Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 262 in window, 128060096 - 128060119, 24 bps 
B D                     Human  tgtaacttacatatattgtaatca
B D                     Chimp  tgtaacttacatatattgtaatca
B D                   Gorilla  tgtaacttacatatattgtaatca
B D                 Orangutan  tgtaacttacatatattgtaatca
B D                    Gibbon  tgtaacttacatatattgtaatca
B D                    Rhesus  tgtaacttacacatattacattca
B D       Crab-eating macaque  tgtaacttacacatattacattca
B D                    Baboon  tgtaacttacacatattatattca
B D              Green monkey  tgtaacttacacatattgtatcca
B D                  Marmoset  tgtaatttacacatgttgtaatct
B D           Squirrel monkey  cgtaacttacacatattgtaatct
B D                  Bushbaby  cgtaacttgtacacact-cactca
           Chinese tree shrew  tataactggcacgtggt-cacccg
B D                  Squirrel  catagtttatgcata--ttaatca
                 Prairie vole  cataacttatacatactttaatca
B D           Chinese hamster  gataacttgtttatacattcatca
               Golden hamster  gataacttgtttatcctttcatca
B D                     Mouse  tataacttgtgcttactgtaatca
B D            Naked mole-rat  cataacttgtacatattttaatca
B D                Guinea pig  cataacttgtacatattgtaacga
                   Chinchilla  cataacttatacatatttcaatca
             Brush-tailed rat  c------tgtacataattcaacca
B D                    Rabbit  tacaacctgtacatattttcatca
B D                       Pig  cccagcttgtacatattttaatta
B D                   Dolphin  cctaaattgaacatattttaattg
                 Killer whale  cctaaattgaacatattttaattg
B D                     Horse  cctaagttgtacatattttaactg
B D          White rhinoceros  cctaagttgtacatattttaactg
B D                       Cat  -------------agttttagttg
B D                       Dog  cctaacttgtacctattttaattg
B D                   Ferret   cctaacttgtacatattttaaatg
B D                     Panda  cctaacttgcacatattttaatta
               Pacific walrus  cctaacttgta--------cattg
                 Weddell seal  cctaacttgtc-atattttaattg
             Black flying-fox  cttaacttgtacatattttagttg
B D                   Megabat  cttaacttgtacatattttagttg
B D                     Shrew  tcttccttacacat----------
              Star-nosed mole  cctaacttattcatttttcagtca
B D                  Elephant  cacgaaaaatcc-tgttaaacttt
B D                   Manatee  cctgacatatccattttttgatca
             Cape golden mole  cctaacttgtgtacattttaaaca
                     Aardvark  cctaacttgtacacattttaatca
B D                 Armadillo  ct--aactgtacatattttagcca
B D                      Pika  ========================
B D                  Hedgehog  ========================
B D                       Rat  ========================
      Lesser Egyptian jerboa  ========================
B D                    Tenrec  ========================
               Big brown bat  ========================
B D                       Cow  ========================
               Domestic goat  ========================
B D                     Sheep  ========================
            Tibetan antelope  ========================
B D                  Microbat  ========================
        David's myotis (bat)  ========================
              Bactrian camel  ========================
B D                    Alpaca  ========================
                 Spotted gar  ========================
B D                Coelacanth  ========================
B D                    Lizard  ========================
  D  Chinese softshell turtle  ========================
  D            Painted turtle  ========================
  D           Green seaturtle  ========================
  D              Mallard duck  ========================
B D        American alligator  ========================
B D                   Opossum  ========================
B D           Tasmanian devil  ========================

Inserts between block 1 and 2 in window
B D           Naked mole-rat 206bp

Alignment block 2 of 262 in window, 128060120 - 128060234, 115 bps 
B D                     Human  gggcacccaactt-----------------------------tatatattattttca------gtttttg
B D                     Chimp  gggcactcaactt-----------------------------tatatattattctca------gtttttg
B D                   Gorilla  gggcacccaactt-----------------------------tatatattattttca------gtttttg
B D                 Orangutan  gggcacccaactt-----------------------------tatatatcattttca------gtttttg
B D                    Gibbon  gggcacccaactt-----------------------------tatgtattattttca------gtttttg
B D                    Rhesus  aggcacccaactt-----------------------------tacatgttattttca------gtttttg
B D       Crab-eating macaque  aggcacccaactt-----------------------------tacatgttattttca------gtttttg
B D                    Baboon  aggcacccaactt-----------------------------tacatattattttca------gtttttg
B D              Green monkey  aggcacccaactt-----------------------------tatgtattattttca------gtttttg
B D                  Marmoset  gggcatccaactt-----------------------------tacatattattttcc------gtttttg
B D           Squirrel monkey  gggcacctaactt-----------------------------tacatattattttca------gtttttg
B D                  Bushbaby  ggacactcagc-c-----------------------------cgcgccttac------------tgttgg
           Chinese tree shrew  aggctcacggtc---------------------------------------------------gctgcgg
B D                  Squirrel  aagt--ttaacaa-----------------------------tggatagcattacca------ttttgca
                 Prairie vole  gggtgcttagctc-----------------------------tatatgctattgtgg------tttacca
B D           Chinese hamster  agatgcttagcta-----------------------------tacacgttattgtga------tttatca
               Golden hamster  aggtgcttagcta-----------------------------tacacgttattatga------tttatca
B D                     Mouse  aggctcttaactc-----------------------------tacatattagtgcca------atttccc
B D                Guinea pig  aggtgcttgagta-----------------------------tatgtattgttgcca------atttttg
                   Chinchilla  aggtgcttaagta-----------------------------tatgtattattgtca------ctttttg
             Brush-tailed rat  acatacttaatta-----------------------------tacgtattattgtta------atgtttg
B D                    Rabbit  cagcactcttgtg-----------------------------tatagattattttca----tttttttca
B D                       Pig  cagcacttaactc-----------------------------tatgtaccactacca--cattttta---
B D                   Dolphin  cagcaattaacca-----------------------------tatgtactattgtca--tagttttgttg
                 Killer whale  cagcaattaacca-----------------------------tatgtactactgtca--tagttttgttg
B D                     Horse  ctgcactgaacta-----------------------------tatgtgctattgtca--ttttttttttg
B D          White rhinoceros  cagcactgaacta-----------------------------tatgtactattgtca-----ttttcttg
B D                       Cat  aagcacttaactt-----------------------------caagtactattgtcgcttttttttattg
B D                       Dog  gagcactgaactg-----------------------------tatgtactactgtca--tttttttgttg
B D                   Ferret   aagtacttaactg-----------------------------tatgtactactgtca---ttttttgttc
B D                     Panda  gagcacataactg-----------------------------tatgtactatcatca---ttttttattg
               Pacific walrus  gagcacttaacta-----------------------------tatgtactattgtca---ttttttgttg
                 Weddell seal  gagcacttaactg-----------------------------tatgtactattgtca---ttttttattg
             Black flying-fox  cagaacttaacta-----------------------------taggtactattgtca-----tttttttc
B D                   Megabat  cagaacttaacta-----------------------------taggtactattgtca-----tttttttc
B D                     Shrew  -agc-tctag-----------------------------------atgctgctgtca------gattttg
              Star-nosed mole  gagcatttaact---------------------------------acactattatga------tatctta
B D                  Elephant  tagcacttaactg-----------------------------tatgcactattgtca-------tttttc
B D                   Manatee  cagcacttaactg-----------------------------taggcacgattgtca-------cttgtc
             Cape golden mole  taacacttaattg-----------------------------tatgcactattatca-------ttttaa
                     Aardvark  cagcacttaactg-----------------------------tacacactatggtaa-------ttttta
B D                 Armadillo  tagcacttgagtgcatatattctgcatatatatatatatatatatatattttttttt-------tttttt
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
               Big brown bat  ======================================================================
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D            Naked mole-rat  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ttta--------gttcccccc-tccacta---------gacaagaaactctt---tttggcatctttgat
                        Chimp  ttta--------gtt-ccccc-tccacta---------gacaagaaactctt---tttggcatctttgat
                      Gorilla  ttta--------attcccccc-tccacta---------gacaggaaactctt---tttggcatctttgat
                    Orangutan  ttta--------gttcccctc-tccacta---------gacaagaaaatctt---tttggcatctttgat
                       Gibbon  ttta--------gttcccccc-tccacta---------gacaagaaactctt---tttggcatctttgat
                       Rhesus  ttta--------gttcccccc-tccacta---------gacaaggaactctt---tttggcatctttgat
          Crab-eating macaque  ttta--------gttcccccc-tccacta---------gacaaggaactctt---tttggcatctttgat
                       Baboon  ttta--------gttcccccc-tccacta---------gacaaggaactctt---tttggcatctttgat
                 Green monkey  ttta--------gttcccccc-tccacta---------gacaaggaactctt---tttggcatctttgat
                     Marmoset  ttta--------gttcccccc-tccacta---------gacaaggaac--------------tctttgat
              Squirrel monkey  ttta--------gtt-ccccc-tcctcga---------gacaaggaac--------------tctttgat
                     Bushbaby  tgta--------gctcctgcc-tccgcta---------ggcagggagcccac---ggtggcatctttcac
           Chinese tree shrew  tttt--------gcacgtagc-tgcact----------------gctccgtt---tgtggcaactctgct
                     Squirrel  ttta--------gctgctccc-tccatta---------gacaatgaatagtt---tgtggaatctctgat
                 Prairie vole  ctca--------tctgcccct-tccccta---------gactgcaaactg-c---tgtgagatcttagat
              Chinese hamster  ctca--------gttgtctct-ccacc-a---------gacaatgaactg-c---tgcgagacttttgat
               Golden hamster  ctca--------gctgcccct-ccacc-----------gacaatgaactg-c---tgtgagacctttgat
                        Mouse  ctcg--------gctgctctt-tccctta---------gtcagtgaactg-c---tgtgagacctttgaa
                   Guinea pig  ctga--------gctactgtc-ttcacta---------tgcagtgactagtt---ggcagcatcttcgag
                   Chinchilla  ctta--------gcacctgtc-tccacta---------aacaatgaacagtt---tgtggcatctttgat
             Brush-tailed rat  ctta--------gctcctacc-tcgatta---------gacaatgaacatgt---tgtgacatctttgat
                       Rabbit  tcta--------gctcccttcaaacacta---------gatagtgagctatt---tgtggcacctttgat
                          Pig  -cca--------tct-ctcct-tcttcta---------gaccatgaactatt---tgtgacatctttgct
                      Dolphin  tcta--------tct-ttcct-tcctcta---------gacaatgaactgtt---cgtgacatctttgct
                 Killer whale  tcta--------tct-ttcct-tcctcta---------gacaatgaactgtt---cgtgacatctttgct
                        Horse  ttta--------tc--ctccc-tccacca---------ggaaatgaactttt---agtgacatctttgat
             White rhinoceros  ttta--------gc--ctcct-tctacca---------gacaatgaactctt---tgtgacatctttgat
                          Cat  ttta--------gt--ccctc-tccacta---------cacaatgaacagtt---tgtgacatctctgat
                          Dog  ttta--------tc--tcctg-tcctcta---------tgcaacacactgtt---tatggcatccccaat
                      Ferret   ttta--------tg--ccctc-tctactacatgaactgcacaatgaactgtt---tatgacacctcggat
                        Panda  ttta--------tc--tcctc-ttcctta---------cacaacaaactgtt---tatgacatctcagat
               Pacific walrus  ttta--------tc--ccctc-tccacta---------cacaacgaactgct---aatgacatctcagat
                 Weddell seal  ttta--------tc--ccctc-tctacta---------cacaaccaactgtt---aatgacatctcagat
             Black flying-fox  tatc--------tt--cccct-ttcacta---------gatgatgaactgtt---tgtgacattttttat
                      Megabat  tatc--------tt--cccct-ttcacta---------gatgatgaactgtt---tgtgacattttttat
                        Shrew  ctta--------tc--ttccc-ttcacta---------g-aaatgatctgct---tggggtaaccttggc
              Star-nosed mole  ttca------agat--ccccc-tctatta---------gaaaatgaactatt---tgtgacatctttga-
                     Elephant  cttag-------gcc-cccct-cccacta----------acaataaactgtt----atggcatctttgat
                      Manatee  ttta--------tcc-ccttg-cccatta----------gcaataaactg-------tggcatctttgat
             Cape golden mole  tgta---------tc-ccctc-ctcacta----------acaaaaaagtgtt-----ctgtgttttttat
                     Aardvark  ttag---------ca-tcctc-accacta----------acaaaaaactatt---tgtggcatctttgat
                    Armadillo  tttggtttagcctct-ccctt-cccccta------ctggataatgaactgtttgttgtggtatcttcgtt
                         Pika  ======================================================================
                     Hedgehog  ======================================================================
                          Rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Naked mole-rat  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  tattctacatc-tagttaaggatttctcagca
                        Chimp  tattctacatc-tagttaaggatttctcagca
                      Gorilla  tattctacatc-tagttaaggatttctcagca
                    Orangutan  tattctacatc-tagttaaagatttctcagca
                       Gibbon  tattctacatc-tagttaaggatttctcagca
                       Rhesus  tattctacatc-taattaaggatttctcagca
          Crab-eating macaque  tattctacatc-taattaaggatttctcagca
                       Baboon  tattctacatc-tagttaaggatttctcagca
                 Green monkey  tattctacatc-tagttaaggatttctcagca
                     Marmoset  tattctacatc-tagttaagggtttctcagca
              Squirrel monkey  tattctacatc-tagttaatggtttctcagca
                     Bushbaby  tattctgcatc-tagttaagtgtttctcgtct
           Chinese tree shrew  ggttctacgac-t-gctaagggcttctcggct
                     Squirrel  tgttctatatt-aagttagtggtttaacaatt
                 Prairie vole  tattctgcatc-tcactacttgtttctgaact
              Chinese hamster  tgttctatatc-tcactacccatttctcaact
               Golden hamster  tcttctatatc-tcactacccatttttcaact
                        Mouse  tattctacatc-ttactacctgtctcttaact
                   Guinea pig  ttttctagatc-cagtaaagagattctcaaga
                   Chinchilla  tattctagatc-tactaaagagtttctcaaga
             Brush-tailed rat  catcctagacc-tagtaaaagatttctcaaga
                       Rabbit  tattctacatt--------ggatttctcaaca
                          Pig  tattctgcgtg-tagttatgggttcctcaaca
                      Dolphin  tattccccatc-ttgctatgggtttctcaaca
                 Killer whale  tattctccatc-ttgttatgggtttctcaaca
                        Horse  tattctacgtc-tacttaagggtttctcaaca
             White rhinoceros  tattctgtatc-tacttaaaggtttctcaaga
                          Cat  tattctacatc-tgcttaagggttcctcaggg
                          Dog  tattctacatcttatttgaggattcttcaatg
                      Ferret   tattctatatc-tatttaaactttcctcaatg
                        Panda  tattctccatc-tatttaa-ggttcctcagtg
               Pacific walrus  tattctacatc-tatttaagggttcctcagtg
                 Weddell seal  tattctacatc-tatttaagggttcctcagtg
             Black flying-fox  tattctgtgtc-tggttaaggatttctcaacg
                      Megabat  tattctgtgtc-tggttaaggatttctcaacg
                        Shrew  tatctcctatc-taatgaagtgtttctcctct
              Star-nosed mole  ----------t-tggttaagggtttctctgca
                     Elephant  tgtcttagctc-tagtta-ggttttctcaaca
                      Manatee  tgtcttaactc-tagtta-ggttttcttgaca
             Cape golden mole  tgttttacttc-tagtta-gggtttctcagca
                     Aardvark  tgtcttttctc-tagtta-gtatttctcaaca
                    Armadillo  tgttgtacatc-tagtgaggggtttattgcca
                         Pika  ================================
                     Hedgehog  ================================
                          Rat  ================================
       Lesser Egyptian jerboa  ================================
                       Tenrec  ================================
                Big brown bat  ================================
                          Cow  ================================
                Domestic goat  ================================
                        Sheep  ================================
             Tibetan antelope  ================================
                     Microbat  ================================
         David's myotis (bat)  ================================
               Bactrian camel  ================================
                       Alpaca  ================================
               Naked mole-rat  ================================
                  Spotted gar  ================================
                   Coelacanth  ================================
                       Lizard  ================================
     Chinese softshell turtle  ================================
               Painted turtle  ================================
              Green seaturtle  ================================
                 Mallard duck  ================================
           American alligator  ================================
                      Opossum  ================================
              Tasmanian devil  ================================

Alignment block 3 of 262 in window, 128060235 - 128060301, 67 bps 
B D                     Human  a--tgatg-----atattggcattctgggccag-taattcttt-------gt-------ttttggag---
B D                     Chimp  a--tgatg-----atattggcattttgggccag-taattcttt-------gt-------ttttggag---
B D                   Gorilla  a--tgatg-----atattggcattttgggccag-taattcttt-------gt-------ttttggag---
B D                 Orangutan  a--tgatg-----atattggcattttgggccag-taattcttt-------gt-------ttttggag---
B D                    Gibbon  a--tggta-----ttattggcattttgggccag-taactcttt-------gt-------tttgggag---
B D                    Rhesus  a--tgatg-----atattggcattttgggccaa-taattcttt-------gt-------ttttggag---
B D       Crab-eating macaque  a--tgatg-----atattggcattttgggccaa-taattcttt-------gt-------ttttggag---
B D                    Baboon  a--tgatg-----atattggcatcttgggccaa-taattcttt-------gt-------ttttggag---
B D              Green monkey  a--tgatg-----atattggcattttgggccaa-taattcttt-------gt-------ttttggag---
B D                  Marmoset  a--tgatt-----atcgtggcattttgggccag-taattcgtt-------gt-------ttctggag---
B D           Squirrel monkey  a--tgatt-----gtcatggcattttgggccag-taattattt-------gt-------ttctggaa---
B D                  Bushbaby  a--tgatg-----atgttgacgttttagtacag-tgagtcttt-------gt-------ttctggtg---
           Chinese tree shrew  c--tg--------------------tgaaccag---------a-------gg-------tttgggca---
B D                  Squirrel  a--tggtaccaacattttagga---cagtaatt----tgtttt-------gt-------tttcggtg---
                 Prairie vole  c--tg----------------------------------------------t-------ttgcagtg---
B D           Chinese hamster  c--tgatg-----atatgtaga----------------ggctt-------tc-------ttgaagtg---
               Golden hamster  c--tgatg-----atatgcaga----------------gcttt-------tc-------ttgaagtg---
B D                     Mouse  c--tgata-----atgtgcaga----------------ggttt-------gt-------ctggagtg---
B D                Guinea pig  a--cggta-----atattgaca-ttgagaccac----aagtct-------gt-------ggagggtg---
                   Chinchilla  a--taatg-----acattgacattttagatcag----tagtct-------gt-------ggaaggtg---
             Brush-tailed rat  a--taatg-----acactgaca-ttcagaccag----cagtct-------atgta---agaaaggtg---
B D                    Rabbit  actttata-----ttcttggtattttggaccaa----ttattc-------tt-ca---gttttagta---
B D                       Pig  a--tgatg-----ctattgacattttgaaccag-taattat------------------ttttgatg---
B D                   Dolphin  a--cggta-----ctactgacattttggaccgg-tcattcttt-------gg-------tttgggtt---
                 Killer whale  a--cggta-----ctactgacattttggaccgg-tcattcttt-------gg-------tttgggtt---
B D                     Horse  a--tgatg-----tcgttagcattttggatcag-tgattcttt-------gt-------ttttggtg---
B D          White rhinoceros  a--tgatg-----ctattgacattttggaccag-taattcttt-------gt-------ttttggtg---
B D                       Cat  a--tgata-----ctattgacattttggaccag-taattcttc-------gg-------tttcggtg---
B D                       Dog  a--taatg-----ctattgacattttggaccag-agattcttt-------gg-------ctttggtg---
B D                   Ferret   a--cgatg-----atattgacattttggatcag-taattcttt-------gg--------tttggtg---
B D                     Panda  a--tggtg-----ctagtgacgttttgggtcag-taattcttt-------gg-------atttagtg---
               Pacific walrus  a--tgatg-----ctattgacattttggatcag-taattcttt-------gc-------ttttggtg---
                 Weddell seal  a--tgatg-----ctattgacattttggatcag-taattcttt-------gc-------ttttggtg---
             Black flying-fox  a--tgatg-----ctattgacattttgaaccgg-taattcatt-------gt-------tttgggtg---
B D                   Megabat  a--tgatg-----ctattgacattttgaaccgg-taattcatt-------gt-------tttgggtg---
B D                     Shrew  ----------------ctgatacaatgaataag-tg-cacggg-------ga-------catggggt---
B D                  Elephant  g--tgctg-----ttattgaaatgtaagaccagacaattatttatt----ttgcacgtgtgtgtgtg---
B D                   Manatee  a--tgctg-----ttattgaaattttggaccaaatagtcatttattgtgcgtgcacgtgtgtgtgtgtgc
             Cape golden mole  a--tagtg-----ttattgacatttttggcaagataattattcatt----gtgcatgtgtatctgta---
                     Aardvark  a--tgata-----ttattgatattttaagccaaataattact--------gtgcatgtgtgtgcatg---
B D                 Armadillo  a--tgatt-----ctattgacattttgaactagatagttcttt-------gtg-------gtaggtg---
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
               Big brown bat  ======================================================================
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D            Naked mole-rat  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  -------------------------------gggtattct------------------------------
                        Chimp  -------------------------------gggtattct------------------------------
                      Gorilla  -------------------------------gggtattct------------------------------
                    Orangutan  -------------------------------gggtattct------------------------------
                       Gibbon  -------------------------------gggtattct------------------------------
                       Rhesus  -------------------------------gggtattct------------------------------
          Crab-eating macaque  -------------------------------gggtattct------------------------------
                       Baboon  -------------------------------gggtattct------------------------------
                 Green monkey  -------------------------------gggtattct------------------------------
                     Marmoset  -------------------------------gggtagtct------------------------------
              Squirrel monkey  -------------------------------gggtagtct------------------------------
                     Bushbaby  -------------------------------ggccgtcc-------------------------------
           Chinese tree shrew  -------------------------------ggatatcct------------------------------
                     Squirrel  -------------------------------agctgtgtt------------------------------
                 Prairie vole  -------------------------------agctgt---------------------------------
              Chinese hamster  -------------------------------agctgtgctgt----------------------------
               Golden hamster  -------------------------------agttgtgctgt----------------------------
                        Mouse  -------------------------------tgctgt---------------------------------
                   Guinea pig  -------------------------------ggccgtctt------------------------------
                   Chinchilla  -------------------------------agctctttt------------------------------
             Brush-tailed rat  -------------------------------agctatctt------------------------------
                       Rabbit  -------------------------------gtctgtcttgttgcttgtcttatatttaaggtttataca
                          Pig  -------------------------------ggctgttgt------------------------------
                      Dolphin  -------------------------------ggctcttga------------------------------
                 Killer whale  -------------------------------ggctcttga------------------------------
                        Horse  -------------------------------ggctgtctt------------------------------
             White rhinoceros  -------------------------------ggctgtcct------------------------------
                          Cat  -------------------------------ggatgttct------------------------------
                          Dog  -------------------------------ggatgttct------------------------------
                      Ferret   -------------------------------ggatattct------------------------------
                        Panda  -------------------------------ggatgttct------------------------------
               Pacific walrus  -------------------------------ggatgttct------------------------------
                 Weddell seal  -------------------------------ggatgttct------------------------------
             Black flying-fox  -------------------------------ggttgtcct------------------------------
                      Megabat  -------------------------------ggttgtcct------------------------------
                        Shrew  -------------------------------gagcattct------------------------------
                     Elephant  -----------------tgggtggggatgagaggtaccct------------------------------
                      Manatee  gcgcgcgcggaagcgcctgggtgtgggctgggggtgttct------------------------------
             Cape golden mole  ----------------actaatgtggtggtagggtgttct------------------------------
                     Aardvark  ---------------ccttggtgaggataag--------c------------------------------
                    Armadillo  -------------------------------agctgtcct------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                         Pika  ======================================================================
                     Hedgehog  ======================================================================
                          Rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Naked mole-rat  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ----------------------gctcattacatga
                        Chimp  ----------------------gctcattacatga
                      Gorilla  ----------------------gctcattacatga
                    Orangutan  ----------------------gctcattatatga
                       Gibbon  ----------------------gctcattacatga
                       Rhesus  ----------------------gcacattacatga
          Crab-eating macaque  ----------------------gcacattacatga
                       Baboon  ----------------------gcacattacatga
                 Green monkey  ----------------------gcacattgcatga
                     Marmoset  ----------------------gctcattgcatga
              Squirrel monkey  ----------------------gctcattgcatga
                     Bushbaby  -----------------------------------
           Chinese tree shrew  ----------------------attccctgtgtgg
                     Squirrel  ----------------------atacattgtagga
                 Prairie vole  ----------------------gtttcttgcaaaa
              Chinese hamster  ------------------gcaggtttggagtaaga
               Golden hamster  ------------------gctggttttgagtaaga
                        Mouse  ----------------------gcttcttataaga
                   Guinea pig  ----------------------gttcactatgaga
                   Chinchilla  ----------------------attcactattagg
             Brush-tailed rat  ----------------------gtttactattaga
                       Rabbit  atctgaagagaaaccatagtataatccttgtctta
                          Pig  ----------------------gttaattgtggaa
                      Dolphin  ----------------------gttaactgtagaa
                 Killer whale  ----------------------gttcactgtagaa
                        Horse  ----------------------cttcattgtagga
             White rhinoceros  ----------------------gttcactgtagaa
                          Cat  ----------------------gttcatggtagaa
                          Dog  ----------------------gttcattgtagaa
                      Ferret   ----------------------gctcattgtagaa
                        Panda  ----------------------gttcattgcagaa
               Pacific walrus  ----------------------gttcattgtagaa
                 Weddell seal  ----------------------gttcattgtagaa
             Black flying-fox  ----------------------gtttattgtataa
                      Megabat  ----------------------gtttattgtataa
                        Shrew  ----------------------ggtcattgtagaa
                     Elephant  ----------------------gtttattgtagg-
                      Manatee  ----------------------gtgcattgtagga
             Cape golden mole  ----------------------gtacattgtaaga
                     Aardvark  ----------------------atgcattgtagta
                    Armadillo  ----------------------gtgcctaataaga
              Star-nosed mole  -----------------------------------
                         Pika  ===================================
                     Hedgehog  ===================================
                          Rat  ===================================
       Lesser Egyptian jerboa  ===================================
                       Tenrec  ===================================
                Big brown bat  ===================================
                          Cow  ===================================
                Domestic goat  ===================================
                        Sheep  ===================================
             Tibetan antelope  ===================================
                     Microbat  ===================================
         David's myotis (bat)  ===================================
               Bactrian camel  ===================================
                       Alpaca  ===================================
               Naked mole-rat  ===================================
                  Spotted gar  ===================================
                   Coelacanth  ===================================
                       Lizard  ===================================
     Chinese softshell turtle  ===================================
               Painted turtle  ===================================
              Green seaturtle  ===================================
                 Mallard duck  ===================================
           American alligator  ===================================
                      Opossum  ===================================
              Tasmanian devil  ===================================

Alignment block 4 of 262 in window, 128060302 - 128060303, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
           Chinese tree shrew  tg
B D                  Squirrel  ag
                 Prairie vole  tg
B D           Chinese hamster  ta
               Golden hamster  ta
B D                     Mouse  tg
B D                Guinea pig  tg
                   Chinchilla  ca
             Brush-tailed rat  tg
B D                    Rabbit  tt
B D                       Pig  cg
B D                   Dolphin  tc
                 Killer whale  tc
B D                     Horse  ta
B D          White rhinoceros  ta
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  tg
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  tg
B D                   Megabat  tg
B D                  Hedgehog  tg
B D                  Elephant  tg
B D                   Manatee  tg
             Cape golden mole  tg
                     Aardvark  tg
B D                 Armadillo  tg
             Star-nosed mole  --
B D                      Pika  ==
B D                     Shrew  --
B D                       Rat  ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
               Big brown bat  ==
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D            Naked mole-rat  ==
                 Spotted gar  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
  D              Mallard duck  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==

Alignment block 5 of 262 in window, 128060304 - 128060371, 68 bps 
B D                     Human  cttagc---agcccctctgtcctccacc-ca------ctag----atgttagcaggatattc------tt
B D                     Chimp  cttagc---agcccctctgtcctctacc-ta------ctag----atgttagcaggatattc------tt
B D                   Gorilla  cttagc---agcccctctggcctctacc-ca------ctag----atgttagcaggatattc------tt
B D                 Orangutan  cttaga---agcccctctggcctctacc-ca------ctag----atgttagcaggatattc------tt
B D                    Gibbon  cttaga---agcccctctggcctctact-ca------ctag----atgttagcaggatattc------tt
B D                    Rhesus  cttcga---agcccctctgacctctacc-cc------ctag----atgttagcaggatattc------tt
B D       Crab-eating macaque  cttcga---agcccctctgacctctacc-cc------ctag----atgttagcaggatattc------tt
B D                    Baboon  cttcga---agcccctctgacctctacc-cc------ctag----atgttagcaggatattc------tt
B D              Green monkey  ctttga---agcccctctggcccctacc-ca------ctag----atgttagcaggatattc------tt
B D                  Marmoset  tttagc---atcccctctggcctccacc-ca------ctag----atgttaacaggatattcc-ta--tt
B D           Squirrel monkey  tttagc---agccccgctggcctccacc-ca------ctag----atgttagcaggatattct-cc--tt
B D                  Bushbaby  tctggc---agtgtccctggcct-tacc-ca------ctgg----aggtcaacagaacattct-cc--ct
           Chinese tree shrew  tcgagt---ggcccacccg-cttcgccc-ca------gtag----atgccaacacgacactc---c--ct
B D                  Squirrel  tttagc---agcctacttggtctccact-ca------ctaa----atgccagcagaacactct-tc--ct
                 Prairie vole  ttcggt---ggcctccctgggctccatc-ca------ctag----tcgccagcataggcatc---c--cc
B D           Chinese hamster  ttcagt---ggcctccat------------------------------ccagcatagcaatc---c--cc
               Golden hamster  ttcggt---ggcctccat------------------------------ccagcatagcagtt---c--cc
B D                     Mouse  ttcagc---agcgtccccgggctccatc-ca------ttag----ctggcagcatagtagtc---c--cc
B D                Guinea pig  tt-agc---agtctccgt-ggcttaatc-aa------atag----gagctaggagtgcactc--tc--tg
                   Chinchilla  ttcagc---agtctccct-ggccaaatc-ca------ccag----gggctacaggaacactc--tccttg
             Brush-tailed rat  ttcaga---agtct--ct-agccaaatc-taaatcctctgg----gggctagaagaacac--------ca
B D                    Rabbit  tttaaa---aatccccatgacctctagt-ca------ctag----gtaccagcagaacactct-tc--ct
B D                       Pig  ttaagc---cagatccctggcctctacc-ca------ttat----gtgctgggagaacactct-cc--ct
B D                   Dolphin  tttagc---agcccgcctggtctctacc-ca------ctac----atgccagtaaaacactat-ct--ct
                 Killer whale  tttagc---agcccgcctggtctctacc-ca------ctac----atgccagtaaaacactct-ct--ct
B D                     Horse  tttagc---agcctccctggcctctacc-c-------ctac----gtgccagtaaaacattct-cc--ct
B D          White rhinoceros  cttagc---agcctccctggtctctacc-ca------ctac----gtgccagtaaaacactct-cc--ct
B D                       Cat  ttttgc---ag-ttccctggcccccacc-ca------ctac----ataccaatagaatactatccc--ct
B D                       Dog  tttagc---agcctccctggcccttacc-ca------ct-c----gtactagtggaatactct-cc--ct
B D                   Ferret   tttagc---agcctccaaggcccctatc-ca------gtac----atactagtagaatactct-cc--ct
B D                     Panda  tttggc---agcctccctgggccctacc-ca------ctac----ataccagcagaatactct-cc--ct
               Pacific walrus  tttagc---agcctccaaggcccatacc-ca------gtac----ataccggtagaatattct-cc--ct
                 Weddell seal  tttagc---agcctccaaggcccctacc-ca------gtac----ataccagtagaatattct-cc--ct
             Black flying-fox  ttttgc---agcctcactggtctctacc-ta------ttac----atgacagtagaatattct-cc--ct
B D                   Megabat  ttttgc---agcctcactggtctctacc-ta------ttac----atgacagtagaatattct-cc--ct
B D                  Hedgehog  ctgatc---atccttgttggccttagaa-ta------cttc----atgccactagaacattca-tt--ct
B D                     Shrew  -tggtctaaatcctccttggcctcaatt-cc------cctcttgaatgcctttagaacactct-tc--tg
B D                  Elephant  tttagc---agcaactctggcctctact-ca------ctag----atgccagtagcacccctc-cc--cc
B D                   Manatee  tttagc---agcatctctggcttctgct-ca------ctag----atgccagtagcacccctc-cc--cc
             Cape golden mole  tttagcagaagtatctctgccctccactcca------tcct----gtgccagtagcaccctat-ac--ct
                     Aardvark  tttagc---agcatgtctggtctctaat-tg------ctag----gtatcagtagcaccc-ac-cc--ca
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
               Big brown bat  ======================================================================
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D            Naked mole-rat  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  gac-tt--ccccagtagtgac
                        Chimp  gac-tt--ccccggtagtgac
                      Gorilla  gac-tt--ccccagtagtgac
                    Orangutan  gac-tt--ccccagtagtgac
                       Gibbon  gac-tt--ctccagtagtgac
                       Rhesus  aacttt--ccccagtagtgac
          Crab-eating macaque  aacttt--ccccagtagtgac
                       Baboon  aacttt--ccccagtagtgac
                 Green monkey  gac-tt--ccccagtagtgac
                     Marmoset  gac-tt--ccccagtagtgac
              Squirrel monkey  gac-tt--ccccagtagtgac
                     Bushbaby  gac-ct--c-ccaggagtgac
           Chinese tree shrew  gac-ct--c-ctggtagtgac
                     Squirrel  gac-ctcccctc--tagtgac
                 Prairie vole  agc-ct--cctt--aaatgac
              Chinese hamster  aga-ct--cccc--aaatgac
               Golden hamster  agc-ct--cctc--aaacgac
                        Mouse  agc-ct--cgtc--aaatgac
                   Guinea pig  aag-cc--cctt--tagtgac
                   Chinchilla  aac-cc--ccat--tagtgac
             Brush-tailed rat  gaa-ac--ccat--tagtaac
                       Rabbit  aac-tt--cctcggtagttac
                          Pig  ggc-ct--cccta-gtgtgac
                      Dolphin  gac-ct--atttatttgttac
                 Killer whale  gac-ct--atctatttgttac
                        Horse  gat-ct--ccatatttgtgac
             White rhinoceros  gac-ct--ccatatttgtgac
                          Cat  gac-ct--ttctattggtgac
                          Dog  gac-tt--ccctactgatgac
                      Ferret   gac-ct--tcctattagtgac
                        Panda  acc-ct--tcctattagtgac
               Pacific walrus  gac-ct--ccctattagtgac
                 Weddell seal  gac-ct--tcctattagtgac
             Black flying-fox  gat-at--ccttatttgtgac
                      Megabat  gat-ct--ccttatttgtgac
                     Hedgehog  gac-ct--tcctagtggttac
                        Shrew  gat-ct--cccaatttatgat
                     Elephant  aaa-ta--atgc---------
                      Manatee  aac-tg--agac---------
             Cape golden mole  aat-tc--agac---------
                     Aardvark  aat-tt--agac---------
              Star-nosed mole  ---------------------
                         Pika  =====================
                          Rat  =====================
       Lesser Egyptian jerboa  =====================
                       Tenrec  =====================
                Big brown bat  =====================
                          Cow  =====================
                Domestic goat  =====================
                        Sheep  =====================
             Tibetan antelope  =====================
                     Microbat  =====================
         David's myotis (bat)  =====================
                    Armadillo  ---------------------
               Bactrian camel  =====================
                       Alpaca  =====================
               Naked mole-rat  =====================
                  Spotted gar  =====================
                   Coelacanth  =====================
                       Lizard  =====================
     Chinese softshell turtle  =====================
               Painted turtle  =====================
              Green seaturtle  =====================
                 Mallard duck  =====================
           American alligator  =====================
                      Opossum  =====================
              Tasmanian devil  =====================

Inserts between block 5 and 6 in window
            Black flying-fox 733bp
B D                  Megabat 648bp

Alignment block 6 of 262 in window, 128060372 - 128060413, 42 bps 
B D                     Human  aaccaaa-aatgtcttcaggaatttctaaacgttccctgca-----ag
B D                     Chimp  aaccaaa-aatgtcttcaggaatttctaaacgttccctgca-----ag
B D                   Gorilla  aaccaaa-aatgtcttcaggaatttctaaacgttccctgca-----ag
B D                 Orangutan  aaccaaa-aatgtcttcaggaatttccaaacgttccctgca-----gg
B D                    Gibbon  aaccaaa-aatgtcttcaggaatttccagacgtttcctgca-----gg
B D                    Rhesus  aatcaaa-aatgtcttcaggtatttccaaacattccctgca-----ag
B D       Crab-eating macaque  aatcaaa-aatgtcttcaggtatttccaaacattccctgca-----ag
B D                    Baboon  aatcaaa-aatgtcttcaggtatttctaaacgttccctgca-----ag
B D              Green monkey  agtcaaa-aatgtcttcaggtatttccaaacattccctgca-----ag
B D                  Marmoset  aaccaca-aatgtcttcaggtattttcacatgttccctgca-----gg
B D           Squirrel monkey  aaccaca-aatgtcttcagttattttcacatgtaccctgca-----gg
B D                  Bushbaby  catcgaa-aatgtcttcagacatttccaaactttccccgcc-----gt
           Chinese tree shrew  acccaaa-tgtgtcctcagacatt-----------cctcaa-----gg
B D                  Squirrel  aaccagatatagctt-cagatactttcaaat-tgtcctgca-----aa
                 Prairie vole  aaccaga-agagcca-cagatgtttccacatgtttcctgca-----ga
B D           Chinese hamster  aaccaga-agagcca-tagatgtttccaaatgtttcctgaa-----ga
               Golden hamster  tctcaga-agagcca-cagatgtttccaaatgtttcctgaa-----ga
B D                     Mouse  aaccaga-atagcca-cagatgtttccaaatgtctcctgta-----ga
B D                Guinea pig  aaccaga-aaattcttcaaatgtttccaagtgtttcctgca-----aa
                   Chinchilla  aaccaga-taattcttcaagtatttccaagtgtttcctgca-----aa
             Brush-tailed rat  aaccaga-aaattcataaagtatttccaagcatctcccaca-----aa
B D                    Rabbit  aaccaaa-atgtcat-cagatatttccaaatgttccctgaa-----gt
B D                       Pig  aactaac-aatgtctgcagatatttccaaatatcctttctgaagatgg
B D                   Dolphin  atctaag-aaggttttcagatatttccaagtgttctttctgggggtgg
                 Killer whale  atctaag-aaggttttcagatatttccaagtgttctttctgggggtgg
B D                     Horse  aactaaa-aatgtcttcagacatttccaaatgttctttccaggtataa
B D          White rhinoceros  aactaaa-aatgtcttcaggtatttccaaatgttctttccaggggtgg
B D                       Cat  aactaaa-aatttc--cagatatttccagatggtcttcccggt---ag
B D                       Dog  aactaaa-gatatc--ctgatatttccaaatgttctttcctgg---ag
B D                   Ferret   aactgaa-aatgtc--cagatatttccaaatgttctttccagg---ag
B D                     Panda  aactgaa-aatgtc--tagatatttccaaatgttctttccagg---ag
               Pacific walrus  aattgaa-aatgtc--cagatagttccaaatattctttccagg---ag
                 Weddell seal  aattgaa-aatgcc--cagatagttccaaatgttctttccagg---ag
             Black flying-fox  aaataaa-aatgtcttcaaatagttccaaatgttctttctct----aa
B D                   Megabat  aaataaa-aatgtcttcaaatatttccaaatgttctttctct----aa
                Big brown bat  aaataaa-aatgtcttcatatatttccaaatgttctttcca-----gg
B D                  Microbat  aaataaa-aatgtcttcatatatttccaaatgttctttcta-----gg
B D                  Hedgehog  aactgaa-aatgtcttgatatgtctataaatgttctttccagg---tg
B D                     Shrew  aactata-aatgtcttcagacacatataaatg-tcttcccatg---gg
B D                  Elephant  aatcaaa-aatatcttttgttaattctaaatgtttcctgct-----ga
B D                   Manatee  agtcaaa-aatgtcttctgtcaatttcaaatatttcccacc-----aa
             Cape golden mole  attgaaa-aatgtcttatgttaattccagatgtttcctgtt-----aa
                     Aardvark  aatcaaa-aatgtcttttgttgattccaaatgttttctgcc-----aa
             Star-nosed mole  ------------------------------------------------
B D                      Pika  ================================================
B D                       Rat  ================================================
      Lesser Egyptian jerboa  ================================================
B D                    Tenrec  ================================================
B D                       Cow  ================================================
               Domestic goat  ================================================
B D                     Sheep  ================================================
            Tibetan antelope  ================================================
        David's myotis (bat)  ================================================
B D                 Armadillo  ------------------------------------------------
              Bactrian camel  ================================================
B D                    Alpaca  ================================================
B D            Naked mole-rat  ================================================
                 Spotted gar  ================================================
B D                Coelacanth  ================================================
B D                    Lizard  ================================================
  D  Chinese softshell turtle  ================================================
  D            Painted turtle  ================================================
  D           Green seaturtle  ================================================
  D              Mallard duck  ================================================
B D        American alligator  ================================================
B D                   Opossum  ================================================
B D           Tasmanian devil  ================================================

Inserts between block 6 and 7 in window
B D                 Elephant 17bp
B D                  Manatee 14bp
            Cape golden mole 17bp
                    Aardvark 9bp

Alignment block 7 of 262 in window, 128060414 - 128060485, 72 bps 
B D                     Human  g----------g-taggga--atga-taaaattgaccccaggtaagaaccactaatcaaatttatagttt
B D                     Chimp  g----------g-taggga--atga-taaaattgaccccaggtaagaaccactaatcaaatttatagttt
B D                   Gorilla  g----------g-caggga--atga-taaaattgaccccaggtaagaaccactaatcaaatttatagttt
B D                 Orangutan  g----------g-taggga--atga-taaaattgaccgcaggtaagaaccactaatcaaatttatagttt
B D                    Gibbon  g----------g-taggga--atga-taaatttgaccccaggtaagaaccactaatcaaatttatagttt
B D                    Rhesus  g----------g-taggga--atga-tgaaattgaccccaggtaagaaccactaatcaaatttatagttt
B D       Crab-eating macaque  g----------g-taggga--atga-taaaattgaccccaggtaagaaccactaatcaaatttatagttt
B D                    Baboon  g----------g-taggga--atga-taaaattggccccaggtaagaaccactaatcaaatttatagttt
B D              Green monkey  g----------g-taggga--atga-taaaatggaccccaggtaagaaccactaatcaaatttatagttt
B D                  Marmoset  g----------g-tgggga--atga-taaaattgactccaggtaagaaccactaatcaaatttacagttt
B D           Squirrel monkey  g----------g-tgggga--atga-taaaattgaccccaggtaagaaccactaatcaaatttacagttt
B D                  Bushbaby  g----------g-gtggaa--------------------gagtaagagtcacgaatctgatttctagttt
           Chinese tree shrew  g----------g-gagtgg--gaga-tgaaactgaccc-aggtaagaaccacgggtctaatgtgcagttt
B D                  Squirrel  gg---------c-caagga--atgc-c-aaattcactccatatgagaaccactgatctaattcatggttt
                 Prairie vole  gaacatgtggga-tgaggg--ata-----------------atgaaagtcagtgatcaaattcataactt
B D           Chinese hamster  ga---------a-taaggg--atg-----------------atgaaagccagtgatcaaattcttaggtt
               Golden hamster  ga---------a-taaggg--atg-----------------atgaaagccagtgatcaaattctttgctt
B D                     Mouse  ga---------a-ggaggg--atg-----------------atgaaagccagtgatgaaattcataactt
B D                Guinea pig  ga---------g-tgagag--gtga-t-taacttatccaaggtgaaaaccct-----aa--cctcatt--
                   Chinchilla  ga---------g-tgatgg--gtca-t-tcacttatgccaggtgagaaccatttatcta--cctcagtgt
             Brush-tailed rat  ga---------g-ggagga--gtga-t-taacttactct-gatgggaaccctgttccag-tccatagcat
B D                    Rabbit  gt---------a-tgggag--atga-tgaaaatgaaacaacgtgaagattgttgatataattcattactc
B D                       Pig  g----------gatgagca--gtgg-aaaaattgaccccacatgaggaccactgatctagtac--ggttt
B D                   Dolphin  g----------g-taagca--gtggcaaaaattgaccccatatgag--ccactgatctagatc--agttt
                 Killer whale  g----------g-taagca--gtggcaaaaattgaccccgtatgag--ccactgatctagatc--agttt
B D                     Horse  g----------g-aggaag--atgg-caaaatttacccttcatgagaaccactaatctacttcaaagttt
B D          White rhinoceros  g----------gtgggggg--gtgg-caaaatttacccctcatgaga--cactagtctagttcaaagttt
B D                       Cat  g----------g-cagggc--atgg-cagaattggcccttcttgagaaccactgatctagttcagagctg
B D                       Dog  g----------g-cagggcatatgg-caaaattggcccttcatgagaaccactg--aaaccacaaagttg
B D                   Ferret   g----------g-caggac--atgg-aagaattaacccttcatgagaaccactga-aaaccacaaagttg
B D                     Panda  g----------g-cagggc--atgg-caaaattgacccttcatgggaaccactga-aaaccacaaagttg
               Pacific walrus  g----------g-cagggc--ttgg-caaaattaacccttca----------tga-aaaccacaaagttg
                 Weddell seal  g----------g-cagggc--atgg-caaaattaacccttca----------tga-aaaccacaaagttg
             Black flying-fox  g----------t-agggag--atgg-cgaaatttgtcccaggagagaagcactaatctagttaaaagttt
B D                   Megabat  g----------t-agggag--atgg-caaaattggtcccaggagagaagcactaatctagttaaaagttt
                Big brown bat  g----------t-agagaa---agg-caaaatttacttcaggagagaagcaatgatctagttcatagtct
B D                  Microbat  g----------t-agagaa--gggg-caaaatttatttcaggagagaagcaatgatctagctcacagtgt
B D                  Hedgehog  c-------------------------caaagttgaccccctgtgagaaccattgatctaactcaga-ttt
B D                     Shrew  c----------t-agggag--attt-caaaattggttcac-atgaagaccacggatctag--------tt
B D                  Elephant  -----------t-ggtggg-agttg-ctaaatt-tcctcaggttagaagcactgatctagttcaaagttt
B D                   Manatee  -----------a-gaaggg--gtgg-ctaaatt-tcctcaggttagaagcactgatctagttcaaagttt
             Cape golden mole  -----------g-ggtggc-----a-ctaaatt-gcctcagattaaaataactagtctagtgcaaagtct
                     Aardvark  -----------a-ggaagt-------ctgaatt-tccccaggttagaaacactgatccagttgaaagttt
B D                 Armadillo  ---------------------ggtg-caaaattgttcccagttgaaaaccactgatttatttcaaagtct
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D            Naked mole-rat  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ggcatgtt--------gtct----a---------------------------------------------
                        Chimp  ggcatatt--------gtct----a---------------------------------------------
                      Gorilla  ggcatatt--------gtct----a---------------------------------------------
                    Orangutan  ggcatatt--------gtct----a---------------------------------------------
                       Gibbon  ggcatatt--------gtct----a---------------------------------------------
                       Rhesus  ggtatatt--------gtct----a---------------------------------------------
          Crab-eating macaque  ggtatatt--------gtct----a---------------------------------------------
                       Baboon  ggtatatt--------gtct----a---------------------------------------------
                 Green monkey  ggtatatt--------gtct----a---------------------------------------------
                     Marmoset  ggcatatt--------atct----a---------------------------------------------
              Squirrel monkey  gggacatt--------atct----a---------------------------------------------
                     Bushbaby  agtgtatt--------gtct----a---------------------------------------------
           Chinese tree shrew  gacatagg--------gtct----a---------------------------------------------
                     Squirrel  ggtatatg--------atct----a---------------------------------------------
                 Prairie vole  cagataca--------gtct----a---------------------------------------------
              Chinese hamster  agcatatg--------gtct----a---------------------------------------------
               Golden hamster  agcatatt--------gtct----a---------------------------------------------
                        Mouse  ggcatact--------gtct----a---------------------------------------------
                   Guinea pig  --catata--------gtct----a---------------------------------------------
                   Chinchilla  ggtttatt--------gtct----a---------------------------------------------
             Brush-tailed rat  ggcataag--------gtcc----a---------------------------------------------
                       Rabbit  agtgtgag--------gtct----a---------------------------------------------
                          Pig  tgcatgta--------gtct----a---------------------------------------------
                      Dolphin  tgcatata--------gttt----a---------------------------------------------
                 Killer whale  tgcatata--------gttt----a---------------------------------------------
                        Horse  tgcatgta--------gtct----a---------------------------------------------
             White rhinoceros  tgcatgta--------gtct----a---------------------------------------------
                          Cat  c------a--------gtct----a---------------------------------------------
                          Dog  tgcata------------ct----a---------------------------------------------
                      Ferret   tgcctata--------gtgt----aatcaacactattatttaatgaatgatattagttaatattaataac
                        Panda  tgcctatc--------gtct----a---------------------------------------------
               Pacific walrus  tgcctata--------gtct----a---------------------------------------------
                 Weddell seal  tccctata--------gtct----a---------------------------------------------
             Black flying-fox  tgcatata--------gttt----a---------------------------------------------
                      Megabat  tgcatata--------gttt----a---------------------------------------------
                Big brown bat  tggatata--------gttt----a---------------------------------------------
                     Microbat  tggatata--------gttt----a---------------------------------------------
                     Hedgehog  taaatatt--------gtct----a---------------------------------------------
                        Shrew  aaaatatt--------ttccataaa---------------------------------------------
                     Elephant  gtcatctg--------------------------------------------------------------
                      Manatee  gtcatatg--------------------------------------------------------------
             Cape golden mole  ggcatatg--------------------------------------------------------------
                     Aardvark  ggcatacg--------------------------------------------------------------
                    Armadillo  gacatatgatctaact------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                         Pika  ======================================================================
                          Rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Naked mole-rat  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   aagttaatattaactaattaattaattaatattagttaatattaataactagttactattaactaataat
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Hedgehog  ----------------------------------------------------------------------
                        Shrew  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                         Pika  ======================================================================
                          Rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Naked mole-rat  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  --------------------act
                        Chimp  --------------------act
                      Gorilla  --------------------act
                    Orangutan  --------------------act
                       Gibbon  --------------------att
                       Rhesus  --------------------act
          Crab-eating macaque  --------------------act
                       Baboon  --------------------act
                 Green monkey  --------------------act
                     Marmoset  --------------------act
              Squirrel monkey  --------------------act
                     Bushbaby  --------------------aat
           Chinese tree shrew  --------------------acc
                     Squirrel  --------------------att
                 Prairie vole  --------------------att
              Chinese hamster  --------------------att
               Golden hamster  --------------------att
                        Mouse  --------------------att
                   Guinea pig  --------------------att
                   Chinchilla  --------------------att
             Brush-tailed rat  --------------------att
                       Rabbit  --------------------aca
                          Pig  --------------------act
                      Dolphin  --------------------acc
                 Killer whale  --------------------act
                        Horse  --------------------act
             White rhinoceros  --------------------ac-
                          Cat  --------------------act
                          Dog  --------------------aat
                      Ferret   attcattaaataatagtgtgact
                        Panda  --------------------act
               Pacific walrus  --------------------att
                 Weddell seal  --------------------act
             Black flying-fox  --------------------act
                      Megabat  --------------------act
                Big brown bat  --------------------agt
                     Microbat  --------------------act
                     Hedgehog  --------------------act
                        Shrew  --------------------gtt
                     Elephant  -----------------------
                      Manatee  -----------------------
             Cape golden mole  -----------------------
                     Aardvark  -----------------------
                    Armadillo  -----------------------
              Star-nosed mole  -----------------------
                         Pika  =======================
                          Rat  =======================
       Lesser Egyptian jerboa  =======================
                       Tenrec  =======================
                          Cow  =======================
                Domestic goat  =======================
                        Sheep  =======================
             Tibetan antelope  =======================
         David's myotis (bat)  =======================
               Bactrian camel  =======================
                       Alpaca  =======================
               Naked mole-rat  =======================
                  Spotted gar  =======================
                   Coelacanth  =======================
                       Lizard  =======================
     Chinese softshell turtle  =======================
               Painted turtle  =======================
              Green seaturtle  =======================
                 Mallard duck  =======================
           American alligator  =======================
                      Opossum  =======================
              Tasmanian devil  =======================

Inserts between block 7 and 8 in window
B D                 Bushbaby 385bp

Alignment block 8 of 262 in window, 128060486 - 128060487, 2 bps 
B D                     Human  tg
B D                     Chimp  tg
B D                   Gorilla  tg
B D                 Orangutan  tg
B D                    Gibbon  tg
B D                    Rhesus  tg
B D       Crab-eating macaque  tg
B D                    Baboon  tg
B D              Green monkey  tg
B D                  Marmoset  tg
B D           Squirrel monkey  tg
B D                  Bushbaby  tg
           Chinese tree shrew  cg
B D                       Pig  tg
B D                   Dolphin  tg
                 Killer whale  tg
B D                     Horse  ta
B D          White rhinoceros  -a
B D                       Cat  ta
B D                       Dog  ta
B D                   Ferret   ta
B D                     Panda  ta
               Pacific walrus  ta
                 Weddell seal  ta
             Black flying-fox  tg
B D                   Megabat  ag
                Big brown bat  ag
B D                  Microbat  ag
B D                  Hedgehog  tg
B D                     Shrew  tt
B D                 Armadillo  ta
             Star-nosed mole  --
B D                      Pika  ==
B D                     Mouse  --
                Prairie vole  --
B D                       Rat  ==
B D           Chinese hamster  --
              Golden hamster  --
B D                    Rabbit  --
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
            Brush-tailed rat  --
                  Chinchilla  --
B D                Guinea pig  --
B D                       Cow  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
        David's myotis (bat)  ==
B D                   Manatee  --
B D                  Elephant  --
              Bactrian camel  ==
B D                    Alpaca  ==
B D                  Squirrel  --
B D            Naked mole-rat  ==
                 Spotted gar  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
  D              Mallard duck  ==
B D        American alligator  ==
B D                   Opossum  ==
B D           Tasmanian devil  ==
            Cape golden mole  --
                    Aardvark  --

Inserts between block 8 and 9 in window
B D                 Hedgehog 5bp
B D                    Shrew 5bp

Alignment block 9 of 262 in window, 128060488 - 128060528, 41 bps 
B D                     Human  atcatttgatgaat-------gaa-----------------agga----------aaaaggaa-------
B D                     Chimp  atcatttgatgact-------gaa-----------------agga----------aaaaggaa-------
B D                   Gorilla  atcatttgatgaat-------gaa-----------------agga----------aaaaggaa-------
B D                 Orangutan  atcatttgatgaat-------gaa-----------------agga----------aaaaggaa-------
B D                    Gibbon  atcatttgatgaat-------gaa-----------------agga----------aaaaggaa-------
B D                    Rhesus  atcgtttgatgaat-------gaa-----------------agga----------aaaaggaa-------
B D       Crab-eating macaque  atcgtttgatgaat-------gaa-----------------agga----------aaaaggaa-------
B D                    Baboon  atcgtttgatgaat-------gaa-----------------agga----------aaaaggaa-------
B D              Green monkey  atcatttgatgaatgaaaggagaa-----------------agga----------aaaaggaa-------
B D                  Marmoset  atcatgtgatgaat-------gaa-----------------aggg----------ggaaggaa-------
B D           Squirrel monkey  atcatttgatgaac-------gaa-----------------aggg----------gaaaggaa-------
B D                  Bushbaby  atagttggatgaaa-------taa-----------------ggaa----------gaatggaaggtgg--
           Chinese tree shrew  atagcttgatgagg-------aaa-----------------ggga----------agaaggaa-------
B D                  Squirrel  ------tgataagg-------aca-----------------aagg-------------------------
                 Prairie vole  ------tgatagat-------aaa-----------------aaat-------------------------
B D           Chinese hamster  ------tgatagtc-------cac-----------------aaaa----------ag-------------
               Golden hamster  ------tgatagtc-------caa-----------------aaaa-------------------------
B D                     Mouse  ------tgacagtt-------caa-----------------gagg-------------------------
B D                Guinea pig  ------ccctattt-------taa-----------------tgca-------------------------
                   Chinchilla  ------tgatagtt-------taa-----------------tgaa-------------------------
             Brush-tailed rat  ------tggtagtg-------taa-----------------tggg-------------------------
B D                    Rabbit  ------tggtagtt-------tgt-----------------tgaa----------ggaaggagggaagaa
B D                   Dolphin  atagtttgatgaag-------gaa----------------------------------------------
                 Killer whale  atagtttgat------------------------------------------------------------
B D                     Horse  ataatttgatgaag-------aaagggagggagggagagaaggag----------agaggaa--------
B D          White rhinoceros  ataatttgatgaag-------aaagtggg------------ggag----------agaggaa--------
B D                       Cat  ctgctttgagggag-------gaa-----------------agaa----------tgaggaa--------
B D                       Dog  atacttcaatgaaa-------gaa-----------------agaa----------taaggaa--------
B D                   Ferret   atactccagtgaag-------gaa-----------------agac----------tgtggaa--------
B D                     Panda  atacttcaatgaag-------aaa-----------------agaa----------taaggaa--------
               Pacific walrus  attcttcgaggaaa-------gaa-----------------agaa----------caaggaa--------
                 Weddell seal  attcttcgatgaag-------gaa-----------------agaa----------caaggaa--------
             Black flying-fox  atagtttgatgaat-------aaa-----------------agag----------ggaagga-----agg
B D                   Megabat  atagtttgatgaat-------aaa-----------------agag----------ggaagga-----ggg
                Big brown bat  atattttgatgaag-------gaa-----------------agaa----------tgaagaagggtaggg
B D                  Microbat  atattttgatgaag-------gaa-----------------agaa----------tgaagga--------
B D                  Hedgehog  gtaaggagacagat-------gaa-----------------aaaaatatttagtgggtagga--------
B D                     Shrew  gtaatttgagaaag-------gaa-----------------gaga----------gggaggc--------
B D                  Elephant  gtaggtaggtaaag-------gaa-----------------agaa----------agaaggaa-------
B D                   Manatee  gtagcttggtaaag-------gaa-----------------agga----------agaagata-------
             Cape golden mole  gtagtttgttaaag-------gaa-----------------taaa----------aggaga---------
                     Aardvark  gtagtttggtaaag-------aaa-----------------gaaa----------agagga-a-------
B D                 Armadillo  atatcttgcttaag-------gaa-----------------ggaa----------a--------------
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Pig  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D            Naked mole-rat  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  ---------------------------------------------------------aggaga--gaggg
                        Chimp  ---------------------------------------------------------aggatatcgaggg
                      Gorilla  ---------------------------------------------------------aggaga--gaggg
                    Orangutan  ---------------------------------------------------------aggagg--gaggg
                       Gibbon  ---------------------------------------------------------aggagg--gaggg
                       Rhesus  ---------------------------------------------------------aggagg--gaggg
          Crab-eating macaque  ---------------------------------------------------------aggagg--gaggg
                       Baboon  ---------------------------------------------------------aggagg--gaggg
                 Green monkey  ---------------------------------------------------------aggagg--gaggg
                     Marmoset  ---------------------------------------------------------agcgga--gaggg
              Squirrel monkey  ---------------------------------------------------------agggat--gaggg
                     Bushbaby  ------------------------------------------------------gggagggga--gagaa
           Chinese tree shrew  ---------------------------------------------------------gggagg--gtg-g
                     Squirrel  ------------------------------------------------------------aag--gaggg
                 Prairie vole  ------------------------------------------------------------gga--gaagg
              Chinese hamster  ------------------------------------------------------------gga--gaagg
               Golden hamster  -------------------------------------------------------------ga--gaagg
                        Mouse  ------------------------------------------------------------gtg--gaaag
                   Guinea pig  --------------------------------------------------------------g--gaaag
                   Chinchilla  --------------------------------------------------------------g--gaaag
             Brush-tailed rat  --------------------------------------------------------------g--gaaag
                       Rabbit  a---------------------gaaaggtgggtggaaggaagggtggaagaataggtggaagg--gaggg
                      Dolphin  ---------------------------------------------------------agaa---------
                 Killer whale  ----------------------------------------------------------gaa---------
                        Horse  ---------------------------------------------------------agga---------
             White rhinoceros  ---------------------------------------------------------agga---------
                          Cat  ---------------------------------------------------------agga---------
                          Dog  ---------------------------------------------------------aaga---------
                      Ferret   ---------------------------------------------------------agga---------
                        Panda  ---------------------------------------------------------agga---------
               Pacific walrus  ---------------------------------------------------------a------------
                 Weddell seal  ---------------------------------------------------------agga---------
             Black flying-fox  agggaggaagggacagaaggaagaagagggggaggcaggaaagaaagaaaaaagtgaggaa---------
                      Megabat  agggaggaagggacagaaggaagaagagagggaggcaggaaagaaagaaaaaagtgaggaa---------
                Big brown bat  agataagaaggaaggaaagaaggaaggaaggaaggaaggaaggaaggaaggaaggaaggaa---------
                     Microbat  ----------------------taaggaaggaaggaaggaaggaaggaaggaaggaaggaa---------
                     Hedgehog  ---------------------------------------------------------taga---------
                        Shrew  ---------------------------------------------------------gaga---------
                     Elephant  ---------------------------------------------------------tgaatg--gacag
                      Manatee  ---------------------------------------------------------tgaaag--gaggg
             Cape golden mole  -----------------------------------------------------------------gggag
                     Aardvark  ---------------------------------------------------------tgaaag--gaggg
                    Armadillo  -----------------------------------------------------------aatg--gaaag
              Star-nosed mole  ----------------------------------------------------------------------
                         Pika  ======================================================================
                          Rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                          Pig  ----------------------------------------------------------------------
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
         David's myotis (bat)  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Naked mole-rat  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
                      Opossum  ======================================================================
              Tasmanian devil  ======================================================================

                        Human  a---------
                        Chimp  a---------
                      Gorilla  a---------
                    Orangutan  a---------
                       Gibbon  a---------
                       Rhesus  a---------
          Crab-eating macaque  a---------
                       Baboon  a---------
                 Green monkey  a---------
                     Marmoset  a---------
              Squirrel monkey  a---------
                     Bushbaby  g---------
           Chinese tree shrew  a---------
                     Squirrel  a---------
                 Prairie vole  a---------
              Chinese hamster  a---------
               Golden hamster  a---------
                        Mouse  c---------
                   Guinea pig  a---------
                   Chinchilla  a---------
             Brush-tailed rat  a---------
                       Rabbit  a---------
                      Dolphin  ----------
                 Killer whale  ----------
                        Horse  ----------
             White rhinoceros  ----------
                          Cat  ----------
                          Dog  ----------
                      Ferret   ----------
                        Panda  ----------
               Pacific walrus  ----------
                 Weddell seal  ----------
             Black flying-fox  ----------
                      Megabat  ----------
                Big brown bat  ----------
                     Microbat  ----------
                     Hedgehog  ----------
                        Shrew  ----------
                     Elephant  agg-----ga
                      Manatee  aga-----ga
             Cape golden mole  aggtatttga
                     Aardvark  aag-----ga
                    Armadillo  aag-----aa
              Star-nosed mole  ----------
                         Pika  ==========
                          Rat  ==========
       Lesser Egyptian jerboa  ==========
                       Tenrec  ==========
                          Pig  ----------
                          Cow  ==========
                Domestic goat  ==========
                        Sheep  ==========
             Tibetan antelope  ==========
         David's myotis (bat)  ==========
               Bactrian camel  ==========
                       Alpaca  ==========
               Naked mole-rat  ==========
                  Spotted gar  ==========
                   Coelacanth  ==========
                       Lizard  ==========
     Chinese softshell turtle  ==========
               Painted turtle  ==========
              Green seaturtle  ==========
                 Mallard duck  ==========
           American alligator  ==========
                      Opossum  ==========
              Tasmanian devil  ==========

Inserts between block 9 and 10 in window
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 4bp
B D                      Dog 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
                Weddell seal 3bp
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 3bp
B D                 Microbat 3bp
B D                 Hedgehog 197bp
B D                    Shrew 4bp

Alignment block 10 of 262 in window, 128060529 - 128060595, 67 bps 
B D                     Human  ----aggaag----aa---ag-----------------gaagg---------------------------
B D                     Chimp  ----aggaag----aa---ag-----------------gaagg---------------------------
B D                   Gorilla  ----aggaag----aa---ag-----------------gaagg---------------------------
B D                 Orangutan  ----aggagg----aa---ag-----------------gaagg---------------------------
B D                    Gibbon  ----aggagg----aa---ag-----------------gaagg---------------------------
B D                    Rhesus  ----aggaag----aa---aa-----------------gaagg---------------------------
B D       Crab-eating macaque  ----aggaag----aa---aa-----------------gaagg---------------------------
B D                    Baboon  ----aggaag----aa---aa-----------------gaagg---------------------------
B D              Green monkey  ----aggaag----aa---ag-----------------aaagg---------------------------
B D                  Marmoset  ----aggagg----aa---ag-----------------gaagg---------------------------
B D           Squirrel monkey  ----aggagg----aa---ag-----------------gaagg---------------------------
B D                  Bushbaby  ----agggga----ag---gg-----------------gcagg---------------------------
           Chinese tree shrew  ----agaaaa----ag---ag-----------------tgggg---------------------------
B D                  Squirrel  ----agggaa----gg---ag-----------------taaag---------------------------
                 Prairie vole  ----agatag----gc---gg-----------------gaaga---------------------------
B D           Chinese hamster  ----agacac----gc---ag-----------------gcaag---------------------------
               Golden hamster  ----agacag----gc---ag-----------------gcagg---------------------------
B D                     Mouse  ----aggcaa----gg---aa-----------------gaaag---------------------------
B D                Guinea pig  ----aggtg-------------------------------------------------------------
                   Chinchilla  ----atgtg-------------------------------------------------------------
             Brush-tailed rat  ----gggca-------------------------------------------------------------
B D                    Rabbit  ----gggcag----ga---ga-----------------ttggg---------------------------
B D                   Dolphin  --------------ga---ag-----------------gaagg---------------------------
                 Killer whale  --------------ga---ag-----------------gaagg---------------------------
B D                     Horse  ----agaaag----aa---gg-----------------gcgag---------------------------
B D          White rhinoceros  ----aggaag----ga---ag-----------------gaaag---------------------------
B D                       Cat  ----agggag----gg---ag-----------------ggagg---------------------------
B D                       Dog  ----gtagag--------------------------------g---------------------------
B D                   Ferret   ----ataaag----ga---aa-----------------ggaga---------------------------
B D                     Panda  ----gtagag----gg---aa-----------------ggagg---------------------------
               Pacific walrus  --------------gg---ag-----------------ggaag---------------------------
                 Weddell seal  ----gtggagggaggg---ag-----------------ggaag---------------------------
             Black flying-fox  ----aggaag----ga---tg-----------------ggagg---------------------------
B D                   Megabat  ----aggaag----ga---tg-----------------ggagg---------------------------
                Big brown bat  ----aggaag----ga---aggaaaaaaagtgagtgaggaagg---------------------------
B D                  Microbat  ----aggaag----ga---ag------aagtgagtgatgaagg---------------------------
B D                     Shrew  -----aagaa----gc---aa-----------------ggaag---------------------------
B D                  Elephant  aagagggaga----gaatgaa-----------------ggaggaaggaaaggagggaga-----------
B D                   Manatee  aagaaggaag----aa---aa-----------------ggagggagagaaggtgg---------------
             Cape golden mole  aaggaggaag----taagcaa-----------------aaaaaaaaaaaa--------------------
                     Aardvark  gaaaagaagg----aaggtag-----------------gaaggaacagaaggagggagagaggaagacag
B D                 Armadillo  tagaaggaaa----ga------------------------------------------------------
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                  Hedgehog  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Pig  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D            Naked mole-rat  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  -aaggacagaaacacatgaagaaataca--tgaaaagt-------aggatatagaa------gcatat
                        Chimp  -aaggacagaaacacatgaagaaataca--tgaaaagc-------aggatatagaa------gcatat
                      Gorilla  -aaggacagaaacgcacgaagaaataca--tgaaaagt-------aggatatagaa------gcatat
                    Orangutan  -aaggacagaaacacatgaagaaataca--tgaaaagt-------aggatatagaa------gcatat
                       Gibbon  -aaggacagaaacaaatgaagaaatgta--tgaaaagt-------aggatatagaa------gcatat
                       Rhesus  -aaggacagaaataaatgaagaaatata--tgaaaagt-------aggatatagaa------gcatat
          Crab-eating macaque  -aaggacagaaataaatgaagaaatata--tgaaaagt-------aggatgtagaa------gcatat
                       Baboon  -aaggacagaaataaatgaagaaatata--tgaaaagt-------aggatatagaa------gcatat
                 Green monkey  -aaggacagaaataaatgaagaaatatg--tgaaaagt-------aggatatagaa------gcatat
                     Marmoset  -aa----ataaacaaatgaagaaatata--tgaaaagt-------agggtagaaaa------atttat
              Squirrel monkey  -aa----ataaacaaatgaagaaatgta--tgaggagt-------aaggtagaaaa------gcatat
                     Bushbaby  -aagggaataaacggatgaaaaaataca--cagacggt-------gggataacggg------acatcc
           Chinese tree shrew  -aggg--------aaatgaagaactatg--tagagggt-------gggacagagaa------atatct
                     Squirrel  -gaggatgagaagacatgaacacgtata--taaaggat-------ag----gataaagaaatacacct
                 Prairie vole  -aag-----ggtgttataaaagattacg--tgaaggac-------aa----gag-a------gcatag
              Chinese hamster  -aagg--aagaggacttaaaaacataca--tgaaggac-------aa----gagaa------gcatat
               Golden hamster  -aagg--aagaggacataaaaacataca--tgaaggac-------aa----gagaa------gcatgt
                        Mouse  -aagga-aaggggagataaaaatataca--cgaaggac-------aa----gagaa------gcatat
                   Guinea pig  ----------gggagaagagaacacatc--taaatg--------------------------gcatct
                   Chinchilla  ------------gggagaagaaaacatc--tcaatg--------------------------gcatct
             Brush-tailed rat  -----------tgagaagaaaatatata--taaatg--------------------------gcattt
                       Rabbit  -aagaagggaggaaccagaaaatgtaca--taaagggt-------gacaatgaaag------acatct
                      Dolphin  -aaaggaggaaacagatgaagaaatatatatgaaaggt-------tggatagagaa------atatct
                 Killer whale  -aagggaggaaacagatgaagaaatatatatgaaaggt-------tggatagagaa------atatct
                        Horse  -g-ggaaggaaacagatgaagaaatata---aagatat-------ggaatagagaa------acatct
             White rhinoceros  -gagaaaggaaacagatgaagaaatata--taaagggt-------gagatagagca------acatct
                          Cat  -gagggaggaaacagatgaataaatata--tgaaggct-------gggatagaaac------acatcc
                          Dog  -gaggaaagaaacagatgaagaaacata--tgaagggt-------gggatagaaaa------acatct
                      Ferret   -gaggaaggaaacaaaggaagaaatata--tgaagggg-------gggacagaaat------atatct
                        Panda  -gaggaaggaaacagaggaagaaatata--tgaaaggt-------gggatagaaaa------atatct
               Pacific walrus  -gaggaaggaaacagaggaagaaatata--tgaagggt-------gggatagaaaa------atatct
                 Weddell seal  -gaggaaggaaacagaggaagaaatata--tgaagggt-------gggatggaaaa------atagct
             Black flying-fox  -gaggaagagaacagatgaagaactata--tgaaaatt-------gggat--agga------acatct
                      Megabat  -gaggaagagaacagatgaagaagtata--tgaaaatt-------gggat--agga------acatct
                Big brown bat  -gaggagggtaatatatgaggaaatata--tgaaatat-------gggatagagaa------acatca
                     Microbat  -gag--ggataatatatgaggaaatata--tgaaggat-------gggatagagaa------acatca
                        Shrew  -gaggaagaaaatagatttttaaaaatc--tgcagggt-------gggacagagaa------g-atct
                     Elephant  -gagggagggaagagatgaagcaccaca--tgaaggatgaagtgtaggatagaaaa------gcatat
                      Manatee  -gagggaggaaaaagatgaagaaatacg--tgaaggataaagggtagaatagagaa------gcatct
             Cape golden mole  -aaaagagaaatattttgaagaaatatt--taaagcataa-----atgttagtgaa------gcacct
                     Aardvark  tgagggagaaaagagatgaagaaatatg--tgaaggataaaagatgggatagataa------gaatct
                    Armadillo  -----------------gaagaaatata--tgaaaggt-------aggatagagaa------gtatct
              Star-nosed mole  --------------------------------------------------------------------
                         Pika  ====================================================================
                     Hedgehog  ====================================================================
                          Rat  ====================================================================
       Lesser Egyptian jerboa  ====================================================================
                       Tenrec  ====================================================================
                          Pig  --------------------------------------------------------------------
                          Cow  ====================================================================
                Domestic goat  ====================================================================
                        Sheep  ====================================================================
             Tibetan antelope  ====================================================================
         David's myotis (bat)  ====================================================================
               Bactrian camel  ====================================================================
                       Alpaca  ====================================================================
               Naked mole-rat  ====================================================================
                  Spotted gar  ====================================================================
                   Coelacanth  ====================================================================
                       Lizard  ====================================================================
     Chinese softshell turtle  ====================================================================
               Painted turtle  ====================================================================
              Green seaturtle  ====================================================================
                 Mallard duck  ====================================================================
           American alligator  ====================================================================
                      Opossum  ====================================================================
              Tasmanian devil  ====================================================================

Inserts between block 10 and 11 in window
B D                   Rhesus 301bp
B D      Crab-eating macaque 319bp

Alignment block 11 of 262 in window, 128060596 - 128060619, 24 bps 
B D                     Human  aacaatatgg-ta-t---ttttaa--aa-gag--
B D                     Chimp  aacaatatgg-ta-t---ttttaa--aa-gag--
B D                   Gorilla  aacaatatgg-ta-t---ttttaa--aa-gag--
B D                 Orangutan  aacaatatgg-ta-t---ttttaa--aa-gag--
B D                    Gibbon  aacaatatgg-ta-t---ttttaa--aa-gag--
B D                    Rhesus  aacaatatgg-ta-t---ttttaa--aa-gat--
B D       Crab-eating macaque  aacaatatgg-ta-t---ttttaa--aa-gat--
B D                    Baboon  aacaatatgg-ta-t---ttttaa--aa-gat--
B D              Green monkey  aacaatatgg-ta-t---ttttaa--aa-gag--
B D                  Marmoset  aacaatatgatta-t---ttttga--aa-gag--
B D           Squirrel monkey  agcaatatggtta-t---ttttga--aa-gag--
B D                  Bushbaby  aaagagacagtta-t---tttgaa-gaa-aag--
           Chinese tree shrew  aacaataggg-tt-a---tcagaa--aa-gag--
B D                  Squirrel  aacaatatgt-tt-a---tttaaa--aa-cag--
                 Prairie vole  accaatatgg-ca-a---ctaaaattgg-gag--
B D           Chinese hamster  tacaatatgg-ca-g---ctaaaatttg-gag--
               Golden hamster  aacaatatgg-ca-c---ctaaaatttg-gag--
B D                     Mouse  aacaacatgg-ca-a---ctaaagttga-tag--
B D                Guinea pig  aacaata--------------aaaaaga-aag--
                   Chinchilla  aacaatatgg-tt-a---ttaaaaaaga-aat--
             Brush-tailed rat  aatgatatgg-tt-attttttaaaaag-------
B D                    Rabbit  aataacaaga-ct-a---ctaaagcata-gat--
B D                   Dolphin  aac-atacag-at-c---tcaaaa--aa-gac--
                 Killer whale  aac-atacag-at-c---tcaaaa--aa-gac--
B D                     Horse  aacaatacgg-tt-a---tttaag--aa-gag--
B D          White rhinoceros  aacaatatgg-ttaa---ttttaa--aa-gag--
B D                       Cat  aacaatatgg-tt-a---tttata--aa-gaa--
B D                       Dog  aacaatatgg-tt-a---tttata--ag-gaa--
B D                   Ferret   cacaatatga-tt-a---gttgta--ag-gaa--
B D                     Panda  aataatatgg-tt-a---gttata--ag-gaa--
               Pacific walrus  aacaatatgg-tt-a---cttata--agtgaa--
                 Weddell seal  aacaatatgg-tt-a---gttatg--agtgaa--
             Black flying-fox  aacactatga-tt-a---ttaaaa--aa-gag--
B D                   Megabat  aacactatgg-ct-a---ttaaaa--aa-gag--
                Big brown bat  aac-----------------aaaa--ag-gag--
B D                  Microbat  aac-----------------aaaa--ag-gag--
B D                     Shrew  aataaaatag-tt-a---tttcca--a-------
B D                  Elephant  cataatatgc-tt-a---tttaaa--at-gagag
B D                   Manatee  cacaataagc-tt-a---tttaaa--aa-gagag
             Cape golden mole  aacaatatgc-at-a---tttaaa--a--gagtg
                     Aardvark  aacatcatgg-tt-a---tttaaa--aa-gagag
B D                 Armadillo  agcaagatgc-tt-t---taataa--aa-gggaa
             Star-nosed mole  ----------------------------------
B D                      Pika  ==================================
B D                  Hedgehog  ==================================
B D                       Rat  ==================================
      Lesser Egyptian jerboa  ==================================
B D                    Tenrec  ==================================
B D                       Pig  ----------------------------------
B D                       Cow  ==================================
               Domestic goat  ==================================
B D                     Sheep  ==================================
            Tibetan antelope  ==================================
        David's myotis (bat)  ==================================
              Bactrian camel  ==================================
B D                    Alpaca  ==================================
B D            Naked mole-rat  ==================================
                 Spotted gar  ==================================
B D                Coelacanth  ==================================
B D                    Lizard  ==================================
  D  Chinese softshell turtle  ==================================
  D            Painted turtle  ==================================
  D           Green seaturtle  ==================================
  D              Mallard duck  ==================================
B D        American alligator  ==================================
B D                   Opossum  ==================================
B D           Tasmanian devil  ==================================

Inserts between block 11 and 12 in window
B D                  Dolphin 2bp
                Killer whale 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
B D                 Microbat 2bp

Alignment block 12 of 262 in window, 128060620 - 128060647, 28 bps 
B D                     Human  ccaaaaatt--------gcacccagtcagggatcag
B D                     Chimp  ccaaaaatt--------gcacccaggcagggatgag
B D                   Gorilla  ccaaaaatt--------gcacccagtcagggatcag
B D                 Orangutan  ccaaaattt--------gcacccagtcagggatcag
B D                    Gibbon  ccaaaaatt--------gcacccagtcagggatcag
B D                    Rhesus  ccaaaaatt--------gcacccagtcagggatcag
B D       Crab-eating macaque  ccaaaaatt--------gcacccagtcagggatcag
B D                    Baboon  ccaaaaatt--------acacccagtcagggatcag
B D              Green monkey  ccaaaaatt--------gcacccgatcagggatcag
B D                  Marmoset  caaaaaatt--------gcacctagtcagagatcag
B D           Squirrel monkey  caaaaaatt--------gtacccagtcagagatcag
B D                  Bushbaby  ccaacactg--------gcactaagtgaggaatcag
           Chinese tree shrew  cca------------------------aggggccag
B D                  Squirrel  caaaagga---------aaaggaactaagggattaa
                 Prairie vole  caaaaaaat--------ctattcactcagtcattga
B D           Chinese hamster  caaagaatt--------atattcattctgtcattga
               Golden hamster  caaagaatt--------atattcactcagtcactga
B D                     Mouse  caaaaaaatc-------atattcactcagccatcaa
B D                Guinea pig  ctaaaggt---------gtactcagccttgcactag
                   Chinchilla  ccagaatt---------gcactcactcaggcattag
             Brush-tailed rat  ccaaaatt---------gcactgactcatgcattag
B D                    Rabbit  taaaaaatt--------gcactcagtcagggatcag
B D                   Dolphin  cca-acatt--------gcactcaggcaagggtcag
                 Killer whale  cca-acatt--------gcactcaggcaagggtctg
B D                     Horse  ccaaaaa--------------ccagtcaaggatcca
B D          White rhinoceros  ccaaaaatt--------gcactcagtcaaggatcag
B D                       Cat  ccccaaatc--------acactcagttaaggctctg
B D                       Dog  ccacaaatt--------acactcagcccaggatctg
B D                   Ferret   ctaaaaatt--------acactccgtttaggatctg
B D                     Panda  ccaaaaatt--------acactcg-----------g
               Pacific walrus  ccaaaaatt--------gcactcagttaaggatctg
                 Weddell seal  ccaaaaact--------gcactcagttaaggatctg
             Black flying-fox  cca-aaatt--------gcattcagtaaagggtcag
B D                   Megabat  cca-aaatt--------gcattcagtaaagggtcag
                Big brown bat  cca-taatt--------gtactcagtgaagggtcag
B D                  Microbat  cca-taatt--------gcactcagtgaagggtcag
B D                  Hedgehog  tcaaaaaac--------ggattcagatgttaatgag
B D                     Shrew  caaataatt--------gtgttgagttaaggatgag
B D                  Elephant  ---------ccactcagacactcagctggggattag
B D                   Manatee  ---------ccactcagatactcagttggggattag
             Cape golden mole  ---------ctaataggacactcagctgtggattag
                     Aardvark  ---------cccttgagatattcagtcagggattag
B D                 Armadillo  ---------cca---aaaattgtaccaacagttcag
             Star-nosed mole  ------------------------------------
B D                      Pika  ====================================
B D                       Rat  ====================================
      Lesser Egyptian jerboa  ====================================
B D                    Tenrec  ====================================
B D                       Pig  ------------------------------------
B D                       Cow  ====================================
               Domestic goat  ====================================
B D                     Sheep  ====================================
            Tibetan antelope  ====================================
        David's myotis (bat)  ====================================
              Bactrian camel  ====================================
B D                    Alpaca  ====================================
B D            Naked mole-rat  ====================================
                 Spotted gar  ====================================
B D                Coelacanth  ====================================
B D                    Lizard  ====================================
  D  Chinese softshell turtle  ====================================
  D            Painted turtle  ====================================
  D           Green seaturtle  ====================================
  D              Mallard duck  ====================================
B D        American alligator  ====================================
B D                   Opossum  ====================================
B D           Tasmanian devil  ====================================

Inserts between block 12 and 13 in window
          Chinese tree shrew 99bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp

Alignment block 13 of 262 in window, 128060648 - 128060662, 15 bps 
B D                     Human  tcacctgt---aagtcta
B D                     Chimp  tcacctgt---aagtcca
B D                   Gorilla  tcacctgt---aagtcta
B D                 Orangutan  ttgcctat---aagtcca
B D                    Gibbon  tcacctat---aagtcca
B D                    Rhesus  tcacctat---aagtcca
B D       Crab-eating macaque  tcacctat---aagtcca
B D                    Baboon  tcacctgt---aagtcca
B D              Green monkey  tcacctat---aagccca
B D                  Marmoset  ttgcctgt---aagttca
B D           Squirrel monkey  ttgcctgt---aagttca
B D                  Bushbaby  tcccctgt---gtgccca
B D                  Squirrel  ttgcctcc---aaatcta
                 Prairie vole  ttgcctct---gaatcta
B D           Chinese hamster  tggcctct---gaaccta
               Golden hamster  tggcctct---gaaccta
B D                     Mouse  ttgcctct---gaatcta
B D                Guinea pig  tcacctct---gaaacca
                   Chinchilla  ttgcctct---aaaccca
             Brush-tailed rat  ctgcctct---aaaccca
B D                    Rabbit  tcatctac---aagccag
B D                   Dolphin  ttgcctat---aagccca
                 Killer whale  ttgcctat---aagccca
B D                     Horse  tagcctat---aagccca
B D          White rhinoceros  tagcctct---atgccca
B D                       Cat  tggtctgt---aagtcca
B D                       Dog  tggcctat---aagctca
B D                   Ferret   tggcctag---aagccca
B D                     Panda  tggcctagactaagccca
               Pacific walrus  tggcctag---aagccca
                 Weddell seal  tggcctag---aagccca
             Black flying-fox  tagcctat---aggccga
B D                   Megabat  tagcctat---aggccca
                Big brown bat  tagcctat---aggccca
B D                  Microbat  tagcctat---aggccaa
B D                  Hedgehog  tagcctgt---aaatccc
B D                     Shrew  tgccatgt----------
B D                  Elephant  tcatctgt---tatccca
B D                   Manatee  tcatctgt---tatccca
             Cape golden mole  tcaaatgt---tattcca
                     Aardvark  tcatctgt---tatccca
B D                 Armadillo  taatctgt---tagccaa
             Star-nosed mole  ------------------
B D                      Pika  ==================
B D                       Rat  ==================
      Lesser Egyptian jerboa  ==================
B D                    Tenrec  ==================
B D                       Pig  ------------------
B D                       Cow  ==================
               Domestic goat  ==================
B D                     Sheep  ==================
            Tibetan antelope  ==================
        David's myotis (bat)  ==================
              Bactrian camel  ==================
B D                    Alpaca  ==================
          Chinese tree shrew  ==================
B D            Naked mole-rat  ==================
                 Spotted gar  ==================
B D                Coelacanth  ==================
B D                    Lizard  ==================
  D  Chinese softshell turtle  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
  D              Mallard duck  ==================
B D        American alligator  ==================
B D                   Opossum  ==================
B D           Tasmanian devil  ==================

Inserts between block 13 and 14 in window
B D                 Squirrel 1bp

Alignment block 14 of 262 in window, 128060663 - 128060710, 48 bps 
B D                     Human  agattaaa----ctatcctt--gttgatatcactggtagtgagaa---ggtaga-agc
B D                     Chimp  agattaaa----ctatcctt--gttgatatcactggtagtgagaa---ggcaga-ggt
B D                   Gorilla  agattaaa----ctatcctt--gttgatatcactggtagtgagaa---ggtaga-agc
B D                 Orangutan  agattaaa----ctatcctt--attgatatcactggtagtgagaa---ggtaga-agc
B D                    Gibbon  agattaaa----ctatcttt--attgacatcactggtagtgataa---ggtaga-agc
B D                    Rhesus  agattaac----ctatcctt--attgatatcactggtagtgataa---ggtaga-aac
B D       Crab-eating macaque  agattaac----ctatcctt--attgatatcactggtagtgataa---ggtaga-aac
B D                    Baboon  agattaac----ctatcctt--attgatatcactggtagtgataa---gctaga-aac
B D              Green monkey  agattaaa----ctatcctt--attgatatcactggtagtgataa---ggtaga-agc
B D                  Marmoset  agattaaa----ctatgctc--attggtatcactggtagtgataa---agtaga-agc
B D           Squirrel monkey  agattaaa----caatgctt--attggtatcactggtagtgataa---agcaga-agc
B D                  Bushbaby  ggaataaa----ctgtgtcc--attagtgtcacgggcagtaatac---agtacg-ggc
                 Prairie vole  aaatcaaa----tcacacta--t-tgatgttactaacagtaaaac---tgcaca-agc
B D           Chinese hamster  aaagcaag----ctacacta--t-tggtgttactcatagtaatat---agtaca-agt
               Golden hamster  aaatcaaa----ctacacta--t-tggtgttactaacagtaatac---agtaca-agt
B D                     Mouse  aaatcaaa----ctacactc--t-tggtgctactgatagtaatat---ggcacc-agt
B D                Guinea pig  atattaaa----ctatgcct--a-tgacatcactgacagcaatga---gataca-ggc
                   Chinchilla  ggattaaa----ctatgcta--attgatttcaatggtagcaatga---ggtata-gtc
             Brush-tailed rat  a---------------gctt--actgattttaatgatagctatga---agtata-agc
B D                    Rabbit  aggttaca----gtatgctt--actgatgttcctggtagtgataa---ggtaca-agc
B D                   Dolphin  agattaaa----gtatgtct--actgatatcac-agtagtgataa---gacacagaag
                 Killer whale  agattaaa----gtatgtct--actgatatcac-agtagtgatga---gacacagaag
B D                     Horse  acattaaa----ctgtacct--attgaggtcac-agtagtgataa---ggcaca-agc
B D          White rhinoceros  acattaaa----ctatgtct--attgacgtcac-agtagtgataa---ggcata-agc
B D                       Cat  acactaaa----ctatgtct--attgatatcgc-agtagtagtaa---ggcaca-agc
B D                       Dog  acattaaactatctatatct--actgatatcct-agtagtgataa---ggcaca-agc
B D                   Ferret   acatttaa----ctgtatct--attgatatcat-agtagtgataa---ggcaca-agt
B D                     Panda  acattcaa----ctctatct--gttgagatcat-aggagtgataa---ggcaca-agt
               Pacific walrus  atattcaa----ctgtattt--attgatatcat-aatagtgataa---ggcaca-agt
                 Weddell seal  acattcaa----ctata-tt--aatgatatcat-aatagtgataa---ggcaca-agt
             Black flying-fox  agattaaa----ctatgtcc--tctgacatcac-ggtagtaataa---aacaca-aga
B D                   Megabat  agattaaa----ctatgtcc--tctgacatcac-ggtagtaataa---aacaca-aga
                Big brown bat  agattaga----c--tgctt--actgaggccac-agtaaaaataa---agcaca-agc
B D                  Microbat  agattaga----t--ggttt--actgatgccac-agtaataatagagcagcaca-agc
B D                  Hedgehog  aagaataa----ctaagttt--attaacatcat-agtagtgggga---aaaata-aag
B D                     Shrew  ---tgtga----ctg---tt--ggtggcactgt-aggggtcgata---taagaa-gag
B D                  Elephant  agattaaa----ctatgtttatattgatgtcagtggtagtgataa---gataca-ggc
B D                   Manatee  agattaaa----ctatgtttacattgatgtcagtggtagtgataa---gataca-ggc
             Cape golden mole  agattaaa----cgatgttt--attgatgttactggtattgatat---aa-------c
                     Aardvark  agattaaa----ctatgtgc--attgatatcaccgttagtgataa---gacaca-ggc
B D                 Armadillo  agacacaa-----------------ggtattagc------------------------
             Star-nosed mole  ----------------------------------------------------------
B D                      Pika  ==========================================================
B D                       Rat  ==========================================================
      Lesser Egyptian jerboa  ==========================================================
B D                    Tenrec  ==========================================================
B D                       Pig  ----------------------------------------------------------
B D                       Cow  ==========================================================
               Domestic goat  ==========================================================
B D                     Sheep  ==========================================================
            Tibetan antelope  ==========================================================
        David's myotis (bat)  ==========================================================
              Bactrian camel  ==========================================================
B D                    Alpaca  ==========================================================
B D                  Squirrel  ==========================================================
          Chinese tree shrew  ==========================================================
B D            Naked mole-rat  ==========================================================
                 Spotted gar  ==========================================================
B D                Coelacanth  ==========================================================
B D                    Lizard  ==========================================================
  D  Chinese softshell turtle  ==========================================================
  D            Painted turtle  ==========================================================
  D           Green seaturtle  ==========================================================
  D              Mallard duck  ==========================================================
B D        American alligator  ==========================================================
B D                   Opossum  ==========================================================
B D           Tasmanian devil  ==========================================================

Alignment block 15 of 262 in window, 128060711 - 128060713, 3 bps 
B D                     Human  aa-------------------g
B D                     Chimp  aa-------------------g
B D                   Gorilla  aa-------------------g
B D                 Orangutan  aa-------------------g
B D                    Gibbon  aa-------------------g
B D                    Rhesus  aa-------------------g
B D       Crab-eating macaque  aa-------------------g
B D                    Baboon  aa-------------------g
B D              Green monkey  aa-------------------g
B D                  Marmoset  aa-------------------g
B D           Squirrel monkey  aa-------------------g
B D                  Bushbaby  aa-------------------a
                 Prairie vole  ag-------------------a
B D           Chinese hamster  at-------------------a
               Golden hamster  ac-------------------a
B D                     Mouse  ag-------------------a
B D                Guinea pig  aa--------------------
                   Chinchilla  aa-------------------a
             Brush-tailed rat  aa-------------------a
B D                    Rabbit  ag-------------------g
B D                   Dolphin  gg-------------------g
                 Killer whale  gg-------------------g
B D                     Horse  ag-------------------g
B D          White rhinoceros  ag-------------------a
B D                       Cat  ag-------------------g
B D                       Dog  ag-------------------g
B D                   Ferret   ca-------------------g
B D                     Panda  ag-------------------g
               Pacific walrus  ag-------------------g
                 Weddell seal  ag-------------------g
             Black flying-fox  ag-------------------g
B D                   Megabat  ag-------------------g
                Big brown bat  tt-------------------g
B D                  Microbat  tg-------------------g
B D                  Hedgehog  gaattaaaagggaaatatatca
B D                     Shrew  ga-------------------a
B D                  Elephant  ag-------------------g
B D                   Manatee  ag-------------------g
             Cape golden mole  ag-------------------g
                     Aardvark  ag-------------------g
             Star-nosed mole  ----------------------
B D                      Pika  ======================
B D                       Rat  ======================
      Lesser Egyptian jerboa  ======================
B D                    Tenrec  ======================
B D                       Pig  ----------------------
B D                       Cow  ======================
               Domestic goat  ======================
B D                     Sheep  ======================
            Tibetan antelope  ======================
        David's myotis (bat)  ======================
B D                 Armadillo  ----------------------
              Bactrian camel  ======================
B D                    Alpaca  ======================
B D                  Squirrel  ======================
          Chinese tree shrew  ======================
B D            Naked mole-rat  ======================
                 Spotted gar  ======================
B D                Coelacanth  ======================
B D                    Lizard  ======================
  D  Chinese softshell turtle  ======================
  D            Painted turtle  ======================
  D           Green seaturtle  ======================
  D              Mallard duck  ======================
B D        American alligator  ======================
B D                   Opossum  ======================
B D           Tasmanian devil  ======================

Inserts between block 15 and 16 in window
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                    Mouse 2bp
            Brush-tailed rat 583bp

Alignment block 16 of 262 in window, 128060714 - 128060753, 40 bps 
B D                     Human  a-----------aaacat-aa-----------aataa-aa------atgaaa------------------
B D                     Chimp  a-----------aaacat-aa-----------aataa-aa------atgaaa------------------
B D                   Gorilla  a-----------aaacat-aa-----------aataa-aa------atgaaa------------------
B D                 Orangutan  a-----------aaacat-aa-----------aataa-aa------atgaaa------------------
B D                    Gibbon  a-----------aaacgt-aa-----------aataa-aa------atgaaa------------------
B D                    Rhesus  a-----------aaacat-aa-----------aataa-ag------atgaat------------------
B D       Crab-eating macaque  a-----------aaacat-aa-----------aataa-ag------atgaat------------------
B D                    Baboon  a-----------aaacat-aa-----------aataa-ag------atgaat------------------
B D              Green monkey  a-----------aaacat-aa-----------aataa-ag------atgaat------------------
B D                  Marmoset  a-----------aaacat-aa-----------aat------------tgaat------------------
B D           Squirrel monkey  a-----------aaacat-aa-----------aataa-at------atgaaa------------------
B D                  Bushbaby  a-----------accccg-aa-----------ggcca---------------------------------
                 Prairie vole  a-----------aatgataaa-----------aataa-ga------gtgaaa------------------
B D           Chinese hamster  a-----------aacaat-aa-----------agtaa-aa------gagaaa------------------
               Golden hamster  a-----------cacaat-aa-----------aatag-aa------atg---------------------
B D                     Mouse  a-----------aaaggt--a-----------aacat-aa------aaggaa------------------
B D                Guinea pig  a-----------agggaa-aa-----------aataa-aa------aagaaa------------------
                   Chinchilla  ------------aggaaa-aa-----------gataa-aa------gggaaa------------------
             Brush-tailed rat  aatacataaatttagaaa-aa-----------aataataa------gttcgt------------------
B D                    Rabbit  -----------taaaaat-aa-----------attaa-aatgaatggggaaa------------------
B D                   Dolphin  ------------------aaa-----------aaaat-ga------aagagg------------------
                 Killer whale  ------------------aaa-----------aaaat-ga------aagagg------------------
B D                     Horse  ------------------aaa--------aacaaaat-gg------aagagg------------------
B D          White rhinoceros  ------------------aaa--------aaaaaaat-gg------aagagg------------------
B D                       Cat  ------------------gaa-----------aatac-aa----------ag------------------
B D                       Dog  ------------------aaa-----------cacat-gt------acatag------------------
B D                   Ferret   -------------------aa-----------aaaat-ga------gagtag------------------
B D                     Panda  ------------------gaa-----------aaaat-ga------aagtag------------------
               Pacific walrus  ------------------aaa-----------aaaat-ga------aagtag------------------
                 Weddell seal  ------------------aag-----------aaaat-ga------aagtac------------------
             Black flying-fox  -------------------aa-----------aaaaa-aa------atgtaa------------------
B D                   Megabat  ------------------aaa-----------aaaaa-aa------atgtaa------------------
                Big brown bat  ------------------gaa-----------aaatg-aa------agggaa------------------
B D                  Microbat  ------------------gaa-----------aaata-aa------agggaa------------------
B D                  Hedgehog  ------------------gag-----------ataat-ag------caaggagagaaaattaagatgtca
B D                     Shrew  ------------------gaa-----------ataat-ga------aaggga------------------
B D                  Elephant  ------------------aaa----------gaacat-aa------aatgaa------------------
B D                   Manatee  ------------------aaa----------gaaaat-aa------attgaa------------------
             Cape golden mole  ------------------aaaaacataaaataaaaat-aa------aatgaa------------------
                     Aardvark  ------------------aaa----gaaaataaaaat-aa------aacaaa------------------
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                       Rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Pig  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                  Squirrel  ======================================================================
          Chinese tree shrew  ======================================================================
B D            Naked mole-rat  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  -----gaaaaaattatgtt--------------------------------agag
                        Chimp  -----ggaaaaattatgtt--------------------------------agag
                      Gorilla  -----gaaaaaattatgtt--------------------------------agag
                    Orangutan  -----ggaaaaattatgtt--------------------------------agag
                       Gibbon  -----ggaaaaattatgtt--------------------------------agag
                       Rhesus  -----ggaaaaattatgtt--------------------------------agag
          Crab-eating macaque  -----ggaaaaattatgtt--------------------------------agag
                       Baboon  -----ggaaaaattatgtt--------------------------------agag
                 Green monkey  -----ggaaaaattatgtt--------------------------------agag
                     Marmoset  -----ggaaaaaatatgtt--------------------------------agag
              Squirrel monkey  -----ggaaaaaatatgtt--------------------------------agag
                     Bushbaby  -----------------------------------------------------ag
                 Prairie vole  -------------tgtact--------------------------------aaac
              Chinese hamster  -------------t-tgct--------------------------------agag
               Golden hamster  ---------------tgct--------------------------------acag
                        Mouse  -------------tgtgct--------------------------------agag
                   Guinea pig  -------------tatatt--------------------------------caaa
                   Chinchilla  -------------tatgtt--------------------------------caga
             Brush-tailed rat  -------------tatatg--------------------------------cag-
                       Rabbit  -------------tatgtc--------------------------------agag
                      Dolphin  ----------aaatatgtc--------------------------------agag
                 Killer whale  ----------aaatatgtc--------------------------------agag
                        Horse  ----------aaatacgtc--------------------------------agag
             White rhinoceros  ----------aaatatgtc--------------------------------agag
                          Cat  ----------aaatatgtc--------------------------------agaa
                          Dog  ----------aaatatgtc--------------------------------agag
                      Ferret   ----------acgtatgtc--------------------------------agaa
                        Panda  ----------aaatatgtc--------------------------------agaa
               Pacific walrus  ----------aaatatgtc--------------------------------agaa
                 Weddell seal  ----------aaatacgtcagaaataaaaaaaaataaaataaaataaaaaaagaa
             Black flying-fox  --------ggggaactgtc--------------------------------agag
                      Megabat  --------ggggaactgtc--------------------------------agag
                Big brown bat  ------------atatgtc--------------------------------agat
                     Microbat  -----------gatatgtc--------------------------------agat
                     Hedgehog  tttgtgatagacctctatt------------aatggcattattttttgcaatgaa
                        Shrew  ----------acccgtgtc--------------------------------tgag
                     Elephant  -----aggggaaatatgtc--------------------------------agag
                      Manatee  -----gggggaaatatgtc--------------------------------agag
             Cape golden mole  ------ggagaagtatgtc--------------------------------agag
                     Aardvark  -----gggggaagtacgta--------------------------------agag
              Star-nosed mole  -------------------------------------------------------
                         Pika  =======================================================
                          Rat  =======================================================
       Lesser Egyptian jerboa  =======================================================
                       Tenrec  =======================================================
                          Pig  -------------------------------------------------------
                          Cow  =======================================================
                Domestic goat  =======================================================
                        Sheep  =======================================================
             Tibetan antelope  =======================================================
         David's myotis (bat)  =======================================================
                    Armadillo  -------------------------------------------------------
               Bactrian camel  =======================================================
                       Alpaca  =======================================================
                     Squirrel  =======================================================
           Chinese tree shrew  =======================================================
               Naked mole-rat  =======================================================
                  Spotted gar  =======================================================
                   Coelacanth  =======================================================
                       Lizard  =======================================================
     Chinese softshell turtle  =======================================================
               Painted turtle  =======================================================
              Green seaturtle  =======================================================
                 Mallard duck  =======================================================
           American alligator  =======================================================
                      Opossum  =======================================================
              Tasmanian devil  =======================================================

Inserts between block 16 and 17 in window
B D                    Mouse 650bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 17 of 262 in window, 128060754 - 128060765, 12 bps 
B D                     Human  atagttcagcaa
B D                     Chimp  atagttcagcaa
B D                   Gorilla  atagttcagcaa
B D                 Orangutan  atagtttagcaa
B D                    Gibbon  atagtttaggaa
B D                    Rhesus  atagtttagcaa
B D       Crab-eating macaque  atagtttagcaa
B D                    Baboon  atagtttagcaa
B D              Green monkey  atagtttagcaa
B D                  Marmoset  atagtttagcaa
B D           Squirrel monkey  atagtttagcga
B D                  Bushbaby  atagtgtagcaa
                 Prairie vole  --aaactatcat
B D           Chinese hamster  --aaattgtcaa
               Golden hamster  --gaatcatcaa
B D                Guinea pig  gtagtttagcaa
                   Chinchilla  gtagcttggcaa
             Brush-tailed rat  atgttatagtaa
B D                    Rabbit  aaagtttagcaa
B D                   Dolphin  atagaataacaa
                 Killer whale  atagaatagcaa
B D                     Horse  agagaatagcaa
B D          White rhinoceros  atagaatagcaa
B D                       Cat  atagaacagcaa
B D                       Dog  atagactagcaa
B D                   Ferret   ctaaactagcaa
B D                     Panda  atagactagcaa
               Pacific walrus  atagactagcaa
                 Weddell seal  atagactagcaa
             Black flying-fox  atagaatagcaa
B D                   Megabat  atagaatagcaa
                Big brown bat  atagaacagcaa
B D                  Microbat  agagaacagcaa
B D                  Hedgehog  gtttaatttaaa
B D                     Shrew  attgaacagcaa
B D                  Elephant  atattatagcaa
B D                   Manatee  atatcatagcaa
             Cape golden mole  atattagaacac
                     Aardvark  atagtataacaa
             Star-nosed mole  ------------
B D                      Pika  ============
B D                     Mouse  ============
B D                       Rat  ============
      Lesser Egyptian jerboa  ============
B D                    Tenrec  ============
B D                       Pig  ------------
B D                       Cow  ============
               Domestic goat  ============
B D                     Sheep  ============
            Tibetan antelope  ============
        David's myotis (bat)  ============
B D                 Armadillo  ------------
              Bactrian camel  ============
B D                    Alpaca  ============
B D                  Squirrel  ============
          Chinese tree shrew  ============
B D            Naked mole-rat  ============
                 Spotted gar  ============
B D                Coelacanth  ============
B D                    Lizard  ============
  D  Chinese softshell turtle  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
  D              Mallard duck  ============
B D        American alligator  ============
B D                   Opossum  ============
B D           Tasmanian devil  ============

Inserts between block 17 and 18 in window
                  Chinchilla 385bp
            Brush-tailed rat 12bp

Alignment block 18 of 262 in window, 128060766 - 128060766, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  c
                 Prairie vole  a
B D           Chinese hamster  g
               Golden hamster  g
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  g
B D                   Dolphin  a
                 Killer whale  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  g
B D                  Microbat  g
B D                  Hedgehog  a
B D                     Shrew  a
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  g
                     Aardvark  a
             Star-nosed mole  -
B D                      Pika  =
B D                     Mouse  =
B D                       Rat  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                       Pig  -
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
        David's myotis (bat)  =
B D                 Armadillo  -
              Bactrian camel  =
B D                    Alpaca  =
B D                  Squirrel  =
          Chinese tree shrew  =
B D            Naked mole-rat  =
                 Spotted gar  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =

Inserts between block 18 and 19 in window
B D               Guinea pig 473bp

Alignment block 19 of 262 in window, 128060767 - 128060771, 5 bps 
B D                     Human  -aagag
B D                     Chimp  -aagag
B D                   Gorilla  -aagag
B D                 Orangutan  -aagaa
B D                    Gibbon  -aagaa
B D                    Rhesus  -aagaa
B D       Crab-eating macaque  -aagaa
B D                    Baboon  -aagaa
B D              Green monkey  -aagaa
B D                  Marmoset  -aagaa
B D           Squirrel monkey  -aagaa
B D                  Bushbaby  -aagaa
                 Prairie vole  -aagaa
B D           Chinese hamster  -aagaa
               Golden hamster  -aagaa
B D                Guinea pig  -aggaa
                   Chinchilla  -agaaa
             Brush-tailed rat  -aggaa
B D                    Rabbit  -aaga-
B D                   Dolphin  -aagaa
                 Killer whale  -aagaa
B D                     Horse  -aaaaa
B D          White rhinoceros  -aagaa
B D                       Cat  -aagaa
B D                       Dog  -aagaa
B D                   Ferret   -aagaa
B D                     Panda  -aagaa
               Pacific walrus  -aagaa
                 Weddell seal  -aagaa
             Black flying-fox  -aagag
B D                   Megabat  -aagag
                Big brown bat  -aagag
B D                  Microbat  -gagag
B D                  Hedgehog  -ag---
B D                     Shrew  -aa---
B D                  Elephant  aaggaa
B D                   Manatee  aaggaa
             Cape golden mole  aaggaa
                     Aardvark  aaggaa
             Star-nosed mole  ------
B D                      Pika  ======
B D                     Mouse  ======
B D                       Rat  ======
      Lesser Egyptian jerboa  ======
B D                    Tenrec  ======
B D                       Pig  ------
B D                       Cow  ======
               Domestic goat  ======
B D                     Sheep  ======
            Tibetan antelope  ======
        David's myotis (bat)  ======
B D                 Armadillo  ------
              Bactrian camel  ======
B D                    Alpaca  ======
B D                  Squirrel  ======
          Chinese tree shrew  ======
B D            Naked mole-rat  ======
                 Spotted gar  ======
B D                Coelacanth  ======
B D                    Lizard  ======
  D  Chinese softshell turtle  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
  D              Mallard duck  ======
B D        American alligator  ======
B D                   Opossum  ======
B D           Tasmanian devil  ======

Inserts between block 19 and 20 in window
B D          Chinese hamster 3bp
              Golden hamster 122bp
B D                  Dolphin 4bp
                Killer whale 4bp
B D         White rhinoceros 4bp
B D                      Cat 4bp
B D                      Dog 4bp
B D                  Ferret  4bp
B D                    Panda 4bp
              Pacific walrus 4bp
                Weddell seal 4bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 4bp
B D                 Microbat 4bp

Alignment block 20 of 262 in window, 128060772 - 128060774, 3 bps 
B D                     Human  gga
B D                     Chimp  gga
B D                   Gorilla  gga
B D                 Orangutan  gga
B D                    Gibbon  gga
B D                    Rhesus  aga
B D       Crab-eating macaque  aga
B D                    Baboon  aga
B D              Green monkey  aga
B D                  Marmoset  gga
B D           Squirrel monkey  aga
B D                  Bushbaby  ggg
                 Prairie vole  gta
B D           Chinese hamster  tta
B D                Guinea pig  gga
                   Chinchilla  gga
             Brush-tailed rat  aga
B D                    Rabbit  --a
B D                   Dolphin  gaa
                 Killer whale  gaa
B D                     Horse  gga
B D          White rhinoceros  gga
B D                       Cat  gga
B D                       Dog  gga
B D                   Ferret   aga
B D                     Panda  aga
               Pacific walrus  gga
                 Weddell seal  gga
             Black flying-fox  gga
B D                   Megabat  ggc
                Big brown bat  gga
B D                  Microbat  gga
B D                  Hedgehog  aga
B D                     Shrew  ggc
B D                  Elephant  aga
B D                   Manatee  gaa
             Cape golden mole  gga
                     Aardvark  gga
             Star-nosed mole  ---
B D                      Pika  ===
B D                     Mouse  ===
B D                       Rat  ===
              Golden hamster  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                       Pig  ---
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
        David's myotis (bat)  ===
B D                 Armadillo  ---
              Bactrian camel  ===
B D                    Alpaca  ===
B D                  Squirrel  ===
          Chinese tree shrew  ===
B D            Naked mole-rat  ===
                 Spotted gar  ===
B D                Coelacanth  ===
B D                    Lizard  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
  D              Mallard duck  ===
B D        American alligator  ===
B D                   Opossum  ===
B D           Tasmanian devil  ===

Inserts between block 20 and 21 in window
                Prairie vole 131bp
B D          Chinese hamster 2bp

Alignment block 21 of 262 in window, 128060775 - 128060814, 40 bps 
B D                     Human  aaa----agaaagccaacaaa--a----tgagatgcactggttatagaaa
B D                     Chimp  aaa----agaaagccaacaaa--a----tgagatgcactggttatagaaa
B D                   Gorilla  aaa----agaaagccaacaca--a----tgagatgcactggttatagaaa
B D                 Orangutan  aaaagagagaaagccaacaaa--a----tgagatgcactggttatagaaa
B D                    Gibbon  aaaagagagaaagccaacaaa--a----tgagatgcactggctatggaaa
B D                    Rhesus  gaaagagagaaagccaacaaa--a----taagatgcactcgttacagaaa
B D       Crab-eating macaque  gaaagagagaaagccaacaaa--a----taagatgcactcattacagaaa
B D                    Baboon  gaaagagagaaagccaacaaa--a----taagatgcactcgttacagaaa
B D              Green monkey  aaaagagagaaagccaacaaa--a----taagatgcactggttacagaaa
B D                  Marmoset  aaatgagagaaagccaacaaa--a----tgagatgcattggttacagaaa
B D           Squirrel monkey  aaatgagagaaagacaacaaa--a----tgagatgcattggttacagaaa
B D                  Bushbaby  agaggagataaagt--ggcaa--a----cgagatgaattagtcgcagaca
B D           Chinese hamster  ----atgtgtatatttaatat--cccttaaaatcacatgagtt-------
B D                Guinea pig  ----aagagaacatagaaaat--a----agacttaaattgttaaaaaaaa
                   Chinchilla  ----ggtacaaaattgaaaat--a----agacttacattgcttggaaaaa
             Brush-tailed rat  ----aagagaatatagaaact--a----agatttacgttgtttggaaga-
B D                    Rabbit  ----aggagacagcagaaaat--a----agagttgcattggttgtagaaa
B D                   Dolphin  ----gacagaaagcagag-gc--a----agacttgcactgattatagaaa
                 Killer whale  ----gacagaaagcagag-gc--a----agacttgccctgattatagaaa
B D                     Horse  ----agaagaatggggaaaac--a----agagttgcactggttgcagaaa
B D          White rhinoceros  ----gagagaaagcagaaaac--a----agagttgcattggttgtagaaa
B D                       Cat  ----gcaagacagcagaaatg--a----agagctgcactggctgtggaaa
B D                       Dog  ----gagagaaagcagatcag--a----agagctgcgctggtagtgggaa
B D                   Ferret   ----gagaggaagcaggaaacaga----aga-----gctggttgtagaaa
B D                     Panda  ----gagaggaagcagaaagc--a----aga-----gctggctgtagaaa
               Pacific walrus  ----gagaggaagcagaaaac--a----aga-----gctgattgtataaa
                 Weddell seal  ----gagaggaagcagaaaac--a----aga-----gctgattgtggaaa
             Black flying-fox  ----gagaaaaagcggaaaac--a----aaagttgcattggttgtagaaa
B D                   Megabat  ----aagaaaaagcagaaaac--a----aaagttgcattggttgtagaaa
                Big brown bat  ----gagagaaagcagagaag--a----aaagttgaattggttgtagaaa
B D                  Microbat  ----gagagaaagcagagaag--a----aaagctgcattggttgtagaaa
B D                  Hedgehog  ----gagaga-------aaat--a----agccttgtattggttgtaaaa-
B D                     Shrew  ----aagagaagccaggaaat--g----ag--ttgttctgagtgtggaca
B D                  Elephant  ----gtggggaagcagaaaat--a----agagttg---------------
B D                   Manatee  ----gagaggaagcagaaaat--a----agaattg---------------
             Cape golden mole  ----gagaggaagcagaaaat--a----aaggttgccttggttgtaagaa
                     Aardvark  ----gagaggaagcagaaaat--c----acagttgcactggcagtatgaa
             Star-nosed mole  --------------------------------------------------
B D                      Pika  ==================================================
B D                     Mouse  ==================================================
                Prairie vole  ==================================================
B D                       Rat  ==================================================
              Golden hamster  ==================================================
      Lesser Egyptian jerboa  ==================================================
B D                    Tenrec  ==================================================
B D                       Pig  --------------------------------------------------
B D                       Cow  ==================================================
               Domestic goat  ==================================================
B D                     Sheep  ==================================================
            Tibetan antelope  ==================================================
        David's myotis (bat)  ==================================================
B D                 Armadillo  --------------------------------------------------
              Bactrian camel  ==================================================
B D                    Alpaca  ==================================================
B D                  Squirrel  ==================================================
          Chinese tree shrew  ==================================================
B D            Naked mole-rat  ==================================================
                 Spotted gar  ==================================================
B D                Coelacanth  ==================================================
B D                    Lizard  ==================================================
  D  Chinese softshell turtle  ==================================================
  D            Painted turtle  ==================================================
  D           Green seaturtle  ==================================================
  D              Mallard duck  ==================================================
B D        American alligator  ==================================================
B D                   Opossum  ==================================================
B D           Tasmanian devil  ==================================================

Inserts between block 21 and 22 in window
B D          Chinese hamster 1bp
                  Chinchilla 1bp
B D                    Shrew 352bp

Alignment block 22 of 262 in window, 128060815 - 128060817, 3 bps 
B D                     Human  atg
B D                     Chimp  atg
B D                   Gorilla  atg
B D                 Orangutan  atg
B D                    Gibbon  atg
B D                    Rhesus  atg
B D       Crab-eating macaque  atg
B D                    Baboon  atg
B D              Green monkey  atg
B D                  Marmoset  ata
B D           Squirrel monkey  ata
B D                  Bushbaby  acc
B D                Guinea pig  atc
                   Chinchilla  atc
             Brush-tailed rat  atc
B D                    Rabbit  atc
B D                   Dolphin  ttc
                 Killer whale  ttc
B D                     Horse  atc
B D          White rhinoceros  atc
B D                       Cat  atc
B D                       Dog  gtc
B D                   Ferret   gtc
B D                     Panda  gtc
               Pacific walrus  gtc
                 Weddell seal  gtc
             Black flying-fox  atg
B D                   Megabat  atg
                Big brown bat  att
B D                  Microbat  att
B D                  Hedgehog  atc
             Cape golden mole  ata
                     Aardvark  atg
             Star-nosed mole  ---
B D                      Pika  ===
B D                     Shrew  ===
B D                     Mouse  ===
                Prairie vole  ===
B D                       Rat  ===
B D           Chinese hamster  ===
              Golden hamster  ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                       Pig  ---
B D                       Cow  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
        David's myotis (bat)  ===
B D                 Armadillo  ---
B D                   Manatee  ---
B D                  Elephant  ---
              Bactrian camel  ===
B D                    Alpaca  ===
B D                  Squirrel  ===
          Chinese tree shrew  ===
B D            Naked mole-rat  ===
                 Spotted gar  ===
B D                Coelacanth  ===
B D                    Lizard  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
  D              Mallard duck  ===
B D        American alligator  ===
B D                   Opossum  ===
B D           Tasmanian devil  ===

Alignment block 23 of 262 in window, 128060818 - 128060831, 14 bps 
B D                     Human  aagaagcactagtg
B D                     Chimp  aaggagcactagtg
B D                   Gorilla  aaggagcactagtg
B D                 Orangutan  aaggagcactaatg
B D                    Gibbon  aaggagcactagtg
B D                    Rhesus  aaggggcactagta
B D       Crab-eating macaque  aaggggcactagta
B D                    Baboon  aaggggcactagta
B D              Green monkey  aaggggcactagta
B D                  Marmoset  aaggaccac-agtg
B D           Squirrel monkey  aaggaccactagca
B D                  Bushbaby  cagtcccaccg---
B D           Chinese hamster  ggagatcataa---
B D            Naked mole-rat  aagtaccattagta
B D                Guinea pig  aagtaccataagta
                   Chinchilla  aagtaccataagta
             Brush-tailed rat  aggtaccataagta
B D                    Rabbit  acatatgaccagag
B D                   Dolphin  aagtcctatgaata
                 Killer whale  aagtcctatgaata
B D                     Horse  aagttcctccagta
B D          White rhinoceros  aagttctaccagaa
B D                       Cat  aagcatcctcgata
B D                       Dog  acgcatcctcagga
B D                   Ferret   aggcatcctctgta
B D                     Panda  aagcaccctcagta
               Pacific walrus  aaac----------
                 Weddell seal  aaac----------
             Black flying-fox  aagtaccattagta
B D                   Megabat  aagtaccattagta
                Big brown bat  caatcccaccagtg
B D                  Microbat  caatctcgccagtg
B D                  Hedgehog  aagcagagatagca
             Cape golden mole  gaattacagcatta
                     Aardvark  gagttacagcagca
             Star-nosed mole  --------------
B D                      Pika  ==============
B D                     Shrew  ==============
B D                     Mouse  ==============
                Prairie vole  ==============
B D                       Rat  ==============
              Golden hamster  ==============
      Lesser Egyptian jerboa  ==============
B D                    Tenrec  ==============
B D                       Pig  --------------
B D                       Cow  ==============
               Domestic goat  ==============
B D                     Sheep  ==============
            Tibetan antelope  ==============
        David's myotis (bat)  ==============
B D                 Armadillo  --------------
B D                   Manatee  --------------
B D                  Elephant  --------------
              Bactrian camel  ==============
B D                    Alpaca  ==============
B D                  Squirrel  ==============
          Chinese tree shrew  ==============
                 Spotted gar  ==============
B D                Coelacanth  ==============
B D                    Lizard  ==============
  D  Chinese softshell turtle  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
  D              Mallard duck  ==============
B D        American alligator  ==============
B D                   Opossum  ==============
B D           Tasmanian devil  ==============

Alignment block 24 of 262 in window, 128060832 - 128060887, 56 bps 
B D                     Human  gcatccaaggcttatccca--------------ga----------cagcagtgagac-actgctgtggt-
B D                     Chimp  gcatccgaggcttatccca--------------ga----------cagcagtgagac-actgctgtggt-
B D                   Gorilla  gcatccaaggcttatccca--------------ga----------cagcagtgagac-actgctgtggt-
B D                 Orangutan  gcatccaaggcttatcccg--------------gg----------cagcagtgagac-actgctgtggt-
B D                    Gibbon  gcatccaaggcttatccca--------------ga----------cagcagtgagac-actgctgtggt-
B D                    Rhesus  gcatccaaggcttctccca--------------ga----------cagcagtgagac-actgctgtggt-
B D       Crab-eating macaque  gcatccaaagcttctccca--------------ga----------cagcagtgagac-actgctgtggt-
B D                    Baboon  gcatccaaggcttctccca--------------ga----------cagcagtgagac-actgctgtggt-
B D              Green monkey  gcatccaaggcttatccca--------------ga----------cagcagtgagac-actgctgtggt-
B D                  Marmoset  gcatccaaggcttatccca--------------ga----------cagcagtgagat-gttgctgtggt-
B D           Squirrel monkey  gcatccaaggcttatcctg--------------ga----------cagcagtgagac-gtagctgtggt-
B D                  Bushbaby  ----ctaaggcttatcaca--------------gg----------catcagtgaaac-gccgttgtggt-
           Chinese tree shrew  gcatccaaa----atcccaacaggaggagaaggga----------ttgcggtgtggc--cagtcgtgct-
B D           Chinese hamster  ------------tgttatt--------------gggaagtaatgatgcagatgatgcagactttaagag-
B D            Naked mole-rat  gcatctaagttttgtcatt--------------tg----------tgtcaataacacactttttgtgaa-
B D                Guinea pig  gcatctaagttttctcatt--------------tg----------tatcaataatacactttctgtgag-
                   Chinchilla  gcatttaagttttgtcatt--------------tg----------catcaataatacactttgtgtgtg-
             Brush-tailed rat  gcatcaatgttctgtcatt--------------tg----------tgtcaataatgcaatttttgtgag-
B D                    Rabbit  gcacctaaggcttatcatg--------------tg----------agtcaatgatac-tttcttaaggt-
B D                   Dolphin  acatttaaggtatattatg--------------tg----------caccaatgatat------tgtggtt
                 Killer whale  acatttaaggtatattatg--------------tg----------caccaatgagat------tgtggtt
B D                     Horse  gcatttaaagtttatcatg--------------tg----------catctgagatag-gctgttgtgct-
B D          White rhinoceros  gcatctaaggtttgtcatg--------------tg----------catcagtgatac-gctattgtggc-
B D                       Cat  gcaactaagcttcatcacg--------------gg----------catcagtgatgt-gctg-tgtggt-
B D                       Dog  gcacctaagttgcatcatg--------------gg----------catcagtgaggt-gctg-tgtggt-
B D                   Ferret   gctcccaagttataccctg--------------gg----------catcaatgaggg-gctg-catggt-
B D                     Panda  gcgcctaagttgtatcatg--------------gg----------catcaatgacct-gctg-tgtggt-
               Pacific walrus  ------aagttgtatcatg--------------gg----------catcgatgacgt-gctg-tgtggt-
                 Weddell seal  ------aagttgtatcatg--------------gg----------catcaatgacgt-gcta-tttggt-
             Black flying-fox  gcatctaaggtttattaca--------------tt----------cactaatgatat-gttg-tgtggt-
B D                   Megabat  gcatctaaggtttattacg--------------tt----------cactaatgatat-gttg-tgtggt-
                Big brown bat  gcacataagctttatcatg--------------tg----------catttgtgctat-gctg-tctggt-
B D                  Microbat  gcacctacgctttctctta--------------tg----------cattcatgctat-gctg-tcttat-
B D                  Hedgehog  gcatg-gaatggtatccat--------------gg----------cgtcaatgacag-actgttgctac-
B D                  Elephant  -----caaggtttttcatg--------------ta----------catcaatgatgt-gttg-tgtggc-
B D                   Manatee  -----caaggtttttcagg--------------ag----------cattactgatgt-gctg-tgtggt-
             Cape golden mole  ttacccaaggctttccatg--------------tg----------catcaatgaaaa-gctg-tatggt-
                     Aardvark  gtatcaaaagttcttcacg--------------tg----------tatcaatgatat-gcta-tgtagt-
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
B D                     Mouse  ======================================================================
                Prairie vole  ======================================================================
B D                       Rat  ======================================================================
              Golden hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Pig  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                  Squirrel  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  -c-aagagcacaga
                        Chimp  -c-aagagcacaga
                      Gorilla  -c-aagagcacaga
                    Orangutan  -c-aagagcacaga
                       Gibbon  -c-aagagcacaga
                       Rhesus  -c-aagagcacaga
          Crab-eating macaque  -c-aagagcacaga
                       Baboon  -c-aagagcacaga
                 Green monkey  -c-aagagcacaga
                     Marmoset  -c-aacagcacagg
              Squirrel monkey  -c-aagagcacagg
                     Bushbaby  -t-aagagcacagg
           Chinese tree shrew  -c-aaacatgctga
              Chinese hamster  -t-cagggc-----
               Naked mole-rat  -t-aagaacacaga
                   Guinea pig  -t-aagaccacagc
                   Chinchilla  -t-aacaacacagc
             Brush-tailed rat  -t-aaaagcatagt
                       Rabbit  -t-aagagcacagg
                      Dolphin  at-aagagcaccgg
                 Killer whale  at-aagagcaccgg
                        Horse  -t-aggagcacagg
             White rhinoceros  -t-aggagcacagg
                          Cat  -t-aggagagccgg
                          Dog  -t-aggagcacagg
                      Ferret   -t-aagggcacagg
                        Panda  -t-aggagcacggg
               Pacific walrus  -t-aggagcacagg
                 Weddell seal  -t-aggagaaccgg
             Black flying-fox  -t-accagtacagg
                      Megabat  -t-accagtacagg
                Big brown bat  -t-aggagcacagg
                     Microbat  -t-aggagcacggg
                     Hedgehog  -t-aggaacacagg
                     Elephant  -t-aagagaactgg
                      Manatee  -t-aagagcattgg
             Cape golden mole  -taaagagcatggg
                     Aardvark  -t-aagagtattgg
              Star-nosed mole  --------------
                         Pika  ==============
                        Shrew  ==============
                        Mouse  ==============
                 Prairie vole  ==============
                          Rat  ==============
               Golden hamster  ==============
       Lesser Egyptian jerboa  ==============
                       Tenrec  ==============
                          Pig  --------------
                          Cow  ==============
                Domestic goat  ==============
                        Sheep  ==============
             Tibetan antelope  ==============
         David's myotis (bat)  ==============
                    Armadillo  --------------
               Bactrian camel  ==============
                       Alpaca  ==============
                     Squirrel  ==============
                  Spotted gar  ==============
                   Coelacanth  ==============
                       Lizard  ==============
     Chinese softshell turtle  ==============
               Painted turtle  ==============
              Green seaturtle  ==============
                 Mallard duck  ==============
           American alligator  ==============
                      Opossum  ==============
              Tasmanian devil  ==============

Inserts between block 24 and 25 in window
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
                    Aardvark 1bp

Alignment block 25 of 262 in window, 128060888 - 128060888, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  c
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  c
       Lesser Egyptian jerboa  t
B D           Chinese hamster  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                   Dolphin  t
                 Killer whale  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  t
B D                  Microbat  t
B D                  Hedgehog  c
B D                  Elephant  t
B D                   Manatee  t
             Cape golden mole  t
                     Aardvark  t
             Star-nosed mole  -
B D                      Pika  =
B D                     Shrew  =
B D                     Mouse  =
                Prairie vole  =
B D                       Rat  =
              Golden hamster  =
B D                    Tenrec  =
B D                       Pig  -
B D                       Cow  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
        David's myotis (bat)  =
B D                 Armadillo  -
              Bactrian camel  =
B D                    Alpaca  =
B D                  Squirrel  =
                 Spotted gar  =
B D                Coelacanth  =
B D                    Lizard  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D        American alligator  =
B D                   Opossum  =
B D           Tasmanian devil  =

Inserts between block 25 and 26 in window
B D                 Bushbaby 1bp
          Chinese tree shrew 1bp

Alignment block 26 of 262 in window, 128060889 - 128060900, 12 bps 
B D                     Human  cagaaa------ccagg-c
B D                     Chimp  cagaaa------ccagg-c
B D                   Gorilla  cagaaa------ccagg-c
B D                 Orangutan  aaggaa------ccagg-c
B D                    Gibbon  caggaa------ccagg-c
B D                    Rhesus  caggaa------ccagg-t
B D       Crab-eating macaque  caggaa------ccagg-t
B D                    Baboon  caggaa------ccagg-t
B D              Green monkey  caggaa------ccagg-t
B D           Squirrel monkey  caggaa------ccagg-c
B D                  Bushbaby  ctgcac------agagg-c
           Chinese tree shrew  ctggaa------atggg-a
       Lesser Egyptian jerboa  ctaaag------tcagga-
B D           Chinese hamster  tagaaggaggcattagg--
B D            Naked mole-rat  ctagaa------ccagg-t
B D                Guinea pig  ctggaa------caaag-t
                   Chinchilla  ctggag------caaag-t
             Brush-tailed rat  ctggac------caaag-c
B D                    Rabbit  ctggga------ccaga-a
B D                   Dolphin  atagaa------ccagg-c
                 Killer whale  ctagaa------ccagg-c
B D                     Horse  ctggaa------ccagg-c
B D          White rhinoceros  ccggaa------cctgg--
B D                       Cat  ggggca------ccagg-t
B D                       Dog  ctgaaa------ccagg-t
B D                   Ferret   caggaa------ccagg-t
B D                     Panda  ctggaa------ccacg-t
               Pacific walrus  ccggaa------ccatc-t
                 Weddell seal  ctggaa------ccagc-t
             Black flying-fox  ttggat------ccatt-t
B D                   Megabat  ttggat------ccatt-t
                Big brown bat  atggga------ccatt-t
B D                  Microbat  gtggga------ccatt-t
B D                  Hedgehog  ctggag------ccttg-t
B D                  Elephant  ctggaa------tcagg-g
B D                   Manatee  ctggaa------tcagg-t
             Cape golden mole  ctggaa------tcagg-t
                     Aardvark  ctggaa------atagg-t
             Star-nosed mole  -------------------
B D                      Pika  ===================
B D                     Shrew  ===================
B D                     Mouse  ===================
                Prairie vole  ===================
B D                       Rat  ===================
              Golden hamster  ===================
B D                    Tenrec  ===================
B D                       Pig  -------------------
B D                  Marmoset  -------------------
B D                       Cow  ===================
               Domestic goat  ===================
B D                     Sheep  ===================
            Tibetan antelope  ===================
        David's myotis (bat)  ===================
B D                 Armadillo  -------------------
              Bactrian camel  ===================
B D                    Alpaca  ===================
B D                  Squirrel  ===================
                 Spotted gar  ===================
B D                Coelacanth  ===================
B D                    Lizard  ===================
  D  Chinese softshell turtle  ===================
  D            Painted turtle  ===================
  D           Green seaturtle  ===================
  D              Mallard duck  ===================
B D        American alligator  ===================
B D                   Opossum  ===================
B D           Tasmanian devil  ===================

Inserts between block 26 and 27 in window
B D               Guinea pig 5bp
                  Chinchilla 5bp
            Brush-tailed rat 5bp

Alignment block 27 of 262 in window, 128060901 - 128060998, 98 bps 
B D                     Human  ttcctgggcccacactcctc--------cct-atcacttactatctagcatcaga-a-cctcat-ctgtg
B D                     Chimp  tccctgggcccacactcctc--------cct-atcacttactatctagcatcaga-a-cctcat-ctgtg
B D                   Gorilla  ttcctgggcccacactcctc--------cct-atcacttactatctagcatcaga-a-cctcat-ctgtg
B D                 Orangutan  ttcctgggcccacactcctc--------cct-attacttactatctagcatcaga-a-cctcat-ctgtg
B D                    Gibbon  ttcctgagcccacactcctc--------cct-atcacttactatctagcatcaga-a-cctcat-ctgtg
B D                    Rhesus  ttcctgggcccacactcctc--------cct-atcacttactatctagcatcaga-a-cctcat-ctgtg
B D       Crab-eating macaque  ttcctgggcccacactcctc--------cct-atcacttactatctagcatcaga-a-cctcat-ctgtg
B D                    Baboon  ttcctgggcccacactcctc--------cct-gtcacttactatctagcatcaga-a-cctcat-ctgtg
B D              Green monkey  ttcctgggcccacactcctc--------cct-atcacttactatctagcatcaga-a-cctcat-ctgtg
B D           Squirrel monkey  atcctgggtccacgctcctc--------cct-atcacttgctatctagcatcaga-a--ctcat-ctgtg
B D                  Bushbaby  atcccgg--tcacgctcccc--------tct-gcctcgtgctgtctagc--caga-tttctcat-ctgta
           Chinese tree shrew  accacgg--ccactctctctgaaaaacacct-cttaatccctacctggcgccaga-c-tcctatgctgtg
       Lesser Egyptian jerboa  attctgagttcacaccacac--------gca-gtcacctactacccagcttcagatt-cctcat-gtgtt
                 Prairie vole  tcattggggata-gcctctc--------acaggtgactcagtatccaactttgggga-cttcct-gtgta
B D           Chinese hamster  tccctagggata-gtctctc--------acaggtgactcagtacctagtttcagata-cctcct-gtgta
               Golden hamster  tcactgggaata-gccactc--------acaggtgactcagtacccagtttcagata-cttgct-gtgta
B D            Naked mole-rat  atcctggatttacatcgtac--------tct-atccctggctacccagcctcatata-ccacac-ctgta
B D                Guinea pig  accctggactcacatcatac--------tc---ctccttgctagccagcttcacaca-ccactg-ctgca
                   Chinchilla  atcctgggctcacatcatac--------tc---tcccttgctacccagcttcagata-ccacac-ctgta
             Brush-tailed rat  atcctgggctcacggcatgc------------------------------------a-ccgcac-ctgga
B D                    Rabbit  atcctggactcataccatac-----------------ttactgcctagcatc--atc-cctcat-ctgaa
B D                   Dolphin  atcctgggctcatgcttcac--------tgt-accacttactacctaacttcatatt-catcat-ctgta
                 Killer whale  atcctgggctcatgcttcac--------tgt-accacttactacctaacttcatatt-catcat-ctgta
B D                     Horse  atcctctgtccatacctcac--------tct-actacctatgacctaccttcagatt-cctcat-ctgta
B D          White rhinoceros  -------gtcc--acctcac--------tct-accacttacgacctaacttcagatt-cctcat-ctgta
B D                       Cat  gtcctgggatcatacttggc--------tcc-aca-cttactacccaacttcagatt-cctcat-cagtc
B D                       Dog  gtcctggcatcatacctggc--------tcc-acctctttctatctaattccagatt-cctcac-ctgta
B D                   Ferret   gtcctggcatcagagctcgc--------tct-acttcttaatacttaacttcagatt-cctcat-ctgta
B D                     Panda  gtcctggcatcagacctggc--------tct-acctcttactacctaacttcagatt-cctcat-ctgta
               Pacific walrus  gtcctggcatcagacctggc--------tct-acctcttactgcctaacttcagatt-cctcat-ctgta
                 Weddell seal  gtcctggcattagacctggc--------tct-acctcttactgcctaacttcagatt-cctcat-ctgta
             Black flying-fox  -tcctgggcttgtacctcac--------ttc-accccttacaacatacattcaaatt-cttcaa-ccgta
B D                   Megabat  -tcctgggcttgtacctcac--------ttc-accccttacaacatacgttcaaatt-cttcaa-ccata
                Big brown bat  -tactgggctccaacctcac--------tct-accacttactgcctaacttcagatt-cctcac-ctgca
B D                  Microbat  -tactgggctcctacctcac--------tct-accacttgctgcctaacttcagatt-cctcac-ctgca
B D                  Hedgehog  gtcctgagctcatatcatac--------ttg-gaaac---------aacttcagttc-cctcat-ctgta
B D                  Elephant  agtctgggtccacaccctgc--------tct-accacttactacctcacctcagttt-cctcat-ctgta
B D                   Manatee  ggcctgggtccacaccctgc--------tct-accacttattacctcacctccgttt-cctcat-ctgta
             Cape golden mole  gatctgggttcataccctga--------tct-accactcactacctaacttcagttt-cctcat-cagta
                     Aardvark  agtctgggtccatattctgc--------tct-atgacttattgcctcacttctgttg-cttcat-ctgta
B D                 Armadillo  --------ctcacacc--------------------atctctacctaatttcacttt-cctcat-ctgta
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                     Shrew  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Pig  ----------------------------------------------------------------------
B D                  Marmoset  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                  Squirrel  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  gaatagaggagatagcaatgctg-ccta-tatcctgggctat
                        Chimp  gaatagaggagatagcaatgctg-ccta-tatcctgggctat
                      Gorilla  gaatagaggagatagcaatgctg-ccta-tatcctgggctat
                    Orangutan  gaatagaggagatagcaatgctg-ccta-tatcctgggctat
                       Gibbon  gaatagaggagatagcaatgctg-ccta-tatcctgggctat
                       Rhesus  gaatagaggtgatagcaatgctg-cctg-tatcctaggctat
          Crab-eating macaque  gaatagaggtgatagcaatgctg-cctg-tatcctaggctat
                       Baboon  gaatagaggtgatagcaatgctg-ccta-tatcctaggctat
                 Green monkey  gaatagaggtgatagcaatgctg-ccta-tatcctaggctat
              Squirrel monkey  gaatagaagagata--------a-ccta-tatcctgggctgt
                     Bushbaby  aaattca---gataacaatgctg-cctgttatctggggatgt
           Chinese tree shrew  aaatggggctgaccaca---ccg-cctg-gctccggggctgc
       Lesser Egyptian jerboa  ta------gagaaaataataatg---------tgt-------
                 Prairie vole  aa------gaaataattatatta-acat-ttctgtaatagaa
              Chinese hamster  aa------ggaataattatatta-atat-tactacaacaaaa
               Golden hamster  aa------ggaat-attatatta-atat-tactataagagaa
               Naked mole-rat  aaat---ggagataacaatactg-ccta-taccataggctac
                   Guinea pig  gaat---gaagataacaacactg-ccta-taccatgggcgac
                   Chinchilla  aaat---ggggataacaatactt-catg-tactgtgggcaac
             Brush-tailed rat  aaac---agagcctgcagtcctg-ccaa-cactacgggtgac
                       Rabbit  aaat---ggagatggcaatactg-ctcc-tgttgagattgt-
                      Dolphin  aaat---agagataacaaaactg-cct--tatcttggactgt
                 Killer whale  aaat---agagataacaaaactg-cct--tatcttggactgt
                        Horse  gcat---gg-gataacagtactg-ccta-taattca-----t
             White rhinoceros  acat---ggagataacaatactg-cgt--tatcttg-----t
                          Cat  aaac---ggagacgatcggactg-ccta--atctagggcttt
                          Dog  aagt---gtatataaccacaatg-ccta-tatctcaggcatt
                      Ferret   caaa---tgacataactctacag-tcta-tatcttgggcatt
                        Panda  aaat---ggacataactatg------------ctcaggcatt
               Pacific walrus  aaat---ggacataactatgctg-ccta-tatctctggcatt
                 Weddell seal  aaat---ggacataactatgctg-ccta-tatctctggcatt
             Black flying-fox  aaat---gaagataacagtactg-ccaa-tatcttggactgt
                      Megabat  aaat---gaagataacagtactg-ccaa-tatcttggactgt
                Big brown bat  gaat---agagataacagtactg-acaa-tatattggcctat
                     Microbat  gaat---agagctaacagtactg-acaa-catattgggctat
                     Hedgehog  -aat---ggagacagaagca----------------------
                     Elephant  aaat---ggagagaacagtattg-ctaa-tcctctgggctgt
                      Manatee  aaat---ggagatgacagtcttg-ctat-tccattgggctgt
             Cape golden mole  aaat---gaagacaacaatattg-atat-ttccctggattgt
                     Aardvark  aaat---gatgataacaattttg-ctat-ttcatttggctgt
                    Armadillo  aaat---ggagttaacaatattgtctat-ttcattgtgcttt
              Star-nosed mole  ------------------------------------------
                         Pika  ==========================================
                        Shrew  ==========================================
                        Mouse  ==========================================
                          Rat  ==========================================
                       Tenrec  ==========================================
                          Pig  ------------------------------------------
                     Marmoset  ------------------------------------------
                          Cow  ==========================================
                Domestic goat  ==========================================
                        Sheep  ==========================================
             Tibetan antelope  ==========================================
         David's myotis (bat)  ==========================================
               Bactrian camel  ==========================================
                       Alpaca  ==========================================
                     Squirrel  ==========================================
                  Spotted gar  ==========================================
                   Coelacanth  ==========================================
                       Lizard  ==========================================
     Chinese softshell turtle  ==========================================
               Painted turtle  ==========================================
              Green seaturtle  ==========================================
                 Mallard duck  ==========================================
           American alligator  ==========================================
                      Opossum  ==========================================
              Tasmanian devil  ==========================================

Inserts between block 27 and 28 in window
                Prairie vole 37bp
B D          Chinese hamster 47bp
              Golden hamster 47bp

Alignment block 28 of 262 in window, 128060999 - 128061015, 17 bps 
B D                     Human  tg---------taaagaatacatggg
B D                     Chimp  tg---------taaagaatacatggg
B D                   Gorilla  tg---------taaagaatacatggg
B D                 Orangutan  tg---------taaagaatacatggg
B D                    Gibbon  tg---------taaagaatacatggg
B D                    Rhesus  tg---------taaagaatacatggg
B D       Crab-eating macaque  tg---------taaagaatacatggg
B D                    Baboon  tg---------taaagaatacatggg
B D              Green monkey  tg---------taaagaatacatggg
B D           Squirrel monkey  tg---------taaagaatacatggt
B D                  Bushbaby  tg---------taaaaactccatgat
           Chinese tree shrew  tg---------tgaagggtgcatgag
       Lesser Egyptian jerboa  ta---------taaagaaatcatgat
                 Prairie vole  tg---------taa---------tat
B D           Chinese hamster  tg---------taaagaatatatgat
               Golden hamster  tg---------taaagaatatatgat
B D                     Mouse  tg---------taaagaatccatgac
B D            Naked mole-rat  tg---------taaagaatacataat
B D                Guinea pig  ta---------taaaaaatacacaac
                   Chinchilla  ta---------taaaaaatacatgat
             Brush-tailed rat  tg---------tgaagaatacccgaa
B D                    Rabbit  tg---------taaagaacaaatggt
B D                   Dolphin  ta---------cgaaggatacatgag
                 Killer whale  ta---------caaaggatacatgag
B D                     Horse  tg---------agaaagatacatgag
B D          White rhinoceros  tg---------tgaacggtacatgag
B D                       Cat  tg---------tgcacgatagatgag
B D                       Dog  tg---------tgaaggatatatgag
B D                   Ferret   tg---------caaaggatatatgag
B D                     Panda  tg---------tgaaggatctaggag
               Pacific walrus  tg---------tgaaggatatatgac
                 Weddell seal  tg---------tgaaggatatatgac
             Black flying-fox  tg---------tgaagcatacatgaa
B D                   Megabat  tg---------tgaagcatacatgaa
                Big brown bat  tt---------tgaaggattcatgag
B D                  Microbat  tt---------tgaaggatacatgag
B D                  Hedgehog  tg---------tgaagggtacatgag
B D                  Elephant  tgaacacgtgttgaagaatacatgag
B D                   Manatee  tgaatatgtgttgaagagaccatgag
             Cape golden mole  tgaatacatgttgaagaatacataag
                     Aardvark  tgaaaacatagtgatgaatacattag
B D                 Armadillo  tg----------taagtagacatgag
             Star-nosed mole  --------------------------
B D                      Pika  ==========================
B D                     Shrew  ==========================
B D                       Rat  ==========================
B D                    Tenrec  ==========================
B D                       Pig  --------------------------
B D                  Marmoset  --------------------------
B D                       Cow  ==========================
               Domestic goat  ==========================
B D                     Sheep  ==========================
            Tibetan antelope  ==========================
        David's myotis (bat)  ==========================
              Bactrian camel  ==========================
B D                    Alpaca  ==========================
B D                  Squirrel  ==========================
                 Spotted gar  ==========================
B D                Coelacanth  ==========================
B D                    Lizard  ==========================
  D  Chinese softshell turtle  ==========================
  D            Painted turtle  ==========================
  D           Green seaturtle  ==========================
  D              Mallard duck  ==========================
B D        American alligator  ==========================
B D                   Opossum  ==========================
B D           Tasmanian devil  ==========================

Inserts between block 28 and 29 in window
          Chinese tree shrew 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
B D                 Microbat 2bp
B D                 Hedgehog 2bp

Alignment block 29 of 262 in window, 128061016 - 128061074, 59 bps 
B D                     Human  -----actcc--aggta------cggg------att----t----ggaagagtgtctg------------
B D                     Chimp  -----actcc--aggta------cagg------att----t----ggaagagtgtctg------------
B D                   Gorilla  -----actcc--aggta------cagg------att----t----ggaagagtgtctg------------
B D                 Orangutan  -----actcc--aggta------cagg------att----t----ggaagagtgtctg------------
B D                    Gibbon  -----actcc--atgta------cagg------att----t----ggaagagtgtctg------------
B D                    Rhesus  -----actcc--aggta------cagg------att----t----ggaagagtgtctg------------
B D       Crab-eating macaque  -----actcc--aggta------cagg------att----t----ggaagagtgtctg------------
B D                    Baboon  -----actcc--aggta------cagg------att----t----ggaagagtgtctg------------
B D              Green monkey  -----actcc--aggta------cagg------att----t----agaagagtgtctg------------
B D                  Marmoset  -----actct--atgta------cagg------att----t----ggaagattgtctg------------
B D           Squirrel monkey  -----actcc--atgta------cagg------att----t----ggaagagtatctg------------
B D                  Bushbaby  -----actcc--acgtt------aagg------att----c----agacgagggtgca------------
           Chinese tree shrew  -----acttc-----ca------aagg------act----t----caaa---------------------
       Lesser Egyptian jerboa  -----actgt--atgtgatacctatga------atgactt----------aatgtctg------------
                 Prairie vole  -----gctct--atgtg------aggg------atgatctt----aaaagagtatctt------------
B D           Chinese hamster  -----accct--acatg------aagg------atggtctt----aaatgagtatctg------------
               Golden hamster  -----accct--acatg------aggg------atggtttt----aaatgagtatctc------------
B D                     Mouse  -----actcc--atgtg------aggg------atgatctt----aaaagagtatcat------------
B D            Naked mole-rat  -----aaccc--acata------aggg------atg----c----aaatgagtatttg------------
B D                Guinea pig  -----agccc--ataga------gggg------atg----c----aaatgagtatttg------------
                   Chinchilla  -----aaccc--acaga------aggg------atg----c----aaatgagtatttgatgcactttaat
             Brush-tailed rat  -----accct--acaga------aagt------atg----c----aaaggagtctttg------------
B D                    Rabbit  -----gtttc--ttgta------aagg------agt----t----aaaagaat----g------------
B D                   Dolphin  -----actct--aggta------aaag------att----t----agaagagtgtctg------------
                 Killer whale  -----actct--aggta------aaag------att----t----agaagagtgtctg------------
B D                     Horse  -----actct--gtgta------aagg------att----t----ggaagagtgtctg------------
B D          White rhinoceros  -----actcc--acgta------aagg------att----t----agaagaacgtctg------------
B D                       Cat  -----cctct--acaca------aag-------atc----t----agaagagtccctg------------
B D                       Dog  -----gctcc--atata------aaaaaaacatatt----t----agaaaagtgtctg------------
B D                   Ferret   -----actct--gtgta------aagg------att----tacacagaaaggtgtctg------------
B D                     Panda  -----cctcc--atgta------aagg------att----t----agaaaggtgtctg------------
               Pacific walrus  -----actcc--atgt-------aagg------att----t----aggcaggtgtctg------------
                 Weddell seal  -----actcc--acgta------aaga------att----t----agaaaggtgtctg------------
             Black flying-fox  -----atttc--acata------aagg------atg----t----agaagagtgtctg------------
B D                   Megabat  -----atttc--acata------aagg------atg----t----agaagagtgtctg------------
                Big brown bat  -----gctcc--acata------aagg------ata----t----agatgagtgcctg------------
B D                  Microbat  -----gctcc--acaga------aagg------ata----t----agatgaatgcctg------------
B D                  Hedgehog  -----gctac--atgta------aagg------att----t----tgaaaagtggcat------------
B D                     Shrew  -----actcctggtttt------aagg------atg----g----agaaaattgtctg------------
B D                  Elephant  a---aactcg--atgaa------aagg------att----t----agaacagtgtcag------------
B D                   Manatee  a---tactcc--gtgaa------aagg------gtt----t----agaacagtgtcag------------
             Cape golden mole  a---taatcc--atgta------agag------att----t----acaacactgtcat------------
                     Aardvark  a---tacttc--acata------aaag------att----t----aga--agtgtcag------------
B D                 Armadillo  agggcattcc--aggta------aagg------att----t----agaagag------------------
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                       Rat  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Pig  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                  Squirrel  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  gcacattttatacacttcataaatgg----ta
                        Chimp  gcacattttatacacttcataaatgg----ta
                      Gorilla  gcacattttatacacttcataaatgg----ga
                    Orangutan  gcaaattttgtacacttcataaatgg----ta
                       Gibbon  gcacattttatacacttcataaatgg----ta
                       Rhesus  gcacattttatacacttcataaatggtaacta
          Crab-eating macaque  gcacattttatacacttcataaatggtaacta
                       Baboon  gcacattttgtacacttcataaatggtaacta
                 Green monkey  gcacattttatacacttcataaatggtaacta
                     Marmoset  gcacattttatgcacttcataagtggtaacta
              Squirrel monkey  gcatattttatgtactccatatgtggtaacta
                     Bushbaby  gcccactttacacacttcataaagggtaactc
           Chinese tree shrew  -----------acccttcatcagtgccggctg
       Lesser Egyptian jerboa  ccacattctaaata-tttataagtggta----
                 Prairie vole  ccccattctaaaca-tttgtgattggta----
              Chinese hamster  ccgcattctaagta-ttcatgtttggta----
               Golden hamster  ccatattctaagta-ttcatgtttggta----
                        Mouse  ccacatcctaagca-ttcataaatgata----
               Naked mole-rat  gtgcattctaatcacttcataaatgatg----
                   Guinea pig  gtgcattctaagcacttcttgaatgata----
                   Chinchilla  gagtattctaagcacttta-aaatgac-----
             Brush-tailed rat  gcatgttctaagctctctagaaatgatg----
                       Rabbit  gcaagtattaagctcttcataaatggta----
                      Dolphin  gcaaattttaagtgcttcataaatgcta----
                 Killer whale  gcaaattttaagtgcttcataaatgcta----
                        Horse  gcacattgtaaatgcgtcataagtggta----
             White rhinoceros  gcacattttaagtgcttcgtaaatggta----
                          Cat  gcacattttaagtgcttcataa-tggtg----
                          Dog  acacattttaagtgtttcataattggta----
                      Ferret   gcacattctaagtgcttcataaatggta----
                        Panda  gcacattttaagtgcttcacaaatgata----
               Pacific walrus  gcacattttaagtgcttcataaatggta----
                 Weddell seal  gcacattttaagtgcttcataaatggta----
             Black flying-fox  gcacattttaagtgcttcataaattgta----
                      Megabat  gcacattttaagtgcttcataaattgta----
                Big brown bat  gcacgctttaagtgcttcataaatggca----
                     Microbat  gcaggctttaagtgcttcataaattgca----
                     Hedgehog  at----tttaagtgctttatgaatgaga----
                        Shrew  gttga-tgtaagtgcttcatgagtcgta----
                     Elephant  gcacattttaagtgcttcacagtttgca----
                      Manatee  gtacattttaagtgcctcacaactggta----
             Cape golden mole  acacattttaagtgtttcatgaagagta----
                     Aardvark  gggcattttaacttcttcacaaatgata----
                    Armadillo  --------------------aattggtg----
              Star-nosed mole  --------------------------------
                         Pika  ================================
                          Rat  ================================
                       Tenrec  ================================
                          Pig  --------------------------------
                          Cow  ================================
                Domestic goat  ================================
                        Sheep  ================================
             Tibetan antelope  ================================
         David's myotis (bat)  ================================
               Bactrian camel  ================================
                       Alpaca  ================================
                     Squirrel  ================================
                  Spotted gar  ================================
                   Coelacanth  ================================
                       Lizard  ================================
     Chinese softshell turtle  ================================
               Painted turtle  ================================
              Green seaturtle  ================================
                 Mallard duck  ================================
           American alligator  ================================
                      Opossum  ================================
              Tasmanian devil  ================================

Inserts between block 29 and 30 in window
B D                   Rabbit 2020bp

Alignment block 30 of 262 in window, 128061075 - 128061077, 3 bps 
B D                     Human  aat-
B D                     Chimp  aat-
B D                   Gorilla  aat-
B D                 Orangutan  aat-
B D                    Gibbon  aat-
B D                    Rhesus  aat-
B D       Crab-eating macaque  aat-
B D                    Baboon  aat-
B D              Green monkey  aat-
B D                  Marmoset  aat-
B D           Squirrel monkey  aat-
B D                  Bushbaby  tat-
           Chinese tree shrew  tcc-
       Lesser Egyptian jerboa  -ac-
                 Prairie vole  -ac-
B D           Chinese hamster  -ac-
               Golden hamster  -ac-
B D                     Mouse  -at-
B D            Naked mole-rat  -ac-
B D                Guinea pig  -ac-
                   Chinchilla  -tg-
             Brush-tailed rat  -cc-
B D                   Dolphin  -ac-
                 Killer whale  -ac-
B D                     Horse  -ac-
B D          White rhinoceros  -ac-
B D                       Cat  -ac-
B D                       Dog  -ac-
B D                   Ferret   -ac-
B D                     Panda  -ac-
               Pacific walrus  -ac-
                 Weddell seal  -ac-
             Black flying-fox  -ac-
B D                   Megabat  -ac-
                Big brown bat  -ac-
B D                  Microbat  -ac-
B D                  Hedgehog  -ac-
B D                     Shrew  -ac-
B D                  Elephant  -act
B D                   Manatee  -act
             Cape golden mole  -cct
                     Aardvark  -acc
B D                 Armadillo  -act
             Star-nosed mole  ----
B D                      Pika  ====
B D                       Rat  ====
B D                    Rabbit  ====
B D                    Tenrec  ====
B D                       Pig  ----
B D                       Cow  ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ====
        David's myotis (bat)  ====
              Bactrian camel  ====
B D                    Alpaca  ====
B D                  Squirrel  ====
                 Spotted gar  ====
B D                Coelacanth  ====
B D                    Lizard  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
  D              Mallard duck  ====
B D        American alligator  ====
B D                   Opossum  ====
B D           Tasmanian devil  ====

Inserts between block 30 and 31 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 2bp
B D          Chinese hamster 4bp
              Golden hamster 4bp
B D                    Mouse 4bp
B D           Naked mole-rat 4bp
B D               Guinea pig 5bp
                  Chinchilla 5bp
            Brush-tailed rat 5bp
B D                  Dolphin 5bp
                Killer whale 3bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Cat 5bp
B D                      Dog 5bp
B D                  Ferret  5bp
B D                    Panda 5bp
              Pacific walrus 5bp
                Weddell seal 5bp
            Black flying-fox 5bp
B D                  Megabat 5bp
               Big brown bat 5bp
B D                 Microbat 5bp
B D                 Hedgehog 5bp
B D                    Shrew 3bp

Alignment block 31 of 262 in window, 128061078 - 128061122, 45 bps 
B D                     Human  ----atagcccttttatctgt---------attaaatgttgt---------------tgacaa----aga
B D                     Chimp  ----atagcccttttatctgt---------attaaatgttgt---------------tgacaa----aga
B D                   Gorilla  ----atagcccttttatctgt---------attaaatgttgt---------------tgacaa----aga
B D                 Orangutan  ----atagccccttaatctgt---------attaaatgttgt---------------tgacaa----aga
B D                    Gibbon  ----atagccccttcatctgt---------attaaatgttgt---------------tgacaa----aga
B D                    Rhesus  ----atagccccttcatatgt---------attaaatgttgt---------------tgacaa----aga
B D       Crab-eating macaque  ----atagccccttcatatgt---------attaaatgttgt---------------tgacaa----aga
B D                    Baboon  ----atagccccttcatatgt---------attaaatg-tgt---------------tgacaa----aga
B D              Green monkey  ----agagccccttcatatgt---------attaaatgttgt---------------tgacaa----aga
B D                  Marmoset  ----agagccccttcatctgt---------attaaatgttgt---------------tgacaa----aga
B D           Squirrel monkey  ----agagccccttcatcagt---------attaaatgttgt---------------tgacaa----aga
B D                  Bushbaby  ----acagccccttctcgtgt---------gttaaata-cgt---------------tggtgt----ag-
           Chinese tree shrew  ----gtggccccttc---tgt---------gtcaagtgctgt---------------tgacac----agg
       Lesser Egyptian jerboa  ----agagtttcttcttctga---------attcacagtttt---------------tgacat----tgg
                 Prairie vole  ----acagtctg---ttttat---------attagctactgt---------------aggtat----a-g
B D           Chinese hamster  ----atagtctg---ttttgt---------attagctactgt---------------tgatat----a-g
               Golden hamster  ----atagtctg---ttttgt---------attagctactct---------------tggtat----a-a
B D                     Mouse  ----acagtctgtccttctgt---------attagctactgt---------------tggttc----agg
B D            Naked mole-rat  -----cagtcttttcttctat---------aataactattgt---------------taatat----agg
B D                Guinea pig  ----ttagtcttttcttccgt---------attaactattgc---------------tagcat----agg
                   Chinchilla  ----atagcctttgcttctgt---------ggtaattactgt---------------tagcat----agg
             Brush-tailed rat  ----gtagccttttattctgt---------attaactattgt---------------gag-ac----agg
B D                    Rabbit  ----attgccctttattctat---------atcaaatattgc---------------ttacac----agg
B D                   Dolphin  ----atagttccttcttctgt---------atttatttct------------------------------
                 Killer whale  ----atagtcccttcttctgt---------atttatttct------------------------------
B D                     Horse  ----atagtcccttcttctgt---------atttatttat------------------------------
B D          White rhinoceros  ----atagtcccttcgcctgt---------atttatttat------------------------------
B D                       Cat  ----atcatctcttcttctgc---------atttatttct------------------------------
B D                       Dog  ----ataggctct---tctgc---------ggttattttt------------------------------
B D                   Ferret   ----g--ggttct---tctgt---------acttatttct------------------------------
B D                     Panda  ----attggctcgtcttctgt---------atttatttct------------------------------
               Pacific walrus  ----acaggctcttcctctgt---------atttatttct------------------------------
                 Weddell seal  ----ataggctct---tctgt---------atttatttct------------------------------
             Black flying-fox  ----atagtctcttactcttt---------att--tttct------------------------------
B D                   Megabat  ----atagtctcttactcttt---------att--tttct------------------------------
                Big brown bat  ----agagtcccttactcttt---------atttatctct------------------------------
B D                  Microbat  ----agagtcccttacccttt---------atttatctct------------------------------
B D                  Hedgehog  ----atagtcccttcttt-------------tttatgtct------------------------------
B D                     Shrew  ----atcgtcccttcttcaca---------atttattcct------------------------------
B D                  Elephant  atctatagtcatctcttctgt---------attaaacatttt---------------ttgcat----agt
B D                   Manatee  atccatagttgtctcttctgt---------attaaatagttt---------------ttgcat----agt
             Cape golden mole  atctacaatcatctcttcttt---------attaagcatttt---------------ttgcaa----agg
                     Aardvark  atctatagttatctcttctttggaaggaagattgggcaatctgcttccatacagatactgcattggaaac
B D                 Armadillo  acatgcagcc--ttcttctgt---------atcaactattat---------------tgacat----aga
             Star-nosed mole  ----------------------------------------------------------------------
B D                      Pika  ======================================================================
B D                       Rat  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Pig  ----------------------------------------------------------------------
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
        David's myotis (bat)  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                  Squirrel  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
B D                   Opossum  ======================================================================
B D           Tasmanian devil  ======================================================================

                        Human  gctgcat
                        Chimp  gctgcat
                      Gorilla  gctgcat
                    Orangutan  gctgcat
                       Gibbon  gctgcat
                       Rhesus  gctgtat
          Crab-eating macaque  gctgtat
                       Baboon  gctgtat
                 Green monkey  gctgtat
                     Marmoset  accgtat
              Squirrel monkey  gccgtat
                     Bushbaby  gctgtgc
           Chinese tree shrew  tccatgt
       Lesser Egyptian jerboa  gctttg-
                 Prairie vole  actatgt
              Chinese hamster  gctatgt
               Golden hamster  gctatgt
                        Mouse  gctatgt
               Naked mole-rat  tttagat
                   Guinea pig  tctagat
                   Chinchilla  tctagat
             Brush-tailed rat  tctagat
                       Rabbit  tatgtga
                      Dolphin  tttgtgt
                 Killer whale  tttgtgt
                        Horse  tctgtgt
             White rhinoceros  tccctgt
                          Cat  tctgtgt
                          Dog  tccatat
                      Ferret   tctgtgt
                        Panda  tctgtgt
               Pacific walrus  tctgtgt
                 Weddell seal  tctgcgt
             Black flying-fox  tctgtgt
                      Megabat  tctgtgt
                Big brown bat  tctgtgt
                     Microbat  cccgtgt
                     Hedgehog  tctatat
                        Shrew  tc-----
                     Elephant  tctatgt
                      Manatee  tctgtgt
             Cape golden mole  tctttgt
                     Aardvark  ccaagga
                    Armadillo  tccatgt
              Star-nosed mole  -------
                         Pika  =======
                          Rat  =======
                       Tenrec  =======
                          Pig  -------
                          Cow  =======
                Domestic goat  =======
                        Sheep  =======
             Tibetan antelope  =======
         David's myotis (bat)  =======
               Bactrian camel  =======
                       Alpaca  =======
                     Squirrel  =======
                  Spotted gar  =======
                   Coelacanth  =======
                       Lizard  =======
     Chinese softshell turtle  =======
               Painted turtle  =======
              Green seaturtle  =======
                 Mallard duck  =======
           American alligator  =======
                      Opossum  =======
              Tasmanian devil  =======

Alignment block 32 of 262 in window, 128061123 - 128061143, 21 bps 
B D                     Human  agt---gtta--tgggcccagttctg
B D                     Chimp  agt---gtta--tgggcccagttctg
B D                   Gorilla  agt---gtta--tgggcccagttctg
B D                 Orangutan  aga---g-ta--tgcacccagttctg
B D                    Gibbon  agt---gtta--tgggcccagttctg
B D                    Rhesus  agt---gttg--tgggcccagttctg
B D       Crab-eating macaque  agt---gttg--tgggcccagttctg
B D                    Baboon  agt---gttg--tgggcccagttctg
B D              Green monkey  agt---gttg--tgggcccagttctg
B D                  Marmoset  agt---gtta--tcggcccagctctg
B D           Squirrel monkey  agt---gtta--tcggcccagttctg
B D                  Bushbaby  aat---gtga--cgggccttgatctg
           Chinese tree shrew  tgt---gttg--tggacccagatttg
B D                  Squirrel  agt---gtta--tggactcagatctg
       Lesser Egyptian jerboa  aac---gcta--aggacccagacctg
                 Prairie vole  tgt---gtta--taggccaagatctg
B D           Chinese hamster  tgt---gtta--cacaccaggatctg
               Golden hamster  tgt---gtta--tacaatagtatgtg
B D                     Mouse  tat---gtta--tagactgagatcct
B D            Naked mole-rat  aga---atta--t-gaaccagacttg
B D                Guinea pig  cga---attg--cagacccagagctg
                   Chinchilla  aaa---atta--tggacccagacctg
             Brush-tailed rat  aga---atgg--cagacccagacctg
B D                    Rabbit  agt---atta--caaacccatatttg
B D                   Dolphin  agt---gtta--cgaacccagatttg
                 Killer whale  agt---gtta--tgaacccagatttg
B D                     Horse  agt---atta--tgagcccagatttg
B D          White rhinoceros  agt---gtta--tgggccaagatttg
B D                       Cat  agt---gtaa--tgagcccagatttg
B D                       Dog  agt---ttaa--tgggcccagatttg
B D                   Ferret   ggt---ttaa--cggacccaaatttg
B D                     Panda  cat---ttaa--tgggcccaaattta
               Pacific walrus  att---ttaa--agggcccagatttg
                 Weddell seal  agt---ttaa--agggcccagatttg
             Black flying-fox  aat---gata--tgggcctgtgtttg
B D                   Megabat  aat---gata--tgggcctgtgtttg
                Big brown bat  aat---g-ta--tgggcccatatttg
B D                  Microbat  aat---g-ta--tgggcccatatttg
B D                  Hedgehog  agt---gtta--taggaccactagat
B D                     Shrew  -------tcc--tgggcccagacgtg
B D                  Elephant  ggt---gcaa--tgggtccatatttg
B D                   Manatee  agt---gctg--tgggtctgcatttg
             Cape golden mole  agt---acta--tggttccatattta
                     Aardvark  agtgtggctg--tgaatcgggtctga
B D                 Armadillo  aga---gttgtatggacccagatttg
             Star-nosed mole  --------------------------
B D                      Pika  ==========================
B D                       Rat  ==========================
B D                    Tenrec  ==========================
B D                       Pig  --------------------------
B D                       Cow  ==========================
               Domestic goat  ==========================
B D                     Sheep  ==========================
            Tibetan antelope  ==========================
        David's myotis (bat)  ==========================
              Bactrian camel  ==========================
B D                    Alpaca  ==========================
                 Spotted gar  ==========================
B D                Coelacanth  ==========================
B D                    Lizard  ==========================
  D  Chinese softshell turtle  ==========================
  D            Painted turtle  ==========================
  D           Green seaturtle  ==========================
  D              Mallard duck  ==========================
B D        American alligator  ==========================
B D                   Opossum  ==========================
B D           Tasmanian devil  ==========================

Inserts between block 32 and 33 in window
          Chinese tree shrew 2bp

Alignment block 33 of 262 in window, 128061144 - 128061148, 5 bps 
B D                     Human  ---------gtcta
B D                     Chimp  ---------gtcta
B D                   Gorilla  ---------gtcta
B D                 Orangutan  ---------gtcta
B D                    Gibbon  ---------gtcta
B D                    Rhesus  ---------gtcta
B D       Crab-eating macaque  ---------gtcta
B D                    Baboon  ---------gtcta
B D              Green monkey  ---------gtcta
B D                  Marmoset  ---------ctcta
B D           Squirrel monkey  ---------gtcta
           Chinese tree shrew  ---------ctc--
B D                  Squirrel  ---------gacta
       Lesser Egyptian jerboa  ---------cattt
                 Prairie vole  ---------gacta
B D           Chinese hamster  ---------gacta
               Golden hamster  ---------gacta
B D                     Mouse  ---------gacga
B D            Naked mole-rat  ---------ggcca
B D                Guinea pig  ---------gaccc
                   Chinchilla  ---------gacca
             Brush-tailed rat  ---------gaccg
B D                    Rabbit  ---------tgcta
B D                   Dolphin  ---------gacta
                 Killer whale  ---------gacta
B D                     Horse  ---------ggata
B D          White rhinoceros  ---------agata
B D                       Cat  ---------gacca
B D                       Dog  ---------gacta
B D                   Ferret   ---------aacta
B D                     Panda  ---------gactc
               Pacific walrus  ---------aacta
                 Weddell seal  ---------aacta
             Black flying-fox  ---------gacta
B D                   Megabat  ---------gacta
                Big brown bat  ---------gccta
B D                  Microbat  ---------gccta
B D                  Hedgehog  ---------gccta
B D                     Shrew  ---------ggctg
B D                  Elephant  c---------ccta
B D                   Manatee  c---------agta
             Cape golden mole  ccaaa----gcaca
                     Aardvark  ctagatggcgcata
B D                 Armadillo  g---------acta
             Star-nosed mole  --------------
B D                      Pika  ==============
B D                       Rat  ==============
B D                    Tenrec  ==============
B D                       Pig  --------------
B D                       Cow  ==============
               Domestic goat  ==============
B D                     Sheep  ==============
            Tibetan antelope  ==============
        David's myotis (bat)  ==============
              Bactrian camel  ==============
B D                    Alpaca  ==============
                 Spotted gar  ==============
B D                Coelacanth  ==============
B D                    Lizard  ==============
  D  Chinese softshell turtle  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
  D              Mallard duck  ==============
B D        American alligator  ==============
B D                   Opossum  ==============
B D           Tasmanian devil  ==============
B D                  Bushbaby  NNNNNNNNNNNNNN

Alignment block 34 of 262 in window, 128061149 - 128061152, 4 bps 
B D                     Human  gaaa
B D                     Chimp  gaaa
B D                   Gorilla  gaaa
B D                 Orangutan  gaaa
B D                    Gibbon  gaaa
B D                    Rhesus  gaaa
B D       Crab-eating macaque  gaaa
B D                    Baboon  gaaa
B D              Green monkey  gaaa
B D                  Marmoset  gaaa
B D           Squirrel monkey  gaaa
B D                  Bushbaby  gaga
           Chinese tree shrew  -gaa
B D                  Squirrel  gaat
       Lesser Egyptian jerboa  gaat
                 Prairie vole  aagt
B D                     Mouse  aagt
B D            Naked mole-rat  gaat
B D                Guinea pig  gaat
                   Chinchilla  gaat
             Brush-tailed rat  gaat
B D                    Rabbit  gaaa
B D                   Dolphin  gaag
                 Killer whale  gaag
B D                     Horse  gaaa
B D          White rhinoceros  gaaa
B D                       Cat  cgaa
B D                       Dog  caaa
B D                   Ferret   caaa
B D                     Panda  ctaa
               Pacific walrus  caaa
                 Weddell seal  caaa
             Black flying-fox  gaaa
B D                   Megabat  gaaa
                Big brown bat  gaaa
B D                  Microbat  gaaa
B D                  Hedgehog  aaca
B D                     Shrew  ggga
B D                  Elephant  ggaa
B D                   Manatee  gaac
             Cape golden mole  gaaa
                     Aardvark  acaa
B D                 Armadillo  gaaa
             Star-nosed mole  ----
B D                      Pika  ====
B D                       Rat  ====
B D           Chinese hamster  ----
              Golden hamster  ----
B D                    Tenrec  ====
B D                       Pig  ----
B D                       Cow  ====
               Domestic goat  ====
B D                     Sheep  ====
            Tibetan antelope  ====
        David's myotis (bat)  ====
              Bactrian camel  ====
B D                    Alpaca  ====
                 Spotted gar  ====
B D                Coelacanth  ====
B D                    Lizard  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
  D              Mallard duck  ====
B D        American alligator  ====
B D                   Opossum  ====
B D           Tasmanian devil  ====

Inserts between block 34 and 35 in window
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
B D                 Microbat 1bp
B D                 Hedgehog 303bp
B D                    Shrew 1bp

Alignment block 35 of 262 in window, 128061153 - 128061173, 21 bps 
B D                     Human  gaatg---tacc--c--ccaaattg--atc
B D                     Chimp  gaatg---tacc--c--ccaaattg--atc
B D                   Gorilla  gaatg---tacc--c--ccaaattg--atc
B D                 Orangutan  ggatg---tacc--c--ccaaattg--atc
B D                    Gibbon  gaatt---tacc--c--ccaaattc--atc
B D                    Rhesus  gaatg---tacc--t--ccaagttg--atc
B D       Crab-eating macaque  gaatg---tacc--t--ccaagttg--atc
B D                    Baboon  gaatg---tacc--c--ccaaattg--atc
B D              Green monkey  gaatg---tacc--c--ccaaattg--atc
B D                  Marmoset  gaatg---tacc--c--ccaaatta--atc
B D           Squirrel monkey  gaatg---tacc--c--ccaaatta--atc
B D                  Bushbaby  gaatg---tgcc--c--tgaacttg--gtg
           Chinese tree shrew  gcctg---tgct--c--ctgaatgg--aca
B D                  Squirrel  gaatg---tgcc--c--c-aaattg--ata
       Lesser Egyptian jerboa  aaatg---tgtccgc--a--agtag--ata
                 Prairie vole  caatg---ggcc--c--c--agcta--aga
B D           Chinese hamster  -aatg---ggcc--a--c--aattg--aca
               Golden hamster  -aatg---ggcc--c--c--aattg--aca
B D                     Mouse  caatg---tgcc--c--c--aattg--ata
B D            Naked mole-rat  gaatg---tgtc--t--c--aaattgttta
B D                Guinea pig  gaata---tgtc--t--a--acatctgtta
                   Chinchilla  gaatg---tgtc--t--a--aaa----tta
             Brush-tailed rat  gaata---tgcc--t--a--aaatcgctta
B D                    Rabbit  -aatg---tgcc--t--ccaaattg--ata
B D                   Dolphin  atttg---cact--c--ccaaactg--atg
                 Killer whale  atttg---cact--c--ccaaactg--atg
B D                     Horse  atttg---tact--c--ccaaattg--atg
B D          White rhinoceros  atttg---tact--c--tcaaattg--ata
B D                       Cat  gtgtg---tgct--c--ccaaattg--aca
B D                       Dog  -tttg---tact--c--tcaaattg--ata
B D                   Ferret   atttg---tact--c--ccaaattg--ata
B D                     Panda  atttg---tact--c--ccgaattg--ata
               Pacific walrus  atttg---tact--c--ccaaattg--atg
                 Weddell seal  atttg---tact--c--ccaaattg--ata
             Black flying-fox  atctg---tact--c--ccaaatca--gta
B D                   Megabat  atctg---tact--c--ccaaatca--gta
                Big brown bat  atctg---tcct--t--ccaaattg--atg
B D                  Microbat  atctg---ttct--t--ccaaattg--atg
B D                     Shrew  atttg---tact--c--acaaatta--ata
B D                  Elephant  gag-g---tccc--c--c--aactg--ata
B D                   Manatee  gagtg---tccc--c--c-aaactg--gtt
             Cape golden mole  gagtg---tttg--c--c-aaactt--ata
                     Aardvark  caaca---acaa--caac-acactg--ata
B D                 Armadillo  gaatgccctccc--c--c-aaattg--ata
             Star-nosed mole  ------------------------------
B D                      Pika  ==============================
B D                  Hedgehog  ==============================
B D                       Rat  ==============================
B D                    Tenrec  ==============================
B D                       Pig  ------------------------------
B D                       Cow  ==============================
               Domestic goat  ==============================
B D                     Sheep  ==============================
            Tibetan antelope  ==============================
        David's myotis (bat)  ==============================
              Bactrian camel  ==============================
B D                    Alpaca  ==============================
                 Spotted gar  ==============================
B D                Coelacanth  ==============================
B D                    Lizard  ==============================
  D  Chinese softshell turtle  ==============================
  D            Painted turtle  ==============================
  D           Green seaturtle  ==============================
  D              Mallard duck  ==============================
B D        American alligator  ==============================
B D                   Opossum  ==============================
B D           Tasmanian devil  ==============================

Alignment block 36 of 262 in window, 128061174 - 128061181, 8 bps 
B D                     Human  aacatgtg
B D                     Chimp  atcatgtg
B D                   Gorilla  atcatgtg
B D                 Orangutan  atcatgtg
B D                    Gibbon  atcatgtg
B D                    Rhesus  atcatgtg
B D       Crab-eating macaque  atcatgtg
B D                    Baboon  atcatgtg
B D              Green monkey  atcatgtg
B D                  Marmoset  atcacaca
B D           Squirrel monkey  atcactca
B D                  Bushbaby  gtgatg-a
           Chinese tree shrew  gtaatgtg
B D                  Squirrel  ataatgtg
       Lesser Egyptian jerboa  gtaatgaa
                 Prairie vole  ataatgta
B D           Chinese hamster  ataatgtg
               Golden hamster  aaaattta
B D                     Mouse  aaaa--ca
B D            Naked mole-rat  acaacgtg
B D                Guinea pig  acaccatg
                   Chinchilla  acaccatg
             Brush-tailed rat  atactatg
B D                    Rabbit  ataaagta
B D                   Dolphin  atgatgta
                 Killer whale  ataatgta
B D                     Horse  ataatgcc
B D          White rhinoceros  atagcgca
B D                       Cat  acggtatc
B D                       Dog  ataatgta
B D                   Ferret   ataatgtc
B D                     Panda  ataatgtc
               Pacific walrus  ataatgtc
                 Weddell seal  ataatgtc
             Black flying-fox  ataatgta
B D                   Megabat  ataatgta
                Big brown bat  gtaatgta
B D                  Microbat  gtagtgta
B D                     Shrew  gtaatgta
B D                  Elephant  ataatgta
B D                   Manatee  ataatgta
             Cape golden mole  ataacgta
                     Aardvark  ataatata
B D                 Armadillo  atactttg
  D    Spiny softshell turtle  aacatgta
             Star-nosed mole  --------
B D                      Pika  ========
B D                  Hedgehog  ========
B D                       Rat  ========
B D                    Tenrec  ========
B D                       Pig  --------
B D                       Cow  ========
               Domestic goat  ========
B D                     Sheep  ========
            Tibetan antelope  ========
        David's myotis (bat)  ========
              Bactrian camel  ========
B D                    Alpaca  ========
                 Spotted gar  ========
B D                Coelacanth  ========
B D                    Lizard  ========
  D  Chinese softshell turtle  ========
  D            Painted turtle  ========
  D           Green seaturtle  ========
  D              Mallard duck  ========
B D        American alligator  ========
B D                   Opossum  ========
B D           Tasmanian devil  ========

Inserts between block 36 and 37 in window
          Chinese tree shrew 473bp

Alignment block 37 of 262 in window, 128061182 - 128061288, 107 bps 
B D                     Human  ----gg--agaaagat---agatctggggtatc-attgtagagcc--act--ggaa--------------
B D                     Chimp  ----gg--agaa-------agatctgggatatc-actgtagagcc--act--ggaa--------------
B D                   Gorilla  ----gg--agaaagat---agatctgggatatc-attgtagagcc--act--ggaa--------------
B D                 Orangutan  ----gg--agaaagac---agatctgggatatc-attgtagagcc--act--ggaa--------------
B D                    Gibbon  ----gg--agaaagat---agatctgggatgtc-attgtagagcc--acc--agaa--------------
B D                    Rhesus  ----gg--agaaagac---aga