                 Gorilla  ==
B D                Hedgehog  ==
B D                  Rabbit  ==
          Cape golden mole  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                Elephant  ==
B D                  Tenrec  ==
B D                Bushbaby  ==
B D                 Ferret   ==
           Star-nosed mole  ==
             Domestic goat  ==
          Tibetan antelope  ==
          Black flying-fox  ==
B D               Armadillo  --
      David's myotis (bat)  ==
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  --
B D                Marmoset  --
B D                     Cow  ==

Alignment block 25 of 907 in window, 169072240 - 169072254, 15 bps 
B D                   Human  -acaatgggt-----cca-gtg
B D                   Chimp  -acaatgggt-----cca-gtg
B D               Orangutan  -acaatgggt-----cca-gtg
B D                  Gibbon  -acaatgggt-----cca-gtg
B D                  Rhesus  -acagtgggt-----cca-gtg
B D     Crab-eating macaque  -acagtgggt-----cca-gtg
B D                  Baboon  -acaatgggt-----cca-gtg
B D            Green monkey  -acaatgggt-----cca-gtg
B D                Squirrel  -acagtggctctgtccca-ggg
     Lesser Egyptian jerboa  -aaaatggct-----cta-gta
B D         Chinese hamster  -tcaatggct-----cca-gtg
             Golden hamster  -tcaatggcc-----cta-gta
B D                   Mouse  -tcaatgact-----cca-ggg
B D                     Rat  -tcaatggct-----cca-ggg
B D          Naked mole-rat  -acagtgact-----c-a-gtg
B D              Guinea pig  -acagcaact-----c-a-gtg
                 Chinchilla  -acagtgact-----c-a-gtg
           Brush-tailed rat  -atagagact-----cgg-gtg
B D                     Pig  -aaaatggct-----cca-atg
B D                  Alpaca  -acaatggtt-----cca-gtg
             Bactrian camel  -acaatggtt-----cca-gtg
B D                 Dolphin  -ataacggct-----cca-gtt
               Killer whale  -ataatggct-----cca-gtt
B D                   Sheep  -ttaacaaat-----tca-ata
B D                   Horse  -ataatggct-----ccagcgc
B D        White rhinoceros  -ataatggct-----ccagcac
B D                     Cat  -acaatggct-----cca-cac
B D                     Dog  -acaatggtt-----cca-cac
B D                   Panda  -acaacagca-----gta-cac
             Pacific walrus  -ccaacagct-----cta-cac
               Weddell seal  -acaacagct-----cta-cac
           Black flying-fox  -acaatgtcc-----cca-gcg
B D                 Megabat  -acagtgtcc-----cca-gcg
B D                 Manatee  aataatgg-------cca-gtt
                   Aardvark  actaatgg-------cca-gct
              Prairie vole  ======================
B D                    Pika  ======================
B D                 Gorilla  ======================
B D                Hedgehog  ======================
B D                  Rabbit  ======================
          Cape golden mole  ======================
B D         Tasmanian devil  ======================
B D                 Opossum  ======================
       Cape elephant shrew  ======================
        Chinese tree shrew  ======================
B D                Platypus  ======================
B D                Elephant  ======================
B D                  Tenrec  ======================
B D                Bushbaby  ======================
B D                 Ferret   ======================
           Star-nosed mole  ======================
             Domestic goat  ======================
          Tibetan antelope  ======================
B D               Armadillo  ----------------------
      David's myotis (bat)  ======================
             Big brown bat  ======================
B D                Microbat  ======================
B D         Squirrel monkey  ----------------------
B D                Marmoset  ----------------------
B D                     Cow  ======================

Alignment block 26 of 907 in window, 169072255 - 169072259, 5 bps 
B D                   Human  c-ta--ct
B D                   Chimp  c-ta--ct
B D               Orangutan  c-ta--ct
B D                  Gibbon  c-ta--ct
B D                  Rhesus  c-ta--ct
B D     Crab-eating macaque  c-ta--ct
B D                  Baboon  c-ta--ct
B D            Green monkey  c-ta--ct
B D                Squirrel  c-tg--gt
     Lesser Egyptian jerboa  c-tg--gt
B D         Chinese hamster  t-ag--gt
             Golden hamster  t-ag--gt
B D                   Mouse  t-gt--gt
B D                     Rat  t-gg--gc
B D          Naked mole-rat  c-ta--gc
B D              Guinea pig  c-ta--ct
                 Chinchilla  c-ta--at
           Brush-tailed rat  c-ta--gt
B D                     Pig  c-tg--ca
B D                  Alpaca  c-tg--ct
             Bactrian camel  c-tg--ct
B D                 Dolphin  c-ta--ct
               Killer whale  c-ta--ct
B D                   Sheep  a-agactt
B D                   Horse  cacg--ct
B D        White rhinoceros  cacg--ct
B D                     Cat  c-ta--cg
B D                     Dog  c-tt--cc
B D                   Panda  c-cg--ct
             Pacific walrus  c-tg--ct
               Weddell seal  c-tg--ct
           Black flying-fox  c-tg--tc
B D                 Megabat  c-tg--tc
B D                Elephant  c-ta--gt
B D                 Manatee  c-ta--tt
                   Aardvark  c-tg--tt
              Prairie vole  ========
B D                    Pika  ========
B D                 Gorilla  ========
B D                Hedgehog  ========
B D                  Rabbit  ========
          Cape golden mole  ========
B D         Tasmanian devil  ========
B D                 Opossum  ========
       Cape elephant shrew  ========
        Chinese tree shrew  ========
B D                Platypus  ========
B D                  Tenrec  ========
B D                Bushbaby  ========
B D                 Ferret   ========
           Star-nosed mole  ========
             Domestic goat  ========
          Tibetan antelope  ========
B D               Armadillo  --------
      David's myotis (bat)  ========
             Big brown bat  ========
B D                Microbat  ========
B D         Squirrel monkey  --------
B D                Marmoset  --------
B D                     Cow  ========

Alignment block 27 of 907 in window, 169072260 - 169072279, 20 bps 
B D                   Human  ctcagctggactccttactt
B D                   Chimp  ctcagctggactccttactt
B D               Orangutan  ctcagctgggctccttactt
B D                  Gibbon  ctcagctgggctccttactt
B D                  Rhesus  ctcaggtgggctccttactt
B D     Crab-eating macaque  ctcaggtgggctccttactt
B D                  Baboon  ctcaggtgggctcct-----
B D            Green monkey  ctcaggtgggctccttactt
B D                Squirrel  cctagcagtgtgcccagctt
     Lesser Egyptian jerboa  aacacctactctcctcactt
B D         Chinese hamster  cgaatctgtgctctctgctt
             Golden hamster  cagatctgtgctctgtgctt
B D                   Mouse  ggtacctgggctctctgctt
B D                     Rat  agtgtctg-------tgctt
B D          Naked mole-rat  ctctgctttgctccttatat
B D              Guinea pig  ctcagcctggctccttactt
                 Chinchilla  cttggcctgactccttattt
           Brush-tailed rat  ctcagcagagcgccttagtt
B D                     Pig  ct-acctggactccttactt
B D                  Alpaca  cttagccgtgctccttgctt
             Bactrian camel  cttagccgtgctccttactt
B D                 Dolphin  ctcagttgtgttccttactt
               Killer whale  ctcagttgtgttccttactt
B D                   Sheep  ttaaaaaacagtccacatta
B D                   Horse  cctgact------------t
B D        White rhinoceros  cctgact------------t
B D                     Cat  cttagctgtgt----ttcct
B D                     Dog  cttaactgtgc----tttgc
B D                   Panda  cttagctgtgc----ttcgc
             Pacific walrus  cttagctgtgc----tttgc
               Weddell seal  cttagctgtgc----ttcac
           Black flying-fox  cttagctgggctccttcctt
B D                 Megabat  cttagctgggctccttcctt
            Star-nosed mole  ctgagctttgctccttatca
B D                Elephant  tttagctgtgttcc-tactt
B D                 Manatee  tttaactgtgttcc-tactt
                   Aardvark  cttagctatattccttactt
              Prairie vole  ====================
B D                    Pika  ====================
B D                 Gorilla  ====================
B D                Hedgehog  ====================
B D                  Rabbit  ====================
          Cape golden mole  ====================
B D         Tasmanian devil  ====================
B D                 Opossum  ====================
       Cape elephant shrew  ====================
        Chinese tree shrew  ====================
B D                Platypus  ====================
B D                  Tenrec  ====================
B D                Bushbaby  ====================
B D                 Ferret   ====================
             Domestic goat  ====================
          Tibetan antelope  ====================
B D               Armadillo  --------------------
      David's myotis (bat)  ====================
             Big brown bat  ====================
B D                Microbat  ====================
B D         Squirrel monkey  --------------------
B D                Marmoset  --------------------
B D                     Cow  ====================

Alignment block 28 of 907 in window, 169072280 - 169072281, 2 bps 
B D                   Human  aa
B D                   Chimp  aa
B D               Orangutan  aa
B D                  Gibbon  aa
B D                  Rhesus  aa
B D     Crab-eating macaque  aa
B D            Green monkey  aa
B D                Bushbaby  -a
B D                Squirrel  aa
     Lesser Egyptian jerboa  aa
B D         Chinese hamster  aa
             Golden hamster  ag
B D                   Mouse  ag
B D                     Rat  ag
B D          Naked mole-rat  aa
B D              Guinea pig  aa
                 Chinchilla  aa
           Brush-tailed rat  aa
B D                     Pig  aa
B D                  Alpaca  aa
             Bactrian camel  aa
B D                 Dolphin  aa
               Killer whale  aa
B D                   Sheep  aa
B D                   Horse  ga
B D        White rhinoceros  ga
B D                     Cat  ca
B D                     Dog  aa
B D                   Panda  aa
             Pacific walrus  ag
               Weddell seal  ag
           Black flying-fox  gc
B D                 Megabat  gc
            Star-nosed mole  a-
B D                Elephant  aa
B D                 Manatee  aa
                   Aardvark  aa
              Prairie vole  ==
B D                    Pika  ==
B D                 Gorilla  ==
B D                Hedgehog  ==
B D                  Baboon  --
B D                  Rabbit  ==
          Cape golden mole  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                  Tenrec  ==
B D                 Ferret   ==
             Domestic goat  ==
          Tibetan antelope  ==
B D               Armadillo  --
      David's myotis (bat)  ==
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  --
B D                Marmoset  --
B D                     Cow  ==

Inserts between block 28 and 29 in window
B D                  Sheep 2bp

Alignment block 29 of 907 in window, 169072282 - 169072284, 3 bps 
B D                   Human  gac
B D                   Chimp  gac
B D               Orangutan  gac
B D                  Gibbon  gac
B D                  Rhesus  gat
B D     Crab-eating macaque  gat
B D            Green monkey  gat
B D                Bushbaby  ggt
B D                Squirrel  cgt
     Lesser Egyptian jerboa  gac
B D         Chinese hamster  gat
             Golden hamster  gat
B D                   Mouse  ggc
B D                     Rat  ggc
B D          Naked mole-rat  tac
B D              Guinea pig  aac
                 Chinchilla  gac
           Brush-tailed rat  gac
B D                     Pig  gac
B D                  Alpaca  gac
             Bactrian camel  gac
B D                 Dolphin  gac
               Killer whale  gac
           Tibetan antelope  gac
B D                   Sheep  aat
B D                   Horse  gcc
B D        White rhinoceros  gcc
B D                     Cat  gac
B D                     Dog  gac
B D                   Panda  gac
             Pacific walrus  gac
               Weddell seal  gac
           Black flying-fox  aac
B D                 Megabat  aac
            Star-nosed mole  gta
B D                Elephant  gac
B D                 Manatee  gac
                   Aardvark  gat
              Prairie vole  ===
B D                    Pika  ===
B D                 Gorilla  ===
B D                Hedgehog  ===
B D                  Baboon  ---
B D                  Rabbit  ===
          Cape golden mole  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                  Tenrec  ===
B D                 Ferret   ===
             Domestic goat  ===
B D               Armadillo  ---
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ---
B D                Marmoset  ---
B D                     Cow  ===

Inserts between block 29 and 30 in window
B D           Green monkey 321bp
B D               Bushbaby 1bp

Alignment block 30 of 907 in window, 169072285 - 169072292, 8 bps 
B D                   Human  attcataa
B D                   Chimp  attcataa
B D               Orangutan  attcataa
B D                  Gibbon  atttataa
B D                  Rhesus  atttataa
B D     Crab-eating macaque  atttataa
B D                  Baboon  -----taa
B D            Green monkey  atttataa
B D                Bushbaby  agttatgg
B D                Squirrel  g----tag
     Lesser Egyptian jerboa  attcataa
B D         Chinese hamster  attc-tta
             Golden hamster  agtcataa
B D                   Mouse  attcataa
B D                     Rat  tttcataa
B D          Naked mole-rat  agtcgcaa
B D              Guinea pig  aattgcaa
                 Chinchilla  a-tctcag
           Brush-tailed rat  actcacac
B D                     Pig  atttgtaa
B D                  Alpaca  attcgtga
             Bactrian camel  attcgtga
B D                 Dolphin  atct----
               Killer whale  atct----
           Tibetan antelope  atttgtga
B D                   Sheep  aatcttaa
B D                   Horse  atttat-a
B D        White rhinoceros  ttgtgtaa
B D                     Cat  gtttgcaa
B D                     Dog  attcacaa
B D                   Panda  atccacaa
             Pacific walrus  atccacaa
               Weddell seal  atccacaa
           Black flying-fox  attcgcaa
B D                 Megabat  attcgcaa
            Star-nosed mole  gtttataa
B D                Elephant  atttgtac
B D                 Manatee  atttgtaa
                   Aardvark  atttgtaa
              Prairie vole  ========
B D                    Pika  ========
B D                 Gorilla  ========
B D                Hedgehog  ========
B D                  Rabbit  ========
          Cape golden mole  ========
B D         Tasmanian devil  ========
B D                 Opossum  ========
       Cape elephant shrew  ========
        Chinese tree shrew  ========
B D                Platypus  ========
B D                  Tenrec  ========
B D                 Ferret   ========
             Domestic goat  ========
B D               Armadillo  --------
      David's myotis (bat)  ========
             Big brown bat  ========
B D                Microbat  ========
B D         Squirrel monkey  --------
B D                Marmoset  --------
B D                     Cow  ========

Alignment block 31 of 907 in window, 169072293 - 169072293, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Bushbaby  a
B D                Squirrel  a
     Lesser Egyptian jerboa  a
B D         Chinese hamster  a
             Golden hamster  a
B D                   Mouse  a
B D                     Rat  a
B D          Naked mole-rat  a
B D              Guinea pig  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                     Pig  a
B D                  Alpaca  g
             Bactrian camel  g
           Tibetan antelope  a
B D                   Sheep  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                 Megabat  a
            Star-nosed mole  a
B D                Elephant  a
B D                 Manatee  a
                   Aardvark  a
B D               Armadillo  a
              Prairie vole  =
B D                    Pika  =
B D                 Gorilla  =
B D                Hedgehog  =
B D                  Rabbit  =
          Cape golden mole  =
B D                 Dolphin  -
B D         Tasmanian devil  =
B D                 Opossum  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                  Tenrec  =
B D                 Ferret   =
             Domestic goat  =
              Killer whale  -
      David's myotis (bat)  =
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  -
B D                Marmoset  -
B D                     Cow  =

Inserts between block 31 and 32 in window
B D                  Sheep 15bp

Alignment block 32 of 907 in window, 169072294 - 169072324, 31 bps 
B D                   Human  gtaaaatat---actttcaaatggaaaa-----taacaa
B D                   Chimp  gtaaaatat---actttcaaatggaaaa-----taacaa
B D               Orangutan  gtaaaatat---actttcaaatggaaaa-----taacaa
B D                  Gibbon  gtaaaatat---actttcaaatggaaaa-----tagcaa
B D                  Rhesus  gtaaaatat---actttcaaatggaaaa-----taacaa
B D     Crab-eating macaque  gtaaaatat---actttcaaatggaaaa-----taacaa
B D                  Baboon  gtaaaatat---actttcaaatggaaaa-----taacaa
B D            Green monkey  gtaaaatat---actttcaaatggaaaa-----taacaa
B D                Bushbaby  gttctacct---actttcatattgaaaa-----taacaa
B D                Squirrel  gtgaaacac-----tttcaaattgaaat--------taa
     Lesser Egyptian jerboa  atgcagtat---actttcaacttgaaca-----taaaaa
B D         Chinese hamster  aggaagaat---a-ttccagtctgaaag-----gaataa
             Golden hamster  aggaagaat---a-ttccagtctaaaag-----gaataa
B D                   Mouse  atgaagccg---acttccaatctgaaagtaatataatag
B D                     Rat  atgaagaagaatacttccaatctgaaag-----taatag
B D          Naked mole-rat  gcgaaaca-------tccacatggaaaa-----tagtaa
B D              Guinea pig  gcaaaacac---atttctacattgaaaa-----taataa
                 Chinchilla  ggaaaacac---acttccacattgaaaa-----taat--
           Brush-tailed rat  gcaaaacac---acttccacactgaaaa-----taac--
B D                     Pig  gtgaaatat---acttttaattagaaag-----taacaa
B D                  Alpaca  acaaagtat---actttcaactagaaaa-----taacaa
             Bactrian camel  acaaagtat---actttcaactagaaaa-----taacaa
B D                 Dolphin  gtgaagtat---actttcaattagaaaa-----taacaa
               Killer whale  gtgaagtat---actttcaattagaaaa-----taacaa
           Tibetan antelope  -----gtat---actttcagttagaaaa-----taacaa
B D                     Cow  gtgaagtat---actttcagttagaaaa-----taacaa
B D                   Sheep  gtgaagtat---actttcagttagaaaa-----taacaa
              Domestic goat  gtgaagtat---actttcagttagaaaa-----taacaa
B D                   Horse  gtgaggtat---actttcagttagaaaa-----taacaa
B D        White rhinoceros  gtgaagtat---attttcagttggaaaa-----tgacaa
B D                     Cat  -----gtat---acgttcaattaggaaa-----caacaa
B D                     Dog  -----gtat---atgctcaattaggaaa-----caaca-
B D                 Ferret   gcgaagtat---gtgctcaattaggaaa-----caaca-
B D                   Panda  -----atat---gtgctcaattaggaaa-----caacaa
             Pacific walrus  -----gtat---gtgctcaattagaaaa-----caacaa
               Weddell seal  -----gtat---gtgctcaattagaaaa-----caacaa
           Black flying-fox  gtgaactat---agttttcatcagaaaa-----taacca
B D                 Megabat  gtgaactat---agttttaatcagaaaa-----taacca
            Star-nosed mole  gtgaagtct---gatttctattcaaaaa-----taaaaa
B D                Elephant  gtgaagtat---gcttgcaaacagaaaa-----taataa
B D                 Manatee  gtggcatat---acttgcaaacagaaaa-----tagtaa
                   Aardvark  gtgaagtac---acttgcaaatagaaaa-----taata-
B D               Armadillo  gtgaagtat---atcttcaagtggaaaa-----taacca
              Prairie vole  =======================================
B D                    Pika  =======================================
B D                 Gorilla  =======================================
B D                Hedgehog  =======================================
B D                  Rabbit  =======================================
          Cape golden mole  =======================================
B D         Tasmanian devil  =======================================
B D                 Opossum  =======================================
       Cape elephant shrew  =======================================
        Chinese tree shrew  =======================================
B D                Platypus  =======================================
B D                  Tenrec  =======================================
      David's myotis (bat)  =======================================
             Big brown bat  =======================================
B D                Microbat  =======================================
B D         Squirrel monkey  ---------------------------------------
B D                Marmoset  ---------------------------------------

Inserts between block 32 and 33 in window
B D               Elephant 618bp

Alignment block 33 of 907 in window, 169072325 - 169072332, 8 bps 
B D                   Human  cagctta---g
B D                   Chimp  cagctta---g
B D               Orangutan  cagctta---g
B D                  Gibbon  cagctta---g
B D                  Rhesus  caactta---g
B D     Crab-eating macaque  caactta---g
B D                  Baboon  cagctta---g
B D            Green monkey  cagctta---g
B D                Bushbaby  -agctca---g
B D                Squirrel  cagcttg---a
     Lesser Egyptian jerboa  caaccta---g
B D         Chinese hamster  caaccaa---a
             Golden hamster  caaccga---a
B D                   Mouse  cagtagg---a
B D                     Rat  caaccga---a
B D          Naked mole-rat  gagctta---g
B D              Guinea pig  gagcttg---g
                 Chinchilla  gagttta---g
           Brush-tailed rat  gagctta---g
B D                     Pig  gcattta---a
B D                  Alpaca  ccattta---a
             Bactrian camel  ccattta---a
B D                 Dolphin  ccattta---a
               Killer whale  ccattta---a
           Tibetan antelope  ccattaa---a
B D                     Cow  ccattta---a
B D                   Sheep  ccattaa---c
              Domestic goat  ccattaa---a
B D                   Horse  ccactta-a--
B D        White rhinoceros  ccactta-a--
B D                     Cat  caacttgg---
B D                     Dog  --acttg----
B D                 Ferret   --acttg----
B D                   Panda  caacttg----
             Pacific walrus  tgacctg----
               Weddell seal  tgacttg----
           Black flying-fox  ccgctta--a-
B D                 Megabat  ccgctta--a-
            Star-nosed mole  ccacata----
B D                 Manatee  --gccct---t
                   Aardvark  -aaccta---a
B D               Armadillo  ---ctta---c
              Prairie vole  ===========
B D                    Pika  ===========
B D                 Gorilla  ===========
B D                Hedgehog  ===========
B D                  Rabbit  ===========
          Cape golden mole  ===========
B D         Tasmanian devil  ===========
B D                 Opossum  ===========
       Cape elephant shrew  ===========
        Chinese tree shrew  ===========
B D                Platypus  ===========
B D                Elephant  ===========
B D                  Tenrec  ===========
      David's myotis (bat)  ===========
             Big brown bat  ===========
B D                Microbat  ===========
B D         Squirrel monkey  -----------
B D                Marmoset  -----------

Inserts between block 33 and 34 in window
B D                    Cat 5664bp
           Star-nosed mole 1bp

Alignment block 34 of 907 in window, 169072333 - 169072334, 2 bps 
B D                   Human  tt
B D                   Chimp  tt
B D               Orangutan  tt
B D                  Gibbon  tt
B D                  Rhesus  tt
B D     Crab-eating macaque  tt
B D                  Baboon  tt
B D            Green monkey  tt
B D                Bushbaby  tt
B D                Squirrel  tt
     Lesser Egyptian jerboa  tt
B D         Chinese hamster  tt
             Golden hamster  gt
B D                   Mouse  tt
B D                     Rat  tt
B D          Naked mole-rat  tt
B D              Guinea pig  tt
                 Chinchilla  tt
           Brush-tailed rat  tt
B D                     Pig  tt
B D                  Alpaca  ca
             Bactrian camel  ca
B D                 Dolphin  tt
               Killer whale  tt
           Tibetan antelope  tt
B D                     Cow  tt
B D                   Sheep  tt
              Domestic goat  tt
B D                   Horse  tt
B D        White rhinoceros  tt
B D                     Dog  at
B D                 Ferret   at
B D                   Panda  at
             Pacific walrus  ag
               Weddell seal  ag
           Black flying-fox  -t
B D                 Megabat  -t
            Star-nosed mole  ct
B D                 Manatee  at
                   Aardvark  gt
B D               Armadillo  tt
              Prairie vole  ==
B D                    Pika  ==
B D                 Gorilla  ==
B D                Hedgehog  ==
B D                  Rabbit  ==
          Cape golden mole  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                Elephant  ==
B D                  Tenrec  ==
B D                     Cat  ==
      David's myotis (bat)  ==
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  --
B D                Marmoset  --

Inserts between block 34 and 35 in window
           Star-nosed mole 91bp

Alignment block 35 of 907 in window, 169072335 - 169072338, 4 bps 
B D                   Human  tgtc
B D                   Chimp  tgtc
B D               Orangutan  tgcc
B D                  Gibbon  tgcc
B D                  Rhesus  tgcc
B D     Crab-eating macaque  tgcc
B D                  Baboon  tgcc
B D            Green monkey  tgcc
B D                Bushbaby  tgcc
B D                Squirrel  gttt
     Lesser Egyptian jerboa  tgac
B D         Chinese hamster  tctc
             Golden hamster  tctc
B D                   Mouse  tgtc
B D                     Rat  tgtc
B D          Naked mole-rat  tgtc
B D              Guinea pig  tgac
                 Chinchilla  tgtc
           Brush-tailed rat  tacc
B D                     Pig  tctt
B D                  Alpaca  tgtt
             Bactrian camel  tgtt
B D                 Dolphin  tctt
               Killer whale  tctt
           Tibetan antelope  tgtt
B D                     Cow  tgtt
B D                   Sheep  tgtt
              Domestic goat  tgtt
B D                   Horse  tgtc
B D        White rhinoceros  tgtg
B D                     Dog  tgtc
B D                 Ferret   tgtc
B D                   Panda  tgtc
             Pacific walrus  tgtc
               Weddell seal  tgtc
           Black flying-fox  tgtc
B D                 Megabat  tgtc
B D                 Manatee  tgtc
                   Aardvark  tgcc
B D               Armadillo  tgca
              Prairie vole  ====
B D                    Pika  ====
B D                 Gorilla  ====
B D                Hedgehog  ====
B D                  Rabbit  ====
          Cape golden mole  ====
B D         Tasmanian devil  ====
B D                 Opossum  ====
       Cape elephant shrew  ====
        Chinese tree shrew  ====
B D                Platypus  ====
B D                Elephant  ====
B D                  Tenrec  ====
B D                     Cat  ====
           Star-nosed mole  ====
      David's myotis (bat)  ====
             Big brown bat  ====
B D                Microbat  ====
B D         Squirrel monkey  ----
B D                Marmoset  ----

Inserts between block 35 and 36 in window
B D                Manatee 637bp

Alignment block 36 of 907 in window, 169072339 - 169072340, 2 bps 
B D                   Human  ct
B D                   Chimp  ct
B D               Orangutan  ct
B D                  Gibbon  ct
B D                  Rhesus  ct
B D     Crab-eating macaque  ct
B D                  Baboon  ct
B D            Green monkey  ct
B D                Bushbaby  ct
B D                Squirrel  ct
     Lesser Egyptian jerboa  ct
B D         Chinese hamster  ct
             Golden hamster  ct
B D                   Mouse  ct
B D                     Rat  ct
B D          Naked mole-rat  ct
B D              Guinea pig  ct
                 Chinchilla  ct
           Brush-tailed rat  ct
B D                     Pig  at
B D                  Alpaca  ct
             Bactrian camel  ct
B D                 Dolphin  ct
               Killer whale  ct
           Tibetan antelope  ct
B D                     Cow  ct
B D                   Sheep  ct
              Domestic goat  ct
B D                   Horse  ct
B D        White rhinoceros  ct
B D                     Dog  ct
B D                 Ferret   ct
B D                   Panda  ct
             Pacific walrus  ct
               Weddell seal  ct
           Black flying-fox  cc
B D                 Megabat  cc
                   Aardvark  tt
B D               Armadillo  ct
              Prairie vole  ==
B D                    Pika  ==
B D                 Gorilla  ==
B D                Hedgehog  ==
B D                  Rabbit  ==
          Cape golden mole  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                 Manatee  ==
B D                Elephant  ==
B D                  Tenrec  ==
B D                     Cat  ==
           Star-nosed mole  ==
      David's myotis (bat)  ==
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  --
B D                Marmoset  --

Inserts between block 36 and 37 in window
                  Aardvark 1023bp

Alignment block 37 of 907 in window, 169072341 - 169072368, 28 bps 
B D                   Human  attaagtttgactttt-----gtataatatatt
B D                   Chimp  attaagtttgactttt-----gtataatatatt
B D               Orangutan  attaagtttgactttt-----gtataatatatt
B D                  Gibbon  attaagtttggctttg-----gtataatatatt
B D                  Rhesus  attaaatttgactttt-----gtataatatatt
B D     Crab-eating macaque  attaaatttgactttt-----gtataatatatt
B D                  Baboon  attaaatttgactttt-----gtataatatatt
B D            Green monkey  attaagtttgactttt-----gtataatatatt
B D                Bushbaby  attaagctggaatttt-----gtattatatatt
B D                Squirrel  gttaagtttgaattttgcaaaat----t-----
     Lesser Egyptian jerboa  aat-tgtgtatatttt-----ct----t-----
B D         Chinese hamster  tctgtgtttacatttt-----at----t-----
             Golden hamster  tctgtgtttacatttt-----at----t-----
B D                   Mouse  tctacatttacatttt-----at----t-----
B D                     Rat  tctacgtttacatttc-----at----t-----
B D          Naked mole-rat  attaggtttgaatttt-----gtgtatt-----
B D              Guinea pig  attgggtttgaatttt-----gtgttac-----
                 Chinchilla  gttaggtttaaatttt-----gtgttat-----
           Brush-tailed rat  tttaggtttgaacttt-----gtgttat-----
B D                     Pig  atttagttgcaactca-----gtatagcatatc
B D                  Alpaca  a------ttcagttt------------------
             Bactrian camel  a------ttaagttt------------------
B D                 Dolphin  a-taagattgaatttt-----gtgtaacgtatt
               Killer whale  a-taagattgaatttt-----gtgtagcgtatt
           Tibetan antelope  a-aaagtttgaatttt-----gggtagcaaatt
B D                     Cow  a-aaagtttgaatttt-----gtgtagcaaatt
B D                   Sheep  a-aaagtttgaatttt-----gggtagcaaatt
              Domestic goat  a-aaagtttgaatttt-----gggtagcaaatt
B D                   Horse  ataaagttcaaatttt-----gtacaacatatt
B D        White rhinoceros  attaagtttgaatttt-----atataacatact
B D                     Dog  attaggtttgaatttt-----gtgtaacatatt
B D                 Ferret   atgaagtctgaattct-----gtataacctgtc
B D                   Panda  atgaagtttgaattta-----gtataacacatt
             Pacific walrus  atgaagtttgaatttt-----gtataacatatt
               Weddell seal  atgaagtttgaatttt-----gtataacatatt
           Black flying-fox  attaattttgaatttt-----gtctagcaaatt
B D                 Megabat  attaattttgaatttt-----gtatagcaaatt
B D               Armadillo  attaaatgtgaatttt-----gaatattacatt
              Prairie vole  =================================
B D                    Pika  =================================
B D                 Gorilla  =================================
B D                Hedgehog  =================================
B D                  Rabbit  =================================
          Cape golden mole  =================================
                  Aardvark  =================================
B D         Tasmanian devil  =================================
B D                 Opossum  =================================
       Cape elephant shrew  =================================
        Chinese tree shrew  =================================
B D                Platypus  =================================
B D                 Manatee  =================================
B D                Elephant  =================================
B D                  Tenrec  =================================
B D                     Cat  =================================
           Star-nosed mole  =================================
      David's myotis (bat)  =================================
             Big brown bat  =================================
B D                Microbat  =================================
B D         Squirrel monkey  ---------------------------------
B D                Marmoset  ---------------------------------

Inserts between block 37 and 38 in window
B D                    Pig 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp

Alignment block 38 of 907 in window, 169072369 - 169072415, 47 bps 
B D                   Human  -ttctt--aaagaagacaaaactgtggagaaaactgtgcttaatgaagta
B D                   Chimp  -ttctt--aaagaagacaaaactgtggagaaaactgtgcttaatgaagta
B D                 Gorilla  -ttctt--aaagaagacaaaactgtggagaaaaccgtgcttaatgaagta
B D               Orangutan  -ttctt--aaagaagacaaaactgtggagaaaaccgtgcttaatgaagta
B D                  Gibbon  -ttctt--aaagaagataaaactgtgaagaaagccgtgcttaatgaagta
B D                  Rhesus  -ttctt--aaagaagacaaaactgtggagaaaaccgtgctcaatgaagta
B D     Crab-eating macaque  -ttctt--aaagaagacaaaactgtggagaaaaccgtgctcaatgaagta
B D                  Baboon  -ttctt--aaagaagacaaaactgtggagaaaatcgtgctcaatgaagta
B D            Green monkey  -ttctt--aaagaagacaaaactgtggagaaaaccgtgctcaatgaaata
B D                Bushbaby  -ttcgt--aaagaatgcaaacctgtggagaaaactg---ctaatgaggta
B D                Squirrel  -atgtgataaaggcggcaaaactgtggataaaattgttct-aatgaggta
     Lesser Egyptian jerboa  -taaaa--aaaaaaggcaaagctgtggagaaaagtgcact-aatgaggct
B D         Chinese hamster  -ttctg---aagaggaca-agctgg--aggaaagtgtgtg-gatgagatc
             Golden hamster  -ttctg--aaagaggaca-agctgc--aggaaagtgtgca-g--------
B D                   Mouse  -ttctg--aaagaagatgaagctgt--aggaaagtatgct-gatgagata
B D                     Rat  -ttatg--aaagaagacatagctgt--aggaaagtgtgca-gatgagata
B D          Naked mole-rat  -tcctt--aaagaaggtaacactgtggagcaaattgtgcc-aatggggta
B D              Guinea pig  -tcctg--aaagaaggtaactc--tagaaaaaacgatgca-aatggagca
                 Chinchilla  -tcctt--aaagaaggtaacactgtagagaaaattatgct-aatggcata
           Brush-tailed rat  -tcctt--aaagccagtaacaccatgaagaaaattgtggt-agtggaaca
B D                     Pig  -tctta--aaagatggcaaaactttggagaaaact--gct-attgaggta
B D                  Alpaca  -----------gaaggcaaaactttggagaaaactgtgct-aatgagata
             Bactrian camel  -----------gaaggcaaaactttggggaaaactgtgct-aatgagata
B D                 Dolphin  -tctta--aaagaagacaaaactttggagaaaactgtgct-aatgaggta
               Killer whale  -tctta--aaagaagacaaaacttcggagaaaactgtgct-aatgaggta
           Tibetan antelope  -tcttc--atagaaggcaaaactttgaagaaaact-------atgaggta
B D                     Cow  -tcttc--atagaaggcaaaactttggagaaaact-------atgaggta
B D                   Sheep  -tcttc--atagaaggcaaaactttgaagaaaact-------gtgaggta
              Domestic goat  -tcttc--atagaaggcaaaactttgaagaaaact-------atgaggta
B D                   Horse  -tctta--aaggaaggcaaaactttagaggaaaacgtgct-aatgagata
B D        White rhinoceros  -tctta--aaggaaggcaaaactttggagaaaaccgtgct-aatgagata
B D                     Dog  -tctta--aaggaagacaaaactttgaagaaaaccgtgct-aatgaggta
B D                 Ferret   -tcttc--aaggaaggcaaaacttgggagaaggctgtgct-caggaggta
B D                   Panda  -tctta--aaggaaggcaaaactttggagaaatctgtgct-aatgaggta
             Pacific walrus  -tctta--aaggaaggcaaaactttggagaaatctgtgtt-aatgaggta
               Weddell seal  -tctta--aaggaaggcaaaactttggagaaatctgtgct-aatgaggtg
           Black flying-fox  -tctta--caggaagtcaaaactttggagaaaattgtgct-aagaaaggt
B D                 Megabat  -tctta--caggaagtcaaaactttggagaaaattgtgct-aagaaaggt
B D               Armadillo  ttctta--gaagatagcaaaactgtggagaaaatggtgct-aatgaagtg
              Prairie vole  ==================================================
B D                    Pika  ==================================================
B D                Hedgehog  ==================================================
B D                  Rabbit  ==================================================
          Cape golden mole  ==================================================
                  Aardvark  ==================================================
B D         Tasmanian devil  ==================================================
B D                 Opossum  ==================================================
       Cape elephant shrew  ==================================================
        Chinese tree shrew  ==================================================
B D                Platypus  ==================================================
B D                 Manatee  ==================================================
B D                Elephant  ==================================================
B D                  Tenrec  ==================================================
B D                     Cat  ==================================================
           Star-nosed mole  ==================================================
      David's myotis (bat)  ==================================================
             Big brown bat  ==================================================
B D                Microbat  ==================================================
B D         Squirrel monkey  --------------------------------------------------
B D                Marmoset  --------------------------------------------------

Inserts between block 38 and 39 in window
B D                Megabat 7bp

Alignment block 39 of 907 in window, 169072416 - 169072431, 16 bps 
B D                   Human  caagc----aatatgaagaa
B D                   Chimp  caagc----aatatgaagaa
B D                 Gorilla  caggc----aatatgaagaa
B D               Orangutan  caagc----aatatgaagaa
B D                  Gibbon  caagc----aatatgaagaa
B D                  Rhesus  caagc----aatatgaagaa
B D     Crab-eating macaque  caagc----aatatgaagaa
B D                  Baboon  caagc----aatatgaagaa
B D            Green monkey  caagc----aatatgaagaa
B D                Bushbaby  aaagcatttaaagtgaagaa
B D                Squirrel  caagcatttaatgtgaagaa
     Lesser Egyptian jerboa  caagtatttaatgcaaag--
B D         Chinese hamster  tgaacagttcatgtgaagaa
             Golden hamster  ----------atgtgaagag
B D                   Mouse  gaaaaaggtcatgtgaggaa
B D                     Rat  ggaacaggtcacgtgaggaa
B D          Naked mole-rat  caaacatttaatgggaagag
B D              Guinea pig  caagcacttaatgtgaagaa
                 Chinchilla  caagtatttaatgtgaagaa
           Brush-tailed rat  caagcacttaatgcgaagag
B D                     Pig  ------tttaatgtgaagaa
B D                  Alpaca  caagcattgaacgtgaaggt
             Bactrian camel  caagcattgaatgtgaaggt
B D                 Dolphin  cgagcatttagtgtgaagaa
               Killer whale  caagcatttagtgtgaagaa
           Tibetan antelope  caagcttttaatgtgaagaa
B D                     Cow  caagcttttaatgtgaagaa
B D                   Sheep  caagcttttaatgtgaagaa
              Domestic goat  caagcttttaatgtgaagaa
B D                   Horse  caagcatttaa-gtgaagaa
B D        White rhinoceros  caagcatgcaatgtgaagaa
B D                     Dog  caagcatttaatgtgaagaa
B D                 Ferret   caagcatttaatgtgaagaa
B D                   Panda  caagcatttaatgtgaagaa
             Pacific walrus  caagcatttaatgtgaagaa
               Weddell seal  caagtatttaatgtgaagaa
B D               Armadillo  taagcatctaatgtgaaga-
              Prairie vole  ====================
B D                    Pika  ====================
B D                Hedgehog  ====================
B D                  Rabbit  ====================
          Cape golden mole  ====================
                  Aardvark  ====================
B D                 Megabat  ====================
B D         Tasmanian devil  ====================
B D                 Opossum  ====================
       Cape elephant shrew  ====================
        Chinese tree shrew  ====================
B D                Platypus  ====================
B D                 Manatee  ====================
B D                Elephant  ====================
B D                  Tenrec  ====================
B D                     Cat  ====================
           Star-nosed mole  ====================
          Black flying-fox  --------------------
      David's myotis (bat)  ====================
             Big brown bat  ====================
B D                Microbat  ====================
B D         Squirrel monkey  --------------------
B D                Marmoset  --------------------

Inserts between block 39 and 40 in window
B D        Chinese hamster 1bp
            Golden hamster 1bp
B D                  Mouse 70bp
B D                    Rat 1bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
          Tibetan antelope 3127bp
B D                    Cow 5997bp
B D                  Sheep 3142bp
             Domestic goat 3054bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp

Alignment block 40 of 907 in window, 169072432 - 169072433, 2 bps 
B D                   Human  a-a
B D                   Chimp  a-a
B D                 Gorilla  a-a
B D               Orangutan  a-a
B D                  Gibbon  a-a
B D                  Rhesus  a-a
B D     Crab-eating macaque  a-a
B D                  Baboon  a-a
B D            Green monkey  a-a
B D                Bushbaby  aca
B D                Squirrel  a-a
B D         Chinese hamster  a-g
             Golden hamster  a-g
B D                     Rat  a-g
B D          Naked mole-rat  a-g
B D              Guinea pig  a-g
                 Chinchilla  a-g
           Brush-tailed rat  a-g
B D                     Pig  a--
B D                  Alpaca  a--
             Bactrian camel  a--
B D                   Horse  a--
B D        White rhinoceros  a--
B D                     Dog  a--
B D                 Ferret   a--
B D                   Panda  a--
             Pacific walrus  a--
               Weddell seal  a--
              Prairie vole  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ---
B D                    Pika  ===
B D                Hedgehog  ===
B D                  Rabbit  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Megabat  ===
B D                 Dolphin  ---
B D         Tasmanian devil  ===
B D                 Opossum  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Manatee  ===
B D                Elephant  ===
B D                  Tenrec  ===
B D                     Cat  ===
           Star-nosed mole  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
              Killer whale  ---
          Black flying-fox  ---
B D               Armadillo  ---
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ---
B D                Marmoset  ---
B D                     Cow  ===

Inserts between block 40 and 41 in window
B D               Squirrel 5bp
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp
B D                    Pig 1bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                Ferret  1bp
B D                  Panda 5bp
            Pacific walrus 1bp
              Weddell seal 1bp

Alignment block 41 of 907 in window, 169072434 - 169072436, 3 bps 
B D                   Human  tat
B D                   Chimp  tat
B D                 Gorilla  tat
B D               Orangutan  tat
B D                  Gibbon  cat
B D                  Rhesus  tat
B D     Crab-eating macaque  tat
B D                  Baboon  tat
B D            Green monkey  cat
B D                Bushbaby  tgt
B D         Chinese hamster  tat
             Golden hamster  ta-
B D                     Rat  tac
B D          Naked mole-rat  tat
B D              Guinea pig  cat
                 Chinchilla  tat
           Brush-tailed rat  aat
B D                     Pig  tat
B D                  Alpaca  tat
             Bactrian camel  tat
B D                 Dolphin  tat
               Killer whale  tat
B D                   Horse  gat
B D        White rhinoceros  gat
B D                     Dog  --t
B D                 Ferret   tat
             Pacific walrus  tat
               Weddell seal  tat
              Prairie vole  ===
B D                   Mouse  ===
    Lesser Egyptian jerboa  ---
B D                    Pika  ===
B D                Hedgehog  ===
B D                  Rabbit  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Megabat  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Manatee  ===
B D                Elephant  ===
B D                  Tenrec  ===
B D                     Cat  ===
           Star-nosed mole  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
B D                   Panda  ===
          Black flying-fox  ---
B D                Squirrel  ===
B D               Armadillo  ---
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ---
B D                Marmoset  ---
B D                     Cow  ===

Inserts between block 41 and 42 in window
B D                Dolphin 1bp
              Killer whale 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Dog 1bp
            Pacific walrus 1bp
              Weddell seal 1bp

Alignment block 42 of 907 in window, 169072437 - 169072437, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                Bushbaby  t
B D         Chinese hamster  t
             Golden hamster  t
B D                     Rat  g
B D          Naked mole-rat  t
B D              Guinea pig  t
           Brush-tailed rat  a
B D                  Alpaca  t
             Bactrian camel  t
B D                   Horse  t
B D                 Ferret   t
              Prairie vole  =
B D                   Mouse  =
    Lesser Egyptian jerboa  -
B D                    Pika  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  -
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D                 Dolphin  =
B D         Tasmanian devil  =
B D                 Opossum  =
                Chinchilla  -
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                 Manatee  =
B D                Elephant  =
B D                  Tenrec  =
B D                     Cat  =
           Star-nosed mole  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
B D                     Dog  =
          Black flying-fox  -
B D        White rhinoceros  =
B D                Squirrel  =
B D               Armadillo  -
      David's myotis (bat)  =
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  -
B D                Marmoset  -
B D                     Cow  =

Inserts between block 42 and 43 in window
B D                  Horse 1bp

Alignment block 43 of 907 in window, 169072438 - 169072438, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Bushbaby  c
B D         Chinese hamster  t
             Golden hamster  t
B D                     Rat  t
B D          Naked mole-rat  t
B D              Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
              Prairie vole  =
B D                   Mouse  =
    Lesser Egyptian jerboa  -
B D                    Pika  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  -
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D                 Dolphin  =
B D         Tasmanian devil  =
B D                 Opossum  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                 Manatee  =
B D                Elephant  =
B D                  Tenrec  =
B D                     Cat  =
B D                 Ferret   -
           Star-nosed mole  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  -
B D                  Alpaca  -
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
B D                     Dog  =
          Black flying-fox  -
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  =
B D               Armadillo  -
      David's myotis (bat)  =
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  -
B D                Marmoset  -
B D                     Cow  =

Inserts between block 43 and 44 in window
B D        Chinese hamster 1bp
            Golden hamster 1bp
B D                    Rat 1bp
B D         Naked mole-rat 2bp
B D             Guinea pig 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp

Alignment block 44 of 907 in window, 169072439 - 169072439, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
B D            Green monkey  a
B D                Bushbaby  a
     Lesser Egyptian jerboa  a
B D         Chinese hamster  g
             Golden hamster  g
B D                     Rat  g
B D              Guinea pig  a
                 Chinchilla  t
           Brush-tailed rat  a
B D               Armadillo  a
              Prairie vole  =
B D                   Mouse  =
B D                    Pika  =
              Weddell seal  =
B D                Hedgehog  =
B D                     Pig  -
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D                 Dolphin  =
B D         Tasmanian devil  =
B D                 Opossum  =
B D          Naked mole-rat  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                 Manatee  =
B D                Elephant  =
B D                  Tenrec  =
B D                     Cat  =
B D                 Ferret   -
           Star-nosed mole  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  -
B D                  Alpaca  -
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
B D                     Dog  =
          Black flying-fox  -
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  =
      David's myotis (bat)  =
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  -
B D                Marmoset  -
B D                     Cow  =

Alignment block 45 of 907 in window, 169072440 - 169072445, 6 bps 
B D                   Human  -aaaac-t
B D                   Chimp  -aaaac-t
B D                 Gorilla  -aaaac-t
B D               Orangutan  -aaaac-t
B D                  Gibbon  -aaaac-t
B D                  Rhesus  -aaaac-c
B D     Crab-eating macaque  -aaaac-c
B D                  Baboon  -aaaac-c
B D            Green monkey  -aaaac-t
     Lesser Egyptian jerboa  -aaaac--
B D         Chinese hamster  -aaatc--
             Golden hamster  -aaatc--
B D                     Rat  -aaaac--
B D              Guinea pig  -aaaacg-
                 Chinchilla  -agagct-
           Brush-tailed rat  -aaaact-
           Black flying-fox  ---att--
B D               Armadillo  aaatat--
              Prairie vole  ========
B D                   Mouse  ========
B D                    Pika  ========
              Weddell seal  ========
B D                Hedgehog  ========
B D                     Pig  --------
B D                  Rabbit  ========
          Cape golden mole  ========
                  Aardvark  ========
B D                 Megabat  ========
B D                 Dolphin  ========
B D         Tasmanian devil  ========
B D                 Opossum  ========
B D          Naked mole-rat  ========
       Cape elephant shrew  ========
        Chinese tree shrew  ========
B D                Platypus  ========
B D                 Manatee  ========
B D                Elephant  ========
B D                  Tenrec  ========
B D                     Cat  ========
B D                Bushbaby  --------
B D                 Ferret   --------
           Star-nosed mole  ========
             Domestic goat  ========
B D                   Sheep  ========
          Tibetan antelope  ========
            Bactrian camel  --------
B D                  Alpaca  --------
            Pacific walrus  ========
B D                   Panda  ========
              Killer whale  ========
B D                     Dog  ========
B D        White rhinoceros  ========
B D                   Horse  ========
B D                Squirrel  ========
      David's myotis (bat)  ========
             Big brown bat  ========
B D                Microbat  ========
B D         Squirrel monkey  --------
B D                Marmoset  --------
B D                     Cow  ========

Inserts between block 45 and 46 in window
    Lesser Egyptian jerboa 3bp
            Golden hamster 35bp

Alignment block 46 of 907 in window, 169072446 - 169072447, 2 bps 
B D                   Human  -tg
B D                   Chimp  -tg
B D                 Gorilla  -tg
B D               Orangutan  -tg
B D                  Gibbon  -tg
B D                  Rhesus  -tg
B D     Crab-eating macaque  -tg
B D                  Baboon  -tg
B D            Green monkey  -tg
     Lesser Egyptian jerboa  -tg
B D         Chinese hamster  -tg
B D                     Rat  -tg
B D              Guinea pig  --a
                 Chinchilla  --g
           Brush-tailed rat  --t
           Black flying-fox  -tg
B D               Armadillo  tt-
              Prairie vole  ===
            Golden hamster  ===
B D                   Mouse  ===
B D                    Pika  ===
              Weddell seal  ===
B D                Hedgehog  ===
B D                     Pig  ---
B D                  Rabbit  ===
          Cape golden mole  ===
                  Aardvark  ===
B D                 Megabat  ===
B D                 Dolphin  ===
B D         Tasmanian devil  ===
B D                 Opossum  ===
B D          Naked mole-rat  ===
       Cape elephant shrew  ===
        Chinese tree shrew  ===
B D                Platypus  ===
B D                 Manatee  ===
B D                Elephant  ===
B D                  Tenrec  ===
B D                     Cat  ===
B D                Bushbaby  ---
B D                 Ferret   ---
           Star-nosed mole  ===
             Domestic goat  ===
B D                   Sheep  ===
          Tibetan antelope  ===
            Bactrian camel  ---
B D                  Alpaca  ---
            Pacific walrus  ===
B D                   Panda  ===
              Killer whale  ===
B D                     Dog  ===
B D        White rhinoceros  ===
B D                   Horse  ===
B D                Squirrel  ===
      David's myotis (bat)  ===
             Big brown bat  ===
B D                Microbat  ===
B D         Squirrel monkey  ---
B D                Marmoset  ---
B D                     Cow  ===

Inserts between block 46 and 47 in window
B D        Chinese hamster 51bp
B D             Guinea pig 4bp
                Chinchilla 1bp
          Brush-tailed rat 1bp

Alignment block 47 of 907 in window, 169072448 - 169072448, 1 bps 
B D                   Human  -a
B D                   Chimp  -a
B D                 Gorilla  -a
B D               Orangutan  -a
B D                  Gibbon  -a
B D                  Rhesus  -a
B D     Crab-eating macaque  -a
B D                  Baboon  -a
B D            Green monkey  -a
     Lesser Egyptian jerboa  -a
B D                     Rat  -a
                 Chinchilla  -g
           Brush-tailed rat  -a
           Black flying-fox  -a
B D               Armadillo  t-
              Prairie vole  ==
            Golden hamster  ==
B D                   Mouse  ==
B D                    Pika  ==
              Weddell seal  ==
B D                Hedgehog  ==
B D              Guinea pig  ==
B D                     Pig  --
B D                  Rabbit  ==
          Cape golden mole  ==
                  Aardvark  ==
B D                 Megabat  ==
B D                 Dolphin  ==
B D         Tasmanian devil  ==
B D                 Opossum  ==
B D          Naked mole-rat  ==
       Cape elephant shrew  ==
        Chinese tree shrew  ==
B D                Platypus  ==
B D                 Manatee  ==
B D                Elephant  ==
B D         Chinese hamster  ==
B D                  Tenrec  ==
B D                     Cat  ==
B D                Bushbaby  --
B D                 Ferret   --
           Star-nosed mole  ==
             Domestic goat  ==
B D                   Sheep  ==
          Tibetan antelope  ==
            Bactrian camel  --
B D                  Alpaca  --
            Pacific walrus  ==
B D                   Panda  ==
              Killer whale  ==
B D                     Dog  ==
B D        White rhinoceros  ==
B D                   Horse  ==
B D                Squirrel  ==
      David's myotis (bat)  ==
             Big brown bat  ==
B D                Microbat  ==
B D         Squirrel monkey  --
B D                Marmoset  --
B D                     Cow  ==

Inserts between block 47 and 48 in window
          Black flying-fox 1bp

Alignment block 48 of 907 in window, 169072449 - 169072449, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
B D                     Rat  t
                 Chinchilla  t
           Brush-tailed rat  t
B D               Armadillo  t
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  -
B D                    Pika  =
              Weddell seal  =
B D                Hedgehog  =
B D              Guinea pig  =
B D                     Pig  -
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D                 Dolphin  =
B D         Tasmanian devil  =
B D                 Opossum  =
B D          Naked mole-rat  =
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                 Manatee  =
B D                Elephant  =
B D         Chinese hamster  =
B D                  Tenrec  =
B D                     Cat  =
B D                Bushbaby  -
B D                 Ferret   -
           Star-nosed mole  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  -
B D                  Alpaca  -
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
B D                     Dog  =
          Black flying-fox  =
B D        White rhinoceros  =
B D                   Horse  =
B D                Squirrel  =
      David's myotis (bat)  =
             Big brown bat  =
B D                Microbat  =
B D         Squirrel monkey  -
B D                Marmoset  -
B D                     Cow  =

Inserts between block 48 and 49 in window
B D                    Rat 7bp

Alignment block 49 of 907 in window, 169072450 - 169072450, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
B D            Green monkey  t
           Brush-tailed rat  t
B D                     Rat  =
              Prairie vole  =
            Golden hamster  =
B D                   Mouse  =
    Lesser Egyptian jerboa  -
B D                    Pika  =
              Weddell seal  =
B D                Hedgehog  =
B D              Guinea pig  =
B D                     Pig  -
B D                  Rabbit  =
          Cape golden mole  =
                  Aardvark  =
B D                 Megabat  =
B D                 Dolphin  =
B D         Tasmanian devil  =
B D                 Opossum  =
B D          Naked mole-rat  =
                Chinchilla  -
       Cape elephant shrew  =
        Chinese tree shrew  =
B D                Platypus  =
B D                 Manatee  =
B D                Elephant  =
B D         Chinese hamster  =
B D                  Tenrec  =
B D                     Cat  =
B D                Bushbaby  -
B D                 Ferret   -
           Star-nosed mole  =
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  =
            Bactrian camel  -
B D                  Alpaca  -
            Pacific walrus  =
B D                   Panda  =
              Killer whale  =
B D                     Dog  =
          Black flying-fox  =
B D        White rhinoceros  =
B D                   Horse  =
B