Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 546 in window, 174958882 - 174958933, 52 bps 
B D                     Human  tccttgatggattgttacaaggat-gagggatgctgtatgttaaggact-cagc
B D                     Chimp  tccttgatggattgttacaaggat-gagggatgctgtatgtaagggact-cagc
B D                 Orangutan  tccttgatggattgttacaaggat-gagggatgctgtatgttaaggact-cagc
B D                    Gibbon  tccttgatggattgttacaaggat-gagggatgctgtatgttaaggact-cagc
B D                    Rhesus  tccttggtggattattacaaggat-gagggatgctgtatgttaaggact-cagc
B D       Crab-eating macaque  tccttggtggattattacaaggat-gagggatgctgtatgttaaggact-cagc
B D                    Baboon  tccttggtggattattacaaggat-gagggatgctgtatgttaaggact-tagc
B D              Green monkey  tccttggtggattattacaaggat-gagggatgctgtatgttagggact-cagc
B D                  Marmoset  tttttgatggattgttgcaaggat-gaggcatgctgtatgttaaggact-cagc
B D           Squirrel monkey  tttttgatggattgttgcaaggat-gaggcatgctgtatgttaaggact-cagc
B D                  Bushbaby  tccttaacagattattgtgaatat-gaggggtgtcgtatgtt----act-cagc
           Chinese tree shrew  ccctcaaagg-tggttgtgagcat-gaaggcc-ttgtaggtgaaacgct-cagc
B D                  Squirrel  ttcttgatggatttgtgcgaggtt-gagggatgttgtatgttaagtact-cggc
                 Prairie vole  tttgtggtgaattactttgagatt-gaaggctgctgtgtgttaggtact-caga
B D           Chinese hamster  tttgtggtagattactgtgagatt-gaaggctgtcatatgttaagtact-caga
               Golden hamster  tttgtggtagattactgtgagatt-gaaggctgtcatatgttaagtact-caga
B D                       Rat  tttgtgatgggttagtgtgagatt-gaaggctgtcatatgttaagtact-caaa
B D            Naked mole-rat  ttcttggtgaactgttgtgaagat-gagagatgctataggctaagtact-cagt
B D                Guinea pig  ttcttggtggaccgttatgaagat-gacagacgctatatgttaagtact-tagc
                   Chinchilla  ttcttggtggaccatggtgaagat-gagagatgctatatgttaagtact-tagc
             Brush-tailed rat  tgctcggtggactgtagtgaagat-cagagatgctgtatgttaagtact-tggc
B D                    Rabbit  tccgtgatgggttgccgtgagggt-gagggttcttggatgcgaaagact-cggc
B D                      Pika  tccttgagggattggcatgaagat-gagggttgctggatgcaaagtcctccggg
B D                       Pig  tccttgaagaactgttgtgaggat-gagggatgctgtatgttaagaatc-cagc
B D                    Alpaca  tccttgaaggcttgctctgaggat-gggggatgctggatgtttggtacc-cagc
               Bactrian camel  tccttgaaagcttgctctgaggat-ggaggatgctggatgtttggtacc-cagc
B D                   Dolphin  tccttgaaagattgttgtgaggat-gagggatgttatatgttaagtacc-cagc
                 Killer whale  tccttgaaagattgttgtgaggat-gagggatgttatatgttaagtacc-cagc
             Tibetan antelope  tccttgaaggattgttgcgaagat-gaggtatgttgtatgcaaagtacc-cagc
B D                       Cow  tccttgaaggattgttgtgaagat-gaggtacgttgtatgcaaagtacc-cagc
B D                     Sheep  tccttgcaggattgttgccaagat-gaggtatgttgtatgcaaagtacc-cagc
                Domestic goat  tccttgcaggattgttgccaagat-gaggtatgttgtatgcaaagtacc-cagc
B D                     Horse  tccttgagggactgttgtaaaggt-gacggatgttgtatgttaagta-c-cagc
B D          White rhinoceros  tccttgagggattgttgtgggggt-gagggatgttgtgtgttaaatacc-cagc
B D                       Cat  tccttgaatgactt--gtaaagat-gagggattttgtgtgtcacgtacc-tagc
B D                       Dog  tccttgaaggacttttgcaaagat-gagggatgttgtgtggt-agtacc-tagc
B D                   Ferret   tccttaaagggctcctgtgaagat-gagggatgtcgtgtgtgaagcggc-tcgc
B D                     Panda  tccttgcagggcttctgtgaaggt-gagggatgttgtgggttcagtacc-tagc
               Pacific walrus  --cttacagggcttc--------t-ga-ggacgttgtgtgctaagtacc-tagc
                 Weddell seal  tccttacagggcttctgcaaagat-ga-ggacgttgtgtgctaagtacc-tagc
             Black flying-fox  cccttga-ggatagctgtgaggtt-aggggacggcgcatgctcagtacc-cagc
B D                   Megabat  cccttga-ggatagctgtgaggtt-aggggacggcgcacgctcagtacc-cagc
                Big brown bat  gcctggaaggactgttgagaagat-gggggatggcgtattttaagcacc-cagc
         David's myotis (bat)  gcctggagggactgttgtgaagat-gggggatggcgtattttaagcacc-cagc
B D                  Microbat  gcctggaaggactgttgtgaagat-gggggatggcatattttaagcacc-cggc
              Star-nosed mole  tccttgatagattgtgttgaggat-gagagtgatggcatgttaagtgtc-caga
B D                  Elephant  accttgcagaattgttgtgaggat-gagggatgttgtatgttaagtagc-cagc
          Cape elephant shrew  accttgtaggattgttgtgaggat-gaggggcgtggtatgttaagtatt-aaac
B D                   Manatee  accttgcaggattgttctgaggat-gagggatgttgtgtgttaagtacc-cagc
             Cape golden mole  ------caggatcgttatgaagat-gagagatgttgtatgttaagtacc-cagt
                     Aardvark  acattgcaggattgttgtgaggatggaggaatgttgtacattaagtacc-cagc
B D                 Armadillo  tccttgcaggattattgtgaggct-gagggatgttctattttaagaatc-caac
B D                     Mouse  ======================================================
      Lesser Egyptian jerboa  ======================================================
B D                   Gorilla  ------------------------------------------------------
B D                  Hedgehog  ======================================================
B D                     Shrew  ======================================================
B D                Coelacanth  ======================================================
  D    Spiny softshell turtle  ======================================================
B D             X. tropicalis  ======================================================
B D              Atlantic cod  ======================================================
                 Spotted gar  ======================================================
B D               Stickleback  ======================================================
          Southern platyfish  ======================================================
      Yellowbelly pufferfish  ======================================================
B D                      Fugu  ======================================================
B D                    Turkey  ======================================================
B D                   Chicken  ======================================================
  D              Mallard duck  ======================================================
          Tibetan ground jay  ======================================================
B D               Zebra finch  ======================================================
  D    White-throated sparrow  ======================================================
B D           Tasmanian devil  ======================================================
    Mexican tetra (cavefish)  ======================================================
B D                    Medaka  ======================================================
         Pundamilia nyererei  ======================================================
                 Zebra mbuna  ======================================================
       Burton's mouthbreeder  ======================================================
         Princess of Burundi  ======================================================
B D              Nile tilapia  ======================================================
  D            Painted turtle  ======================================================
  D           Green seaturtle  ======================================================
B D        American alligator  ======================================================
  D             Scarlet macaw  ======================================================
B D                Budgerigar  ======================================================
B D                   Opossum  ======================================================
  D               Rock pigeon  ======================================================
  D       Collared flycatcher  ======================================================
B D       Medium ground finch  ======================================================
B D                    Lizard  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
  D                    Parrot  ======================================================
B D                  Platypus  ======================================================
B D                   Wallaby  ======================================================
B D                    Tenrec  ======================================================
  D  Chinese softshell turtle  ======================================================

Inserts between block 1 and 2 in window
         Cape elephant shrew 352bp

Alignment block 2 of 546 in window, 174958934 - 174958941, 8 bps 
B D                     Human  tcatagtt
B D                     Chimp  tcatagtt
B D                 Orangutan  tcatagtt
B D                    Gibbon  tcatagtt
B D                    Rhesus  tcatagtt
B D       Crab-eating macaque  tcatagtt
B D                    Baboon  tcatagtt
B D              Green monkey  tcatagtt
B D                  Marmoset  tcatagtt
B D           Squirrel monkey  ttatagtt
B D                  Bushbaby  acattctt
           Chinese tree shrew  acatagtt
B D                  Squirrel  acagggtt
                 Prairie vole  acataatt
B D           Chinese hamster  acataatt
               Golden hamster  acataatt
B D                       Rat  acataatt
B D            Naked mole-rat  gcatagtt
B D                Guinea pig  aggtagtt
                   Chinchilla  acatagtt
             Brush-tailed rat  acacagct
B D                    Rabbit  ccatagct
B D                      Pika  acatagtt
B D                       Pig  acattgtt
B D                    Alpaca  acagagct
               Bactrian camel  acagagct
B D                   Dolphin  acatagtt
                 Killer whale  acatagtt
             Tibetan antelope  acatagtt
B D                       Cow  acaaagt-
B D                     Sheep  acatagtt
                Domestic goat  acatagtt
B D                     Horse  acatagtt
B D          White rhinoceros  acatagtt
B D                       Cat  acgtggtt
B D                       Dog  acatagtt
B D                   Ferret   acggagct
B D                     Panda  acggagct
               Pacific walrus  acatagct
                 Weddell seal  acatagct
             Black flying-fox  actcggtc
B D                   Megabat  actcggtc
                Big brown bat  acatggtt
         David's myotis (bat)  acatggtt
B D                  Microbat  acatggtt
              Star-nosed mole  agag---t
B D                  Elephant  acatagct
B D                   Manatee  acatggtt
             Cape golden mole  acatactt
                     Aardvark  acatagct
B D                 Armadillo  acat----
B D                     Mouse  ========
      Lesser Egyptian jerboa  ========
B D                   Gorilla  --------
B D                  Hedgehog  ========
B D                     Shrew  ========
B D                Coelacanth  ========
  D    Spiny softshell turtle  ========
B D             X. tropicalis  ========
B D              Atlantic cod  ========
                 Spotted gar  ========
B D               Stickleback  ========
          Southern platyfish  ========
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
B D                    Turkey  ========
B D                   Chicken  ========
  D              Mallard duck  ========
          Tibetan ground jay  ========
B D               Zebra finch  ========
  D    White-throated sparrow  ========
B D           Tasmanian devil  ========
    Mexican tetra (cavefish)  ========
B D                    Medaka  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D              Nile tilapia  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
B D        American alligator  ========
  D             Scarlet macaw  ========
B D                Budgerigar  ========
B D                   Opossum  ========
  D               Rock pigeon  ========
  D       Collared flycatcher  ========
B D       Medium ground finch  ========
B D                    Lizard  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
         Cape elephant shrew  ========
B D                  Platypus  ========
B D                   Wallaby  ========
B D                    Tenrec  ========
  D  Chinese softshell turtle  ========

Inserts between block 2 and 3 in window
B D                 Bushbaby 2bp
          Chinese tree shrew 1bp
B D                 Squirrel 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
              Golden hamster 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
             Star-nosed mole 1bp
B D                 Elephant 1149bp
B D                  Manatee 1128bp
            Cape golden mole 553bp
                    Aardvark 1bp

Alignment block 3 of 546 in window, 174958942 - 174958965, 24 bps 
B D                     Human  g---------------------------------------------------------------------
B D                     Chimp  g---------------------------------------------------------------------
B D                 Orangutan  g---------------------------------------------------------------------
B D                    Gibbon  g---------------------------------------------------------------------
B D                    Rhesus  g---------------------------------------------------------------------
B D       Crab-eating macaque  g---------------------------------------------------------------------
B D                    Baboon  g---------------------------------------------------------------------
B D              Green monkey  g---------------------------------------------------------------------
B D                  Marmoset  g---------------------------------------------------------------------
B D           Squirrel monkey  g---------------------------------------------------------------------
B D                  Bushbaby  g---------------------------------------------------------------------
           Chinese tree shrew  g---------------------------------------------------------------------
B D                  Squirrel  g---------------------------------------------------------------------
                 Prairie vole  g---------------------------------------------------------------------
B D           Chinese hamster  g---------------------------------------------------------------------
               Golden hamster  g---------------------------------------------------------------------
B D                       Rat  g---------------------------------------------------------------------
B D            Naked mole-rat  g---------------------------------------------------------------------
B D                Guinea pig  g---------------------------------------------------------------------
                   Chinchilla  gtgttcagtaagtttgttgttttttttttttttttttttttggtttttctctggtaccgggaaccgaact
             Brush-tailed rat  g---------------------------------------------------------------------
B D                    Rabbit  g---------------------------------------------------------------------
B D                      Pika  g---------------------------------------------------------------------
B D                       Pig  c---------------------------------------------------------------------
B D                    Alpaca  g---------------------------------------------------------------------
               Bactrian camel  g---------------------------------------------------------------------
B D                   Dolphin  g---------------------------------------------------------------------
                 Killer whale  g---------------------------------------------------------------------
             Tibetan antelope  g---------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------
B D                     Sheep  g---------------------------------------------------------------------
                Domestic goat  g---------------------------------------------------------------------
B D                     Horse  g---------------------------------------------------------------------
B D          White rhinoceros  g---------------------------------------------------------------------
B D                       Cat  g---------------------------------------------------------------------
B D                       Dog  g---------------------------------------------------------------------
B D                   Ferret   c---------------------------------------------------------------------
B D                     Panda  g---------------------------------------------------------------------
               Pacific walrus  g---------------------------------------------------------------------
                 Weddell seal  g---------------------------------------------------------------------
             Black flying-fox  g---------------------------------------------------------------------
B D                   Megabat  g---------------------------------------------------------------------
                Big brown bat  g---------------------------------------------------------------------
         David's myotis (bat)  g---------------------------------------------------------------------
B D                  Microbat  g---------------------------------------------------------------------
              Star-nosed mole  a---------------------------------------------------------------------
B D                  Elephant  g---------------------------------------------------------------------
B D                   Manatee  g---------------------------------------------------------------------
                     Aardvark  g---------------------------------------------------------------------
B D                 Armadillo  ----------------------------------------------------------------------
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                   Gorilla  ----------------------------------------------------------------------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
            Cape golden mole  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  --------------------------------------------------------tgttcaa-taaa--
                        Chimp  --------------------------------------------------------tgttcaa-taaa--
                    Orangutan  --------------------------------------------------------tgttcaa-taaa--
                       Gibbon  --------------------------------------------------------tgttcaa-taaa--
                       Rhesus  --------------------------------------------------------cattcaa-taaa--
          Crab-eating macaque  --------------------------------------------------------cattcaa-taaa--
                       Baboon  --------------------------------------------------------cattcaa-taaa--
                 Green monkey  --------------------------------------------------------cattcaa-taaa--
                     Marmoset  --------------------------------------------------------tgttcaa-gaaa--
              Squirrel monkey  --------------------------------------------------------tgttcaa-gaaa--
                     Bushbaby  --------------------------------------------------------tgttcaa-taaa--
           Chinese tree shrew  --------------------------------------------------------tgtccag-caaa--
                     Squirrel  --------------------------------------------------------tgttcag-taaact
                 Prairie vole  --------------------------------------------------------tgtttaa-taaa--
              Chinese hamster  --------------------------------------------------------tgtttag-taaa--
               Golden hamster  --------------------------------------------------------tgtttaa-taaa--
                          Rat  --------------------------------------------------------tgtttaa-taaa--
               Naked mole-rat  --------------------------------------------------------tattcag-taaata
                   Guinea pig  --------------------------------------------------------tgttcag-taaata
                   Chinchilla  caagaccttgcgcttgccaggcaggcgcttttgccgctgagctaaatccccagccctgttcag-taagtt
             Brush-tailed rat  --------------------------------------------------------tgttcag-taagta
                       Rabbit  --------------------------------------------------------tgttcat-taga--
                         Pika  --------------------------------------------------------tgctgag-caaa--
                          Pig  --------------------------------------------------------tgttcag-taaa--
                       Alpaca  --------------------------------------------------------tgttcga-tgga--
               Bactrian camel  --------------------------------------------------------tgttcga-tgaa--
                      Dolphin  --------------------------------------------------------tgttcaa-taaa--
                 Killer whale  --------------------------------------------------------tgttcaa-taaa--
             Tibetan antelope  --------------------------------------------------------tgttcag-gaaa--
                          Cow  --------------------------------------------------------tgttcagtgaaa--
                        Sheep  --------------------------------------------------------tgttcag-gaaa--
                Domestic goat  --------------------------------------------------------tgttcag-gaaa--
                        Horse  --------------------------------------------------------tgttcaa-taaa--
             White rhinoceros  --------------------------------------------------------tgttcaa-taaa--
                          Cat  --------------------------------------------------------tgttcga-taaa--
                          Dog  --------------------------------------------------------tgttcag-taat--
                      Ferret   --------------------------------------------------------tgttcag-taaa--
                        Panda  --------------------------------------------------------tgttcag-taaa--
               Pacific walrus  --------------------------------------------------------tgttcag-taaa--
                 Weddell seal  --------------------------------------------------------cgttcag-taaa--
             Black flying-fox  --------------------------------------------------------tctgcaa-tgaa--
                      Megabat  --------------------------------------------------------tctgcaa-tgaa--
                Big brown bat  --------------------------------------------------------tgtgcaa-taaa--
         David's myotis (bat)  --------------------------------------------------------tgtgcaa-taaa--
                     Microbat  --------------------------------------------------------tgtgcag-gaaa--
              Star-nosed mole  --------------------------------------------------------tgttcaa-taca--
                     Elephant  --------------------------------------------------------tgttcaa-taaa--
                      Manatee  --------------------------------------------------------tgttcag-taaa--
                     Aardvark  --------------------------------------------------------tattcaa-taaa--
                    Armadillo  -------------------------------------------------------------aa-taaa--
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                      Gorilla  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
             Cape golden mole  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
          Cape elephant shrew  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
                       Tenrec  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ---tggctgtta----t-t----t
                        Chimp  ---tggctgtta----t-t----t
                    Orangutan  ---tggctgtta----t-t----t
                       Gibbon  ---tggctgtta----t-t----t
                       Rhesus  ---tggctgtta----t-t----t
          Crab-eating macaque  ---tggctgtta----t-t----t
                       Baboon  ---tggctgtta----t-t----t
                 Green monkey  ---tggctgtta----t-t----t
                     Marmoset  ---tggctttta----t-t----t
              Squirrel monkey  ---tggctgtta----t-t----t
                     Bushbaby  ---tggttgttattagt-t----t
           Chinese tree shrew  -agttgctatta----g-t----t
                     Squirrel  tggttattatta----g-c----t
                 Prairie vole  ---tggttattg----g-t----t
              Chinese hamster  ---tggttattg----g-t----t
               Golden hamster  ---tgattattg----gtt----t
                          Rat  ---tggctatta----g-t----t
               Naked mole-rat  tggttattaata----g-t----t
                   Guinea pig  tggttattaata----a-t----t
                   Chinchilla  tggttattgtta----g-t----t
             Brush-tailed rat  tggttattgtta----g-t----t
                       Rabbit  caggtgtgactg----gtt----t
                         Pika  agattattgctg----gtt----c
                          Pig  ---tggttttca----t-tagcct
                       Alpaca  ---tggtcgtta----c-tagcct
               Bactrian camel  ---tggtcgtta----c-tagcct
                      Dolphin  ---tggttgtga----t-tagcct
                 Killer whale  ---tggttgtga----t-tagcct
             Tibetan antelope  ---tggttgtta----t-tagcct
                          Cow  ---tggttgtta----t-tagctt
                        Sheep  ---tggttgtta----t-tagcct
                Domestic goat  ---tggttgtta----c-tagcct
                        Horse  ---tggttgttg----t-tagcct
             White rhinoceros  ---tggtggttg----t-tagcct
                          Cat  ---cggttgtta----t-tagcct
                          Dog  ---tggttgtta----t-tagcct
                      Ferret   ---tggtggtta----c-tagacc
                        Panda  ---tggttgtta----t-tagcct
               Pacific walrus  ---tggttgtta----t-tagcct
                 Weddell seal  ---tggttgtta----t-tagcct
             Black flying-fox  ---cggtcgtt-----t-cggcct
                      Megabat  ---cggtcgtt-----t-cggcct
                Big brown bat  ---tggtcgtg-----t-taccct
         David's myotis (bat)  ---tggtcatt-----t-tagcct
                     Microbat  ---tggtcgtt-----t-tagcct
              Star-nosed mole  ---tggttgtta----t-gagact
                     Elephant  ---tggacgtta----c-ta----
                      Manatee  ---tggttgtta----t-ta----
                     Aardvark  ---tggtcatta----a-tc----
                    Armadillo  ---tggtcatta----t-ta----
                        Mouse  ========================
       Lesser Egyptian jerboa  ========================
                      Gorilla  ------------------------
                     Hedgehog  ========================
                        Shrew  ========================
             Cape golden mole  ========================
                   Coelacanth  ========================
       Spiny softshell turtle  ========================
                X. tropicalis  ========================
                 Atlantic cod  ========================
                  Spotted gar  ========================
                  Stickleback  ========================
           Southern platyfish  ========================
       Yellowbelly pufferfish  ========================
                         Fugu  ========================
                       Turkey  ========================
                      Chicken  ========================
                 Mallard duck  ========================
           Tibetan ground jay  ========================
                  Zebra finch  ========================
       White-throated sparrow  ========================
              Tasmanian devil  ========================
     Mexican tetra (cavefish)  ========================
                       Medaka  ========================
          Pundamilia nyererei  ========================
                  Zebra mbuna  ========================
        Burton's mouthbreeder  ========================
          Princess of Burundi  ========================
                 Nile tilapia  ========================
               Painted turtle  ========================
              Green seaturtle  ========================
           American alligator  ========================
                Scarlet macaw  ========================
                   Budgerigar  ========================
                      Opossum  ========================
                  Rock pigeon  ========================
          Collared flycatcher  ========================
          Medium ground finch  ========================
                       Lizard  ========================
             Peregrine falcon  ========================
                 Saker falcon  ========================
                       Parrot  ========================
          Cape elephant shrew  ========================
                     Platypus  ========================
                      Wallaby  ========================
                       Tenrec  ========================
     Chinese softshell turtle  ========================

Inserts between block 3 and 4 in window
B D                 Elephant 4bp
B D                  Manatee 4bp
                    Aardvark 1bp
B D                Armadillo 4bp

Alignment block 4 of 546 in window, 174958966 - 174959005, 40 bps 
B D                     Human  tatga-ag--cctactactacagattatgcaat---tattact-aga
B D                     Chimp  tatga-ag--cctactactacagattatgcaat---tattact-aga
B D                 Orangutan  tatga-ag--cctactactgcagattatgcaat---tattact-aga
B D                    Gibbon  tatga-ag--cctactactacagattatgcaat---tattact-aga
B D                    Rhesus  tatga-ag--cctactactacaaattatgcaat---tattact-aga
B D       Crab-eating macaque  tatga-ag--cctactactacaaattatgcaat---tattact-aga
B D                    Baboon  tatga-ag--cctactactacaaattatgcaat---tattact-aga
B D              Green monkey  tatga-cg--cctactactacaaattatgcaat---tattact-aga
B D                  Marmoset  tatga-ag--gctactatgacaaattatgcaat---tattact-aga
B D           Squirrel monkey  tatga-ag--gctactacgacaaattatgcagt---tattact-aga
B D                  Bushbaby  tatga-aa--cctcctactatgaattatccaag---ttttact-aga
           Chinese tree shrew  ttcga-agtttttagtaccgtgaactactcaag---tattgct-aaa
B D                  Squirrel  tatga-ag--actactaccacaagttatccaag---aattact-gaa
                 Prairie vole  tttaa-ac--tccattacca---------cagg---catgact-aga
B D           Chinese hamster  tttaa-ac--tctgctagta---------caag---catgacttaga
               Golden hamster  tttaa-ac--tctactacta---------aaag---catgact----
B D                       Rat  tttaa-ag--tctactaccacaaaccattcaag---catgact-aga
B D            Naked mole-rat  tatga-ag--tttactactg--aattatccaag---agttact-ata
B D                Guinea pig  catgg-ag--tttactactg--aattatccaag---aattatt-ata
                   Chinchilla  tatga-ag--tttactactc--agttatctaag---aattatt-aca
             Brush-tailed rat  tacga-ag--tttactac-------------ag-------att-ata
B D                    Rabbit  tatga-ag--cacaccgttaagaattacccaag---aatggct-aga
B D                      Pika  tataa-gg--cataccactaagatttacccgac---aagtgc-----
B D                       Pig  tctta-gg--gccactgcctctaattacctgat---tattact-aga
B D                    Alpaca  tattatgg--cctgctgcctctaattacccacg---tatcaca-gga
               Bactrian camel  tatta-gg--cctgctgcctctaattacccacg---tattaca-gga
B D                   Dolphin  tatta-gg--tccactgcctctaattacccaat---tattact-aga
                 Killer whale  tatta-gg--tccactgcctctaattacccaat---tattact-aga
             Tibetan antelope  tatta-gg--cctgccgcctctaattacccaat---tattact-aga
B D                       Cow  tatta-gg--cctgctgcctctaattacccaat---tattgct-aga
B D                     Sheep  tatta-gg--cctgccgcctctaattacccaat---tattact-aga
                Domestic goat  tatta-gg--cctgccgcctctaattacccaat---tattact-aga
B D                     Horse  tagta-gg--cctactgcctcgaattacccaaa---tattact-aaa
B D          White rhinoceros  tatta-tg---ctactgcctcgaattacccaaa---tattact-aaa
B D                       Cat  cacta-gg--ccaact-cctccaattacccagc---tgtgact-aga
B D                       Dog  tatta-ga--cctactgcctccaagtaccccga---tattact-aaa
B D                   Ferret   tttga-gg--cctgctgcctgccatgacccaggtattattact-aga
B D                     Panda  catta-gg--ccgactgcctgccattacctaggtattattact-aga
               Pacific walrus  tagta-gg--ccaacggcctgcccttacccaggtattattacc-aga
                 Weddell seal  aagta-gg--ccgacagcctgcccttacccaggtattattacc-aga
             Black flying-fox  tgtca-gg--cctcctgcctcatgctacccaca---tgttcct-aga
B D                   Megabat  tgtca-gg--cctcctgcctcatgctacccacg---tgttcct-aga
                Big brown bat  tagta-gg--cctactgcttccacttacccaag---tattact-aga
         David's myotis (bat)  tatta-gg--cctactgcttccacttacccaag---tattaat-aga
B D                  Microbat  tatta-gg--cctattgcttctacttacccaag---tattact-aga
              Star-nosed mole  tccta-gg--cttactgcttt--gttatacgag---tattaca-aga
B D                  Elephant  catca-gg--cctactggtactaattttccaca---cattact-aga
          Cape elephant shrew  tatca-ga--cctagtggtactcatttccccaa---tattact-aga
B D                   Manatee  catca-gg--cctactgatactaattttccaca---cattact-aga
                     Aardvark  tctca-gg--cctactgatactaatttcacaca---tattatt-aga
B D                 Armadillo  tggta-gc--tc------tattacttatccagg---tattact-aga
B D                     Mouse  ===============================================
      Lesser Egyptian jerboa  ===============================================
B D                   Gorilla  -----------------------------------------------
B D                  Hedgehog  ===============================================
B D                     Shrew  ===============================================
            Cape golden mole  ===============================================
B D                Coelacanth  ===============================================
  D    Spiny softshell turtle  ===============================================
B D             X. tropicalis  ===============================================
B D              Atlantic cod  ===============================================
                 Spotted gar  ===============================================
B D               Stickleback  ===============================================
          Southern platyfish  ===============================================
      Yellowbelly pufferfish  ===============================================
B D                      Fugu  ===============================================
B D                    Turkey  ===============================================
B D                   Chicken  ===============================================
  D              Mallard duck  ===============================================
          Tibetan ground jay  ===============================================
B D               Zebra finch  ===============================================
  D    White-throated sparrow  ===============================================
B D           Tasmanian devil  ===============================================
    Mexican tetra (cavefish)  ===============================================
B D                    Medaka  ===============================================
         Pundamilia nyererei  ===============================================
                 Zebra mbuna  ===============================================
       Burton's mouthbreeder  ===============================================
         Princess of Burundi  ===============================================
B D              Nile tilapia  ===============================================
  D            Painted turtle  ===============================================
  D           Green seaturtle  ===============================================
B D        American alligator  ===============================================
  D             Scarlet macaw  ===============================================
B D                Budgerigar  ===============================================
B D                   Opossum  ===============================================
  D               Rock pigeon  ===============================================
  D       Collared flycatcher  ===============================================
B D       Medium ground finch  ===============================================
B D                    Lizard  ===============================================
  D          Peregrine falcon  ===============================================
  D              Saker falcon  ===============================================
  D                    Parrot  ===============================================
B D                  Platypus  ===============================================
B D                   Wallaby  ===============================================
B D                    Tenrec  ===============================================
  D  Chinese softshell turtle  ===============================================

Alignment block 5 of 546 in window, 174959006 - 174959050, 45 bps 
B D                     Human  ataa--tgccacctt-at-gtgggtcttcccctctagt-c--ccttattgat
B D                     Chimp  ataa--tgccacctt-at-gtgggtcttcccctctagt-c--ccttattgat
B D                 Orangutan  ataa--tgccacctt-at-gtgggtcttcccctctagt-c--ccttattgat
B D                    Gibbon  ataa--tgccacctt-at-gtgggtcttcccctctagt-c--ccttattgat
B D                    Rhesus  ataa--tgccaactt-at-gtgggtcttcccgtctagt-c--ccttattgat
B D       Crab-eating macaque  ataa--tgccaactt-at-gtgggtcttcccgtctagt-c--ccttattgat
B D                    Baboon  ataa--tgccaactt-at-gtgggtcttcccctctagt-c--ccttattgat
B D              Green monkey  ataa--tgccaactt-at-gtgggtcttcccctctagt-c--ccttattgat
B D                  Marmoset  ataa--tatcacctt-at-atgggtcttcccctctagt-c--cattgctgac
B D           Squirrel monkey  ataa--taccacctt-at-atgggtcttctcctctagt-c--cattgctgac
B D                  Bushbaby  ataa--tattacttg-at-ttgggtctgtccctccagt-c--cctctttcat
           Chinese tree shrew  ataatctctctcctt-aa-gtgagttt---------gt-c--cttcacggat
B D                  Squirrel  ataa--cataacctc-tc-attggtctgcccctccagt-c--cctcatggat
                 Prairie vole  ataa--tataacttt-gc-ttggacctgcctcttgagt-c--attcactgac
B D           Chinese hamster  ataa--tataaactt-gc-ttggatgtgcatctccag--t--attcactgat
               Golden hamster  -taa--tataaactt-gg-ttggatgtgcatctccag--c--attcactgat
B D                       Rat  atga--tattgcctt-gc-ttgactctggctctccagt-c--ctccacagat
B D            Naked mole-rat  atca--tataaccct-ga-atgggtctaccccttcagt-c--cctcatagac
B D                Guinea pig  atca--tgtaacccc-aa-atgggcctgccctttcggt-c--ccttg--gac
                   Chinchilla  atca--tacaaccct-gt-atgggcctgtgccttcatt-c--cctga----c
             Brush-tailed rat  atcc--tacagccat-ag-acaggcctgccccgttggt-c--cctca--g-a
B D                    Rabbit  atag--tttcagcgt-ct-gtggctctgcgcctgca----------------
B D                      Pika  --------------------aggctctgcccctacagt-c--tgttgatgaa
B D                       Pig  ataa--tatcacctt-at-atgtgtctgacccaccagt-t--ccttgcttat
B D                    Alpaca  acag--catcgcctt-gc-gtgtgtctgccccactggt-tagctctccccgt
               Bactrian camel  acag--cttcgcctt-gc-gtgtgtctgccccactggt-tagctctccccgt
B D                   Dolphin  ataa--tatcacctt-at-ttgtgtctgctccaccagt-c--ccttcattat
                 Killer whale  ataa--tatcacctt-at-ttgtgtctgctccaccagt-c--ccttcattat
             Tibetan antelope  ataa--tatccccttaat-ttgtgtctgccccaccagt-c--cctcacttgc
B D                       Cow  atac--tatccccttaat-ttgtttctgccccaccagt-c--cctcacttat
B D                     Sheep  ataa--tatccccttaat-ttgtgtctgccccaccagt-c--cctcacttat
                Domestic goat  ataa--tatccccttaat-ttgtgtctgccccaccagt-c--cctcacttac
B D                     Horse  ata-----------------------------gccagc-c--cctcgcttat
B D          White rhinoceros  acaa--tatcacctt-at-atgggtctgctctgccagc-c--cctcgcttat
B D                       Cat  gtca--tagcccctt--t-gggggtctgttcctccagt-c--ccccacttcc
B D                       Dog  gtaa--tatcccctc-ac-atgaatctgtactcccagt-c--ccttgcttat
B D                   Ferret   gtaa--catcccccc-ac-gtggatctgttctaccagt-c--ccttgcttat
B D                     Panda  ataa--catcccctc-tc-atgggtctgctccaccagt-c--cctcgcttag
               Pacific walrus  atag--catcccctc-gc-gtggatctgccctaccagtcc--cctcgcttat
                 Weddell seal  ataa--catcccctt-gc-atggatctgctctaccagt-c--cctcgcttat
             Black flying-fox  atga--ta--------at-atg---------cgcccgg-c--ccttgctgac
B D                   Megabat  atga--ta--------aa-atg---------cgcccat-c--ccttgctgac
                Big brown bat  gtag--caccacctt-gt-atg---------catcagt-c--tcttgcagat
         David's myotis (bat)  atag--cactacctt-tt-atg---------catcaat-c--tcttgcagat
B D                  Microbat  atag--caccacctt-tt-atg---------catcagt-c--tcttgcagat
              Star-nosed mole  taat--aatcagttt-at-gtgggtctgtccctcatgt-c--cctta-----
B D                  Elephant  ttat--tatcacctt-at-atgggtctgcccctccagt-c--tgtctttgat
          Cape elephant shrew  atat--cctcacctt-ttaaccagtctatccctccaat-c--tctctttaat
B D                   Manatee  atac--tatcacctt-at-atgggtctgctcctccagt-c--tctctttgat
             Cape golden mole  acac--tgtcacctt-at-atgggtttccccctccaat-t----cctttgat
                     Aardvark  atac--tatcacttt-at-atgggtctttccctccaat-c--cctctttgat
B D                 Armadillo  gtaa--tatcatcgt-gt-aggggtctgcccttccagt-c--cttctttgct
B D                     Mouse  ====================================================
      Lesser Egyptian jerboa  ====================================================
B D                   Gorilla  ----------------------------------------------------
B D                  Hedgehog  ====================================================
B D                     Shrew  ====================================================
B D                Coelacanth  ====================================================
  D    Spiny softshell turtle  ====================================================
B D             X. tropicalis  ====================================================
B D              Atlantic cod  ====================================================
                 Spotted gar  ====================================================
B D               Stickleback  ====================================================
          Southern platyfish  ====================================================
      Yellowbelly pufferfish  ====================================================
B D                      Fugu  ====================================================
B D                    Turkey  ====================================================
B D                   Chicken  ====================================================
  D              Mallard duck  ====================================================
          Tibetan ground jay  ====================================================
B D               Zebra finch  ====================================================
  D    White-throated sparrow  ====================================================
B D           Tasmanian devil  ====================================================
    Mexican tetra (cavefish)  ====================================================
B D                    Medaka  ====================================================
         Pundamilia nyererei  ====================================================
                 Zebra mbuna  ====================================================
       Burton's mouthbreeder  ====================================================
         Princess of Burundi  ====================================================
B D              Nile tilapia  ====================================================
  D            Painted turtle  ====================================================
  D           Green seaturtle  ====================================================
B D        American alligator  ====================================================
  D             Scarlet macaw  ====================================================
B D                Budgerigar  ====================================================
B D                   Opossum  ====================================================
  D               Rock pigeon  ====================================================
  D       Collared flycatcher  ====================================================
B D       Medium ground finch  ====================================================
B D                    Lizard  ====================================================
  D          Peregrine falcon  ====================================================
  D              Saker falcon  ====================================================
  D                    Parrot  ====================================================
B D                  Platypus  ====================================================
B D                   Wallaby  ====================================================
B D                    Tenrec  ====================================================
  D  Chinese softshell turtle  ====================================================

Inserts between block 5 and 6 in window
B D                      Pig 5bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp

Alignment block 6 of 546 in window, 174959051 - 174959053, 3 bps 
B D                     Human  t---gt
B D                     Chimp  t---gt
B D                 Orangutan  t---gt
B D                    Gibbon  t---ga
B D                    Rhesus  t---gt
B D       Crab-eating macaque  t---gt
B D                    Baboon  t---gt
B D              Green monkey  t---gt
B D                  Marmoset  t---gt
B D           Squirrel monkey  t---gc
B D                  Bushbaby  c---at
           Chinese tree shrew  c---tt
B D                  Squirrel  c---tt
                 Prairie vole  c---at
B D           Chinese hamster  c---at
               Golden hamster  c---at
B D                       Rat  c---at
B D            Naked mole-rat  t---at
B D                Guinea pig  t---gt
                   Chinchilla  t---gt
             Brush-tailed rat  t---gt
B D                      Pika  t---tt
B D                    Alpaca  ----ct
               Bactrian camel  ----ct
B D                   Dolphin  ----ct
                 Killer whale  ----ct
             Tibetan antelope  ----ct
B D                       Cow  ----ct
B D                     Sheep  ----ct
                Domestic goat  ----ct
B D                     Horse  t---cc
B D          White rhinoceros  t---cc
B D                       Cat  a---tt
B D                       Dog  t---ct
B D                   Ferret   t---ct
B D                     Panda  t---ct
               Pacific walrus  t---cc
                 Weddell seal  t---ct
             Black flying-fox  t---cc
B D                   Megabat  t---cc
                Big brown bat  t---cc
         David's myotis (bat)  t---cc
B D                  Microbat  t---cc
B D                  Elephant  c---tt
          Cape elephant shrew  c---tt
B D                   Manatee  c---tt
             Cape golden mole  c---tt
                     Aardvark  c---tt
B D                 Armadillo  cttttt
B D                     Mouse  ======
      Lesser Egyptian jerboa  ======
B D                   Gorilla  ------
B D                  Hedgehog  ======
B D                     Shrew  ======
B D                       Pig  ======
B D                    Rabbit  ------
B D                Coelacanth  ======
  D    Spiny softshell turtle  ======
B D             X. tropicalis  ======
B D              Atlantic cod  ======
                 Spotted gar  ======
B D               Stickleback  ======
          Southern platyfish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D                    Tenrec  ======
  D  Chinese softshell turtle  ======
             Star-nosed mole  ------

Inserts between block 6 and 7 in window
B D                   Alpaca 3bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp

Alignment block 7 of 546 in window, 174959054 - 174959066, 13 bps 
B D                     Human  --tct-----------t--atttctctc
B D                     Chimp  --tct-----------t--atttctctc
B D                 Orangutan  --tct-----------t--atttctctc
B D                    Gibbon  --tct-----------t--atttctctc
B D                    Rhesus  --tct-----------c--ctttctctc
B D       Crab-eating macaque  --tct-----------c--ctttctctc
B D                    Baboon  --tct-----------c--atttctctc
B D              Green monkey  --tct-----------c--atttctctc
B D                  Marmoset  --tct-----------c--agttctttc
B D           Squirrel monkey  --tct-----------c--agttctttc
B D                  Bushbaby  --cct-----------catatttctccc
           Chinese tree shrew  --cct-----------catatttctccc
B D                  Squirrel  --cctc----------t--gtttctccc
                 Prairie vole  --cttca---------t--attttgtat
B D           Chinese hamster  --cttcc---------t--attttaggt
               Golden hamster  --cttca---------t--attttacaa
B D                       Rat  --gttca---------t--gttct-cag
B D            Naked mole-rat  --ccttg---------t--atttctctt
B D                Guinea pig  --cctct---------t--ttttctcct
                   Chinchilla  --cctca---------t--atttctcct
             Brush-tailed rat  --cttca---------c--atttctcct
B D                    Rabbit  --ccttgcac------t--ggtcctcct
B D                      Pika  --ccttgtatttcttat--atttctcct
B D                       Pig  --tcc-----------t--attttttcc
B D                    Alpaca  --tcc-----------t--ggttctccc
               Bactrian camel  --tcc-----------t--gtttctccc
B D                   Dolphin  --tcc-----------t--atttctctc
                 Killer whale  --tcc-----------t--atttctctc
             Tibetan antelope  --tcc-----------t--aattctccc
B D                       Cow  --tcc-----------t--aattctccc
B D                     Sheep  --tcc-----------t--aattctccc
                Domestic goat  --tcc-----------t--aattctccc
B D                     Horse  --tta-----------t--atttctccc
B D          White rhinoceros  --tca-----------t--atttctccc
B D                       Cat  --tca-----------c--atttctccc
B D                       Dog  --cca-----------t--atatctccc
B D                   Ferret   ----------------c--atttctccc
B D                     Panda  --ttg-----------c--atttctccc
               Pacific walrus  --tca-----------c--atttctccc
                 Weddell seal  --tca-----------c--atttctccc
             Black flying-fox  --tct-----------g--atttctcct
B D                   Megabat  --tct-----------g--atttctcct
                Big brown bat  --tca-----------t--atttcttcc
         David's myotis (bat)  --tca-----------t--atttcttcc
B D                  Microbat  --tca-----------t--atttcttcc
              Star-nosed mole  ----c-----------a--atccttccc
B D                  Elephant  cctca-----------t--atttctc--
          Cape elephant shrew  cttca-----------t--attttcc--
B D                   Manatee  cctca-----------t--atttctc--
             Cape golden mole  cctca-----------a--gtat-----
                     Aardvark  cctca-----------t--atagctc--
B D                 Armadillo  cctca-----------t--atttttc--
B D                     Mouse  ============================
      Lesser Egyptian jerboa  ============================
B D                   Gorilla  ----------------------------
B D                  Hedgehog  ============================
B D                     Shrew  ============================
B D                Coelacanth  ============================
  D    Spiny softshell turtle  ============================
B D             X. tropicalis  ============================
B D              Atlantic cod  ============================
                 Spotted gar  ============================
B D               Stickleback  ============================
          Southern platyfish  ============================
      Yellowbelly pufferfish  ============================
B D                      Fugu  ============================
B D                    Turkey  ============================
B D                   Chicken  ============================
  D              Mallard duck  ============================
          Tibetan ground jay  ============================
B D               Zebra finch  ============================
  D    White-throated sparrow  ============================
B D           Tasmanian devil  ============================
    Mexican tetra (cavefish)  ============================
B D                    Medaka  ============================
         Pundamilia nyererei  ============================
                 Zebra mbuna  ============================
       Burton's mouthbreeder  ============================
         Princess of Burundi  ============================
B D              Nile tilapia  ============================
  D            Painted turtle  ============================
  D           Green seaturtle  ============================
B D        American alligator  ============================
  D             Scarlet macaw  ============================
B D                Budgerigar  ============================
B D                   Opossum  ============================
  D               Rock pigeon  ============================
  D       Collared flycatcher  ============================
B D       Medium ground finch  ============================
B D                    Lizard  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D                    Parrot  ============================
B D                  Platypus  ============================
B D                   Wallaby  ============================
B D                    Tenrec  ============================
  D  Chinese softshell turtle  ============================

Inserts between block 7 and 8 in window
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 2bp
            Cape golden mole 356bp
                    Aardvark 652bp
B D                Armadillo 1bp

Alignment block 8 of 546 in window, 174959067 - 174959111, 45 bps 
B D                     Human  aagt---attgcc-aac---------caat-a---a------------------t-ctcccc-ttgctta
B D                     Chimp  aagt---attgcc-aac---------caat-a---a------------------t-ctcccc-ttgctta
B D                 Orangutan  aagt---actgcc-aac---------caat-a---a------------------t-ctcccc-ttgctta
B D                    Gibbon  aagt---attgcc-aac---------caat-a---a------------------t-ctcccc-ttgctta
B D                    Rhesus  aagt---gttacc-aac---------taat-a---a------------------t-ctcccc-ttgctta
B D       Crab-eating macaque  aagt---gttgcc-aac---------taat-a---a------------------t-ctcccc-ttgctta
B D                    Baboon  aagt---attgcc-aac---------taat-a---a------------------t-ctcccc-ttgctta
B D              Green monkey  aagt---attgcc-aac---------taat-a---a------------------t-ct-ccc-ttgctta
B D                  Marmoset  aagt---attgct-aac---------tagt-a---c------------------t-cacccc-ttgctta
B D           Squirrel monkey  aagt---attgct-aat---------caat-a---c------------------t-ctcccc-ttgcttt
B D                  Bushbaby  aagt---attgct-acc---------cagc-g---g------------------t-ctcctc-ttgttta
           Chinese tree shrew  aaac---agtgct-act---------cagt-a---gttgaca-acagta-tattt-ctcccc-ttgttta
B D                  Squirrel  aggt---attgct-actgaataacc-tacc-a---c----cagtcagta-tgctt-ctcccc-ttgctta
                 Prairie vole  aact---attact-accctatagtcttatc-g---t----cagtcagta-tatta-ttttca-tt-cctc
B D           Chinese hamster  aact---gttact-accctatagttatatc-a---t----cagtcggta-tattt-cttctc-tc-cctc
               Golden hamster  aact---actact-acccgatagtcatatc-a---t----cagttagta-tattt-ctttcc-tt-cctc
B D                       Rat  aacc---attact-gccctatgatcttatcaa---t----ca-----ta-tattt-ctttcc-ct-tctg
B D            Naked mole-rat  aagt---attgtt-attcaatcatc-tcat-t---t----tagacagta-tgttt-ctcctc-ttgatta
B D                Guinea pig  aagt---actgtt-ccctgatcatc-tgac-a---t----tagtcagta-tgttt-cctctc-ttgttta
                   Chinchilla  gagt---attgtt-acttaatcctc-taac-atttt----tagtcaata-tgttt-cttctc-ctgttta
             Brush-tailed rat  aaat---attatt-acctcatcatc-taac-a---t----tagtcagtg-tttttcctcctc-ttgttta
B D                    Rabbit  --------ctgca-actcagcagtc-cacc-a---t----ca--------tgtgt-gtcccc-atgtgca
B D                      Pika  gagt---atggca-actgaatactc-cagc-a---t----ca------t-tgttt-atccct-ttgtgta
B D                       Pig  aagt---attgtt-gcctgataatc-taac-a---t--------cagta-tgttt-ctcctc-ttgttta
B D                    Alpaca  aagt---attgct-gcccaataatc-taac-a---t--------cagta-agttt-ctcccc-ttgttta
               Bactrian camel  aagt---attgct-gcccaataatc-taac-a---t--------cagta-agttt-ctcccc-ttgttta
B D                   Dolphin  aagt---attgct-acc-agtaatc-taac-a---t--------cagtg-tgtta-ctgccc-ttgttta
                 Killer whale  aagt---attgct-acctaataatc-taac-a---t--------cagtg-tgtta-ctgccc-ttgttta
             Tibetan antelope  aagt---attgct-acctaataatt-gaac-g---t--------ctgta-tgttt-ctccct-ttgttta
B D                       Cow  aagt---attgttaacctaataatc-taac-a---t--------ctgta-tgttt-ttccct-ttgttta
B D                     Sheep  aagt---attgtt-acctaataatc-gaac-g---t--------ctgta-tgttt-ttccct-ttgttta
                Domestic goat  aagt---attgtt-acctaataatc-gaat-g---t--------ctgta-tgttt-ctccct-ttgttta
B D                     Horse  aagt---attgct-acccaataatc-tgac-a---t--------cagtc-tgttt-ctcttc-ttattta
B D          White rhinoceros  aagt---attgct-atccggtaaac-tgac-a---t--------cagta-tgttt-ctcccc-ttgttta
B D                       Cat  aagtagtattgct-accccataacc-tga---------------------cgttt-ctctcc-ttgtttc
B D                       Dog  aagc---attgct-tcccgataatc-cgac-a---t--------cagta-tgttt-ctccct-gtgttta
B D                   Ferret   aagg---gttgct-cctcagtagcc-tgac-a---g--------caata-tgcct-ctccgc-ttatttc
B D                     Panda  aagg---attgct-ccccaggggtc-tgac-a---g--------cagcagtgttt-ctcccc-ttgctta
               Pacific walrus  aagg----ttgct-ccccagcagcc-tgac-a---g--------cagta-tgttt-ctcccc-ttgttta
                 Weddell seal  aagg----ttgct-ccccagtagac-tgac-a---g--------cagta-tgttt-ctcccc-ttgttta
             Black flying-fox  acgt---cttgct-gtccaataatc-caac-a---t--------cagtg-tgttg-attctc-tcgttta
B D                   Megabat  acgt---cttgct-gtccaataatc-caac-a---t--------cagta-tgttg-attctc-tcgttta
                Big brown bat  aggc---attgct-agccaataatc-taat-a---t--------cagcg-tgttt-tccctc-ttgttca
         David's myotis (bat)  aggc---attgct-agccaataatc-gaat-a---t--------cagca-tgttt-tccctc-ttgttca
B D                  Microbat  gggc---attgct-agccaataatc-gaat-a---t--------gagca-tgttt-tccttc-ttgttca
              Star-nosed mole  ttac---attgcc-accc---aatc-caac-a---t--------c-----tgtta-cagaac-ttgttt-
B D                  Elephant  aact---attgct-gcctaat-atc-tcac-a---t--------cagta-tgttt-ctctgc-ttgcata
          Cape elephant shrew  agct---tacact-gccta---atc-tcac-a---t--------cagtg-tgttt-cactcctttgctta
B D                   Manatee  aact---attgct-gcctaac-atc-tcac-a---t--------cagta-tgttt-ctctcc-ttgcata
B D                 Armadillo  agct---attgtt-accca---------gt-a---t--------caata-ttttt-tttctc-ttgctta
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                   Gorilla  ----------------------------------------------------------------------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  tagaagtgg-ttc
                        Chimp  tagaagtgg-ttc
                    Orangutan  tagaagtgg-ttc
                       Gibbon  tagaagtgg-ttc
                       Rhesus  tagaagtgg-ttc
          Crab-eating macaque  tagaagtgg-ttc
                       Baboon  tagaagtgg-ttc
                 Green monkey  taaaagtgg-ttc
                     Marmoset  cagaagtgg-ttt
              Squirrel monkey  cagaagtgg-ttc
                     Bushbaby  taggactgc-ctc
           Chinese tree shrew  tagaactgg-ctc
                     Squirrel  tagaactgg-ctc
                 Prairie vole  tagaactgg-ctt
              Chinese hamster  tagaactgg-ctt
               Golden hamster  tagaactgg-ctt
                          Rat  tagacctgg-ctt
               Naked mole-rat  tagaacagg-ctt
                   Guinea pig  cagaacagg-ctt
                   Chinchilla  tagaaaagg-ctt
             Brush-tailed rat  aagaacagg-cct
                       Rabbit  gagcactgg-ctg
                         Pika  tattactgg-ctg
                          Pig  taaaagtag----
                       Alpaca  taaaactgg----
               Bactrian camel  taaaactgg----
                      Dolphin  taaaaccag----
                 Killer whale  taaaaccag----
             Tibetan antelope  taaaactag----
                          Cow  taaaactgg----
                        Sheep  taaaactag----
                Domestic goat  taaaactag----
                        Horse  tagctctag-cta
             White rhinoceros  tagaactggcctg
                          Cat  tcgaactgg-cta
                          Dog  tagaactgg-cta
                      Ferret   tagaatggg-cga
                        Panda  cagaactgg-cta
               Pacific walrus  tagaacggg-gta
                 Weddell seal  taaaacagg-gta
             Black flying-fox  tagaactgg-cta
                      Megabat  tagaactgg-cta
                Big brown bat  tagaactgg-ctg
         David's myotis (bat)  tagaactgg-ctg
                     Microbat  tagaactgg-ctg
              Star-nosed mole  -------------
                     Elephant  cagagcgga-gtc
          Cape elephant shrew  tagagctga-gtc
                      Manatee  tagagct------
                    Armadillo  taaaactgg-atc
                        Mouse  =============
       Lesser Egyptian jerboa  =============
                      Gorilla  -------------
                     Hedgehog  =============
                        Shrew  =============
             Cape golden mole  =============
                     Aardvark  =============
                   Coelacanth  =============
       Spiny softshell turtle  =============
                X. tropicalis  =============
                 Atlantic cod  =============
                  Spotted gar  =============
                  Stickleback  =============
           Southern platyfish  =============
       Yellowbelly pufferfish  =============
                         Fugu  =============
                       Turkey  =============
                      Chicken  =============
                 Mallard duck  =============
           Tibetan ground jay  =============
                  Zebra finch  =============
       White-throated sparrow  =============
              Tasmanian devil  =============
     Mexican tetra (cavefish)  =============
                       Medaka  =============
          Pundamilia nyererei  =============
                  Zebra mbuna  =============
        Burton's mouthbreeder  =============
          Princess of Burundi  =============
                 Nile tilapia  =============
               Painted turtle  =============
              Green seaturtle  =============
           American alligator  =============
                Scarlet macaw  =============
                   Budgerigar  =============
                      Opossum  =============
                  Rock pigeon  =============
          Collared flycatcher  =============
          Medium ground finch  =============
                       Lizard  =============
             Peregrine falcon  =============
                 Saker falcon  =============
                       Parrot  =============
                     Platypus  =============
                      Wallaby  =============
                       Tenrec  =============
     Chinese softshell turtle  =============

Inserts between block 8 and 9 in window
              Pacific walrus 209bp
             Star-nosed mole 1bp
         Cape elephant shrew 4bp

Alignment block 9 of 546 in window, 174959112 - 174959114, 3 bps 
B D                     Human  aag
B D                     Chimp  aag
B D                 Orangutan  aat
B D                    Gibbon  aag
B D                    Rhesus  aag
B D       Crab-eating macaque  aag
B D                    Baboon  aag
B D              Green monkey  aag
B D                  Marmoset  aag
B D           Squirrel monkey  aag
B D                  Bushbaby  aag
           Chinese tree shrew  aag
B D                  Squirrel  agg
                 Prairie vole  gag
B D           Chinese hamster  gag
               Golden hamster  gag
B D                       Rat  gag
B D            Naked mole-rat  aag
B D                Guinea pig  aag
                   Chinchilla  aag
             Brush-tailed rat  gag
B D                    Rabbit  aag
B D                      Pika  acg
B D                     Horse  aag
B D          White rhinoceros  aag
B D                       Cat  cag
B D                       Dog  aag
B D                   Ferret   aag
B D                     Panda  aag
               Pacific walrus  aaa
                 Weddell seal  aag
             Black flying-fox  cag
B D                   Megabat  cag
                Big brown bat  cag
         David's myotis (bat)  cag
B D                  Microbat  cag
              Star-nosed mole  tag
B D                  Elephant  aag
          Cape elephant shrew  aag
B D                   Manatee  aag
B D                 Armadillo  aag
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D                   Gorilla  ---
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                       Pig  ---
            Cape golden mole  ===
                    Aardvark  ===
B D                Coelacanth  ===
  D    Spiny softshell turtle  ===
B D                   Dolphin  ---
B D             X. tropicalis  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
B D                  Platypus  ===
B D                   Wallaby  ===
B D                    Tenrec  ===
  D  Chinese softshell turtle  ===
               Domestic goat  ---
B D                     Sheep  ---
            Tibetan antelope  ---
              Bactrian camel  ---
B D                    Alpaca  ---
                Killer whale  ---
B D                       Cow  ---

Inserts between block 9 and 10 in window
                Weddell seal 1300bp

Alignment block 10 of 546 in window, 174959115 - 174959120, 6 bps 
B D                     Human  atctga
B D                     Chimp  atctga
B D                 Orangutan  atatga
B D                    Gibbon  atctga
B D                    Rhesus  atctga
B D       Crab-eating macaque  atctga
B D                    Baboon  atctga
B D              Green monkey  atctga
B D                  Marmoset  atctga
B D           Squirrel monkey  atctga
B D                  Bushbaby  aactga
           Chinese tree shrew  aagtga
B D                  Squirrel  aactgc
                 Prairie vole  aaatga
B D           Chinese hamster  aaatga
               Golden hamster  aaatga
B D                       Rat  aaatga
B D            Naked mole-rat  aactga
B D                Guinea pig  aactga
                   Chinchilla  aactga
             Brush-tailed rat  aactgc
B D                    Rabbit  agccaa
B D                      Pika  aatgaa
B D                       Pig  --ctga
B D                    Alpaca  --ctga
               Bactrian camel  --ctga
B D                   Dolphin  --ctga
                 Killer whale  --ctga
             Tibetan antelope  --ctga
B D                       Cow  --ctga
B D                     Sheep  --ctga
                Domestic goat  --ctga
B D                     Horse  aactga
B D          White rhinoceros  aactga
B D                       Cat  gagtga
B D                       Dog  gactga
B D                   Ferret   aactga
B D                     Panda  aactgg
               Pacific walrus  aactga
                 Weddell seal  aactga
             Black flying-fox  aactgg
B D                   Megabat  aactgg
                Big brown bat  aactga
         David's myotis (bat)  aactga
B D                  Microbat  aactga
              Star-nosed mole  aactga
B D                  Elephant  aactga
          Cape elephant shrew  aaatga
B D                   Manatee  agctga
B D                 Armadillo  aactga
B D                     Mouse  ======
      Lesser Egyptian jerboa  ======
B D                   Gorilla  ------
B D                  Hedgehog  ======
B D                     Shrew  ======
            Cape golden mole  ======
                    Aardvark  ======
B D                Coelacanth  ======
  D    Spiny softshell turtle  ======
B D             X. tropicalis  ======
B D              Atlantic cod  ======
                 Spotted gar  ======
B D               Stickleback  ======
          Southern platyfish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D                    Tenrec  ======
  D  Chinese softshell turtle  ======

Inserts between block 10 and 11 in window
B D                 Bushbaby 287bp

Alignment block 11 of 546 in window, 174959121 - 174959135, 15 bps 
B D                     Human  ttataaaa-tcccaca
B D                     Chimp  ttataaaa-tcccaca
B D                 Orangutan  ttataaaa-tcccaca
B D                    Gibbon  ttataaaa-tcctaca
B D                    Rhesus  tgataaaa-tcccaca
B D       Crab-eating macaque  tgataaaa-tcccaca
B D                    Baboon  tgataaaa-tcccaca
B D              Green monkey  tgataaaa-tcccaca
B D                  Marmoset  tgataaaa-tcccaca
B D           Squirrel monkey  tgataaaa-tcccaca
B D                  Bushbaby  tgataaaa-tcccacc
           Chinese tree shrew  tcataaaa-tgccaca
B D                  Squirrel  gaataaaa-tcccaca
                 Prairie vole  aaat--aa-ttccaca
B D           Chinese hamster  aaat--aa-ttccaca
               Golden hamster  aaac--ga-ttctaca
B D                       Rat  aaat--ac-ctccaca
B D            Naked mole-rat  taataaaa-tcct-tg
B D                Guinea pig  taataaaa-tcctcta
                   Chinchilla  taataaaa-tcctatg
             Brush-tailed rat  taataaaa-tgctatc
B D                    Rabbit  ggacagag-tcccacg
B D                      Pika  taataaaa-ttctgca
B D                       Pig  taataaaa-tcccaca
B D                    Alpaca  taataaaa-tcccaca
               Bactrian camel  taataaaa-tcccaca
B D                   Dolphin  taataaaa-tcccaca
                 Killer whale  taataaaa-tcccaca
             Tibetan antelope  cagtagaa-tcccac-
B D                       Cow  cagtagaa-tcccac-
B D                     Sheep  cagtagaa-tcccac-
                Domestic goat  cagtagaa-tcccac-
B D                     Horse  taataaaa-ccccaca
B D          White rhinoceros  tgataaaa-tcccaca
B D                       Cat  tgataagattcccccg
B D                       Dog  cagtaaga-tcccaca
B D                   Ferret   taacaaga-gcccatg
B D                     Panda  taagaaga-gcccacg
               Pacific walrus  gaagaaga-gcccatg
                 Weddell seal  gaagaaga-gcccatg
             Black flying-fox  cgataaaa-tctcacc
B D                   Megabat  cgatacaa-tctcacc
                Big brown bat  tagtggag-tcccaca
         David's myotis (bat)  tagtggag-tcccaca
B D                  Microbat  tagtggag-tcccaca
              Star-nosed mole  cttgaaaa--------
B D                  Elephant  taatgaaa-tcccata
          Cape elephant shrew  tgataaaa-ccccaca
B D                   Manatee  taataaaa-tcccgca
B D                 Armadillo  taacatca-tcacata
B D                     Mouse  ================
      Lesser Egyptian jerboa  ================
B D                   Gorilla  ----------------
B D                  Hedgehog  ================
B D                     Shrew  ================
            Cape golden mole  ================
                    Aardvark  ================
B D                Coelacanth  ================
  D    Spiny softshell turtle  ================
B D             X. tropicalis  ================
B D              Atlantic cod  ================
                 Spotted gar  ================
B D               Stickleback  ================
          Southern platyfish  ================
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
  D    White-throated sparrow  ================
B D           Tasmanian devil  ================
    Mexican tetra (cavefish)  ================
B D                    Medaka  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D        American alligator  ================
  D             Scarlet macaw  ================
B D                Budgerigar  ================
B D                   Opossum  ================
  D               Rock pigeon  ================
  D       Collared flycatcher  ================
B D       Medium ground finch  ================
B D                    Lizard  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D                    Parrot  ================
B D                  Platypus  ================
B D                   Wallaby  ================
B D                    Tenrec  ================
  D  Chinese softshell turtle  ================

Alignment block 12 of 546 in window, 174959136 - 174959137, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D              Green monkey  ta
B D                  Marmoset  ta
B D           Squirrel monkey  ta
B D                  Bushbaby  tt
           Chinese tree shrew  ta
B D                  Squirrel  ta
                 Prairie vole  ta
B D           Chinese hamster  ta
               Golden hamster  ta
B D                       Rat  ta
B D            Naked mole-rat  aa
B D                Guinea pig  ag
                   Chinchilla  aa
             Brush-tailed rat  aa
B D                    Rabbit  ca
B D                      Pika  ca
B D                       Pig  ta
B D                    Alpaca  ta
               Bactrian camel  ta
B D                   Dolphin  ta
                 Killer whale  ta
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  ta
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  tg
B D                   Megabat  tg
                Big brown bat  ta
         David's myotis (bat)  ta
B D                  Microbat  ta
B D                  Elephant  ta
          Cape elephant shrew  ta
B D                   Manatee  ta
                     Aardvark  ta
B D                 Armadillo  ta
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                   Gorilla  --
B D                  Hedgehog  ==
B D                     Shrew  ==
            Cape golden mole  ==
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
B D             X. tropicalis  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                  Platypus  ==
B D                   Wallaby  ==
B D                    Tenrec  ==
  D  Chinese softshell turtle  ==
             Star-nosed mole  --
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
B D                       Cow  --

Alignment block 13 of 546 in window, 174959138 - 174959142, 5 bps 
B D                     Human  ct--tct
B D                     Chimp  ct--tct
B D                 Orangutan  ct--tct
B D                    Gibbon  ct--tct
B D                    Rhesus  cttctct
B D       Crab-eating macaque  cttctct
B D                    Baboon  ct--tct
B D              Green monkey  ct--tct
B D                  Marmoset  ct--gct
B D           Squirrel monkey  ct--gct
B D                  Bushbaby  ct--gct
           Chinese tree shrew  tt--gct
B D                  Squirrel  ga--gct
                 Prairie vole  tg--gtt
B D           Chinese hamster  tg--gtt
               Golden hamster  tg--gtt
B D                       Rat  tg--gtt
B D            Naked mole-rat  ta--gct
B D                Guinea pig  ta--gct
                   Chinchilla  ta--gct
             Brush-tailed rat  ta--cat
B D                    Rabbit  ct--gct
B D                      Pika  ct--gtt
B D                       Pig  tt--gct
B D                    Alpaca  ct--gca
               Bactrian camel  ct--gca
B D                   Dolphin  tt--gct
                 Killer whale  tt--gct
             Tibetan antelope  -t--gct
B D                       Cow  -t--gct
B D                     Sheep  -t--gct
                Domestic goat  -t--gct
B D                     Horse  ct--gtc
B D          White rhinoceros  ct--gct
B D                       Cat  ct--gct
B D                       Dog  ct--gct
B D                   Ferret   ct--gct
B D                     Panda  ct--gct
               Pacific walrus  ct--gct
                 Weddell seal  ct--gct
             Black flying-fox  ct--gct
B D                   Megabat  ct--gct
                Big brown bat  ct--gct
         David's myotis (bat)  ct--gct
B D                  Microbat  ct--gct
              Star-nosed mole  ct--gct
B D                  Elephant  ct--gcc
          Cape elephant shrew  ct--gcg
B D                   Manatee  ct--gcc
             Cape golden mole  ct--gcc
                     Aardvark  ct--gac
B D                 Armadillo  ct--gcc
B D                     Mouse  =======
      Lesser Egyptian jerboa  =======
B D                   Gorilla  -------
B D                  Hedgehog  =======
B D                     Shrew  =======
B D                Coelacanth  =======
  D    Spiny softshell turtle  =======
B D             X. tropicalis  =======
B D              Atlantic cod  =======
                 Spotted gar  =======
B D               Stickleback  =======
          Southern platyfish  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                    Turkey  =======
B D                   Chicken  =======
  D              Mallard duck  =======
          Tibetan ground jay  =======
B D               Zebra finch  =======
  D    White-throated sparrow  =======
B D           Tasmanian devil  =======
    Mexican tetra (cavefish)  =======
B D                    Medaka  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
  D            Painted turtle  =======
  D           Green seaturtle  =======
B D        American alligator  =======
  D             Scarlet macaw  =======
B D                Budgerigar  =======
B D                   Opossum  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D       Medium ground finch  =======
B D                    Lizard  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D                    Parrot  =======
B D                  Platypus  =======
B D                   Wallaby  =======
B D                    Tenrec  =======
  D  Chinese softshell turtle  =======

Inserts between block 13 and 14 in window
B D                 Elephant 212bp

Alignment block 14 of 546 in window, 174959143 - 174959148, 6 bps 
B D                     Human  atagca
B D                     Chimp  atagca
B D                 Orangutan  atagca
B D                    Gibbon  atagca
B D                    Rhesus  atagca
B D       Crab-eating macaque  atagca
B D                    Baboon  atagca
B D              Green monkey  atagca
B D                  Marmoset  atagca
B D           Squirrel monkey  atagaa
B D                  Bushbaby  attgta
           Chinese tree shrew  atagta
B D                  Squirrel  acgaca
                 Prairie vole  atgata
B D           Chinese hamster  atgata
               Golden hamster  atgata
B D                       Rat  atgatc
B D            Naked mole-rat  gtgaca
B D                Guinea pig  atggta
                   Chinchilla  ttggta
             Brush-tailed rat  tcggta
B D                    Rabbit  gtgggg
B D                      Pika  gtggta
B D                       Pig  atgtca
B D                    Alpaca  atggca
               Bactrian camel  atggca
B D                   Dolphin  gtggca
                 Killer whale  atggca
             Tibetan antelope  at-gca
B D                       Cow  at-gca
B D                     Sheep  at-gca
                Domestic goat  at-gca
B D                     Horse  agggta
B D          White rhinoceros  agggta
B D                       Cat  gtggca
B D                       Dog  gtggta
B D                   Ferret   ctggta
B D                     Panda  ctggta
               Pacific walrus  cgggta
                 Weddell seal  cgggta
             Black flying-fox  ctggca
B D                   Megabat  ctggca
                Big brown bat  ctggta
         David's myotis (bat)  ctggta
B D                  Microbat  ctgata
              Star-nosed mole  gtgctt
B D                  Elephant  atggta
          Cape elephant shrew  atagga
B D                   Manatee  atggta
             Cape golden mole  atggta
                     Aardvark  atgata
B D                 Armadillo  atggta
B D                     Mouse  ======
      Lesser Egyptian jerboa  ======
B D                   Gorilla  ------
B D                  Hedgehog  ======
B D                     Shrew  ======
B D                Coelacanth  ======
  D    Spiny softshell turtle  ======
B D             X. tropicalis  ======
B D              Atlantic cod  ======
                 Spotted gar  ======
B D               Stickleback  ======
          Southern platyfish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                  Platypus  ======
B D                   Wallaby  ======
B D                    Tenrec  ======
  D  Chinese softshell turtle  ======

Inserts between block 14 and 15 in window
B D                  Manatee 212bp

Alignment block 15 of 546 in window, 174959149 - 174959149, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                       Pig  a
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
              Star-nosed mole  g
B D                  Elephant  g
          Cape elephant shrew  a
B D                   Manatee  g
             Cape golden mole  g
                     Aardvark  a
B D                 Armadillo  g
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                   Gorilla  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                  Platypus  =
B D                   Wallaby  =
B D                    Tenrec  =
  D  Chinese softshell turtle  =

Inserts between block 15 and 16 in window
         Cape elephant shrew 208bp

Alignment block 16 of 546 in window, 174959150 - 174959162, 13 bps 
B D                     Human  ataac----ta-t------ta------------------------------aca
B D                     Chimp  ataac----ta-t------ta------------------------------aca
B D                 Orangutan  ataac----ta-t------ta------------------------------aca
B D                    Gibbon  ataactattta-t------ta------------------------------aca
B D                    Rhesus  gtaac----ta-t------taacagataagg---------------tgtttaca
B D       Crab-eating macaque  gtaac----ta-t------taacagataagg---------------tgtttaca
B D                    Baboon  gtaac----ta-t------taacagataagg---------------tgtttaca
B D              Green monkey  gtaac----ta-t------taacagataagg---------------tgtttaca
B D                  Marmoset  ataac----ta-t------aa--cagtaagg---------------tgttaata
B D           Squirrel monkey  ataac----ta-t------aa--cagtaagg---------------tgttaata
B D                  Bushbaby  ataac----tg-t------taaccagtacag---------------tgccaaaa
           Chinese tree shrew  ctgac----cg-t------tcacagataaag---------------tgctcata
B D                  Squirrel  ataac----ta-c------caccagataagagctaaagctacttcctaccacca
                 Prairie vole  ataac----ta-t------taccagattatg---------------tgcttata
B D           Chinese hamster  ataat----tctt------taccaga----------------------------
               Golden hamster  ataac----tc-t------tgccagattata---------------tgctcata
B D                       Rat  atgac----ta-t------ttccagattatg----------------gctcata
B D            Naked mole-rat  acaac----ta-t------tagcaggtaaga---------------tgcccat-
B D                Guinea pig  acaac----tt-c------tagcaggtcagg---------------tgctcgt-
                   Chinchilla  acagc----ta-t------gagc-----agg---------------tgctc---
             Brush-tailed rat  acaac----ta-t------tagcaggtaagg---------------tgctcgt-
B D                    Rabbit  acact----ta-cacata-gaacagagagcg---------------tgctcaca
B D                      Pika  ataat----ta-cacatatgaacagaaagta---------------tgctatca
B D                       Pig  gtaac----ca-t------tatcatataaga---------------tgctcaca
B D                    Alpaca  gtaac----ta-t------taccctataagg---------------tgctcgga
               Bactrian camel  gtaac----ta-t------taccctataagg---------------tgctcgta
B D                   Dolphin  ataac----ta-t------taccatataagg---------------tgctcata
                 Killer whale  ataac----tg-t------taccatataagg---------------tgctcata
             Tibetan antelope  ataac----ta-t------taccatatgaag---------------tactcct-
B D                       Cow  --aac----tg-t------taccatataaag---------------tactcat-
B D                     Sheep  ataac----tg-t------taccatatgaag---------------tactcct-
                Domestic goat  ataac----tg-t------taccatatgaag---------------tactcct-
B D                     Horse  ataac----ta-t------taacacat-agg---------------cgctcata
B D          White rhinoceros  ataac----tg-t------taacacataagg---------------tgctcgca
B D                       Cat  ataac----tg-t------taacgcttaagg---------------tgctcaca
B D                       Dog  gtaac-----a-t------taacccataaac---------------tactcaca
B D                   Ferret   atccc----ta-c------taacccgcaagg---------------cactcaca
B D                     Panda  atacc----ta-t------taacccacaaga---------------tgctcaca
               Pacific walrus  atacc----ta-t------taacccacaagg---------------cactcaca
                 Weddell seal  atacc----ta-t------taacccacaagg---------------gactcaca
             Black flying-fox  ataac----gt--------taacacataagg---------------tgctcgta
B D                   Megabat  ataac----g---------taacacgtaagg---------------tgctggta
                Big brown bat  agaac----tg--------caacacacacgg---------------tgctcctg
         David's myotis (bat)  agaac----tg--------ta--acacaggg---------------tgctcctg
B D                  Microbat  agaac----tg--------ta--acacaagg---------------tgctcctg
              Star-nosed mole  gtaac----tg-t------taacacataaag---------------agttcata
B D                  Elephant  gtaac----ta-t------tgata------------------------------
          Cape elephant shrew  atagc----tc-t------taata------------------------------
B D                   Manatee  ataac----ta-t------tgata------------------------------
             Cape golden mole  atagc----ta-t------taata------------------------------
                     Aardvark  ataac----ta-t------tacta------------------------------
B D                 Armadillo  gtaac----ta-t------taaca------------------------------
B D                     Mouse  ======================================================
      Lesser Egyptian jerboa  ======================================================
B D                   Gorilla  ------------------------------------------------------
B D                  Hedgehog  ======================================================
B D                     Shrew  ======================================================
B D                Coelacanth  ======================================================
  D    Spiny softshell turtle  ======================================================
B D             X. tropicalis  ======================================================
B D              Atlantic cod  ======================================================
                 Spotted gar  ======================================================
B D               Stickleback  ======================================================
          Southern platyfish  ======================================================
      Yellowbelly pufferfish  ======================================================
B D                      Fugu  ======================================================
B D                    Turkey  ======================================================
B D                   Chicken  ======================================================
  D              Mallard duck  ======================================================
          Tibetan ground jay  ======================================================
B D               Zebra finch  ======================================================
  D    White-throated sparrow  ======================================================
B D           Tasmanian devil  ======================================================
    Mexican tetra (cavefish)  ======================================================
B D                    Medaka  ======================================================
         Pundamilia nyererei  ======================================================
                 Zebra mbuna  ======================================================
       Burton's mouthbreeder  ======================================================
         Princess of Burundi  ======================================================
B D              Nile tilapia  ======================================================
  D            Painted turtle  ======================================================
  D           Green seaturtle  ======================================================
B D        American alligator  ======================================================
  D             Scarlet macaw  ======================================================
B D                Budgerigar  ======================================================
B D                   Opossum  ======================================================
  D               Rock pigeon  ======================================================
  D       Collared flycatcher  ======================================================
B D       Medium ground finch  ======================================================
B D                    Lizard  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
  D                    Parrot  ======================================================
B D                  Platypus  ======================================================
B D                   Wallaby  ======================================================
B D                    Tenrec  ======================================================
  D  Chinese softshell turtle  ======================================================

Inserts between block 16 and 17 in window
B D                 Elephant 15bp
         Cape elephant shrew 16bp
B D                  Manatee 15bp
            Cape golden mole 15bp
                    Aardvark 15bp
B D                Armadillo 15bp

Alignment block 17 of 546 in window, 174959163 - 174959281, 119 bps 
B D                     Human  ga-taatgtttgaagc-t------------------------------aattttcaccacca--------
B D                     Chimp  ga-taatgtttgaagc-t------------------------------aattttcaccacca--------
B D                 Orangutan  ga-taatgtttgaagc-t------------------------------aattttcaccacca--------
B D                    Gibbon  ga-taatgtttgaagc-t------------------------------aattttcaccacca--------
B D                    Rhesus  ga-taatgtttgaagc-t------------------------------aattttcaccacta--------
B D       Crab-eating macaque  ga-taatgtttgaagc-t------------------------------aattttcaccacta--------
B D                    Baboon  ga-taatgtttgaagc-t------------------------------aattttcaccacca--------
B D              Green monkey  ga-taatatttgaagc-t------------------------------aattttcaccacca--------
B D                  Marmoset  ga-tgacgtatgaagctt------------------------------aattttcacc---a--------
B D           Squirrel monkey  ga-taatgtgtgaagctt------------------------------aattttcacc---a--------
B D                  Bushbaby  ga-tatggtttgaagc-t------------------------------aattcccagcatca--------
           Chinese tree shrew  ga-taaggtttgaaga-c------------------------------catctctatcacca--------
B D                  Squirrel  ga-taagagctaaagc-tacttcctaccaccagataagagctaaagctacttcctaccaccagataagag
                 Prairie vole  ga-gaaggtttgatg---------------------------------actatccacta-----------
B D           Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ga-gaagatttgatg---------------------------------actatccactg-----------
B D                       Rat  ga-gaaggttggatg---------------------------------cttatctagta-----------
B D            Naked mole-rat  ------------------------------------------------aattccaaacatca--------
B D                Guinea pig  ------------------------------------------------aatgtctaacatca--------
                   Chinchilla  ------------------------------------------------aattcccacattca--------
             Brush-tailed rat  ------------------------------------------------aatttctgcattca--------
B D                    Rabbit  gg-tgccggtggaggc-t------------------------------cacccccaccagca--------
B D                      Pika  ga-caaggtttgaggc-t------------------------------aatttcacctccca--------
B D                       Pig  ga-taaaatttgaagc-t------------------------------aattt-----------------
B D                    Alpaca  ga-taaatttcaaagc-t------------------------------gattt-----------------
               Bactrian camel  ga-taaatttcaaagc-t------------------------------aattt-----------------
B D                   Dolphin  ga-taaagttggaagt-t------------------------------aattt-----------------
                 Killer whale  ga-taaagttggaagt-t------------------------------aattt-----------------
             Tibetan antelope  ------agttggaagc-t------------------------------agttt-----------------
B D                       Cow  ------agttggaagc-t------------------------------aattt-----------------
B D                     Sheep  ------agttggaagc-t------------------------------agttt-----------------
                Domestic goat  ------agttggaagc-t------------------------------agttt-----------------
B D                     Horse  gaatagggtttgaagc-t------------------------------agtttcc-ccacca--------
B D          White rhinoceros  gaataaggtttgaagc-t------------------------------aattg---ctacca--------
B D                       Cat  gaatacagtttgcagc-t------------------------------aattcccaccacca--------
B D                       Dog  gaataaggtttgaagc-t------------------------------gatttccaccacca--------
B D                   Ferret   gaataaggtttgaggc-t------------------------------catttccaccacca--------
B D                     Panda  gaataaggtttgaagc-t------------------------------aattt-----------------
               Pacific walrus  gaataaggtttgaagc-t------------------------------catttccaccacta--------
                 Weddell seal  gaataaggtttgaagc-t------------------------------cagttccaccacca--------
             Black flying-fox  gaatgaggcttgaaag-t------------------------------ga---------ccac-------
B D                   Megabat  gaatgaggcttgaaag-t------------------------------ga---------ccac-------
                Big brown bat  gagtgaggtgcgaagc-t------------------------------ag---------cca--------
         David's myotis (bat)  gagtaaggtgcaaagc-t------------------------------ag---------cca--------
B D                  Microbat  gagtaaggtgcgaagc-t------------------------------ag---------cca--------
              Star-nosed mole  gaggaagttttgaagc-t------------------------------catttctgtcacca--------
B D                  Elephant  gg-taaggtttgaagc-a------------------------------aatttccagctcct--------
          Cape elephant shrew  gg-tgagatttaaagc-t------------------------------aatttctagcacct--------
B D                   Manatee  gg-taaggtttgaagc-t------------------------------aatttccatctcct--------
             Cape golden mole  gg-taaggtttgaggc-t------------------------------aactt-tagcacct--------
B D                    Tenrec  gg-taaattttgaagc-t------------------------------aatttctaacacct--------
                     Aardvark  gg-tagggtttgcagc-t------------------------------tatttccagcacct--------
B D                 Armadillo  ag-taaaatttgaagc-t------------------------------aattgttaccatca--------
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                   Gorilla  ----------------------------------------------------------------------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  --------------aca----------tcc------------cctca------a----------------
                        Chimp  --------------aca----------tcc------------cctca------a----------------
                    Orangutan  --------------aca----------tcc------------cctca------a----------------
                       Gibbon  --------------aca----------tcc------------cctca------a----------------
                       Rhesus  --------------aca----------tcc------------cctca------a----------------
          Crab-eating macaque  --------------aca----------tcc------------cctca------a----------------
                       Baboon  --------------aca----------tcc------------cctca------a----------------
                 Green monkey  --------------aca----------tcc------------cctca------a----------------
                     Marmoset  --------------aca----------tcc------------cctca------a----------------
              Squirrel monkey  --------------gca----------tcc------------cctca------a----------------
                     Bushbaby  --------------cta----------tcc------------cctca------g----------------
           Chinese tree shrew  --------------ctc----------tcc------------cctca------a----------------
                     Squirrel  ctaaagctacttccatt----------gtt------------ccaca------a----------------
                 Prairie vole  --------------ttt----------tct------------tctca------g----------------
              Chinese hamster  --------------tta----------tct------------tctta------g----------------
               Golden hamster  --------------tta----------tct------------tctca------g----------------
                          Rat  -------------tttt----------tct------------tctca------g----------------
               Naked mole-rat  --------------tta----------ttc------------cctca------c----------------
                   Guinea pig  --------------tta----------ttc------------cctta------gtaagtattcttttttc
                   Chinchilla  --------------tta----------ttc------------cctca------g----------------
             Brush-tailed rat  --------------tta----------ttc------------cctca------g----------------
                       Rabbit  --------------ctg----------tgc------------cctca------g----------------
                         Pika  --------------ctg----------tcc------------cctca------g----------------
                          Pig  --------------cta-----------ccaccaccaccatgcctca------a----------------
                       Alpaca  --------------ccacctcctcctgccc------------cctccccaccaa----------------
               Bactrian camel  --------------cca---cctcctgccc------------ccccc------a----------------
                      Dolphin  --------------cca-----------cc------------cctca------a----------------
                 Killer whale  --------------cca-----------cc------------cctca------a----------------
             Tibetan antelope  --------------cca-----------cc------------cctca------a----------------
                          Cow  --------------cta-----------cc------------cctca------a----------------
                        Sheep  --------------cca-----------cc------------cctca------a----------------
                Domestic goat  --------------cca-----------cc------------cctca------a----------------
                        Horse  --------------cca-----------cc------------tctca------a----------------
             White rhinoceros  --------------cca-----------cc------------cctca------g----------------
                          Cat  --------------cca-----------cc------------tccca------a----------------
                          Dog  --------------cca-----------cc------------cctca------a----------------
                      Ferret   --------------cca---------accc------------cctca------a----------------
                        Panda  --------------cca---------cccc------------cccca------a----------------
               Pacific walrus  --------------cca---------cccc------------cctca------a----------------
                 Weddell seal  --------------cca---------cccc------------cctca------a----------------
             Black flying-fox  --------------cca-----------cc------------cctca------g----------------
                      Megabat  --------------cca-----------cc------------cctca------g----------------
                Big brown bat  --------------cca-----------gc------------cctca------g----------------
         David's myotis (bat)  --------------cca-----------gc------------cctca------a----------------
                     Microbat  --------------cca-----------gc------------cctca------a----------------
              Star-nosed mole  --------------cca---------ttct------------tctta------a----------------
                     Elephant  --------------c------------cct------------ctcca------a----------------
          Cape elephant shrew  --------------c------------ctt------------acccc------c----------------
                      Manatee  --------------c------------cct------------cccca------a----------------
             Cape golden mole  --------------c------------cct------------cccca------g----------------
                       Tenrec  --------------c------------cct------------cccca------a----------------
                     Aardvark  --------------c------------ctt------------cccca------g----------------
                    Armadillo  --------------cca----------cct------------cttca------g----------------
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                      Gorilla  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ---------taaa-ac-cagcttttaatgtaaatc------acatagcatgc--tgctttagaaagg-ct
                        Chimp  ---------taaa-ac-cagcttttaatgtaaatc------acatagcatgc--tgctttagaaagg-ct
                    Orangutan  ---------taaa-ac-cagctgttaatgtaaatc------acatagcatgc--tgctttagaaagg-ct
                       Gibbon  ---------taaa-ac-cagcttttaatgtaaatc------acatagcatgc--tgctttagaaagg-ct
                       Rhesus  ---------taaa-ac-caacttttaatgtaaatc------acatggcatgc--tgctttagaaagg-ct
          Crab-eating macaque  ---------taaa-ac-caacttttaatgtaaatc------acatggcatgc--tgctttagaaagg-ct
                       Baboon  ---------taaa-ac-caacttttaatgtaaatc------acatggcatgc--tgctttagaaagg-ct
                 Green monkey  ---------taaa-ac-caacttttaatgtaaatc------acatggcatgc--tgctttagaaagg-ct
                     Marmoset  ---------taaa-ac-cagctttcaatgtaaatc------atatagcatgc--tgctttagaaagg-ct
              Squirrel monkey  ---------taaa-at-cagctttcagtgtaaatc------atatagcatgc--tgctttagaaagg-ct
                     Bushbaby  ---------taca-ac-tgatttata-tgtaagtc------acgtagcatgc--tgctttagaaagg-ct
           Chinese tree shrew  ---------ttaa-ac-cag-ttttaacatgggtt------atatagcatgc--tgctttgaagagg-ct
                     Squirrel  ---------taag-tc-caa-ttttaatgttggtc------ctataacactc--tactgtaaaaagt-tt
                 Prairie vole  ---------taaattt-cag-ttttagtgccagac------ctatga----------tacaaaaagg-ca
              Chinese hamster  ---------taaa-tc-tag-ttttaatgccagac------ctaaga----------tacagaaagg-ta
               Golden hamster  ---------taaa-tc-cag-ttttaatgccagat------ctatga----------tgcagaaagg-ta
                          Rat  ---------t-------cag-ttttaatggcagac------ctatgc----------tgtagaaa-----
               Naked mole-rat  ---------taag-tc-caa-tcttaatgtaggtt------ctataacagac--tgctttagaaagg-ct
                   Guinea pig  attttaaaataag-tt-cag-ccttaatgtagatc------ctgtaacagac--tggtttagaaaag-ct
                   Chinchilla  ---------taag-tc-cag-tcttcacataaatc------ctatgacagat--tggtttagaaagg-ct
             Brush-tailed rat  ---------taag-tc-cca--------------c------ctgtaacagac--tggtttagaaagg-ct
                       Rabbit  ---------aggg-ac-cag-ctgtaatgtaagtc------gtgtagtgtgccgctgcagacatgag---
                         Pika  ---------tgga-gc-cag-ttttaatgtaagtc------atatagtgtgc--ctgctgagaaggg-ct
                          Pig  ---------taaa-ac-caa-ttttaatgaggctt------atggagcatgc--tgctttagaaagg-ct
                       Alpaca  ---------taaa-ac-cga-ttttaccatagctt------atgtaatgtgc--cgcttgagaaagg-ct
               Bactrian camel  ---------taaa-ac-cga-ttttaccatagctt------atataacatgc--cgcctgagaaagg-ct
                      Dolphin  ---------taaa-ac-cag-ttttaatgcagctt------atgtagcatgc--tgctttagaaagg-ct
                 Killer whale  ---------taaa-ac-cag-ttttaatgcagctt------atgtagcatgc--tgctttagaaagg-ct
             Tibetan antelope  ---------taaa-ac-caa-tttgaatatagctt------atgtagaatgc--tgctgtggaaagc-tt
                          Cow  ---------taaa-ac-caa-ttttaatgtagctt------atgtagcatgc--tgctgtagaaagc-tt
                        Sheep  ---------taaa-ac-caa-tttgaatgtagctt------atgtagaatgc--tgctgtggaaagc-tt
                Domestic goat  ---------taaa-ac-caa-tttgaatgtagctt------atgtagaatgc--tgctgtggaaagc-tt
                        Horse  ---------taaa-ac-caa-ttttaatatagctc------atgtagcatgc--tgctttagaaggg-ct
             White rhinoceros  ---------taaa-ac-caa-ttgtaatgtcgctc------atggagcatgc--tgctctggaaagg-ct
                          Cat  ---------taaa-ac-ccg-ttttcacgtagctc------atgtagcatgc--tgctttaaaaagg-ct
                          Dog  ---------taaa-ac-taa-ttttaatgtagctt------acatagcatgc--tgctttagaaagg-ct
                      Ferret   ---------taaa-ac-cag-ttttaatgtagccc------ctatcacatgc--tgctttaggaagg-ct
                        Panda  ---------taaa-ac-caa-ttttaatgtagctc------gtgtctcatgc--tgctttagaaaggcct
               Pacific walrus  ---------taaa-ac-caa-ttttaatgtagctc------atgtcacatgc--tgctttagaatgg-ct
                 Weddell seal  ---------taaa-ac-cag-ttttaatgtagctc------atgtcacatgc--tgctttagaatgg-ct
             Black flying-fox  ---------taaa-ac-gag-ttttaatgtagctc------atgtggcacgc--tgctttagagagg-ct
                      Megabat  ---------taaa-ac-gag-ttttaatgtagctc------atgtggcgcgc--tgctttagagagg-ct
                Big brown bat  ---------taa----------------ttagctc------atgtagcacac--tgctttagaaagg-ct
         David's myotis (bat)  ---------taa----------------ttagctc------atgtagcacgc--tgctttagaaagg-ct
                     Microbat  ---------taa----------------ttagctc------atgtagcacgc--tgctttagaaaga-ct
              Star-nosed mole  ---------taaa-ac-cag-ttttaatgcaggct------atg-agcatgc--tgctttagaaaag-ct
                     Elephant  ---------taaa-ac-caa-ttctaacacagctc------atatagcatgc--tgctttagaaaga-ct
          Cape elephant shrew  ---------t-aa-ac-caa-ttata--acagcccgtatagatatagcacaa--t-cctcagaaaga-ct
                      Manatee  ---------taaa-ac-taa-ttctaacatagctc------atatagcatgc--tgctatagaaaga-ct
             Cape golden mole  ---------taaa-agccaa-ttctaacataactc------atttagcatac--tgttttaaaaaga-ct
                       Tenrec  ---------gaaa-ag-taa-ttctagcataactc------gtataggcagc--tgctttagaaaga-ct
                     Aardvark  ---------taaa-ac-caa-ttgtcacatagctc------atatagtgtgc--tgctttagaaaca-ct
                    Armadillo  ---------taag-ga-caa-ttctaatgttgttc------atacagcgatc--tgctttagaaagg-tt
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                      Gorilla  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  tga----aggtagta-attat-----------------------a----aactattatt
                        Chimp  tga----aggtagtc-attat-----------------------a----aactattatt
                    Orangutan  tga----aggtagta-attat-----------------------a----aactattatt
                       Gibbon  tga----aggtagta-attat-----------------------a----aactattatt
                       Rhesus  gga----aggtagta-attat-----------------------a----aactattatt
          Crab-eating macaque  gga----aggtagta-attat-----------------------a----aactattatt
                       Baboon  gga----aggtagta-attat-----------------------a----aactattatt
                 Green monkey  gga----aggtagta-attat-----------------------a----aactattatt
                     Marmoset  tga----aggtggta-attat-----------------------a----aactattatt
              Squirrel monkey  tga----aggcagta-attat-----------------------a----aac--ttttt
                     Bushbaby  tga----aggtagta-attat-----------------------agaataaatattatt
           Chinese tree shrew  taa----aagtaata-attat-----------------------t----aaataatatt
                     Squirrel  tga----aggtagta-atggt--------------------------------------
                 Prairie vole  taa----atggactc-atgat------------------------------gaactgtt
              Chinese hamster  tga----acagactc-aagat------------------------------taactgtt
               Golden hamster  tga----atggactc-aagat----------------------ta----actaactgtt
                          Rat  ------------------gat--------------------------------------
               Naked mole-rat  cga----aactagta-atgat-----------------------a----aaatattatt
                   Guinea pig  tga----aacaagca-atgga-----------------------a----aagtattatt
                   Chinchilla  tga----aactagta-atggt-----------------------a----aaatattatt
             Brush-tailed rat  tga----aactggta-atagc-----------------------a----agatatcatt
                       Rabbit  -------gggcagcc-ctcat----------------------------aaaggttagc
                         Pika  tca----aagcagtc-attat----------------------------gaagattatt
                          Pig  tga----a-gtagta-atttt-----------------------g----aaatattatt
                       Alpaca  tga----a-ggagtg-attat-----------------------a----aaatactgtt
               Bactrian camel  tga----a-gtagtg-attac-----------------------a----aaatactgtt
                      Dolphin  tga----a-gtagta-attat-----------------------a----aaatattatt
                 Killer whale  tga----a-gtagta-attat-----------------------a----aaatattatt
             Tibetan antelope  tga----a-gtagtc-attat-----------------------a----aaatattttt
                          Cow  tga----a-gtagta-attaa-----------------------a----aaatattttt
                        Sheep  tga----a-gtagtc-attat-----------------------a----aaatattttt
                Domestic goat  tga----a-gtagtc-attat-----------------------a----aaatattttt
                        Horse  tga----a-gtagtc-attat-----------------------a----aaatattatt
             White rhinoceros  t-a----a-gtagta-atcat----------------------------gaatattgtt
                          Cat  tga----a-gcagta-attat-----------------------a----aaatattctt
                          Dog  tga----a-gcagtc-attat-----------------------a----aaattttttt
                      Ferret   tga----a-gga-ta-attta-----------------------a----aaatattctt
                        Panda  tga----a-gcagta-atttt-----------------------a----aaatattctt
               Pacific walrus  tga----a-gcagta-atttt-----------------------a----aaataatctt
                 Weddell seal  tga----a-gcagta-atttt-----------------------a----aaatagtctt
             Black flying-fox  tga----c-gtagta-attat-----------------------a----aaacatttat
                      Megabat  tga----c-gtagta-attat-----------------------a----aaatatttct
                Big brown bat  tca----a-gtagta-attag-----------------------g----aaacatttct
         David's myotis (bat)  tga----g-gtagta-attaa-----------------------g----aaacatttct
                     Microbat  tga----a-gtagta-attag-----------------------g----aaacatttct
              Star-nosed mole  gga----g-gtaata-at-at-----------------------a----aaggattatt
                     Elephant  cga----aggcagta-attat-----------------------a----aaatattctt
          Cape elephant shrew  tag----acacagta-attag-----------------------a----atacattatt
                      Manatee  tga----aggcagtatattat-----------------------a----aaatattctt
             Cape golden mole  tga----aggcagta-attat-----------------------a----aaatattatt
                       Tenrec  tgaaggcaggcagta-attat-----------------------a----aaatgttact
                     Aardvark  tga----aggcagta-attacattattaagggaaaaaaaaaaaaa----acatacaatt
                    Armadillo  tga----agatagta-attat-----------------------c----aaatagtatt
                        Mouse  ===========================================================
       Lesser Egyptian jerboa  ===========================================================
                      Gorilla  -----------------------------------------------------------
                     Hedgehog  ===========================================================
                        Shrew  ===========================================================
                   Coelacanth  ===========================================================
       Spiny softshell turtle  ===========================================================
                X. tropicalis  ===========================================================
                 Atlantic cod  ===========================================================
                  Spotted gar  ===========================================================
                  Stickleback  ===========================================================
           Southern platyfish  ===========================================================
       Yellowbelly pufferfish  ===========================================================
                         Fugu  ===========================================================
                       Turkey  ===========================================================
                      Chicken  ===========================================================
                 Mallard duck  ===========================================================
           Tibetan ground jay  ===========================================================
                  Zebra finch  ===========================================================
       White-throated sparrow  ===========================================================
              Tasmanian devil  ===========================================================
     Mexican tetra (cavefish)  ===========================================================
                       Medaka  ===========================================================
          Pundamilia nyererei  ===========================================================
                  Zebra mbuna  ===========================================================
        Burton's mouthbreeder  ===========================================================
          Princess of Burundi  ===========================================================
                 Nile tilapia  ===========================================================
               Painted turtle  ===========================================================
              Green seaturtle  ===========================================================
           American alligator  ===========================================================
                Scarlet macaw  ===========================================================
                   Budgerigar  ===========================================================
                      Opossum  ===========================================================
                  Rock pigeon  ===========================================================
          Collared flycatcher  ===========================================================
          Medium ground finch  ===========================================================
                       Lizard  ===========================================================
             Peregrine falcon  ===========================================================
                 Saker falcon  ===========================================================
                       Parrot  ===========================================================
                     Platypus  ===========================================================
                      Wallaby  ===========================================================
     Chinese softshell turtle  ===========================================================

Inserts between block 17 and 18 in window
B D                      Dog 229bp

Alignment block 18 of 546 in window, 174959282 - 174959441, 160 bps 
B D                     Human  aagcatccaaaatgaaggtctcc----ttttgctaat---atcattcagattttcttattactacaatta
B D                     Chimp  aagcatccaaaatgaaggtctcc----ttttgctaat---atcattcagattttcttattactacaatta
B D                 Orangutan  aagcatccaaaatgaaggtctcc----ttttgctaat---atcattcagattttcttattactaccatca
B D                    Gibbon  aagcatccaaaatgaagctctcc----ttttgctaat---atcattctgattttcttattactaccatta
B D                    Rhesus  aagcatccaaaatgaagctctcc----ttttgctaac---atcattctgattttcttattactaccattg
B D       Crab-eating macaque  aagcatccaaaatgaagctctcc----ttttgctaac---atcattctgattttcttattactaccattg
B D                    Baboon  aagcatccaaaatgaagctctcc----ttttgctaac---atcattctgattttcttattactaccattg
B D              Green monkey  aagcatccaaaatgaagctctcc----ttttgctaac---atcattctgattttcttattactaccattg
B D                  Marmoset  aagcatccagaatggagctctcc----ttttgcttat---attattctaattttcttattactaccattg
B D           Squirrel monkey  aagcatctaaaatggagctctcc----ttttgcttat---attattctaattttcttattactaccgttg
B D                  Bushbaby  gagcatccagaatgaagctttcc----tactgcttgt---atctttccaattttcttattgctgctgtca
           Chinese tree shrew  gaagatccaaaatgaagctctct----gactgcttgt---gtcattcaaagttttttattactgc---tg
B D                  Squirrel  --agatccagaatgaaaccctac----tactgcttat---atagttttaatttccttaatgccaccatca
                 Prairie vole  aaagatcaca-------------------------------tcattctaatttttagaatactaccacca
B D           Chinese hamster  aatgatcaaaataaaagcccttt----aattgttt-g---atcattctaatcttcagaatacttccacca
               Golden hamster  aaagatcaaaataaaagcccttt----aattgctt-t---gtcattataatcatcagaatacttgcacca
B D                       Rat  -----tcaaagtaaaatcccttt----tattgttt-g---ttcattctaattttcagaatgctaccacaa
B D            Naked mole-rat  aaggatcccaaatgaaatcctcc----tactacttgt---atcattctaattttcctaatgccaccatca
B D                Guinea pig  aaagatcca-aatgaaaccttcc----tactg-ttgt---atcattctgatcttcttaatgccaccataa
                   Chinchilla  aaagttttaaaatgaaaccttcc-----------tgt---atcattctaattttctcaatgccaccataa
             Brush-tailed rat  aaagatccagaatgaaacctgcctaactac---ttgt---accattctaattttcttaatgctaccataa
B D                    Rabbit  ccagggccaaggtgaggccctcc----tcccg-ctct---atcattctcattttt-tcccgctgccgcca
B D                      Pika  aaaggttcaaaatgaagtc--------------ctgt---gttattcttaatttt-tattgttgccatca
B D                       Pig  aaggatccaaaatgaagctctcc----tacagcttgt---gtcattctaattttcttattgctgccatcg
B D                    Alpaca  aaggatccagaatgaagctctcc----taccgcttgc---atcattctaattttctaaacgctgccatca
               Bactrian camel  aaggatccagaatgaagctctcc----taccgcttgc---atcattctaattttctaactgctgctgtca
B D                   Dolphin  aaggatccaaagtgaacctctcc----tactgcttgc---atcattctaattttcttattgctgccattg
                 Killer whale  aaggatccaaagtgaagctgccc----tactgcttgc---atcattctaattttcttattgctgccattg
             Tibetan antelope  aagaatccgaaatggaactctcc----cgctgcttg-----------------------------cactg
B D                       Cow  aagaatccaaaatgaaactctcc----tgctgcttgc---atcattctgattttcttattgctgccatca
B D                     Sheep  aagaatccgaaatggaactctcc----cgctgcttg-----------------------------cacca
                Domestic goat  aagaatctgaaatggaactctcc----cgctgcttg-----------------------------cacca
B D                     Horse  gaggatccaaaatgaagccctcc----cactgcttct---atcattctgactttcttattgctgccatca
B D          White rhinoceros  gaggatccgaaatgaagccctcc----cactgcttgt---atcattctaattttcttattgctgccatca
B D                       Cat  aaggatccaaaacgaagccctcc----tactgcttgt---atcattctaattttctta--gttgccat--
B D                       Dog  aaggatttaaaatgaagccctcc----tactgcttatactatcattgtaattttctta--gttgccatca
B D                   Ferret   aaggatcctaaatgaagacctcc----tactgtgtagataatcattctaattatctta--gttgacatca
B D                     Panda  gaggatcccaaatgaagcccttg----tactgcttatatgatcattctaattttctta--gttgccatca
               Pacific walrus  aaggatcccaaatgaagccctcc----tactgcttatatgatcattctaattttctta--gttgccatca
                 Weddell seal  aaggatcccaaatgaagccctcc----tactgcttatatgatcattctaattttctta--gttgccatca
             Black flying-fox  gaggatccaaaatgaagccc-cg----tactgattgt---gtcattctgctttcctcatggctgccactg
B D                   Megabat  gaggatccaaaatgaagccc-ca----taatgattgt---gtcattctgctttcctcatggctgccactg
                Big brown bat  gaggatccaacctgaaaccctcc----tactgcttgc---gtcaatctagttttcttattgctgccatcg
         David's myotis (bat)  gaggatccaacctgaagccctcc----tactgcttgc---gtcaatctagttttcttattgctgccatcg
B D                  Microbat  gaggatccaacctgaagccctcc----tactgcttgc---gtcaatctagttttcttattgctgccatcg
              Star-nosed mole  aagggtccaaaatgaagccttcc----tattgcccat---ttcattctgattttcttattgctaccattg
B D                  Elephant  aaggctccaaaatgaagttttcc----tactgctcgt---atcattctaatt---ttattgctaccatcg
          Cape elephant shrew  aaggat---aaaaaaagttctcc----taatgctcct---atcattctactt---ttattg---ccataa
B D                   Manatee  aaggatccaaaaggaagttctcg----tactgcttgt---atcattctaatt---ttattgccaccatca
             Cape golden mole  aaggatccaaatagaagttctcc----tatggcttgc---atcattctag-----ttatagccaccgcca
B D                    Tenrec  gagaatctagaacgacgtcctac----ca---cttgt---atcattctagtt---ttattgccaccaaca
                     Aardvark  aaaaatccaaaatgaagttcccc----tactgcttgt---atcattctaatt---ttattgctgccatca
B D                 Armadillo  aaggattcaaaatgaagcccttc----tatggcttgt---atcataactttc---ttattgccaccatcg
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                   Gorilla  ----------------------------------------------------------------------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ttat-----------------gaata-a-attctgtgaagagtgcttt--aaaat--aaga---gag---
                        Chimp  ttat-----------------gaata-a-attctgtgaagagtgcttt--aaaat--aaga---gag---
                    Orangutan  ttat-----------------gaata-a-attctgtgaagagtgcttt--aaaat--aaga---gag---
                       Gibbon  ttat-----------------gaata-a-attctgtgaagagtgcttt--aaaat--aaga---gag---
                       Rhesus  ttgt-----------------gaata-a-attctgtgaagaatgcttt--aaaat--aaga---gag---
          Crab-eating macaque  ttgt-----------------gaata-a-attctgtgaagaatgcttt--aaaat--aaga---gag---
                       Baboon  ttgt-----------------gaata-a-attctgtgaagaatgcttt--aaaat--aaga---gag---
                 Green monkey  ttgt-----------------gaata-a-attctgtgaagaatgcttt--aaaat--aaga---gag---
                     Marmoset  ttct-----------------gaaga-a-attctgtgaagagtgcttt--aaaat--aaga---gtg---
              Squirrel monkey  ttat-----------------taata-a-attctgtgaagagtgcttt--aaaat--aaga---gtg---
                     Bushbaby  ttat-----------------gcata-a-aatctgtgaagagtgcttt--aaaatcaaaga---gag---
           Chinese tree shrew  tcat-----------------gaata-a-aatgtgtgaagagtgctta--gaaatctaagagaggag---
                     Squirrel  ttat-----------------gaaaa-aaaaaatctgaagagtgcttt--aaagt----aa---aag---
                 Prairie vole  ttat-----------------gaata-a------------agtacttt--cagat--aaaa---gag---
              Chinese hamster  ttat-----------------gaata-a------------agtgcttt--tagat--aaaa---gag---
               Golden hamster  ttat-----------------aaata-a------------agtgcttt--tagat--aaaa---gag---
                          Rat  ctat-----------------aaata-a------------agtacttt--aaaat----aa---gag---
               Naked mole-rat  ttat-----------------gaataaa-aatctgtggacagtgcttt--aaagt--aaaa---aaa---
                   Guinea pig  ttat-----------------gaata-a-aatttgtgaacagtgcttt--caact--gaaa---gaa---
                   Chinchilla  ttat-----------------gaaga-a-aatctgtgaacagtgcttt--caaat--aaga---gag---
             Brush-tailed rat  tgat-----------------gaataca-aatctgtgaacagttcttt--caaat--aagg---gagaaa
                       Rabbit  ccgccaccgtgagtagtctgtgaaga-a--------------tgcctt--cctgt--taga---aag---
                         Pika  gtgc-----------------gaaga-a--------------tgcttt--attgc--ttga---aag---
                          Pig  ttat-----------------gagta-a-aatccaggaagggtacttt--aaaat--agaa---gac---
                       Alpaca  caac-----------------gagcc-a-gatctgggaaggatccttt--aaaac--agaa---gag---
               Bactrian camel  ctat-----------------gagca-a-gatgtgggaaggatacttt--aaaac--agaa---gag---
                      Dolphin  ttat-----------------gagta-a-aacctaggaaggatacttc--aaaat--agaa---gag---
                 Killer whale  ttat-----------------gagta-a-aacctaggaaggatacttc--aaaat--agaa---ga----
             Tibetan antelope  ttct-----------------gagtg-a-tgtctgggaagggcgcttt---aagt--agaa---gac---
                          Cow  ttct-----------------gagtg-a-agtctgggaagcgtgcttt---aaat--agaa---gac---
                        Sheep  ttct-----------------gagtg-a-cgtctgggaagggcgcttt---aagt--agaa---gac---
                Domestic goat  ttct-----------------gagtg-a-cgtctgggaagggcgcttt---aagt--agaa---gac---
                        Horse  gtat-----------------gaata-a-aatctgggaagagtgcttt--aaa------ag---agg---
             White rhinoceros  ttat-----------------gagta-a-gatctgggaagagtccttt--aaa-t--agaa---gag---
                          Cat  ---c-----------------aaata-a-aatctgggaagaatgcttt--aaaat--agaa---gag---
                          Dog  ttac-----------------aaat--a-aatctgggaagagtgcttt-aaaaac--agaa---gag---
                      Ferret   ttac-----------------aaata-a-aatctgggaagagtgcttt--gaaat--agaa---gag---
                        Panda  taac-----------------aaata-a-aacctgggaagagtgcttt--aaaat--agaa---gag---
               Pacific walrus  ttac-----------------aaata-a-aatctgggaagattacttt--aaaat--agag---gaa---
                 Weddell seal  ttac-----------------aaata-a-aatctgggaagattgcttt--aaaat--agag---------
             Black flying-fox  tgac-----------------gagta-a-cagctggggagcgtgcttt--aaaac--agaa---gag---
                      Megabat  tgac-----------------gagta-a-cagctggggagcgtgcttt--aaaac--agaa---gag---
                Big brown bat  ttat-----------------aaata-a-aatctgggaagagtgcttt--aaaat--agaa---gat---
         David's myotis (bat)  ttac-----------------aaata-a-aatctaggaagagtgcttt--aaaat--agaa---ggt---
                     Microbat  ttat-----------------aaata-a-aatctgggaagagtgcttt--aaaat--agaa---ggt---
              Star-nosed mole  ctgt-----------------aaata-a-aatctagggcaagtgcttt--aaaat--agaa---ggg---
                     Elephant  ttat-----------------gaata-a-agtctgggaagaatgcatt--aaaat--aaag---gag---
          Cape elephant shrew  taat-----------------gaatg-a-aat-tgggaagaatgtatt--aaaac--agca---gag---
                      Manatee  ttat-----------------gaata-a-agtctgggatgaatgcatt--aaaac--agag---gag---
             Cape golden mole  ttat-----------------gaata-a-aatctgggaaatatgcatt--aaaat--agta---gag---
                       Tenrec  ttat-----------------gaaga---------------atgcatt--aaagt--agca---gag---
                     Aardvark  ttgt-----------------aaata-a-aatctaggaaaaatgcattaaaaaaa--agtg---gag---
                    Armadillo  tttt-----------------gtgta-a-aatctgggcagaatgcatt--aaaat--agag---gag---
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                      Gorilla  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  --------aa------------------------------------------------------------
                        Chimp  --------aa------------------------------------------------------------
                    Orangutan  --------aa------------------------------------------------------------
                       Gibbon  --------aa------------------------------------------------------------
                       Rhesus  --------aa------------------------------------------------------------
          Crab-eating macaque  --------aa------------------------------------------------------------
                       Baboon  --------aa------------------------------------------------------------
                 Green monkey  --------aa------------------------------------------------------------
                     Marmoset  --------aa------------------------------------------------------------
              Squirrel monkey  --------aa------------------------------------------------------------
                     Bushbaby  --------ca------------------------------------------------------------
           Chinese tree shrew  --------aa------------------------------------------------------------
                     Squirrel  ----aggaaa------------------------------------------------------------
                 Prairie vole  ----aagaaa------------------------------------------------------------
              Chinese hamster  ----aaggaa------------------------------------------------------------
               Golden hamster  ----aaggaa------------------------------------------------------------
                          Rat  ----aaggaa------------------------------------------------------------
               Naked mole-rat  agagaaggaa------------------------------------------------------------
                   Guinea pig  agagaaggaa------------------------------------------------------------
                   Chinchilla  ---aaaggaa------------------------------------------------------------
             Brush-tailed rat  agaaaaggaa------------------------------------------------------------
                       Rabbit  ----agggaa------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----agggaa------------------------------------------------------------
                       Alpaca  ----agggaa------------------------------------------------------------
               Bactrian camel  ----agggaa------------------------------------------------------------
                      Dolphin  ----agggaa------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----agggaa------------------------------------------------------------
                          Cow  ----agggga------------------------------------------------------------
                        Sheep  ----agggaa------------------------------------------------------------
                Domestic goat  ----agggaa------------------------------------------------------------
                        Horse  ----agagaa------------------------------------------------------------
             White rhinoceros  ----agagaa------------------------------------------------------------
                          Cat  ----aggaaa------------------------------------------------------------
                          Dog  ----aaggaa------------------------------------------------------------
                      Ferret   ----aaggca------------------------------------------------------------
                        Panda  ----aaggca------------------------------------------------------------
               Pacific walrus  ----aaggca------------------------------------------------------------
                 Weddell seal  ----aaggca------------------------------------------------------------
             Black flying-fox  ----agggag------------------------------------------------------------
                      Megabat  ----agggag------------------------------------------------------------
                Big brown bat  ----agggaa------------------------------------------------------------
         David's myotis (bat)  ----agggaa------------------------------------------------------------
                     Microbat  ----agggaa------------------------------------------------------------
              Star-nosed mole  ----aatgaaagattaaaatgatatattttagggtgactcggtgatgggaaacccagggggattacaatt
                     Elephant  ----aaggaa------------------------------------------------------------
          Cape elephant shrew  ----agggaa------------------------------------------------------------
                      Manatee  ----aaggaa------------------------------------------------------------
             Cape golden mole  ----acagaa------------------------------------------------------------
                       Tenrec  ----agggga------------------------------------------------------------
                     Aardvark  ----agggaa------------------------------------------------------------
                    Armadillo  ----agcggc------------------------------------------------------------
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                      Gorilla  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ---atggaaga-----------------------------------------ccaaacttgtac--attt
                        Chimp  ---atggaaga-----------------------------------------ccaaacttgtac--attt
                    Orangutan  ---atggaaga-----------------------------------------ccaaacttgtac--attt
                       Gibbon  ---atggaaga-----------------------------------------ccaaacttgtac--attt
                       Rhesus  ---atggaaga-----------------------------------------ccaaatttgtac--attt
          Crab-eating macaque  ---atggaaga-----------------------------------------ccaaatttgtac--attt
                       Baboon  ---atggaaga-----------------------------------------ccaaatttgtac--attt
                 Green monkey  ---atggaaga-----------------------------------------ctaaatttgtac--attt
                     Marmoset  ---atgagaga-----------------------------------------ccaaacttatac--attt
              Squirrel monkey  ---atgaaaga-----------------------------------------ccaaacttgtac--attt
                     Bushbaby  ---aggaa----------------------------------------------------gcac--attt
           Chinese tree shrew  ---gctaaaga-----------------------------------------ccaaatatgtac--gttt
                     Squirrel  ---atgaaaac-----------------------------------------ccagccttgtac--tttt
                 Prairie vole  ---atgatagc-----------------------------------------ccaaactttcat--aatt
              Chinese hamster  ---atgacagc-----------------------------------------ccaaacttacat--aatt
               Golden hamster  ---atgatagc-----------------------------------------ccaaacttatgt--aatt
                          Rat  ---actatagc-----------------------------------------ccaaacttacat--aatt
               Naked mole-rat  ---atgaaaac-----------------------------------------tcaaacttgtac--attc
                   Guinea pig  ---atgaaaat------------------------------------------caaagttgtgt--attc
                   Chinchilla  ---atgaaaac------------------------------------------caaacttgtac--attc
             Brush-tailed rat  ---attaaaac------------------------------------------caaacttgtgc--actc
                       Rabbit  ---ctgagagg-----------------------------------------tcaaacttgtgc--tgtt
                         Pika  -----------------------------------------------------caaacttgggc--atat
                          Pig  ---atggaaga-----------------------------------------ctaaaattgtgt--attt
                       Alpaca  ---atgaaaga-----------------------------------------tgaaaactgtgtaaactt
               Bactrian camel  ---atgaaaga-----------------------------------------tgaaaactgtgtaaactt
                      Dolphin  ---atgaaaga-----------------------------------------ctaaagtggtgt--attt
                 Killer whale  -----gaaaga-----------------------------------------ctaaaatggtgt--attt
             Tibetan antelope  ---atgaaaga-----------------------------------------ttaaagttgtat--attc
                          Cow  ---ataaaaga-----------------------------------------ctaaaattgtg----ttc
                        Sheep  ---atgaaaga-----------------------------------------ctaaagttgtgt--attc
                Domestic goat  ---atgaaaga-----------------------------------------ctaaagttgtgt--attc
                        Horse  ---atgaaaga-----------------------------------------ctaaaatagtgt--attt
             White rhinoceros  ---atgaaaga-----------------------------------------ctaaaatagtac--attt
                          Cat  ---acggaaga-----------------------------------------ctcaagttatat--attt
                          Dog  ---acgaaaga-----------------------------------------ctaaaattgcat--attt
                      Ferret   ---acgaaaga-----------------------------------------ctaaaatcgaac--attt
                        Panda  ---acaagaga-----------------------------------------ctaaaattgtat--gttt
               Pacific walrus  ---acaaaaga-----------------------------------------ctaaaattgtat--attt
                 Weddell seal  ---acgaaaga-----------------------------------------ctaaaattgtat--attt
             Black flying-fox  ---atggaaga-----------------------------------------ctaaaattgtat--attt
                      Megabat  ---atggaaga-----------------------------------------ctaaaattgtat--attt
                Big brown bat  ---atggaaga-----------------------------------------ctaaaattgtat--attt
         David's myotis (bat)  ---atgaaaga-----------------------------------------ctaaaattgtat--attt
                     Microbat  ---atgaaaga-----------------------------------------ctaaaattgtat--attt
              Star-nosed mole  gagatgaaaaaaaagtgtacaaaatgatgtaaaataaactgttatattattttaaaaattatgt--attt
                     Elephant  ---atgaaaga-----------------------------------------ccaaaaatggac--attt
          Cape elephant shrew  ---atgaaaga-----------------------------------------ccaaaactgtac--tttt
                      Manatee  ---atgaaaga-----------------------------------------ccaaaaatgtac--gttt
             Cape golden mole  ---gtaaaaga-----------------------------------------ccaaaactgtac--attt
                       Tenrec  ---ctgaaaga-----------------------------------------ccaaaactgggc--attt
                     Aardvark  ---atgcaaga-----------------------------------------gcaacactatac--attt
                    Armadillo  ---atgagaga-----------------------------------------ccgaaattgtaa--attt
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                      Gorilla  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  aaa--atcaggct---ggaattgaacttgtt-attg
                        Chimp  aaa--atcaggct---ggaattgaacttgtt-atcg
                    Orangutan  aaa--atcaggct---agaattaaacttgtt-attg
                       Gibbon  aaa--atcaggct---ggaattgaacttgtt-attg
                       Rhesus  aaa--atcaggct---ggaattgaacttgtt-attg
          Crab-eating macaque  -aa--atcaggct---ggaattgaacttgtt-attg
                       Baboon  aaa--atcaggct---ggaattgaacttgtt-attg
                 Green monkey  aaa--atcagact---ggaattgaacttgtt-agtg
                     Marmoset  aaa--atcaggct---ggaattgaacttgtt-attg
              Squirrel monkey  aaa--atcaggct---ggaattgaacttgtt-cttg
                     Bushbaby  aaa--agca--------------aacttgtt-attg
           Chinese tree shrew  aaa--ataaggct---gggactaaatatatc-attg
                     Squirrel  aaa--aacaggct---aggactga----act-gtta
                 Prairie vole  --a--cacaggca---aaaactgagc--aca-gttg
              Chinese hamster  --a--cataggca---caaactgagc--aca-gttg
               Golden hamster  --a--cataggta---caaactgagc--aca-gttt
                          Rat  --a--aatagaca---gaagctgttt--cta-----
               Naked mole-rat  aaa--aac----a---gggactaaac-tatt-attg
                   Guinea pig  aaa--aactggag---gagactaaac-tatt-attg
                   Chinchilla  aaa--acctggca---gggattaaac-tatt-attg
             Brush-tailed rat  aaa--aactggca---gggactaaac-tattaattg
                       Rabbit  gaa--atcaggttccgctggcttgct--gcg-g---
                         Pika  gga--attagact---aggacttgtt--act-a---
                          Pig  aaa--atcaatca---tgaac--------tt-gctg
                       Alpaca  aac--atcagcct---ggaactgaacttgtt-actg
               Bactrian camel  aac--atcagcct---ggaactgaacttgtt-actg
                      Dolphin  aaa--atcagcct---ggaactgaac-------tta
                 Killer whale  aaa--atcagcct---ggaactgaac---tt-atta
             Tibetan antelope  aaa--ttcagtct---ggaactgaacttgtt-attg
                          Cow  aaa--ttcagtct---ggaactgaacttgtt-attg
                        Sheep  aaa--ttcagtct---ggaactgaacttgtt-attg
                Domestic goat  aaa--ttcagtct---ggaactgaacttgtt-attg
                        Horse  aaaacatcaatct---gggactgaacttgtt-gttg
             White rhinoceros  aaaa-atcagtct---gggactgaacttgtt-attg
                          Cat  aaa--atccgtct---ggggctgaacttggt-attg
                          Dog  aaa--atcagtct---gggactgagcttcat-actg
                      Ferret   aaa--atcagtct---gggactgaatttggt-actg
                        Panda  aaa--atcagtct---ggaactgaacttggt-acgg
               Pacific walrus  aaa--atcagtct---gggactgaacttggt-actg
                 Weddell seal  aaa--atcagtct---gggactgaacttggt-actg
             Black flying-fox  aaa--atgtgtct---gggactgaacttgtt-attg
                      Megabat  aaa--atgtgtct---gggactgaacttgtt-attg
                Big brown bat  aaa--atctgcct---gggactgacgttgtt-atta
         David's myotis (bat)  aaa--atctgcct---gggactgaatttgtt-attg
                     Microbat  aaa--atctgcct---gggactgaatttgtt-attg
              Star-nosed mole  taa--atcagatt---gaacttgaactt--------
                     Elephant  aa---atcagtgt---gggcctgtacatgtt-attg
          Cape elephant shrew  act--atcagtgt---gagtctgaacatttt-actg
                      Manatee  aa---atcagtat---gggcttgtacatgtt-attg
             Cape golden mole  aaa--atcattgt---gaaccggaacatgtt-attc
                       Tenrec  gaa--atcagtat---ggctccgagtatgcc-agag
                     Aardvark  aaa--atcagtgt---agg-ctgaatatgtt-attt
                    Armadillo  ata--attagcct---gggcctgaacatgtt-atca
                        Mouse  ====================================
       Lesser Egyptian jerboa  ====================================
                      Gorilla  ------------------------------------
                     Hedgehog  ====================================
                        Shrew  ====================================
                   Coelacanth  ====================================
       Spiny softshell turtle  ====================================
                X. tropicalis  ====================================
                 Atlantic cod  ====================================
                  Spotted gar  ====================================
                  Stickleback  ====================================
           Southern platyfish  ====================================
       Yellowbelly pufferfish  ====================================
                         Fugu  ====================================
                       Turkey  ====================================
                      Chicken  ====================================
                 Mallard duck  ====================================
           Tibetan ground jay  ====================================
                  Zebra finch  ====================================
       White-throated sparrow  ====================================
              Tasmanian devil  ====================================
     Mexican tetra (cavefish)  ====================================
                       Medaka  ====================================
          Pundamilia nyererei  ====================================
                  Zebra mbuna  ====================================
        Burton's mouthbreeder  ====================================
          Princess of Burundi  ====================================
                 Nile tilapia  ====================================
               Painted turtle  ====================================
              Green seaturtle  ====================================
           American alligator  ====================================
                Scarlet macaw  ====================================
                   Budgerigar  ====================================
                      Opossum  ====================================
                  Rock pigeon  ====================================
          Collared flycatcher  ====================================
          Medium ground finch  ====================================
                       Lizard  ====================================
             Peregrine falcon  ====================================
                 Saker falcon  ====================================
                       Parrot  ====================================
                     Platypus  ====================================
                      Wallaby  ====================================
     Chinese softshell turtle  ====================================

Inserts between block 18 and 19 in window
B D                 Squirrel 3bp
                Prairie vole 153bp
B D          Chinese hamster 144bp
              Golden hamster 128bp

Alignment block 19 of 546 in window, 174959442 - 174959472, 31 bps 
B D                     Human  tgtcttaaatccttttttgt---gccaaagcagg
B D                     Chimp  tgtcttaaatccttttttgt---gccaaagcagg
B D                 Orangutan  tgtcttaaatccttttttgt---gccaaagcagg
B D                    Gibbon  tgtcttaaatccttttttgt---gacaaagcagg
B D                    Rhesus  tgtcttaaatcattttttgt---gccaaagcagg
B D       Crab-eating macaque  tgtcttaaatcattttttgt---gccaaagcagg
B D                    Baboon  tgtcttaaatcattttttgt---gccaaagcagg
B D              Green monkey  tgtcttaaatcattttttgt---gccaaagcagg
B D                  Marmoset  tgtcttaaatatttttttgt---gccgaagcagg
B D           Squirrel monkey  tgtcttaaatctttttctgt---gccgaagcagg
B D                  Bushbaby  tgtctgaaatccttttgact----tcaaagcagg
           Chinese tree shrew  tgtcttaactcttttttttttctgtcaaagcaga
B D                  Squirrel  tgtttt---tc-tttctttt---gtcaaagcagg
                 Prairie vole  tatcttacatc-ctttttgt---gtcaaagctgg
B D           Chinese hamster  tgtcttatgtc-ctttttgt---gtcaagacagg
               Golden hamster  tgtctttcatc-ctttttgt---atcaagaaaga
B D                     Mouse  tgccttgcacc-ctttttct---gttaaagcagg
B D                       Rat  -----tg-aca-ttctctgt---gatggggcagg
B D            Naked mole-rat  aatcttaaatc-ctttttgt---atcaaagcagg
B D                Guinea pig  agtcttaaatc-cttttagt---atcaaagcagg
                   Chinchilla  agtcttaaatc-atctttat---atcaaagcagg
             Brush-tailed rat  agtcttacatc-ctttttgt---atcaaagcagg
B D                    Rabbit  cgccccagatc-----cctt---gtcaaagcagg
B D                      Pika  tggactaggtctttgttttg---gtcaaggcagg
B D                       Pig  tttcttaaatc-ctttttgt---gtcaaagtaga
B D                    Alpaca  tttcttacatc-ctatttgt---gtcaaagaaga
               Bactrian camel  tttcttacatc-ctttttgt---gtcaaagaaga
B D                   Dolphin  tttcttatatc-ctttttgt---gtcaaagcagc
                 Killer whale  tttcttatatc-ctttttgt---gtcaaagcagc
             Tibetan antelope  tttcttatatc-ctttttgt---gtcaaagcagg
B D                       Cow  tttcttatatc-ctttttgt---gtcaaagcagg
B D                     Sheep  tttcttatatc-ctttttgt---gtcaaagcagg
                Domestic goat  tttcttatatc-ctttttgt---gtcaaagcagg
B D                     Horse  tttcttaaatc-cttt---t---ttaaaagcaga
B D          White rhinoceros  tttcttaaatc-ctttttgt---ttcaaagcaga
B D                       Cat  cttctttaatc-ctttttgt---gtcagagtaga
B D                       Dog  tttcttaaatc-cttttcgt---atcaaagtaga
B D                   Ferret   tt--ttgcatc-cttttcac---atcgaagtaga
B D                     Panda  tttcttaaatc-cttttcct---atcaaaataga
               Pacific walrus  tttcttaaatc-cttttcgt---atcaaagtaga
                 Weddell seal  tttcttaaatc-cttttcgt---atcaaagtaga
             Black flying-fox  tttcttaaatc-ctttttgt---gtcaaagcaga
B D                   Megabat  tttcttaaatc-ctttttgt---gtcaaagcaga
                Big brown bat  ttt-ttaaagt-ctttttgt---gtccaagcaga
         David's myotis (bat)  tttcttaaagt-ctttttct---gtacaagcaga
B D                  Microbat  tttcttaaagt-ctttttgt---gtccaagcaga
              Star-nosed mole  tttttttaatt-cttt--gt---gtcaaggctaa
B D                  Elephant  --------------ttttgt---ttcaaagcaga
          Cape elephant shrew  tatcctaaatc-atttttgt---tttaatgcaga
B D                   Manatee  tgtcttaaatc-ctttttgt---tttaaagcagg
             Cape golden mole  tagtttaaatt-ctttttgt---tttaaatctga
B D                    Tenrec  tgtctgaaacc-ttttttgt---tttaaagcaga
                     Aardvark  tttcttaaatc-ctttttgt---tttaaagcaga
B D                 Armadillo  tgtcttaagtc-ccttttgt---gccaaaacaga
      Lesser Egyptian jerboa  ==================================
B D                   Gorilla  ----------------------------------
B D                  Hedgehog  ==================================
B D                     Shrew  ==================================
B D                Coelacanth  ==================================
  D    Spiny softshell turtle  ==================================
B D             X. tropicalis  ==================================
B D              Atlantic cod  ==================================
                 Spotted gar  ==================================
B D               Stickleback  ==================================
          Southern platyfish  ==================================
      Yellowbelly pufferfish  ==================================
B D                      Fugu  ==================================
B D                    Turkey  ==================================
B D                   Chicken  ==================================
  D              Mallard duck  ==================================
          Tibetan ground jay  ==================================
B D               Zebra finch  ==================================
  D    White-throated sparrow  ==================================
B D           Tasmanian devil  ==================================
    Mexican tetra (cavefish)  ==================================
B D                    Medaka  ==================================
         Pundamilia nyererei  ==================================
                 Zebra mbuna  ==================================
       Burton's mouthbreeder  ==================================
         Princess of Burundi  ==================================
B D              Nile tilapia  ==================================
  D            Painted turtle  ==================================
  D           Green seaturtle  ==================================
B D        American alligator  ==================================
  D             Scarlet macaw  ==================================
B D                Budgerigar  ==================================
B D                   Opossum  ==================================
  D               Rock pigeon  ==================================
  D       Collared flycatcher  ==================================
B D       Medium ground finch  ==================================
B D                    Lizard  ==================================
  D          Peregrine falcon  ==================================
  D              Saker falcon  ==================================
  D                    Parrot  ==================================
B D                  Platypus  ==================================
B D                   Wallaby  ==================================
  D  Chinese softshell turtle  ==================================

Inserts between block 19 and 20 in window
B D                      Rat 163bp

Alignment block 20 of 546 in window, 174959473 - 174959518, 46 bps 
B D                     Human  tatgtatacattaatag-------taagatgtacat-t----attttt----------------------
B D                     Chimp  tatgtatacattaatag-------taagatgtacat-t----attttt----------------------
B D                 Orangutan  tatgtatacattaatag-------taagatgtacat-t----attttt----------------------
B D                    Gibbon  tatgtatacattaatag-------taagatatacat-t----attttt----------------------
B D                    Rhesus  tatgtatacattaatag-------taagatgtacat-t----attttt----------------------
B D       Crab-eating macaque  tatgtatacattaatag-------taagatgtacat-t----attttt----------------------
B D                    Baboon  tatgtatacattaatag-------taagatgtacat-t----attttt----------------------
B D              Green monkey  tatgtatacattaatag-------taagatgtacat-t----attttt----------------------
B D                  Marmoset  tatgtatacatgaatag-------taagatggacat-t----attttt----------------------
B D           Squirrel monkey  tatgtatacatgaatag-------tgagatgtacat-t----gttttt----------------------
B D                  Bushbaby  tatgtataaataagtag-------tatgaagca----t----attttt----------------------
           Chinese tree shrew  tgtgtatacataaagag-------taaaatgtgtat-g----ttttaa----------------------
B D                  Squirrel  tatgtataagtaaatag-------taaaatgtgtgt-t----attttt----------------------
                 Prairie vole  catgtataaatatat-------------------------------------------------------
B D           Chinese hamster  catgtataaa------------------------------------------------------------
               Golden hamster  catgtataaa------------------------------------------------------------
B D                     Mouse  catgtataaa------------------------------------------------------------
B D            Naked mole-rat  tatgtataaataaacaa-------tattatatatat-t----attttt----------------------
B D                Guinea pig  tatgtataaataaataa-------t--gatatatat-t----cctttt----------------------
                   Chinchilla  tatgtataaataaataa-------tgtgatgtatat-t----attttt----------------------
             Brush-tailed rat  tatgtatgtataaataa-------t---atgtattt-t----attttt----------------------
B D                    Rabbit  taagtgtaga----tgg-------taacatgcatgt-g----attctt----------------------
B D                      Pika  tatgtatgaa----caa-------taatgtgtatat-t-----ttttt----------------------
B D                       Pig  tacgtataaataagtat------------tgcatat-t----atcttt----------------------
B D                    Alpaca  tacgtatgtataaatag-------tatgatgcatat-t----attttt----------------------
               Bactrian camel  tacgtatgtataaatag-------tatgatgcatat----------------------------------
B D                   Dolphin  tatgtataaataaatag-------tacaatgcatat-t----atttct----------------------
                 Killer whale  tatgtataaataaatag-------tacaatgcatat-t----atttct----------------------
             Tibetan antelope  tatgtataagtgaatag-------tataatgcgtat-tattatttttt----------------------
B D                       Cow  tacgtataagtgaatag-------tacaatgtgtat-tattatttttt----------------------
B D                     Sheep  tacgtataagtgaatag-------tataatgcata-------tttttt----------------------
                Domestic goat  tacgtataagtgaatag-------tataatgcgtat-t----tttttt----------------------
B D                     Horse  aatgtatagataaatag-------tacaatgtatag-t----attttt----------------------
B D          White rhinoceros  aatgtatagataaatag-------tacactgtatat-t----attttt----------------------
B D                       Cat  tctgt----acaaacgg-------cacaaggcttat-t----atgttt----------------------
B D                       Dog  tatgt----ataaacag-------tgcagtgtatat-t----attttt----------------------
B D                   Ferret   tacgt----gtgaacag-------tacagtgcatat-t----atttgt----------------------
B D                     Panda  tatgt----ataaacag-------tacagtacatat-t----attttt----------------------
               Pacific walrus  tatgt----ataaatag-------tacagtgcatat-t----attttt----------------------
                 Weddell seal  tatgt----ataaatag-------tacagtgcatat-t----attttt----------------------
             Black flying-fox  tatgtataaataaatag-------tacgatgcatat-t----attttt----------------------
B D                   Megabat  tatgtataaataaatag-------tacgatgcatat-t----attttt----------------------
                Big brown bat  tacatacaaataaatag-------tacaatgcataa-t----attatt----------------------
         David's myotis (bat)  tacatataaataaatag-------tacaatgcataa-t----cttatt----------------------
B D                  Microbat  tacatgtaaataaatag-------tgcaatgcataa-t----attatt----------------------
              Star-nosed mole  tatgtataaataaatag-------tataaagcattt-t----tttttt----------------------
B D                  Elephant  tatgtataaataaatag-------taagatgcatac-t----attttt----------------------
          Cape elephant shrew  tatgtatgaataaatag-------taagatgcatac-t----gtattt----------------------
B D                   Manatee  tatgtatgaataaatag-------taagatgcatac-t----gttttt----------------------
             Cape golden mole  tgtgtagaaataaatagattaaaaaaagatacatac-t----attttttt--------------------
B D                    Tenrec  taggtagaagtaaacag---------agat-catatat----gattttgt--------------------
                     Aardvark  tatgaaaaaataaatag-------taagatgcgtac-t----atttcatttatttatttatttggcttta
B D                 Armadillo  tacata----taaatag-------taagatgcatat-t----atttt-----------------------
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                   Gorilla  ----------------------------------------------------------------------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                  Platypus  ======================================================================
B D                   Wallaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ------------------------------------------------aa-----ag--tact-------
                        Chimp  ------------------------------------------------aa-----ag--tact-------
                    Orangutan  ------------------------------------------------aa-----ag--tact-------
                       Gibbon  ------------------------------------------------aa-----ag--tact-------
                       Rhesus  ------------------------------------------------aa-----at--tact-------
          Crab-eating macaque  ------------------------------------------------aa-----at--tact-------
                       Baboon  ------------------------------------------------aa-----at--tact-------
                 Green monkey  ------------------------------------------------aa-----at--tact-------
                     Marmoset  ------------------------------------------------aa-----ag--tact-------
              Squirrel monkey  ------------------------------------------------aa-----ag--tact-------
                     Bushbaby  ------------------------------------------------ta-----ag--tacttattaca
           Chinese tree shrew  ------------------------------------------------aa-----ag--tgtt-------
                     Squirrel  ------------------------------------------------aa-----aaagtgct-------
                 Prairie vole  -----------------------------------------------------------caat-------
              Chinese hamster  -----------------------------------------------------------cact-------
               Golden hamster  -----------------------------------------------------------cact-------
                        Mouse  -----------------------------------------------------------cact-------
               Naked mole-rat  ------------------------------------------------aa-----aat-cact-------
                   Guinea pig  ------------------------------------------------ta-----ag-------------
                   Chinchilla  ------------------------------------------------aa-----ag--tact-------
             Brush-tailed rat  ------------------------------------------------aa-----ag--cact-------
                       Rabbit  ------------------------------------------------aa-----ag--cact-------
                         Pika  ------------------------------------------------aa-----ac--tact-------
                          Pig  ------------------------------------------------ta--aaa------at-------
                       Alpaca  ------------------------------------------------t---aaaag--taat-------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ------------------------------------------------ta--aaaag--taat-------
                 Killer whale  ------------------------------------------------ta--aaaag--taat-------
             Tibetan antelope  ------------------------------------------------ta--aaaag--tgac-------
                          Cow  ------------------------------------------------tt--taaag--tgac-------
                        Sheep  ------------------------------------------------tt--taaag--tgac-------
                Domestic goat  ------------------------------------------------tt--ttaag--tgac-------
                        Horse  ------------------------------------------------ta--aaaag--cact-------
             White rhinoceros  ------------------------------------------------ta--aaaa------t-------
                          Cat  ------------------------------------------------ta--aaaag--tcct-------
                          Dog  ------------------------------------------------ta--aagag--tact-------
                      Ferret   ------------------------------------------------tc--aagag--tact-------
                        Panda  ------------------------------------------------ta--aagag--tact-------
               Pacific walrus  ------------------------------------------------tg--aagag--tact-------
                 Weddell seal  ------------------------------------------------ta--aagag--tact-------
             Black flying-fox  ------------------------------------------------tg----aaa--tgct-------
                      Megabat  ------------------------------------------------tg----aaa--tgct-------
                Big brown bat  ------------------------------------------------tttaaaaaa--tgct-------
         David's myotis (bat)  ------------------------------------------------tt--aaaaa--tgtt-------
                     Microbat  ------------------------------------------------tt--aaaaa--tgtt-------
              Star-nosed mole  ------------------------------------------------aa-----------tt-------
                     Elephant  ------------------------------------------------ca--aaaaa--cac--------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ------------------------------------------------ca--aaaag--ttt--------
             Cape golden mole  ------------------------------------------------tt--aaatg--tact-------
                       Tenrec  ------------------------------------------------tt--aaaag--tacc-------
                     Aardvark  acaaacaggagtttattctcttacagtttaggaggctagaagtccgagtt--caaag--tgcc-------
                    Armadillo  ------------------------------------------------ta--aaaag--tatt-------
                          Rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                      Gorilla  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                     Platypus  ======================================================================
                      Wallaby  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ta
                        Chimp  ta
                    Orangutan  ta
                       Gibbon  ta
                       Rhesus  ta
          Crab-eating macaque  ta
                       Baboon  ta
                 Green monkey  ta
                     Marmoset  ta
              Squirrel monkey  ta
                     Bushbaby  ta
           Chinese tree shrew  tc
                     Squirrel  ta
                 Prairie vole  ta
              Chinese hamster  ta
               Golden hamster  ta
                        Mouse  ta
               Naked mole-rat  ta
                   Guinea pig  --
                   Chinchilla  ta
             Brush-tailed rat  ta
                       Rabbit  tc
                         Pika  ta
                          Pig  ta
                       Alpaca  ta
               Bactrian camel  --
                      Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  ta
                          Cow  ta
                        Sheep  ta
                Domestic goat  ta
                        Horse  ta
             White rhinoceros  ta
                          Cat  ta
                          Dog  ta
                      Ferret   tc
                        Panda  tg
               Pacific walrus  tc
                 Weddell seal  tc
             Black flying-fox  ta
                      Megabat  ta
                Big brown bat  ta
         David's myotis (bat)  ta
                     Microbat  ta
              Star-nosed mole  ta
                     Elephant  --
          Cape elephant shrew  --
                      Manatee  -a
             Cape golden mole  aa
                       Tenrec  aa
                     Aardvark  ta
                    Armadillo  tt
                          Rat  ==
       Lesser Egyptian jerboa  ==
                      Gorilla  --
                     Hedgehog  ==
                        Shrew  ==
                   Coelacanth  ==
       Spiny softshell turtle  ==
                X. tropicalis  ==
                 Atlantic cod  ==
                  Spotted gar  ==
                  Stickleback  ==
           Southern platyfish  ==
       Yellowbelly pufferfish  ==
                         Fugu  ==
                       Turkey  ==
                      Chicken  ==
                 Mallard duck  ==
           Tibetan ground jay  ==
                  Zebra finch  ==
       White-throated sparrow  ==
              Tasmanian devil  ==
     Mexican tetra (cavefish)  ==
                       Medaka  ==
          Pundamilia nyererei  ==
                  Zebra mbuna  ==
        Burton's mouthbreeder  ==
          Princess of Burundi  ==
                 Nile tilapia  ==
               Painted turtle  ==
              Green seaturtle  ==
           American alligator  ==
                Scarlet macaw  ==
                   Budgerigar  ==
                      Opossum  ==
                  Rock pigeon  ==
          Collared flycatcher  ==
          Medium ground finch  ==
                       Lizard  ==
             Peregrine falcon  ==
                 Saker falcon  ==
                       Parrot  ==
                     Platypus  ==
                      Wallaby  ==
     Chinese softshell turtle  ==

Inserts between block 20 and 21 in window
                    Aardvark 132bp

Alignment block 21 of 546 in window, 174959519 - 174959527, 9 bps 
B D                     Human  --taacatg-t----a
B D                     Chimp  --taacatg-t----a
B D                 Orangutan  --taacatg-t----a
B D                    Gibbon  --taacatg-t----a
B D                    Rhesus  --taacatg-t----a
B D       Crab-eating macaque  --taacatg-t----a
B D                    Baboon  --taacatg-t----a
B D              Green monkey  --taacatg-t----a
B D                  Marmoset  --taacatg-t----a
B D           Squirrel monkey  --taacatg-t----a
B D                  Bushbaby  --taacctg-t----a
           Chinese tree shrew  --taacatg-t----a
B D                  Squirrel  --taacatg-t----a
                 Prairie vole  --taaactg-t----a
B D           Chinese hamster  --taagccg-t----a
               Golden hamster  --taaactg-t----a
B D                     Mouse  --taaacaa-t----a
B D            Naked mole-rat  --taatatg-t----a
B D                Guinea pig  --tgactta-t----a
                   Chinchilla  --taatatg-t----a
             Brush-tailed rat  --taatatg-t----a
B D                    Rabbit  --caacatg-t----a
B D                      Pika  --gaacatg-t----a
B D                       Pig  --tcacata-c-a---
B D                    Alpaca  --tcacacg-t-----
               Bactrian camel  --ttataga-c-----
B D                   Dolphin  --tcacaca-ta----
                 Killer whale  --tcacaca-t-----
             Tibetan antelope  --tcacata-t-----
B D                       Cow  --tcataca-t-----
B D                     Sheep  --tcacata-t-----
                Domestic goat  --tcacata-t-----
B D                     Horse  --tcgcaca-t--a--
B D          White rhinoceros  --ccacaca-t--a--
B D                       Cat  --tcacgcatt--a--
B D                       Dog  --tcacacg-c--a--
B D                   Ferret   --ccacaca-------
B D                     Panda  --tcacatg-t--a--
               Pacific walrus  --tcacatg-t--a--
                 Weddell seal  --tcacatg-t--a--
             Black flying-fox  --ccgcaca-t--g--
B D                   Megabat  --ccgcaca-t--g--
                Big brown bat  --ccacaca-------
         David's myotis (bat)  --ccacaca-------
B D                  Microbat  --ccacaca-------
              Star-nosed mole  --ccacaca-t---a-
B D                  Elephant  ttatgcata-------
          Cape elephant shrew  tcatgcatt-------
B D                   Manatee  tcttgcata-------
             Cape golden mole  ttatacata-------
B D                    Tenrec  ----acata-------
                     Aardvark  tcatgcata-------
B D                 Armadillo  ttacactta-------
B D                       Rat  ================
      Lesser Egyptian jerboa  ================
B D                   Gorilla  ----------------
B D                  Hedgehog  ================
B D                     Shrew  ================
B D                Coelacanth  ================
  D    Spiny softshell turtle  ================
B D             X. tropicalis  ================
B D              Atlantic cod  ================
                 Spotted gar  ================
B D               Stickleback  ================
          Southern platyfish  ================
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D              Mallard duck  ================
          Tibetan ground jay  ================
B D               Zebra finch  ================
  D    White-throated sparrow  ================
B D           Tasmanian devil  ================
    Mexican tetra (cavefish)  ================
B D                    Medaka  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D              Nile tilapia  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
B D        American alligator  ================
  D             Scarlet macaw  ================
B D                Budgerigar  ================
B D                   Opossum  ================
  D               Rock pigeon  ================
  D       Collared flycatcher  ================
B D       Medium ground finch  ================
B D                    Lizard  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D                    Parrot  ================
B D                  Platypus  ================
B D                   Wallaby  ================
  D  Chinese softshell turtle  ================

Inserts between block 21 and 22 in window
B D                  Dolphin 253bp

Alignment block 22 of 546 in window, 174959528 - 174959535, 8 bps 
B D                     Human  agatt-----------------------------------------------atc
B D                     Chimp  agatt-----------------------------------------------atc
B D                 Orangutan  agatt-----------------------------------------------atc
B D                    Gibbon  agatt-----------------------------------------------atc
B D                    Rhesus  agatt-----------------------------------------------atc
B D       Crab-eating macaque  agatt-----------------------------------------------atc
B D                    Baboon  agatt-----------------------------------------------atc
B D              Green monkey  agatt-----------------------------------------------atc
B D                  Marmoset  agatc-----------------------------------------------atc
B D           Squirrel monkey  agatt-----------------------------------------------atc
B D                  Bushbaby  agacg-----------------------------------------------gtc
           Chinese tree shrew  aggta-----------------------------------------------atc
B D                  Squirrel  ggatt--------------------------------------------atc---
                 Prairie vole  agatt--------------------------------------------------
B D           Chinese hamster  ggatt--------------------------------------------------
               Golden hamster  agatt--------------------------------------------------
B D                     Mouse  acattatttgtaaagtttccactgagataaaattaaacttttaaaaatc------
B D            Naked mole-rat  agatt-----------------------------------------------atc
B D                Guinea pig  agatt-----------------------------------------------atc
                   Chinchilla  agatt-----------------------------------------------atc
             Brush-tailed rat  agttt-----------------------------------------------atc
B D                    Rabbit  agatc-----------------------------------------------att
B D                      Pika  agatt-----------------------------------------------att
B D                       Pig  -aact-----------------------------------------------atc
B D                    Alpaca  agact-----------------------------------------------gtt
               Bactrian camel  agact-----------------------------------------------att
B D                   Dolphin  atact-----------------------------------------------att
                 Killer whale  atact-----------------------------------------------att
             Tibetan antelope  atact-----------------------------------------------att
B D                       Cow  atact-----------------------------------------------att
B D                     Sheep  atact-----------------------------------------------att
                Domestic goat  atact-----------------------------------------------att
B D                     Horse  agact-----------------------------------------------a--
B D          White rhinoceros  agact-----------------------------------------------atc
B D                       Cat  agacc-----------------------------------------------gtt
B D                       Dog  agact-----------------------------------------------ttc
B D                     Panda  agact-----------------------------------------------tgt
               Pacific walrus  agact-----------------------------------------------ttc
                 Weddell seal  agact-----------------------------------------------ttc
             Black flying-fox  agact-----------------------------------------------atc
B D                   Megabat  agact-----------------------------------------------atc
                Big brown bat  gcact-----------------------------------------------atc
         David's myotis (bat)  gcact-----------------------------------------------atc
B D                  Microbat  gcact-----------------------------------------------atc
              Star-nosed mole  agact-----------------------------------------------atc
B D                  Elephant  agatt-----------------------------------------------atc
          Cape elephant shrew  agata-----------------------------------------------atc
B D                   Manatee  agatt-----------------------------------------------atc
             Cape golden mole  acatt-----------------------------------------------atc
B D                    Tenrec  acatt-----------------------------------------------atc
                     Aardvark  agatt-----------------------------------------------atc
B D                 Armadillo  agatt-----------------------------------------------ata
B D                       Rat  =======================================================
      Lesser Egyptian jerboa  =======================================================
B D                   Gorilla  -------------------------------------------------------
B D                  Hedgehog  =======================================================
B D                     Shrew  =======================================================
B D                Coelacanth  =======================================================
  D    Spiny softshell turtle  =======================================================
B D             X. tropicalis  =======================================================
B D              Atlantic cod  =======================================================
                 Spotted gar  =======================================================
B D               Stickleback  =======================================================
          Southern platyfish  =======================================================
      Yellowbelly pufferfish  =======================================================
B D                      Fugu  =======================================================
B D                    Turkey  =======================================================
B D                   Chicken  =======================================================
  D              Mallard duck  =======================================================
          Tibetan ground jay  =======================================================
B D               Zebra finch  =======================================================
  D    White-throated sparrow  =======================================================
B D           Tasmanian devil  =======================================================
    Mexican tetra (cavefish)  =======================================================
B D                    Medaka  =======================================================
         Pundamilia nyererei  =======================================================
                 Zebra mbuna  =======================================================
       Burton's mouthbreeder  =======================================================
         Princess of Burundi  =======================================================
B D              Nile tilapia  =======================================================
  D            Painted turtle  =======================================================
  D           Green seaturtle  =======================================================
B D        American alligator  =======================================================
  D             Scarlet macaw  =======================================================
B D                Budgerigar  =======================================================
B D                   Opossum  =======================================================
  D               Rock pigeon  =======================================================
  D       Collared flycatcher  =======================================================
B D       Medium ground finch  =======================================================
B D                    Lizard  =======================================================
  D          Peregrine falcon  =======================================================
  D              Saker falcon  =======================================================
  D                    Parrot  =======================================================
B D                  Platypus  =======================================================
B D                   Wallaby  =======================================================
  D  Chinese softshell turtle  =======================================================
B D                   Ferret   -------------------------------------------------------

Inserts between block 22 and 23 in window
B D                 Squirrel 3bp
                Prairie vole 6bp
B D          Chinese hamster 5bp
              Golden hamster 21bp
B D                    Mouse 5bp

Alignment block 23 of 546 in window, 174959536 - 174959540, 5 bps 
B D                     Human  aatat
B D                     Chimp  aatat
B D                 Orangutan  aatat
B D                    Gibbon  aatat
B D                    Rhesus  agtta
B D       Crab-eating macaque  agtta
B D                    Baboon  agtgt
B D              Green monkey  agtgt
B D                  Marmoset  aatgt
B D           Squirrel monkey  aatat
B D                  Bushbaby  agtgt
           Chinese tree shrew  agtgt
               Golden hamster  at---
B D                       Rat  aa---
B D            Naked mole-rat  aatta
B D                Guinea pig  aa---
                   Chinchilla  aa---
             Brush-tailed rat  ag---
B D                       Pig  gatgt
B D                    Alpaca  gatgt
               Bactrian camel  gatgt
B D                   Dolphin  gatgt
                 Killer whale  gatgt
             Tibetan antelope  gatgt
B D                       Cow  gatgt
B D                     Sheep  gatgt
                Domestic goat  gatgt
B D                     Horse  --tgt
B D          White rhinoceros  agtgt
B D                       Cat  agtgt
B D                       Dog  agtgt
B D                   Ferret   ---gt
B D                     Panda  aatgt
               Pacific walrus  aatgt
                 Weddell seal  aatat
             Black flying-fox  aatgt
B D                   Megabat  aatgt
                Big brown bat  aatgt
         David's myotis (bat)  aatgt
B D                  Microbat  agtgt
              Star-nosed mole  agtat
B D                  Elephant  aacct
          Cape elephant shrew  agtgt
B D                   Manatee  aatgt
             Cape golden mole  gatgt
B D                    Tenrec  aatat
                     Aardvark  aat--
B D                 Armadillo  aatgt
                Prairie vole  =====
B D                     Mouse  =====
      Lesser Egyptian jerboa  =====
B D                      Pika  -----
B D                   Gorilla  -----
B D                  Hedgehog  =====
B D                     Shrew  =====
B D                    Rabbit  -----
B D                Coelacanth  =====
  D    Spiny softshell turtle  =====
B D             X. tropicalis  =====
B D              Atlantic cod  =====
                 Spotted gar  =====
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                    Medaka  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
  D             Scarlet macaw  =====
B D                Budgerigar  =====
B D                   Opossum  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
B D                  Platypus  =====
B D                   Wallaby  =====
B D           Chinese hamster  =====
  D  Chinese softshell turtle  =====
B D                  Squirrel  =====

Inserts between block 23 and 24 in window
            Cape golden mole 212bp
B D                   Tenrec 3bp

Alignment block 24 of 546 in window, 174959541 - 174959546, 6 bps 
B D                     Human  gtatag
B D                     Chimp  gtatag
B D                 Orangutan  gtatag
B D                    Gibbon  gtatag
B D                    Rhesus  gtatag
B D       Crab-eating macaque  gtatag
B D                    Baboon  gcatag
B D              Green monkey  gtatag
B D                  Marmoset  atatag
B D           Squirrel monkey  gcgtag
B D                  Bushbaby  gtatag
           Chinese tree shrew  gtttag
B D                  Squirrel  --atat
                 Prairie vole  --acag
B D           Chinese hamster  --acag
               Golden hamster  -cacag
B D                       Rat  -catca
B D            Naked mole-rat  gtatag
B D                Guinea pig  -catag
                   Chinchilla  -catag
             Brush-tailed rat  -gatag
B D                    Rabbit  ----ag
B D                      Pika  ----tg
B D                       Pig  atatag
B D                    Alpaca  atacag
               Bactrian camel  atacag
B D                   Dolphin  gtacag
                 Killer whale  gtacag
             Tibetan antelope  gtacaa
B D                       Cow  gtacaa
B D                     Sheep  gtacag
                Domestic goat  gtacag
B D                     Horse  gtacaa
B D          White rhinoceros  gtacaa
B D                       Cat  gtgcca
B D                       Dog  gtgcac
B D                   Ferret   gttcac
B D                     Panda  gtgcac
               Pacific walrus  gtgcac
                 Weddell seal  gtgcac
             Black flying-fox  gtacaa
B D                   Megabat  gtacaa
                Big brown bat  gtatac
         David's myotis (bat)  gtataa
B D                  Microbat  gtataa
              Star-nosed mole  atatgg
B D                  Elephant  --gtag
          Cape elephant shrew  --gtag
B D                   Manatee  --gtag
B D                    Tenrec  --gtag
B D                 Armadillo  --gctg
B D                     Mouse  ======
      Lesser Egyptian jerboa  ======
B D                   Gorilla  ------
B D                  Hedgehog  ======
B D                     Shrew  ======
            Cape golden mole  ======
                    Aardvark  ------
B D                Coelacanth  ======
  D    Spiny softshell turtle  ======
B D             X. tropicalis  ======
B D              Atlantic cod  ======
                 Spotted gar  ======
B D               Stickleback  ======
          Southern platyfish  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                    Turkey  ======
B D                   Chicken  ======
  D              Mallard duck  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
  D    White-throated sparrow  ======
B D           Tasmanian devil  ======
    Mexican tetra (cavefish)  ======
B D                    Medaka  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D        American alligator  ======
  D             Scarlet macaw  ======
B D                Budgerigar  ======
B D                   Opossum  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D       Medium ground finch  ======
B D                    Lizard  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D                    Parrot  ======
B D                  Platypus  ======
B D                   Wallaby  ======
  D  Chinese softshell turtle  ======

Inserts between block 24 and 25 in window
B D                 Elephant 2bp
         Cape elephant shrew 2bp
B D                  Manatee 2bp
B D                   Tenrec 2bp
B D                Armadillo 2bp

Alignment block 25 of 546 in window, 174959547 - 174959563, 17 bps 
B D                     Human  tttt-----------t---attgaga-gatca
B D                     Chimp  tttt-----------t---attgaga-gatca
B D                 Orangutan  tttt-----------t---attgaga-gatca
B D                    Gibbon  tttt-----------t---attgaga-gatca
B D                    Rhesus  tttt-----------t---attgaga-gatca
B D       Crab-eating macaque  tttt-----------t---attgaga-gatca
B D                    Baboon  -ttt-----------t---attgaga-gatca
B D              Green monkey  tttt-----------t---attgaga-gatca
B D                  Marmoset  ttt-----------------ttgaga-gatca
B D           Squirrel monkey  ttt-----------------ttgaga-gatca
B D                  Bushbaby  tttt-----------t---attgagg-gatca
           Chinese tree shrew  tttt-----------t---attgagg-gatca
B D                  Squirrel  tttt-----------c---a--ttga-ag---
                 Prairie vole  ttt-------------------ttat-tg---
B D           Chinese hamster  ttt-------------------tcat-tg---
               Golden hamster  ttta-----------a---aaatagg-ta---
B D                       Rat  ctta-----------c---aaactgt-aa---
B D            Naked mole-rat  tttt-----------t---aattgaa-ga---
B D                Guinea pig  tgta-----------t---aattgaa-gg---
                   Chinchilla  tttt-----------t---aattggt-gg---
             Brush-tailed rat  tttt-----------t---aattagg-gg---
B D                    Rabbit  tgtgcggaattttact---gagggag-ca---
B D                      Pika  tgta------------------------a---
B D                       Pig  tttt-----------t---actgagc-aatca
B D                    Alpaca  ttgt-----------t---actgaga-gatca
               Bactrian camel  ctgt-----------t---actgaga-gatca
B D                   Dolphin  tttt-----------t---actgaag-ggtca
                 Killer whale  tttt-----------t---actgaag-ggtca
             Tibetan antelope  tttt-----------a---actgagg-agtca
B D                       Cow  tttt-----------t---actgagg-aatca
B D                     Sheep  tttt-----------a---actgagg-agtca
                Domestic goat  tttt-----------a---actgagg-agtca
B D                     Horse  tttt-----------t---actgaaa-gatca
B D          White rhinoceros  tttt-----------t---actgagg-gatca
B D                       Cat  gttt-----------t---actgagg-gacca
B D                       Dog  attt-----------t---actgaga-gacca
B D                   Ferret   attt-----------t---actgtgg-gatca
B D                     Panda  gttt-----------t---actgagg-gacca
               Pacific walrus  attt-----------t---actgagg-gacca
                 Weddell seal  attt-----------t---actgagg-gacca
             Black flying-fox  tttt-----------t---cttgagg-gatca
B D                   Megabat  ttct-----------t---cttgagg-gatca
                Big brown bat  tttt-----------t---attgtgg-gatca
         David's myotis (bat)  tttt-----------t---attgtgg-gatca
B D                  Microbat  tttt-----------t---attgtcg-ggtca
              Star-nosed mole  tttt-----------t---cgtaaggagatca
B D                  Elephant  tttc-----------t---attgaag-gttca
          Cape elephant shrew  tttt-----------ttaagttgcct-gttca
B D                   Manatee  tttt-----------t---attgaag-gttca
             Cape golden mole  tttt-----------a---attgaag-gttca
B D                    Tenrec  gttt-----------a---atcagga-gttc-
                     Aardvark  tttc-----------t---tttagag-gttcg
B D                 Armadillo  tttc-----------t---attgaag-gatca
B D                     Mouse  ================================
      Lesser Egyptian jerboa  ================================
B D                   Gorilla  --------------------------------
B D                  Hedgehog  ================================
B D                     Shrew  ================================
B D                Coelacanth  ================================
  D    Spiny softshell turtle  ================================
B D             X. tropicalis  ================================
B D              Atlantic cod  ================================
                 Spotted gar  ================================
B D               Stickleback  ================================
          Southern platyfish  ================================
      Yellowbelly pufferfish  ================================
B D                      Fugu  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
  D              Mallard duck  ================================
          Tibetan ground jay  ================================
B D               Zebra finch  ================================
  D    White-throated sparrow  ================================
B D           Tasmanian devil  ================================
    Mexican tetra (cavefish)  ================================
B D                    Medaka  ================================
         Pundamilia nyererei  ================================
                 Zebra mbuna  ================================
       Burton's mouthbreeder  ================================
         Princess of Burundi  ================================
B D              Nile tilapia  ================================
  D            Painted turtle  ================================
  D           Green seaturtle  ================================
B D        American alligator  ================================
  D             Scarlet macaw  ================================
B D                Budgerigar  ================================
B D                   Opossum  ================================
  D               Rock pigeon  ================================
  D       Collared flycatcher  ================================
B D       Medium ground finch  ================================
B D                    Lizard  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
  D                    Parrot  ================================
B D                  Platypus  ================================
B D                   Wallaby  ================================
  D  Chinese softshell turtle  ================================

Inserts between block 25 and 26 in window
B D                   Rhesus 195bp
B D                 Bushbaby 1bp

Alignment block 26 of 546 in window, 174959564 - 174959604, 41 bps 
B D                     Human  aag--taggatta--aac------t--tc-----------------------------------------
B D                     Chimp  aag--taggatta--aac------t--tc-----------------------------------------
B D                 Orangutan  aag--taggatta--aac------t--tc-----------------------------------------
B D                    Gibbon  aag--taggatta--aac------t--tc-----------------------------------------
B D                    Rhesus  aag--tatgatta--aac------t--tt-----------------------------------------
B D       Crab-eating macaque  aag--taggatta--aac------t--tt-----------------------------------------
B D                    Baboon  aag--taggatta--aac------t--tt-----------------------------------------
B D              Green monkey  aag--taggatta--aac------t--tt-----------------------------------------
B D                  Marmoset  aag--taggatta--aac------t--tt-----------------------------------------
B D           Squirrel monkey  aag--taggatta--aac------t--tt-----------------------------------------
B D                  Bushbaby  aag--tagaatta--tac------t--tt-----------------------------------------
           Chinese tree shrew  aag--tagaact---ttt------t--tg-----------------------------------------
B D                  Squirrel  gac--taaacttt--cat------t--ga-----------------------------------------
                 Prairie vole  ata--tcaaatca--aac------t---------------------------------------------
B D           Chinese hamster  ata--taaaatca--cac------t--gt-----------------------------------------
               Golden hamster  ttt--taggttcaagtgt------t--gt-----------------------------------------
B D                     Mouse  -tt--taagttctagtat------t--gt-----------------------------------------
B D                       Rat  gat--taagttccaggat------t--gc-----------------------------------------
B D            Naked mole-rat  gta--tacaatta--aac------t--tt-----------------------------------------
B D                Guinea pig  ata--tacagtta--agc------t--tt-----------------------------------------
                   Chinchilla  ata--tacagtta--aac------t--tc-----------------------------------------
             Brush-tailed rat  gta--tacagtta--aac------t---------------------------------------------
B D                    Rabbit  gag--tagaaacg--aag------c--tg-----------------------------------------
B D                      Pika  aag--tagaaata--aaa------t--at-----------------------------------------
B D                       Pig  aag--cagaatta--aac------t--tt-------------------------------ttgtttgttt
B D                    Alpaca  aag--tagaataa--aac------t--tt-------------------------------t--------t
               Bactrian camel  aag--tagaataa--acc------t--tt-------------------------------t--------t
B D                   Dolphin  aag--tagaatta--aac------t--tt-------------------------------tttttggtct
                 Killer whale  aag--tagaatta--aac------t--tt-------------------------------tttttggtct
             Tibetan antelope  aag--tagaatta--aac------t--tt-------------------------------ttttgggcct
B D                       Cow  aag--tagaatta--aac---tt-t--tt-------------------------------tttttggcgt
B D                     Sheep  aag--tagaatta--aac------t--tt-------------------------------ttttgggcct
                Domestic goat  aag--tagaatta--aac------t--tt-------------------------------ttttgggcct
B D                     Horse  aag--tagaatta--aac------t--tt------------------------------ttttct----t
B D          White rhinoceros  aag--tagaatta--aac------g--tt------------------------------ttttgt----t
B D                       Cat  aag--tgaaatta--aac------t--tt-------------------------------ttgtt----t
B D                       Dog  aac--tagaatta--aac------t--tt---------------------------------ttt----t
B D                   Ferret   aag--tagaatta--aac------t--tt------------------------------ttttgt----t
B D                     Panda  acg--tagaatta--aac------t--tt----------------------------------gt----t
               Pacific walrus  aag--tagaatta--aac------t--tt-------------------------ttttgttttgt----t
                 Weddell seal  aag--tagaatta--aac------t--ttttttgttttgttttgttttgttttgttttgttttgt----t
             Black flying-fox  aag--taaaatta--aac------t--tt-------------------------------ttgtt----t
B D                   Megabat  aag--taaaatta--aac------t--tt-------------------------------ttgtt----t
                Big brown bat  aaa--tagaatta--aac------c--tt-------------------------------ttgtt----t
         David's myotis (bat)  aag--tagagcta--aac------c--tt-------------------------------ttgtt----t
B D                  Microbat  aag--tagagcta--aac------c--tt-------------------------------ttgtt----t
              Star-nosed mole  aag--tagaatta--aac------t--tt-----------------------------------------
B D                  Elephant  aag--tagaattg--aac---tt-t--gt----------------------------------------t
          Cape elephant shrew  atg--gaaaattg--aac------t--gt----------------------------------------t
B D                   Manatee  aag--tagaattg--aacttttt-t--gt----------------------------------------t
             Cape golden mole  atg--taaaatta--aactttttaa--at----------------------------------------t
B D                    Tenrec  ------aaagttg--aacttgtt-t--gt----------------------------------------t
                     Aardvark  aag--tacaattg--aacttttt-t--gt----------------------------------------t
B D                 Armadillo  aagtatagaattg--aacttttt-ttggt----------------------------------------t
      Lesser Egyptian jerboa  ======================================================================
B D                   Gorilla  ----------------------------------------------------------------------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D             X. tropicalis  ======================================================================
B