Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 247 in window, 10211344 - 10211373, 30 bps 
B D                     Human  cttggataaga--cattcaaggaagggtggtg---------
B D                     Chimp  cttggataaga--cattcaatgaagggtggtg---------
B D                   Gorilla  cttggataaga--cattcaaggaagggtggtg---------
B D                 Orangutan  cctggataaga--cattcaaggaagggtggtg---------
B D                    Gibbon  cttggataaga--cattcaaggaagggtggtg---------
B D                    Rhesus  cctggatgaga--cattcaaggaagggtggtg---------
B D       Crab-eating macaque  cctggatgaga--cattcaaggaagggtggtg---------
B D                    Baboon  cctggatgaga--cattcaaggaagggtggtg---------
B D              Green monkey  cctggatgaga--cattcaaggaagggtggtg---------
B D                  Marmoset  cctggataaga--cattcaaggaaaggaggtg---------
B D           Squirrel monkey  cctggataaga--cattcaaggaaaggaggtg---------
B D            Naked mole-rat  tct-agcaaga--cattcaggaaaaggtggtg---------
                   Chinchilla  cctggggaaaa--catccggggaaaggtggt----------
             Brush-tailed rat  cctggggaaaa--cattcagggaaaggtggtg---------
B D                    Rabbit  ccttgacaaaa--cactccgggaaagatggtg---------
B D                    Alpaca  cctggatgaga--catttaggtggatg--------------
               Bactrian camel  cctggatgaga--catttaggtggatg--------------
                 Killer whale  ctcagacaaga--catatagggaaaggtggtg---------
             Tibetan antelope  ctcggacaaga--cacttagggaaaagtggta---------
B D                       Cow  cttggacaaga--cacttagggaaaagtggta---------
B D                     Sheep  ctcggacaaga--cacttagggaaaagtggta---------
                Domestic goat  ctcggacaaga--cacttagggaaaagtggta---------
B D                       Cat  c-cagacaaga--tattcagggaaagatcgtg---------
B D                   Ferret   c-cagacaaga--cattcagggaaagatgatg---------
B D                     Panda  c-cagacaaga--cattcggggaaatgtggtg---------
                 Weddell seal  c-cacacaaga--cattcatggaaaggtggtg---------
             Black flying-fox  cttagacaaga--tatttagggaa-----------------
B D                   Megabat  cttggacaaga--tatttagggaa-----------------
              Star-nosed mole  tctagaggagc--cattcatggaaaagagatg---------
B D                  Elephant  cctgagcaaga--caatcagggaacgttggtg---------
                     Aardvark  ccagggccaaa--caattggggaaaggaggtg---------
B D             X. tropicalis  --cagccaatatccatttagagaaagaaaatgaggcaggca
         Cape elephant shrew  =========================================
              Golden hamster  =========================================
                Prairie vole  =========================================
B D                     Mouse  =========================================
B D                       Rat  =========================================
B D                    Medaka  =========================================
    Mexican tetra (cavefish)  =========================================
B D           Chinese hamster  =========================================
      Lesser Egyptian jerboa  =========================================
B D                      Pika  =========================================
B D                    Tenrec  =========================================
          Chinese tree shrew  =========================================
B D                  Hedgehog  =========================================
               Big brown bat  =========================================
B D                     Shrew  =========================================
B D                Guinea pig  =========================================
B D                    Lizard  =========================================
  D              Mallard duck  =========================================
      Yellowbelly pufferfish  =========================================
B D                      Fugu  =========================================
B D                   Wallaby  =========================================
B D           Tasmanian devil  =========================================
B D                   Opossum  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
  D               Rock pigeon  =========================================
  D  Chinese softshell turtle  =========================================
  D           Green seaturtle  =========================================
  D            Painted turtle  =========================================
B D                 Tetraodon  =========================================
B D              Atlantic cod  =========================================
B D               Stickleback  =========================================
          Southern platyfish  =========================================
         Pundamilia nyererei  =========================================
                 Zebra mbuna  =========================================
       Burton's mouthbreeder  =========================================
         Princess of Burundi  =========================================
B D              Nile tilapia  =========================================
                 Spotted gar  =========================================
B D        American alligator  =========================================
          Tibetan ground jay  =========================================
            Cape golden mole  =========================================
B D                   Dolphin  =========================================
B D                       Pig  =========================================
B D                  Microbat  =========================================
        David's myotis (bat)  =========================================
              Pacific walrus  =========================================
B D                       Dog  =========================================
B D                 Armadillo  =========================================
B D                   Manatee  =========================================
B D          White rhinoceros  =========================================
B D                     Horse  =========================================
B D                  Squirrel  =========================================
B D                  Bushbaby  =========================================

Inserts between block 1 and 2 in window
B D           Naked mole-rat 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                      Cat 31bp
B D                 Elephant 1bp
                    Aardvark 1bp

Alignment block 2 of 247 in window, 10211374 - 10211379, 6 bps 
B D                     Human  gtattg-
B D                     Chimp  gtattg-
B D                   Gorilla  gtattg-
B D                 Orangutan  gtattg-
B D                    Gibbon  gtattg-
B D                    Rhesus  gcattg-
B D       Crab-eating macaque  gcattg-
B D                    Baboon  gcattg-
B D              Green monkey  gcattg-
B D                  Marmoset  gtattg-
B D           Squirrel monkey  gtattg-
B D                    Rabbit  acattg-
B D                  Elephant  gtgttg-
B D             X. tropicalis  -ccctga
         Cape elephant shrew  =======
              Golden hamster  =======
                Prairie vole  =======
B D                     Mouse  =======
B D                       Rat  =======
B D                    Medaka  =======
    Mexican tetra (cavefish)  =======
B D           Chinese hamster  =======
      Lesser Egyptian jerboa  =======
B D                      Pika  =======
B D                    Tenrec  =======
          Chinese tree shrew  =======
B D                  Hedgehog  =======
               Big brown bat  =======
               Domestic goat  -------
B D                     Sheep  -------
B D                     Shrew  =======
B D                       Cow  -------
B D                Guinea pig  =======
B D                    Lizard  =======
  D              Mallard duck  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                   Wallaby  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
  D  Chinese softshell turtle  =======
  D           Green seaturtle  =======
  D            Painted turtle  =======
B D                 Tetraodon  =======
B D              Atlantic cod  =======
B D               Stickleback  =======
          Southern platyfish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
                 Spotted gar  =======
B D        American alligator  =======
          Tibetan ground jay  =======
            Cape golden mole  =======
            Tibetan antelope  -------
B D                   Dolphin  =======
            Brush-tailed rat  =======
             Star-nosed mole  -------
                Killer whale  -------
B D            Naked mole-rat  =======
                    Aardvark  =======
B D                   Megabat  -------
B D                       Pig  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
                Weddell seal  -------
B D                     Panda  -------
B D                   Ferret   -------
              Pacific walrus  =======
                  Chinchilla  -------
            Black flying-fox  -------
B D                       Dog  =======
B D                       Cat  =======
              Bactrian camel  -------
B D                    Alpaca  -------
B D                 Armadillo  =======
B D                   Manatee  =======
B D          White rhinoceros  =======
B D                     Horse  =======
B D                  Squirrel  =======
B D                  Bushbaby  =======

Inserts between block 2 and 3 in window
B D                 Elephant 174bp

Alignment block 3 of 247 in window, 10211380 - 10211393, 14 bps 
B D                     Human  ctttctttgaattt
B D                     Chimp  ctttctttgaattt
B D                   Gorilla  ctttctttgaattt
B D                 Orangutan  ctttctttgaattt
B D                    Gibbon  ctttctttgaattt
B D                    Rhesus  gtttctttgaatgt
B D       Crab-eating macaque  gtttctttgaatgt
B D                    Baboon  gtttctttgaatgt
B D              Green monkey  gtttctttgaatgt
B D                  Marmoset  ggttttttgaacat
B D           Squirrel monkey  ggttttttgaatgt
B D                    Rabbit  g-ccgtttgaattt
B D                       Cat  ---atcttgagaga
B D             X. tropicalis  cactattaaaatga
         Cape elephant shrew  ==============
              Golden hamster  ==============
                Prairie vole  ==============
B D                     Mouse  ==============
B D                       Rat  ==============
B D                    Medaka  ==============
    Mexican tetra (cavefish)  ==============
B D           Chinese hamster  ==============
      Lesser Egyptian jerboa  ==============
B D                      Pika  ==============
B D                    Tenrec  ==============
          Chinese tree shrew  ==============
B D                  Hedgehog  ==============
               Big brown bat  ==============
               Domestic goat  --------------
B D                     Sheep  --------------
B D                     Shrew  ==============
B D                       Cow  --------------
B D                Guinea pig  ==============
B D                    Lizard  ==============
  D              Mallard duck  ==============
      Yellowbelly pufferfish  ==============
B D                      Fugu  ==============
B D                   Wallaby  ==============
B D           Tasmanian devil  ==============
B D                   Opossum  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D               Rock pigeon  ==============
  D  Chinese softshell turtle  ==============
  D           Green seaturtle  ==============
  D            Painted turtle  ==============
B D                 Tetraodon  ==============
B D              Atlantic cod  ==============
B D               Stickleback  ==============
          Southern platyfish  ==============
         Pundamilia nyererei  ==============
                 Zebra mbuna  ==============
       Burton's mouthbreeder  ==============
         Princess of Burundi  ==============
B D              Nile tilapia  ==============
                 Spotted gar  ==============
B D        American alligator  ==============
          Tibetan ground jay  ==============
            Cape golden mole  ==============
            Tibetan antelope  --------------
B D                   Dolphin  ==============
            Brush-tailed rat  ==============
             Star-nosed mole  --------------
                Killer whale  --------------
B D            Naked mole-rat  ==============
                    Aardvark  ==============
B D                   Megabat  --------------
B D                       Pig  ==============
B D                  Microbat  ==============
        David's myotis (bat)  ==============
                Weddell seal  --------------
B D                     Panda  --------------
B D                   Ferret   --------------
              Pacific walrus  ==============
                  Chinchilla  --------------
            Black flying-fox  --------------
B D                       Dog  ==============
              Bactrian camel  --------------
B D                    Alpaca  --------------
B D                 Armadillo  ==============
B D                   Manatee  ==============
B D                  Elephant  ==============
B D          White rhinoceros  ==============
B D                     Horse  ==============
B D                  Squirrel  ==============
B D                  Bushbaby  ==============

Inserts between block 3 and 4 in window
B D                   Rabbit 3458bp
B D                      Cat 7bp

Alignment block 4 of 247 in window, 10211394 - 10211433, 40 bps 
B D                     Human  -cttatccgagaatagttaaatctgtccaa-aaaaaggggga
B D                     Chimp  -cttatccgagaatagttaaatctgtccaa-aaaaaggggga
B D                   Gorilla  -cttatccgagaatagttaaatatgtccaa-aaaaaggggga
B D                 Orangutan  -cttatccgagaatagttaaatctgtccaa-aaaaaggggga
B D                    Gibbon  -cttatccgagaatagttaaatctgtccaa-aaaagggggga
B D                    Rhesus  -cttatccgagaatagttaaatctgtccaa-taaaaggggga
B D       Crab-eating macaque  -cttatccgagaatagttaaatctgtccaa-taaaaggggga
B D                    Baboon  -cttatctgagaatagttaaatctgtccaa-taaaaggggga
B D              Green monkey  -cttatccgagaatagttaaatctgtccaa-taaaaggggga
B D                  Marmoset  -cttatccgggaataggtaaatctgtccaa-aaaagtgggga
B D           Squirrel monkey  -cttatctgggaatagttaaatctatccaa-aaaactgggga
                   Chinchilla  ---------------------------------------gca
                 Killer whale  ---gat------------------------------------
             Tibetan antelope  ---tgtctgaaagtgg-----tacgtctga------------
B D                       Cow  ---catctgaaagtgg-----tacgtctga------------
B D                     Sheep  ---tgtctgaaagtgg-----tacgtctga------------
                Domestic goat  ---tgtctgaaagtgg-----tacgtctga------------
              Star-nosed mole  ------------------------------g-----------
B D             X. tropicalis  cactattctagtacagctgaacatatctgc-aacgatg----
         Cape elephant shrew  ==========================================
              Golden hamster  ==========================================
                Prairie vole  ==========================================
B D                     Mouse  ==========================================
B D                       Rat  ==========================================
B D                    Medaka  ==========================================
    Mexican tetra (cavefish)  ==========================================
B D           Chinese hamster  ==========================================
      Lesser Egyptian jerboa  ==========================================
B D                      Pika  ==========================================
B D                    Tenrec  ==========================================
          Chinese tree shrew  ==========================================
B D                  Hedgehog  ==========================================
               Big brown bat  ==========================================
B D                     Shrew  ==========================================
B D                Guinea pig  ==========================================
B D                    Lizard  ==========================================
  D              Mallard duck  ==========================================
      Yellowbelly pufferfish  ==========================================
B D                      Fugu  ==========================================
B D                   Wallaby  ==========================================
B D           Tasmanian devil  ==========================================
B D                   Opossum  ==========================================
  D          Peregrine falcon  ==========================================
  D              Saker falcon  ==========================================
  D               Rock pigeon  ==========================================
  D  Chinese softshell turtle  ==========================================
  D           Green seaturtle  ==========================================
  D            Painted turtle  ==========================================
B D                 Tetraodon  ==========================================
B D              Atlantic cod  ==========================================
B D               Stickleback  ==========================================
          Southern platyfish  ==========================================
         Pundamilia nyererei  ==========================================
                 Zebra mbuna  ==========================================
       Burton's mouthbreeder  ==========================================
         Princess of Burundi  ==========================================
B D              Nile tilapia  ==========================================
                 Spotted gar  ==========================================
B D        American alligator  ==========================================
          Tibetan ground jay  ==========================================
            Cape golden mole  ==========================================
B D                    Rabbit  ==========================================
B D                   Dolphin  ==========================================
            Brush-tailed rat  ==========================================
B D            Naked mole-rat  ==========================================
                    Aardvark  ==========================================
B D                   Megabat  ------------------------------------------
B D                       Pig  ==========================================
B D                  Microbat  ==========================================
        David's myotis (bat)  ==========================================
                Weddell seal  ------------------------------------------
B D                     Panda  ------------------------------------------
B D                   Ferret   ------------------------------------------
              Pacific walrus  ==========================================
            Black flying-fox  ------------------------------------------
B D                       Dog  ==========================================
B D                       Cat  ==========================================
              Bactrian camel  ------------------------------------------
B D                    Alpaca  ------------------------------------------
B D                 Armadillo  ==========================================
B D                   Manatee  ==========================================
B D                  Elephant  ==========================================
B D          White rhinoceros  ==========================================
B D                     Horse  ==========================================
B D                  Squirrel  ==========================================
B D                  Bushbaby  ==========================================

Inserts between block 4 and 5 in window
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp

Alignment block 5 of 247 in window, 10211434 - 10211436, 3 bps 
B D                     Human  agg
B D                     Chimp  agg
B D                   Gorilla  agg
B D                 Orangutan  agg
B D                    Gibbon  agg
B D                    Rhesus  aga
B D       Crab-eating macaque  aga
B D                    Baboon  aga
B D              Green monkey  aga
B D                  Marmoset  aga
B D           Squirrel monkey  aga
                   Chinchilla  tgt
B D                       Cat  ag-
             Black flying-fox  agg
B D                   Megabat  agg
         David's myotis (bat)  ata
         Cape elephant shrew  ===
              Golden hamster  ===
                Prairie vole  ===
B D                     Mouse  ===
B D                       Rat  ===
B D                    Medaka  ===
    Mexican tetra (cavefish)  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  ===
B D                    Tenrec  ===
          Chinese tree shrew  ===
B D                  Hedgehog  ===
               Big brown bat  ===
               Domestic goat  ===
B D                     Sheep  ===
B D                     Shrew  ===
B D                       Cow  ===
B D                Guinea pig  ===
B D             X. tropicalis  ---
B D                    Lizard  ===
  D              Mallard duck  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D              Atlantic cod  ===
B D               Stickleback  ===
          Southern platyfish  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
                 Spotted gar  ===
B D        American alligator  ===
          Tibetan ground jay  ===
            Cape golden mole  ===
B D                    Rabbit  ===
            Tibetan antelope  ===
B D                   Dolphin  ===
            Brush-tailed rat  ===
             Star-nosed mole  ---
                Killer whale  ===
B D            Naked mole-rat  ===
                    Aardvark  ===
B D                       Pig  ===
B D                  Microbat  ===
                Weddell seal  ---
B D                     Panda  ---
B D                   Ferret   ---
              Pacific walrus  ===
B D                       Dog  ===
              Bactrian camel  ---
B D                    Alpaca  ---
B D                 Armadillo  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                  Squirrel  ===
B D                  Bushbaby  ===

Inserts between block 5 and 6 in window
B D                      Cat 1878bp
            Black flying-fox 5bp
B D                  Megabat 5bp
        David's myotis (bat) 5bp

Alignment block 6 of 247 in window, 10211437 - 10211441, 5 bps 
B D                     Human  tggtg-
B D                     Chimp  tggtg-
B D                   Gorilla  tggtg-
B D                 Orangutan  tggtg-
B D                    Gibbon  cggtg-
B D                    Rhesus  tggca-
B D       Crab-eating macaque  tggca-
B D                    Baboon  tggca-
B D              Green monkey  tggca-
B D                  Marmoset  cggtg-
B D           Squirrel monkey  tggtg-
                   Chinchilla  tg----
B D             X. tropicalis  -tgtgt
         Cape elephant shrew  ======
              Golden hamster  ======
                Prairie vole  ======
B D                     Mouse  ======
B D                       Rat  ======
B D                    Medaka  ======
    Mexican tetra (cavefish)  ======
B D           Chinese hamster  ======
      Lesser Egyptian jerboa  ======
B D                      Pika  ======
B D                    Tenrec  ======
          Chinese tree shrew  ======
B D                  Hedgehog  ======
               Big brown bat  ======
               Domestic goat  ======
B D                     Sheep  ======
B D                     Shrew  ======
B D                       Cow  ======
B D                Guinea pig  ======
B D                    Lizard  ======
  D              Mallard duck  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                   Wallaby  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
  D  Chinese softshell turtle  ======
  D           Green seaturtle  ======
  D            Painted turtle  ======
B D                 Tetraodon  ======
B D              Atlantic cod  ======
B D               Stickleback  ======
          Southern platyfish  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
                 Spotted gar  ======
B D        American alligator  ======
          Tibetan ground jay  ======
            Cape golden mole  ======
B D                    Rabbit  ======
            Tibetan antelope  ======
B D                   Dolphin  ======
            Brush-tailed rat  ======
             Star-nosed mole  ------
                Killer whale  ======
B D            Naked mole-rat  ======
                    Aardvark  ======
B D                   Megabat  ======
B D                       Pig  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
                Weddell seal  ------
B D                     Panda  ------
B D                   Ferret   ------
              Pacific walrus  ======
            Black flying-fox  ======
B D                       Dog  ======
B D                       Cat  ======
              Bactrian camel  ------
B D                    Alpaca  ------
B D                 Armadillo  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D          White rhinoceros  ======
B D                     Horse  ======
B D                  Squirrel  ======
B D                  Bushbaby  ======

Inserts between block 6 and 7 in window
                  Chinchilla 3bp

Alignment block 7 of 247 in window, 10211442 - 10211444, 3 bps 
B D                     Human  ---gta
B D                     Chimp  ---gta
B D                   Gorilla  ---gta
B D                 Orangutan  ---gta
B D                    Gibbon  ---gta
B D                    Rhesus  ---gta
B D       Crab-eating macaque  ---gta
B D                    Baboon  ---gta
B D              Green monkey  ---gta
B D                  Marmoset  ---gta
B D           Squirrel monkey  ---gtc
B D            Naked mole-rat  ---atg
             Brush-tailed rat  ---gtg
B D                   Ferret   ----aa
B D                     Panda  ----aa
                 Weddell seal  ----aa
             Black flying-fox  ---gaa
B D                   Megabat  ---gaa
         David's myotis (bat)  ---ggg
              Star-nosed mole  -----a
                     Aardvark  ---aca
B D             X. tropicalis  ctc---
         Cape elephant shrew  ======
              Golden hamster  ======
                Prairie vole  ======
B D                     Mouse  ======
B D                       Rat  ======
B D                    Medaka  ======
    Mexican tetra (cavefish)  ======
B D           Chinese hamster  ======
      Lesser Egyptian jerboa  ======
B D                      Pika  ======
B D                    Tenrec  ======
          Chinese tree shrew  ======
B D                  Hedgehog  ======
               Big brown bat  ======
               Domestic goat  ======
B D                     Sheep  ======
B D                     Shrew  ======
B D                       Cow  ======
B D                Guinea pig  ======
B D                    Lizard  ======
  D              Mallard duck  ======
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
B D                   Wallaby  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
  D               Rock pigeon  ======
  D  Chinese softshell turtle  ======
  D           Green seaturtle  ======
  D            Painted turtle  ======
B D                 Tetraodon  ======
B D              Atlantic cod  ======
B D               Stickleback  ======
          Southern platyfish  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D              Nile tilapia  ======
                 Spotted gar  ======
B D        American alligator  ======
          Tibetan ground jay  ======
            Cape golden mole  ======
B D                    Rabbit  ======
            Tibetan antelope  ======
B D                   Dolphin  ======
                Killer whale  ======
B D                       Pig  ======
B D                  Microbat  ======
              Pacific walrus  ======
                  Chinchilla  ======
B D                       Dog  ======
B D                       Cat  ======
              Bactrian camel  ------
B D                    Alpaca  ------
B D                 Armadillo  ======
B D                   Manatee  ======
B D                  Elephant  ======
B D          White rhinoceros  ======
B D                     Horse  ======
B D                  Squirrel  ======
B D                  Bushbaby  ======

Inserts between block 7 and 8 in window
B D                  Ferret  2bp
B D                    Panda 2bp
                Weddell seal 2bp
             Star-nosed mole 2bp

Alignment block 8 of 247 in window, 10211445 - 10211469, 25 bps 
B D                     Human  ttgggtgtctgaattttgggcaagt-
B D                     Chimp  ttgggtgtctgaattttgggcaagt-
B D                   Gorilla  ttgggtgtctgaattttgggcaagt-
B D                 Orangutan  ttgggtgtctgaattttgggcaagt-
B D                    Gibbon  ttgggtgtctgaattttgggcaagt-
B D                    Rhesus  tcgggtgtccaaattttgggcaagt-
B D       Crab-eating macaque  tcgggtgtccaaattttgggcaagt-
B D                    Baboon  tcgggtgtccaaattttgggcaagt-
B D              Green monkey  tcgggtgtccaaattttggacaagt-
B D                  Marmoset  ccgggtgtctgaattttgag-aagt-
B D           Squirrel monkey  ctgggtgtctgaattttgggcaagg-
B D            Naked mole-rat  ttgactgtctgaactttgggaaagt-
                   Chinchilla  -----------ggatcggggaaagt-
             Brush-tailed rat  ttagctgtctgaaacttggaaaggt-
B D                    Alpaca  tcggatccctgaattt-ggggcagt-
               Bactrian camel  tcggatccctgaattt-ggggcagt-
                 Killer whale  tcggatgtctgacttt-gggaaagt-
             Tibetan antelope  tcagatgtctgaatct-gggggag--
B D                       Cow  tcagatgtctgaatct-gggggagt-
B D                     Sheep  tcagacgtctgaatct-gggggagt-
                Domestic goat  tcagatgtctgaatct-gggggagt-
B D                   Ferret   tcagatgtctgaattttgggagaat-
B D                     Panda  tcagatgtttgaattttgggagagt-
                 Weddell seal  tcagatgtctgaattttgggagagt-
             Black flying-fox  gtcagtgtccgaatttggggaaagt-
B D                   Megabat  gtcagtgtccgaatttggggaaagt-
                Big brown bat  ttgtgggtttgatttggggggaagt-
         David's myotis (bat)  ttgtgggtttgattttgggggaagt-
B D                  Microbat  ttgtgggttttattttgggggaagt-
              Star-nosed mole  ttagctgtctgaactttggggaagt-
                     Aardvark  tcaagtatctgaattgtgggaaagt-
B D             X. tropicalis  tggtgtgtatatatat-gcagaaatg
         Cape elephant shrew  ==========================
              Golden hamster  ==========================
                Prairie vole  ==========================
B D                     Mouse  ==========================
B D                       Rat  ==========================
B D                    Medaka  ==========================
    Mexican tetra (cavefish)  ==========================
B D           Chinese hamster  ==========================
      Lesser Egyptian jerboa  ==========================
B D                      Pika  ==========================
B D                    Tenrec  ==========================
          Chinese tree shrew  ==========================
B D                  Hedgehog  ==========================
B D                     Shrew  ==========================
B D                Guinea pig  ==========================
B D                    Lizard  ==========================
  D              Mallard duck  ==========================
      Yellowbelly pufferfish  ==========================
B D                      Fugu  ==========================
B D                   Wallaby  ==========================
B D           Tasmanian devil  ==========================
B D                   Opossum  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
  D               Rock pigeon  ==========================
  D  Chinese softshell turtle  ==========================
  D           Green seaturtle  ==========================
  D            Painted turtle  ==========================
B D                 Tetraodon  ==========================
B D              Atlantic cod  ==========================
B D               Stickleback  ==========================
          Southern platyfish  ==========================
         Pundamilia nyererei  ==========================
                 Zebra mbuna  ==========================
       Burton's mouthbreeder  ==========================
         Princess of Burundi  ==========================
B D              Nile tilapia  ==========================
                 Spotted gar  ==========================
B D        American alligator  ==========================
          Tibetan ground jay  ==========================
            Cape golden mole  ==========================
B D                    Rabbit  ==========================
B D                   Dolphin  ==========================
B D                       Pig  ==========================
              Pacific walrus  ==========================
B D                       Dog  ==========================
B D                       Cat  ==========================
B D                 Armadillo  ==========================
B D                   Manatee  ==========================
B D                  Elephant  ==========================
B D          White rhinoceros  ==========================
B D                     Horse  ==========================
B D                  Squirrel  ==========================
B D                  Bushbaby  ==========================

Alignment block 9 of 247 in window, 10211470 - 10211512, 43 bps 
B D                     Human  atgtcagctttgta-gacaaatggg-aaaaaatggct-agatatga
B D                     Chimp  atgtcagctttgta-gacaaatgggaaaaaaatggct-agatatga
B D                   Gorilla  atgtcagctttgta-gacaaatgg--aaaaaatggct-agatataa
B D                 Orangutan  atgtcagctttgta-gacaaacagg-aaaaaatggct-agatatga
B D                    Gibbon  atgtcagctttgta-gacaaatggg-aaaaaatggct-agatatga
B D                    Rhesus  atgtcagctttgta-gacaaatggg-aaaaaatggct-agatatga
B D       Crab-eating macaque  atgtcagctttgta-gacaaatggg-aaaaaatggct-agatatga
B D                    Baboon  atgtcagctttgta-gacaaatggg-aaaaaatggct-agatatga
B D              Green monkey  atgtcagctttgta-gacaaatggg-aaaaaatggct-agatatga
B D                  Marmoset  atgtcagctttgta-gacaaatagg-aacaaatggct-agatgtga
B D           Squirrel monkey  atgtcagctttgta-gacaaatggg-aacaaatggct-agatatga
B D            Naked mole-rat  atgggaactttgta-gataatgggg-g------ggtt--aatatga
                   Chinchilla  atggcagcgttgca-gacaatgggg-g--aaatggctgggatatgg
             Brush-tailed rat  atgaccccttcgtagggtaatgggg-g--aaacggctgggatgtga
B D                    Alpaca  acatttgctttgta-gacgaatgag-a-aaaatggccagaatgtga
               Bactrian camel  acatttgctttgta-gacaaatgag-a-aaaatggccagaatgtga
                 Killer whale  acatttgctttgta-gacaaatgag-a-aagatggccagaatgtga
             Tibetan antelope  ----ttgctttgta-gacaaaggaa-a-aagatagccagaatgtga
B D                       Cow  acatttgctttgta-gacaaatgaa-a-aagatggccagaatgtga
B D                     Sheep  acatttgctttgta-gacaaaggaa-a-aagatagccagaatgtga
                Domestic goat  acatttgctttgta-gacaaaggaa-a-aagatagccagaatgtga
B D                   Ferret   acacttgttttgta-gacaaatgag-aaaaaagagccaggaggtag
B D                     Panda  atatttgcttcgta-gacaaatgag-acaaaagagccaggatgtgg
                 Weddell seal  acatttgctttgta-gacaaatgag-aaaaaacagccaggatgtgg
             Black flying-fox  acatttgttttgta-gacaaatgac-a-aaactggccaggatgtga
B D                   Megabat  acatttgttttgta-gacaaatgac-a-aaactggccaggatgtga
                Big brown bat  acatttgccttgta-gacaaatgag-a-aaactgaccaggatgtga
         David's myotis (bat)  acatttgccttgta-gacaaatgag-a-aaactggccaggatgtga
B D                  Microbat  acatttgccatgta-gacaaatgag-a-aaactggccaggatgtga
              Star-nosed mole  gggtttttttagta-aatgaatgag-g-------------atatga
B D                  Elephant  acatcaactttgaa-aacagattag-a-aaaacagccagggagtga
                     Aardvark  acatcagctttaaa-aacaaatgag-a-agaatagccagggtataa
B D             X. tropicalis  gaatcaaaaaagga-aaaagacagg-aagaaatggca-agatatgg
         Cape elephant shrew  ==============================================
              Golden hamster  ==============================================
                Prairie vole  ==============================================
B D                     Mouse  ==============================================
B D                       Rat  ==============================================
B D                    Medaka  ==============================================
    Mexican tetra (cavefish)  ==============================================
B D           Chinese hamster  ==============================================
      Lesser Egyptian jerboa  ==============================================
B D                      Pika  ==============================================
B D                    Tenrec  ==============================================
          Chinese tree shrew  ==============================================
B D                  Hedgehog  ==============================================
B D                     Shrew  ==============================================
B D                Guinea pig  ==============================================
B D                    Lizard  ==============================================
  D              Mallard duck  ==============================================
      Yellowbelly pufferfish  ==============================================
B D                      Fugu  ==============================================
B D                   Wallaby  ==============================================
B D           Tasmanian devil  ==============================================
B D                   Opossum  ==============================================
  D          Peregrine falcon  ==============================================
  D              Saker falcon  ==============================================
  D               Rock pigeon  ==============================================
  D  Chinese softshell turtle  ==============================================
  D           Green seaturtle  ==============================================
  D            Painted turtle  ==============================================
B D                 Tetraodon  ==============================================
B D              Atlantic cod  ==============================================
B D               Stickleback  ==============================================
          Southern platyfish  ==============================================
         Pundamilia nyererei  ==============================================
                 Zebra mbuna  ==============================================
       Burton's mouthbreeder  ==============================================
         Princess of Burundi  ==============================================
B D              Nile tilapia  ==============================================
                 Spotted gar  ==============================================
B D        American alligator  ==============================================
          Tibetan ground jay  ==============================================
            Cape golden mole  ==============================================
B D                    Rabbit  ==============================================
B D                   Dolphin  ==============================================
B D                       Pig  ==============================================
              Pacific walrus  ==============================================
B D                       Dog  ==============================================
B D                       Cat  ==============================================
B D                 Armadillo  ==============================================
B D                   Manatee  ==============================================
B D          White rhinoceros  ==============================================
B D                     Horse  ==============================================
B D                  Squirrel  ==============================================
B D                  Bushbaby  ==============================================

Inserts between block 9 and 10 in window
                    Aardvark 11577bp

Alignment block 10 of 247 in window, 10211513 - 10211521, 9 bps 
B D                     Human  ggat-ggaga
B D                     Chimp  ggat-ggaga
B D                   Gorilla  ggat-ggaga
B D                 Orangutan  ggat-ggaga
B D                    Gibbon  ggat-ggaga
B D                    Rhesus  ggat-ggaga
B D       Crab-eating macaque  ggat-ggaga
B D                    Baboon  ggat-ggaga
B D              Green monkey  ggat-ggaga
B D                  Marmoset  ggat-ggaga
B D           Squirrel monkey  agat-ggaga
B D            Naked mole-rat  ggat-aggga
                   Chinchilla  ggac-aggga
             Brush-tailed rat  gcac-aggga
B D                    Alpaca  ggat-gggga
               Bactrian camel  ggat-gggga
                 Killer whale  ggat-gggga
             Tibetan antelope  gaat-aagaa
B D                       Cow  gaat-aagaa
B D                     Sheep  gaat-aagaa
                Domestic goat  gaat-aagaa
B D                   Ferret   agat-tggaa
B D                     Panda  agat-gggga
                 Weddell seal  agat-gggga
             Black flying-fox  ggat--ggga
B D                   Megabat  ggat--ggga
                Big brown bat  ggat-gggga
         David's myotis (bat)  ggat-gggga
B D                  Microbat  ggat-gggga
              Star-nosed mole  agttggggaa
B D                  Elephant  ggag-gggga
B D             X. tropicalis  gaat-gtaaa
         Cape elephant shrew  ==========
              Golden hamster  ==========
                Prairie vole  ==========
B D                     Mouse  ==========
B D                       Rat  ==========
B D                    Medaka  ==========
    Mexican tetra (cavefish)  ==========
B D           Chinese hamster  ==========
      Lesser Egyptian jerboa  ==========
B D                      Pika  ==========
B D                    Tenrec  ==========
          Chinese tree shrew  ==========
B D                  Hedgehog  ==========
B D                     Shrew  ==========
B D                Guinea pig  ==========
B D                    Lizard  ==========
  D              Mallard duck  ==========
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
B D                   Wallaby  ==========
B D           Tasmanian devil  ==========
B D                   Opossum  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
  D               Rock pigeon  ==========
  D  Chinese softshell turtle  ==========
  D           Green seaturtle  ==========
  D            Painted turtle  ==========
B D                 Tetraodon  ==========
B D              Atlantic cod  ==========
B D               Stickleback  ==========
          Southern platyfish  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D              Nile tilapia  ==========
                 Spotted gar  ==========
B D        American alligator  ==========
          Tibetan ground jay  ==========
            Cape golden mole  ==========
B D                    Rabbit  ==========
B D                   Dolphin  ==========
                    Aardvark  ==========
B D                       Pig  ==========
              Pacific walrus  ==========
B D                       Dog  ==========
B D                       Cat  ==========
B D                 Armadillo  ==========
B D                   Manatee  ==========
B D          White rhinoceros  ==========
B D                     Horse  ==========
B D                  Squirrel  ==========
B D                  Bushbaby  ==========

Alignment block 11 of 247 in window, 10211522 - 10211532, 11 bps 
B D                     Human  gacggtttaga
B D                     Chimp  gacggttcaga
B D                   Gorilla  gatggtttaga
B D                 Orangutan  gatggtttaga
B D                    Gibbon  gacagtttaga
B D                    Rhesus  gatggtttaga
B D       Crab-eating macaque  gatggtttaga
B D                    Baboon  gatggtttaga
B D              Green monkey  gatggtttaga
B D                  Marmoset  g-tggtttaga
B D           Squirrel monkey  gatggtttaga
B D            Naked mole-rat  gatggagtaga
                   Chinchilla  gatggggtgga
             Brush-tailed rat  gggggagtaga
B D                    Alpaca  gatggattaga
               Bactrian camel  gatagattaga
                 Killer whale  gatggatcaga
             Tibetan antelope  tatggctaatg
B D                       Cow  gatggctaatg
B D                     Sheep  gatggctaatg
                Domestic goat  gatggctaatg
B D                   Ferret   ggtagaccaga
B D                     Panda  ggtggaccaga
                 Weddell seal  ggtgggctaaa
             Black flying-fox  gatggatagga
B D                   Megabat  ggtggatagga
                Big brown bat  gatagatttga
         David's myotis (bat)  gacaggttaga
B D                  Microbat  gacagattaga
              Star-nosed mole  aatagactaga
B D                  Elephant  gatggattaga
         Cape elephant shrew  ===========
              Golden hamster  ===========
                Prairie vole  ===========
B D                     Mouse  ===========
B D                       Rat  ===========
B D                    Medaka  ===========
    Mexican tetra (cavefish)  ===========
B D           Chinese hamster  ===========
      Lesser Egyptian jerboa  ===========
B D                      Pika  ===========
B D                    Tenrec  ===========
          Chinese tree shrew  ===========
B D                  Hedgehog  ===========
B D                     Shrew  ===========
B D                Guinea pig  ===========
B D             X. tropicalis  ===========
B D                    Lizard  ===========
  D              Mallard duck  ===========
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
B D                   Wallaby  ===========
B D           Tasmanian devil  ===========
B D                   Opossum  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  ===========
  D  Chinese softshell turtle  ===========
  D           Green seaturtle  ===========
  D            Painted turtle  ===========
B D                 Tetraodon  ===========
B D              Atlantic cod  ===========
B D               Stickleback  ===========
          Southern platyfish  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D              Nile tilapia  ===========
                 Spotted gar  ===========
B D        American alligator  ===========
          Tibetan ground jay  ===========
            Cape golden mole  ===========
B D                    Rabbit  ===========
B D                   Dolphin  ===========
                    Aardvark  ===========
B D                       Pig  ===========
              Pacific walrus  ===========
B D                       Dog  ===========
B D                       Cat  ===========
B D                 Armadillo  ===========
B D                   Manatee  ===========
B D          White rhinoceros  ===========
B D                     Horse  ===========
B D                  Squirrel  ===========
B D                  Bushbaby  ===========

Inserts between block 11 and 12 in window
                  Chinchilla 3537bp
            Brush-tailed rat 3844bp

Alignment block 12 of 247 in window, 10211533 - 10211533, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D            Naked mole-rat  a
B D                    Alpaca  a
               Bactrian camel  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                   Ferret   a
B D                     Panda  a
                 Weddell seal  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
              Star-nosed mole  a
B D                  Elephant  a
         Cape elephant shrew  =
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                    Tenrec  =
          Chinese tree shrew  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                   Opossum  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  =
B D        American alligator  =
          Tibetan ground jay  =
            Cape golden mole  =
B D                    Rabbit  =
B D                   Dolphin  =
            Brush-tailed rat  =
                    Aardvark  =
B D                   Megabat  -
B D                       Pig  =
              Pacific walrus  =
                  Chinchilla  =
            Black flying-fox  -
B D                       Dog  =
B D                       Cat  =
B D                 Armadillo  =
B D                   Manatee  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                  Bushbaby  =

Inserts between block 12 and 13 in window
               Big brown bat 1081bp

Alignment block 13 of 247 in window, 10211534 - 10211534, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D            Naked mole-rat  a
B D                    Alpaca  a
               Bactrian camel  a
                 Killer whale  t
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                   Ferret   a
B D                     Panda  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
         David's myotis (bat)  a
B D                  Microbat  a
              Star-nosed mole  a
B D                  Elephant  a
         Cape elephant shrew  =
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                    Tenrec  =
          Chinese tree shrew  =
B D                  Hedgehog  =
               Big brown bat  =
B D                     Shrew  =
B D                Guinea pig  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                   Opossum  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  =
B D        American alligator  =
          Tibetan ground jay  =
            Cape golden mole  =
B D                    Rabbit  =
B D                   Dolphin  =
            Brush-tailed rat  =
                    Aardvark  =
B D                       Pig  =
              Pacific walrus  =
                  Chinchilla  =
B D                       Dog  =
B D                       Cat  =
B D                 Armadillo  =
B D                   Manatee  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                  Bushbaby  =

Inserts between block 13 and 14 in window
            Tibetan antelope 2252bp
B D                      Cow 1730bp
B D                    Sheep 2298bp
               Domestic goat 2301bp

Alignment block 14 of 247 in window, 10211535 - 10211541, 7 bps 
B D                     Human  ccgtttg
B D                     Chimp  tcgtttg
B D                   Gorilla  ccgtttg
B D                 Orangutan  ccgtttg
B D                    Gibbon  ccatttg
B D                    Rhesus  ctgtttg
B D       Crab-eating macaque  ctgtttg
B D                    Baboon  gtgtttg
B D              Green monkey  ctgtttg
B D                  Marmoset  ccatttg
B D           Squirrel monkey  ccatttg
B D            Naked mole-rat  gcctgtg
B D                    Alpaca  ccctttg
               Bactrian camel  ccctttg
                 Killer whale  ccctttg
B D                   Ferret   tcctctg
B D                     Panda  tcctttg
                 Weddell seal  tcctttg
             Black flying-fox  ccctctg
B D                   Megabat  ccctctg
         David's myotis (bat)  ccctttg
B D                  Microbat  ccctttg
              Star-nosed mole  acctttg
B D                  Elephant  cactttg
         Cape elephant shrew  =======
              Golden hamster  =======
                Prairie vole  =======
B D                     Mouse  =======
B D                       Rat  =======
B D                    Medaka  =======
    Mexican tetra (cavefish)  =======
B D           Chinese hamster  =======
      Lesser Egyptian jerboa  =======
B D                      Pika  =======
B D                    Tenrec  =======
          Chinese tree shrew  =======
B D                  Hedgehog  =======
               Big brown bat  =======
               Domestic goat  =======
B D                     Sheep  =======
B D                     Shrew  =======
B D                       Cow  =======
B D                Guinea pig  =======
B D             X. tropicalis  =======
B D                    Lizard  =======
  D              Mallard duck  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                   Wallaby  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
  D  Chinese softshell turtle  =======
  D           Green seaturtle  =======
  D            Painted turtle  =======
B D                 Tetraodon  =======
B D              Atlantic cod  =======
B D               Stickleback  =======
          Southern platyfish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
                 Spotted gar  =======
B D        American alligator  =======
          Tibetan ground jay  =======
            Cape golden mole  =======
B D                    Rabbit  =======
            Tibetan antelope  =======
B D                   Dolphin  =======
            Brush-tailed rat  =======
                    Aardvark  =======
B D                       Pig  =======
              Pacific walrus  =======
                  Chinchilla  =======
B D                       Dog  =======
B D                       Cat  =======
B D                 Armadillo  =======
B D                   Manatee  =======
B D          White rhinoceros  =======
B D                     Horse  =======
B D                  Squirrel  =======
B D                  Bushbaby  =======

Inserts between block 14 and 15 in window
B D                    Panda 2203bp

Alignment block 15 of 247 in window, 10211542 - 10211543, 2 bps 
B D                     Human  ta-
B D                     Chimp  ca-
B D                   Gorilla  ta-
B D                 Orangutan  ta-
B D                    Gibbon  ta-
B D                    Rhesus  ta-
B D       Crab-eating macaque  ta-
B D                    Baboon  ta-
B D              Green monkey  ta-
B D                  Marmoset  ta-
B D           Squirrel monkey  ta-
B D            Naked mole-rat  ca-
B D                    Alpaca  -a-
               Bactrian camel  -a-
                 Killer whale  -a-
B D                   Ferret   ta-
                 Weddell seal  ca-
             Black flying-fox  -a-
B D                   Megabat  -a-
         David's myotis (bat)  -a-
B D                  Microbat  -a-
              Star-nosed mole  ga-
B D                  Elephant  -aa
         Cape elephant shrew  ===
              Golden hamster  ===
                Prairie vole  ===
B D                     Mouse  ===
B D                       Rat  ===
B D                    Medaka  ===
    Mexican tetra (cavefish)  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  ===
B D                    Tenrec  ===
          Chinese tree shrew  ===
B D                  Hedgehog  ===
               Big brown bat  ===
               Domestic goat  ===
B D                     Sheep  ===
B D                     Shrew  ===
B D                       Cow  ===
B D                Guinea pig  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
  D              Mallard duck  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D              Atlantic cod  ===
B D               Stickleback  ===
          Southern platyfish  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
                 Spotted gar  ===
B D        American alligator  ===
          Tibetan ground jay  ===
            Cape golden mole  ===
B D                    Rabbit  ===
            Tibetan antelope  ===
B D                   Dolphin  ===
            Brush-tailed rat  ===
                    Aardvark  ===
B D                       Pig  ===
B D                     Panda  ===
              Pacific walrus  ===
                  Chinchilla  ===
B D                       Dog  ===
B D                       Cat  ===
B D                 Armadillo  ===
B D                   Manatee  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                  Squirrel  ===
B D                  Bushbaby  ===

Inserts between block 15 and 16 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
                Killer whale 1bp
B D                  Ferret  2373bp
                Weddell seal 3668bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp

Alignment block 16 of 247 in window, 10211544 - 10211544, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D            Naked mole-rat  t
B D                    Alpaca  g
               Bactrian camel  g
                 Killer whale  g
             Black flying-fox  g
B D                   Megabat  g
         David's myotis (bat)  g
B D                  Microbat  g
              Star-nosed mole  g
B D                  Elephant  g
         Cape elephant shrew  =
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                    Tenrec  =
          Chinese tree shrew  =
B D                  Hedgehog  =
               Big brown bat  =
               Domestic goat  =
B D                     Sheep  =
B D                     Shrew  =
B D                       Cow  =
B D                Guinea pig  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                   Opossum  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  =
B D        American alligator  =
          Tibetan ground jay  =
            Cape golden mole  =
B D                    Rabbit  =
            Tibetan antelope  =
B D                   Dolphin  =
            Brush-tailed rat  =
                    Aardvark  =
B D                       Pig  =
                Weddell seal  =
B D                     Panda  =
B D                   Ferret   =
              Pacific walrus  =
                  Chinchilla  =
B D                       Dog  =
B D                       Cat  =
B D                 Armadillo  =
B D                   Manatee  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                  Bushbaby  =

Inserts between block 16 and 17 in window
            Black flying-fox 2037bp
B D                  Megabat 2065bp

Alignment block 17 of 247 in window, 10211545 - 10211545, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D            Naked mole-rat  a
B D                    Alpaca  a
               Bactrian camel  a
                 Killer whale  a
         David's myotis (bat)  a
B D                  Microbat  a
              Star-nosed mole  a
B D                  Elephant  a
         Cape elephant shrew  =
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                    Tenrec  =
          Chinese tree shrew  =
B D                  Hedgehog  =
               Big brown bat  =
               Domestic goat  =
B D                     Sheep  =
B D                     Shrew  =
B D                       Cow  =
B D                Guinea pig  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                   Opossum  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  =
B D        American alligator  =
          Tibetan ground jay  =
            Cape golden mole  =
B D                    Rabbit  =
            Tibetan antelope  =
B D                   Dolphin  =
            Brush-tailed rat  =
                    Aardvark  =
B D                   Megabat  =
B D                       Pig  =
                Weddell seal  =
B D                     Panda  =
B D                   Ferret   =
              Pacific walrus  =
                  Chinchilla  =
            Black flying-fox  =
B D                       Dog  =
B D                       Cat  =
B D                 Armadillo  =
B D                   Manatee  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                  Bushbaby  =

Inserts between block 17 and 18 in window
B D                   Rhesus 2558bp
B D      Crab-eating macaque 2499bp
B D                   Baboon 3033bp
B D             Green monkey 3379bp

Alignment block 18 of 247 in window, 10211546 - 10211546, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D            Naked mole-rat  c
B D                    Alpaca  t
               Bactrian camel  t
                 Killer whale  t
         David's myotis (bat)  c
B D                  Microbat  c
              Star-nosed mole  c
B D                  Elephant  c
         Cape elephant shrew  =
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                    Tenrec  =
          Chinese tree shrew  =
B D                  Hedgehog  =
               Big brown bat  =
               Domestic goat  =
B D                     Sheep  =
B D                     Shrew  =
B D                       Cow  =
B D                Guinea pig  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                   Opossum  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  =
B D        American alligator  =
B D       Crab-eating macaque  =
B D           Squirrel monkey  -
          Tibetan ground jay  =
            Cape golden mole  =
B D                    Rabbit  =
            Tibetan antelope  =
B D                   Dolphin  =
            Brush-tailed rat  =
                    Aardvark  =
B D                   Megabat  =
B D                       Pig  =
                Weddell seal  =
B D                     Panda  =
B D                   Ferret   =
B D                    Baboon  =
              Pacific walrus  =
                  Chinchilla  =
            Black flying-fox  =
B D                       Dog  =
B D                       Cat  =
B D                 Armadillo  =
B D                   Manatee  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                  Bushbaby  =
B D                  Marmoset  -
B D              Green monkey  =
B D                    Rhesus  =

Inserts between block 18 and 19 in window
B D                   Alpaca 740bp
              Bactrian camel 743bp
                Killer whale 1330bp

Alignment block 19 of 247 in window, 10211547 - 10211547, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D            Naked mole-rat  t
         David's myotis (bat)  t
B D                  Microbat  t
              Star-nosed mole  t
B D                  Elephant  t
         Cape elephant shrew  =
              Golden hamster  =
                Prairie vole  =
B D                     Mouse  =
B D                       Rat  =
B D                    Medaka  =
    Mexican tetra (cavefish)  =
B D           Chinese hamster  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                    Tenrec  =
          Chinese tree shrew  =
B D                  Hedgehog  =
               Big brown bat  =
               Domestic goat  =
B D                     Sheep  =
B D                     Shrew  =
B D                       Cow  =
B D                Guinea pig  =
B D             X. tropicalis  =
B D                    Lizard  =
  D              Mallard duck  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                   Opossum  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D               Rock pigeon  =
  D  Chinese softshell turtle  =
  D           Green seaturtle  =
  D            Painted turtle  =
B D                 Tetraodon  =
B D              Atlantic cod  =
B D               Stickleback  =
          Southern platyfish  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
                 Spotted gar  =
B D        American alligator  =
B D       Crab-eating macaque  =
          Tibetan ground jay  =
            Cape golden mole  =
B D                    Rabbit  =
            Tibetan antelope  =
B D                   Dolphin  =
            Brush-tailed rat  =
                Killer whale  =
                    Aardvark  =
B D                   Megabat  =
B D                       Pig  =
                Weddell seal  =
B D                     Panda  =
B D                   Ferret   =
B D                    Baboon  =
              Pacific walrus  =
                  Chinchilla  =
            Black flying-fox  =
B D                       Dog  =
B D                       Cat  =
              Bactrian camel  =
B D                    Alpaca  =
B D                 Armadillo  =
B D                   Manatee  =
B D          White rhinoceros  =
B D                     Horse  =
B D                  Squirrel  =
B D                  Bushbaby  =
B D              Green monkey  =
B D                    Rhesus  =

Inserts between block 19 and 20 in window
        David's myotis (bat) 1307bp
B D                 Microbat 2133bp
B D                 Elephant 1425bp

Alignment block 20 of 247 in window, 10211548 - 10211548, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D            Naked mole-rat  -t
              Star-nosed mole  g-
         Cape elephant shrew  ==
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                       Rat  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                    Tenrec  ==
          Chinese tree shrew  ==
B D                  Hedgehog  ==
               Big brown bat  ==
               Domestic goat  ==
B D                     Sheep  ==
B D                     Shrew  ==
B D                       Cow  ==
B D                Guinea pig  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
  D              Mallard duck  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
                 Spotted gar  ==
B D        American alligator  ==
B D       Crab-eating macaque  ==
          Tibetan ground jay  ==
            Cape golden mole  ==
B D                    Rabbit  ==
            Tibetan antelope  ==
B D                   Dolphin  ==
            Brush-tailed rat  ==
                Killer whale  ==
                    Aardvark  ==
B D                   Megabat  ==
B D                       Pig  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
                Weddell seal  ==
B D                     Panda  ==
B D                   Ferret   ==
B D                    Baboon  ==
              Pacific walrus  ==
                  Chinchilla  ==
            Black flying-fox  ==
B D                       Dog  ==
B D                       Cat  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                 Armadillo  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  ==
B D                  Bushbaby  ==
B D              Green monkey  ==
B D                    Rhesus  ==

Inserts between block 20 and 21 in window
B D           Naked mole-rat 2681bp

Alignment block 21 of 247 in window, 10211549 - 10211550, 2 bps 
B D                     Human  tt
B D                   Gorilla  tt
              Star-nosed mole  tt
         Cape elephant shrew  ==
              Golden hamster  ==
                Prairie vole  ==
B D                     Mouse  ==
B D                       Rat  ==
B D                    Medaka  ==
    Mexican tetra (cavefish)  ==
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                    Tenrec  ==
          Chinese tree shrew  ==
B D                  Hedgehog  ==
               Big brown bat  ==
               Domestic goat  ==
B D                     Sheep  ==
B D                     Shrew  ==
B D                       Cow  ==
B D                Guinea pig  ==
B D             X. tropicalis  ==
B D                    Lizard  ==
  D              Mallard duck  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D               Rock pigeon  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
  D            Painted turtle  ==
B D                 Tetraodon  ==
B D              Atlantic cod  ==
B D               Stickleback  ==
          Southern platyfish  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
                 Spotted gar  ==
B D        American alligator  ==
B D       Crab-eating macaque  ==
B D           Squirrel monkey  --
          Tibetan ground jay  ==
            Cape golden mole  ==
B D                    Rabbit  ==
            Tibetan antelope  ==
B D                   Dolphin  ==
            Brush-tailed rat  ==
                Killer whale  ==
B D            Naked mole-rat  ==
                    Aardvark  ==
B D                   Megabat  ==
B D                       Pig  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
                Weddell seal  ==
B D                     Panda  ==
B D                   Ferret   ==
B D                    Baboon  ==
              Pacific walrus  ==
                  Chinchilla  ==
            Black flying-fox  ==
B D                       Dog  ==
B D                       Cat  ==
              Bactrian camel  ==
B D                    Alpaca  ==
B D                 Armadillo  ==
B D                   Manatee  ==
B D                  Elephant  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  ==
B D                  Bushbaby  ==
B D                  Marmoset  --
B D              Green monkey  ==
B D                    Rhesus  ==
B D                    Gibbon  --
B D                 Orangutan  --
B D                     Chimp  --

Inserts between block 21 and 22 in window
             Star-nosed mole 1139bp

Alignment block 22 of 247 in window, 10211551 - 10211557, 7 bps 
B D                     Human  tgtttgt
B D                   Gorilla  tgtttgt
B D                 Orangutan  --tttgt
B D                    Gibbon  ------t
B D       Crab-eating macaque  --tacgt
B D           Squirrel monkey  ------t
         Cape elephant shrew  =======
              Golden hamster  =======
                Prairie vole  =======
B D                     Mouse  =======
B D                       Rat  =======
B D                    Medaka  =======
    Mexican tetra (cavefish)  =======
B D           Chinese hamster  =======
      Lesser Egyptian jerboa  =======
B D                      Pika  =======
B D                    Tenrec  =======
          Chinese tree shrew  =======
B D                  Hedgehog  =======
               Big brown bat  =======
               Domestic goat  =======
B D                     Sheep  =======
B D                     Shrew  =======
B D                       Cow  =======
B D                Guinea pig  =======
B D             X. tropicalis  =======
B D                    Lizard  =======
  D              Mallard duck  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                   Wallaby  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
  D  Chinese softshell turtle  =======
  D           Green seaturtle  =======
  D            Painted turtle  =======
B D                 Tetraodon  =======
B D              Atlantic cod  =======
B D               Stickleback  =======
          Southern platyfish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
                 Spotted gar  =======
B D        American alligator  =======
          Tibetan ground jay  =======
            Cape golden mole  =======
B D                    Rabbit  =======
            Tibetan antelope  =======
B D                   Dolphin  =======
            Brush-tailed rat  =======
             Star-nosed mole  =======
                Killer whale  =======
B D            Naked mole-rat  =======
                    Aardvark  =======
B D                   Megabat  =======
B D                       Pig  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
                Weddell seal  =======
B D                     Panda  =======
B D                   Ferret   =======
B D                    Baboon  =======
              Pacific walrus  =======
                  Chinchilla  =======
            Black flying-fox  =======
B D                       Dog  =======
B D                       Cat  =======
              Bactrian camel  =======
B D                    Alpaca  =======
B D                 Armadillo  =======
B D                   Manatee  =======
B D                  Elephant  =======
B D          White rhinoceros  =======
B D                     Horse  =======
B D                  Squirrel  =======
B D                  Bushbaby  =======
B D                  Marmoset  -------
B D              Green monkey  =======
B D                    Rhesus  =======
B D                     Chimp  -------

Inserts between block 22 and 23 in window
B D      Crab-eating macaque 4bp

Alignment block 23 of 247 in window, 10211558 - 10211564, 7 bps 
B D                     Human  ttgtttg
B D                     Chimp  ---tctg
B D                   Gorilla  ttgtttg
B D                 Orangutan  ttgtttg
B D                    Gibbon  ttgtttg
B D       Crab-eating macaque  ttattta
B D                    Baboon  tttttt-
B D                  Marmoset  ---tttg
B D           Squirrel monkey  ttatttg
         Cape elephant shrew  =======
              Golden hamster  =======
                Prairie vole  =======
B D                     Mouse  =======
B D                       Rat  =======
B D                    Medaka  =======
    Mexican tetra (cavefish)  =======
B D           Chinese hamster  =======
      Lesser Egyptian jerboa  =======
B D                      Pika  =======
B D                    Tenrec  =======
          Chinese tree shrew  =======
B D                  Hedgehog  =======
               Big brown bat  =======
               Domestic goat  =======
B D                     Sheep  =======
B D                     Shrew  =======
B D                       Cow  =======
B D                Guinea pig  =======
B D             X. tropicalis  =======
B D                    Lizard  =======
  D              Mallard duck  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
B D                   Wallaby  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
  D               Rock pigeon  =======
  D  Chinese softshell turtle  =======
  D           Green seaturtle  =======
  D            Painted turtle  =======
B D                 Tetraodon  =======
B D              Atlantic cod  =======
B D               Stickleback  =======
          Southern platyfish  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D              Nile tilapia  =======
                 Spotted gar  =======
B D        American alligator  =======
          Tibetan ground jay  =======
            Cape golden mole  =======
B D                    Rabbit  =======
            Tibetan antelope  =======
B D                   Dolphin  =======
            Brush-tailed rat  =======
             Star-nosed mole  =======
                Killer whale  =======
B D            Naked mole-rat  =======
                    Aardvark  =======
B D                   Megabat  =======
B D                       Pig  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
                Weddell seal  =======
B D                     Panda  =======
B D                   Ferret   =======
              Pacific walrus  =======
                  Chinchilla  =======
            Black flying-fox  =======
B D                       Dog  =======
B D                       Cat  =======
              Bactrian camel  =======
B D                    Alpaca  =======
B D                 Armadillo  =======
B D                   Manatee  =======
B D                  Elephant  =======
B D          White rhinoceros  =======
B D                     Horse  =======
B D                  Squirrel  =======
B D                  Bushbaby  =======
B D              Green monkey  =======
B D                    Rhesus  =======

Alignment block 24 of 247 in window, 10211565 - 10211732, 168 bps 
B D                     Human  tttgtttgtttttagagaggcagtctcactctactgcccaggctggagtgcagtggtgccatcatagctc
B D                     Chimp  tttgtttgtttttagagaggcagtctcactttactgcccaggctggagtgcagtggtgccatcatagctc
B D                   Gorilla  tttgtttgtttttagagaggcagtctcactctactgcccaggctggagtgcagtggtgccatcatagctc
B D                 Orangutan  tttgtttgtttttagagaggcagtctcactctgttgcccaggctggagtgcagtggtgccatcatagctc
B D                    Gibbon  tttgtttgattttagagaggcagtctcactctgttgtccaggctggagtgcagaggtggcattatagctc
B D       Crab-eating macaque  tttatttattttttgagatggagtctcactctgtgtcccaggctagagtgcagtggtgcgatctcggctc
B D                  Marmoset  ttagtttgtttttagagaggcagtctcactctgtggcccaggctggagtgcagtggtgccgtcagagctc
B D           Squirrel monkey  tttgtttgtttttagagaggcagtcttactctgttgcccaggctggagtgcagtggtgccatcatagctc
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                     Shrew  ======================================================================
B D                       Cow  ======================================================================
B D                Guinea pig  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Tibetan antelope  ======================================================================
B D                   Dolphin  ======================================================================
            Brush-tailed rat  ======================================================================
             Star-nosed mole  ======================================================================
                Killer whale  ======================================================================
B D            Naked mole-rat  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
                Weddell seal  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
B D                    Baboon  ======================================================================
              Pacific walrus  ======================================================================
                  Chinchilla  ======================================================================
            Black flying-fox  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D                  Bushbaby  ======================================================================
B D              Green monkey  ======================================================================
B D                    Rhesus  ======================================================================

                        Human  actgcatcctccaactcctgggttcaagtgatcctcctgctttgccctcctgaatagctgggactatagg
                        Chimp  actgcatcctccaactcctgggttcaagtgatcctcctgctttgccctcctgagtagctgggactatagg
                      Gorilla  actgcatcctccaactcctgggttcaagtgatcctcctgctttgccctcctgagtagctgggactatagg
                    Orangutan  actgcatcctccaactcctgggttcaagcgatcctcctgctttgccctcctgagtagctgggactataag
                       Gibbon  actgcatcctccaactcctaggttcaagcgatcctcctgctttgccctcctgagtagctgggactatagg
          Crab-eating macaque  actgcaacttccgcctcccaggttcaagcgattctccagcctctgcctccccaggagctgcgattacagg
                     Marmoset  actgcatcctccaactcctgggttcaagcgatcctcctgcttcagcctcccaagtagctgggactatagg
              Squirrel monkey  actgcatcctccaactcctgggttcaagcgatcctcctgcttcggcctcccaagtagctgggactacagg
          Cape elephant shrew  ======================================================================
               Golden hamster  ======================================================================
                 Prairie vole  ======================================================================
                        Mouse  ======================================================================
                          Rat  ======================================================================
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Chinese hamster  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
           Chinese tree shrew  ======================================================================
                     Hedgehog  ======================================================================
                Big brown bat  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                        Shrew  ======================================================================
                          Cow  ======================================================================
                   Guinea pig  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                  Spotted gar  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
             Cape golden mole  ======================================================================
                       Rabbit  ======================================================================
             Tibetan antelope  ======================================================================
                      Dolphin  ======================================================================
             Brush-tailed rat  ======================================================================
              Star-nosed mole  ======================================================================
                 Killer whale  ======================================================================
               Naked mole-rat  ======================================================================
                     Aardvark  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                 Weddell seal  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                       Baboon  ======================================================================
               Pacific walrus  ======================================================================
                   Chinchilla  ======================================================================
             Black flying-fox  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                    Armadillo  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                     Bushbaby  ======================================================================
                 Green monkey  ======================================================================
                       Rhesus  ======================================================================

                        Human  ttcctgctaccatgcccaactaattttt
                        Chimp  ttcatgctaccatgcccaactaattttt
                      Gorilla  ttcctgctaccatgcccaactaattttt
                    Orangutan  tgcctgctaccatgcccaactaattttt
                       Gibbon  tgcatgctactatgcccaactaattctt
          Crab-eating macaque  tgcccaccaccacgtccagctatttttt
                     Marmoset  tgcatgataccacacccaactaattttt
              Squirrel monkey  tgcatgataccacacccaactaattttt
          Cape elephant shrew  ============================
               Golden hamster  ============================
                 Prairie vole  ============================
                        Mouse  ============================
                          Rat  ============================
                       Medaka  ============================
     Mexican tetra (cavefish)  ============================
              Chinese hamster  ============================
       Lesser Egyptian jerboa  ============================
                         Pika  ============================
                       Tenrec  ============================
           Chinese tree shrew  ============================
                     Hedgehog  ============================
                Big brown bat  ============================
                Domestic goat  ============================
                        Sheep  ============================
                        Shrew  ============================
                          Cow  ============================
                   Guinea pig  ============================
                X. tropicalis  ============================
                       Lizard  ============================
                 Mallard duck  ============================
       Yellowbelly pufferfish  ============================
                         Fugu  ============================
                      Wallaby  ============================
              Tasmanian devil  ============================
                      Opossum  ============================
             Peregrine falcon  ============================
                 Saker falcon  ============================
                  Rock pigeon  ============================
     Chinese softshell turtle  ============================
              Green seaturtle  ============================
               Painted turtle  ============================
                    Tetraodon  ============================
                 Atlantic cod  ============================
                  Stickleback  ============================
           Southern platyfish  ============================
          Pundamilia nyererei  ============================
                  Zebra mbuna  ============================
        Burton's mouthbreeder  ============================
          Princess of Burundi  ============================
                 Nile tilapia  ============================
                  Spotted gar  ============================
           American alligator  ============================
           Tibetan ground jay  ============================
             Cape golden mole  ============================
                       Rabbit  ============================
             Tibetan antelope  ============================
                      Dolphin  ============================
             Brush-tailed rat  ============================
              Star-nosed mole  ============================
                 Killer whale  ============================
               Naked mole-rat  ============================
                     Aardvark  ============================
                      Megabat  ============================
                          Pig  ============================
                     Microbat  ============================
         David's myotis (bat)  ============================
                 Weddell seal  ============================
                        Panda  ============================
                      Ferret   ============================
                       Baboon  ============================
               Pacific walrus  ============================
                   Chinchilla  ============================
             Black flying-fox  ============================
                          Dog  ============================
                          Cat  ============================
               Bactrian camel  ============================
                       Alpaca  ============================
                    Armadillo  ============================
                      Manatee  ============================
                     Elephant  ============================
             White rhinoceros  ============================
                        Horse  ============================
                     Squirrel  ============================
                     Bushbaby  ============================
                 Green monkey  ============================
                       Rhesus  ============================

Inserts between block 24 and 25 in window
B D      Crab-eating macaque 2bp

Alignment block 25 of 247 in window, 10211733 - 10211734, 2 bps 
B D                     Human  -aa
B D                     Chimp  -aa
B D                   Gorilla  -aa
B D                 Orangutan  -aa
B D                    Gibbon  -aa
B D                  Marmoset  ta-
B D           Squirrel monkey  ta-
         Cape elephant shrew  ===
              Golden hamster  ===
                Prairie vole  ===
B D                     Mouse  ===
B D                       Rat  ===
B D                    Medaka  ===
    Mexican tetra (cavefish)  ===
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  ===
B D                    Tenrec  ===
          Chinese tree shrew  ===
B D                  Hedgehog  ===
               Big brown bat  ===
               Domestic goat  ===
B D                     Sheep  ===
B D                     Shrew  ===
B D                       Cow  ===
B D                Guinea pig  ===
B D             X. tropicalis  ===
B D                    Lizard  ===
  D              Mallard duck  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
  D            Painted turtle  ===
B D                 Tetraodon  ===
B D              Atlantic cod  ===
B D               Stickleback  ===
          Southern platyfish  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
                 Spotted gar  ===
B D        American alligator  ===
B D       Crab-eating macaque  ===
          Tibetan ground jay  ===
            Cape golden mole  ===
B D                    Rabbit  ===
            Tibetan antelope  ===
B D                   Dolphin  ===
            Brush-tailed rat  ===
             Star-nosed mole  ===
                Killer whale  ===
B D            Naked mole-rat  ===
                    Aardvark  ===
B D                   Megabat  ===
B D                       Pig  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
                Weddell seal  ===
B D                     Panda  ===
B D                   Ferret   ===
B D                    Baboon  ===
              Pacific walrus  ===
                  Chinchilla  ===
            Black flying-fox  ===
B D                       Dog  ===
B D                       Cat  ===
              Bactrian camel  ===
B D                    Alpaca  ===
B D                 Armadillo  ===
B D                   Manatee  ===
B D                  Elephant  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D                  Squirrel  ===
B D                  Bushbaby  ===
B D              Green monkey  ===
B D                    Rhesus  ===

Alignment block 26 of 247 in window, 10211735 - 10211853, 119 bps 
B D                     Human  gattttttgtagagctgggggtgtctcactgtgttgcccaggctagtctcgaattcctggcctcaa----
B D                     Chimp  gattttttgtagagctgggggtgtctcactgtgttgcccaggctagtctcgaattcctggcctcaa----
B D                   Gorilla  gattttttgtagagctgggggtgtctcactgtgttgcccaggctagtctcaaattcctggcctcaa----
B D                 Orangutan  gattttttgtagagctgggggtgtctcactgtgttgcccaggctagtctcgaatttctggcctcaa----
B D                    Gibbon  gattttttgtagagctgtgggtgtctcactgtgttgcccaggctagtctcgaattcctggcctcaa----
B D       Crab-eating macaque  tatttttagtagagacggg---gtttcatcatgtag-ccatgctggtctcaaactcctggcttcaagtga
B D                  Marmoset  ttttttttgtagagctgggggtgtctcacagtgtcacccaggctagtctcgaattcctgggctcca----
B D           Squirrel monkey  aattttttgtagagctgggggtgtctcacagtgttgcccaggctagtctcgaattcctgggctaaa----
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                     Shrew  ======================================================================
B D                       Cow  ======================================================================
B D                Guinea pig  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Tibetan antelope  ======================================================================
B D                   Dolphin  ======================================================================
            Brush-tailed rat  ======================================================================
             Star-nosed mole  ======================================================================
                Killer whale  ======================================================================
B D            Naked mole-rat  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
                Weddell seal  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
B D                    Baboon  ======================================================================
              Pacific walrus  ======================================================================
                  Chinchilla  ======================================================================
            Black flying-fox  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D                  Bushbaby  ======================================================================
B D              Green monkey  ======================================================================
B D                    Rhesus  ======================================================================

                        Human  ------------gcaatcttcccgcctgagcctcctagagcactggaattacagacatgggccac
                        Chimp  ------------gcaatcttcccgcctgagcctcctagagcactggaattacagacgtgggccac
                      Gorilla  ------------gcaatcttcccgcctgagcctcctagagcactggaattacagacgtgggccac
                    Orangutan  ------------gcagtcttcccgcctgagcctcctagagcactggaattacagacgtgggccac
                       Gibbon  ------------gcgatcttcccgcctgagcctcctagagcactggaattacagacgtgggccac
          Crab-eating macaque  ttcacctgccttgtgatccgcccgccttcgcctcccaaagtgctgagattacaggcgtgaaccac
                     Marmoset  ------------gagatcttcccgattcagcctcccagagcggtgggattatagatgtggaccgc
              Squirrel monkey  ------------gcaatcttcctgcttcagcctcccagagcggtgcaataaaagacatggaccac
          Cape elephant shrew  =================================================================
               Golden hamster  =================================================================
                 Prairie vole  =================================================================
                        Mouse  =================================================================
                          Rat  =================================================================
                       Medaka  =================================================================
     Mexican tetra (cavefish)  =================================================================
              Chinese hamster  =================================================================
       Lesser Egyptian jerboa  =================================================================
                         Pika  =================================================================
                       Tenrec  =================================================================
           Chinese tree shrew  =================================================================
                     Hedgehog  =================================================================
                Big brown bat  =================================================================
                Domestic goat  =================================================================
                        Sheep  =================================================================
                        Shrew  =================================================================
                          Cow  =================================================================
                   Guinea pig  =================================================================
                X. tropicalis  =================================================================
                       Lizard  =================================================================
                 Mallard duck  =================================================================
       Yellowbelly pufferfish  =================================================================
                         Fugu  =================================================================
                      Wallaby  =================================================================
              Tasmanian devil  =================================================================
                      Opossum  =================================================================
             Peregrine falcon  =================================================================
                 Saker falcon  =================================================================
                  Rock pigeon  =================================================================
     Chinese softshell turtle  =================================================================
              Green seaturtle  =================================================================
               Painted turtle  =================================================================
                    Tetraodon  =================================================================
                 Atlantic cod  =================================================================
                  Stickleback  =================================================================
           Southern platyfish  =================================================================
          Pundamilia nyererei  =================================================================
                  Zebra mbuna  =================================================================
        Burton's mouthbreeder  =================================================================
          Princess of Burundi  =================================================================
                 Nile tilapia  =================================================================
                  Spotted gar  =================================================================
           American alligator  =================================================================
           Tibetan ground jay  =================================================================
             Cape golden mole  =================================================================
                       Rabbit  =================================================================
             Tibetan antelope  =================================================================
                      Dolphin  =================================================================
             Brush-tailed rat  =================================================================
              Star-nosed mole  =================================================================
                 Killer whale  =================================================================
               Naked mole-rat  =================================================================
                     Aardvark  =================================================================
                      Megabat  =================================================================
                          Pig  =================================================================
                     Microbat  =================================================================
         David's myotis (bat)  =================================================================
                 Weddell seal  =================================================================
                        Panda  =================================================================
                      Ferret   =================================================================
                       Baboon  =================================================================
               Pacific walrus  =================================================================
                   Chinchilla  =================================================================
             Black flying-fox  =================================================================
                          Dog  =================================================================
                          Cat  =================================================================
               Bactrian camel  =================================================================
                       Alpaca  =================================================================
                    Armadillo  =================================================================
                      Manatee  =================================================================
                     Elephant  =================================================================
             White rhinoceros  =================================================================
                        Horse  =================================================================
                     Squirrel  =================================================================
                     Bushbaby  =================================================================
                 Green monkey  =================================================================
                       Rhesus  =================================================================

Alignment block 27 of 247 in window, 10211854 - 10212137, 284 bps 
B D                     Human  accacgcccatccagaaaccctttgaagactgctaatgaaacaacagttccaggcaatggttatccatgg
B D                     Chimp  accacgcccagccagaaaccctttgaagactgctaatgaaacaacagttccaggcaatggttatccatgg
B D                   Gorilla  accacgcccagccagaaaccctttgaagactgctaatgaaacaacagttccaggcaatggttatccatgg
B D                 Orangutan  accacgcccagccagaaaccctttgaagactgctaatgaaacaacagttccaggcaatggttatccatgg
B D                    Gibbon  accacgctcagccagaaaccctttgaagactgctaatgaaacaacagtttcaggcaatggttattcatgg
B D                  Marmoset  accacgcccagccagaaaccctttgaagactgctaatgaaaccatgggtccaggcaatggttatccatgg
B D           Squirrel monkey  accacgcccagccagaaaccctttgaagacggctaacgtaacaatggatccaggcaatggttatccatgg
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                     Shrew  ======================================================================
B D                       Cow  ======================================================================
B D                Guinea pig  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
B D        American alligator  ======================================================================
B D       Crab-eating macaque  ======================================================================
          Tibetan ground jay  ======================================================================
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Tibetan antelope  ======================================================================
B D                   Dolphin  ======================================================================
            Brush-tailed rat  ======================================================================
             Star-nosed mole  ======================================================================
                Killer whale  ======================================================================
B D            Naked mole-rat  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
                Weddell seal  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
B D                    Baboon  ======================================================================
              Pacific walrus  ======================================================================
                  Chinchilla  ======================================================================
            Black flying-fox  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D                  Bushbaby  ======================================================================
B D              Green monkey  ======================================================================
B D                    Rhesus  ======================================================================

                        Human  atgatcaaacctttagggaaacgccaagtggggaatttacaaaggcatggtcaggcggatggcatccgaa
                        Chimp  atgatcaaacctttagggaaacgccaagtggggaatttacaaaggcagggtcaggcggatggcatccgaa
                      Gorilla  atgatcaaacctttagggaaacgccaagtggggaatttacaaaggcagcgtcaggcggatggcatccgaa
                    Orangutan  atgatcaaacctttagggaaacaccaagtggggaatttacaaaggcagggtcaggcggatggcatccgaa
                       Gibbon  atgatcaaacctttagggaaacgccaagtgggaaatttacaaaggcagggtcaggcggatggcatctgaa
                     Marmoset  tggatcaaacccttagggaaatgccaaatggggaatttacaaaggcagggtcaggcagatggcatctgaa
              Squirrel monkey  ttgatcaaacccttagagaaatgccaagtggggaatttacaaagacaggatcaggcagatggcatctgaa
          Cape elephant shrew  ======================================================================
               Golden hamster  ======================================================================
                 Prairie vole  ======================================================================
                        Mouse  ======================================================================
                          Rat  ======================================================================
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Chinese hamster  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
           Chinese tree shrew  ======================================================================
                     Hedgehog  ======================================================================
                Big brown bat  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                        Shrew  ======================================================================
                          Cow  ======================================================================
                   Guinea pig  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                  Spotted gar  ======================================================================
           American alligator  ======================================================================
          Crab-eating macaque  ======================================================================
           Tibetan ground jay  ======================================================================
             Cape golden mole  ======================================================================
                       Rabbit  ======================================================================
             Tibetan antelope  ======================================================================
                      Dolphin  ======================================================================
             Brush-tailed rat  ======================================================================
              Star-nosed mole  ======================================================================
                 Killer whale  ======================================================================
               Naked mole-rat  ======================================================================
                     Aardvark  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                 Weddell seal  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                       Baboon  ======================================================================
               Pacific walrus  ======================================================================
                   Chinchilla  ======================================================================
             Black flying-fox  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                    Armadillo  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                     Bushbaby  ======================================================================
                 Green monkey  ======================================================================
                       Rhesus  ======================================================================

                        Human  tccc----tggatcattcttagttatcagtgaaaagtggaaagaaaggccaggcacagtggctcatgact
                        Chimp  tccc----tggatcattcttagttatcagggaaaagtggaaagaaaggccaggcacagtggctcatgcct
                      Gorilla  ttcc----tggatcattcttagttatcagtgaaaagtggaaagaaaggccaggcacagtggcttatgcct
                    Orangutan  tccc----tggatcattctgagttatcagtgaaaagtggaaagaaaggccaggcacagtggctcatgcct
                       Gibbon  cccc----tggataattcttagttatcagtgaaaagtggaaagaaaggccaggcacagtggctcatgcct
                     Marmoset  cccccggatggatcattcttagttatcagt--aaaatggaaagacaggccaggtgcagtggctcacacct
              Squirrel monkey  cccctgaatggatcattcttagttatcagt--aaaatggaaagacaggcca---gcagtggctcacacct
          Cape elephant shrew  ======================================================================
               Golden hamster  ======================================================================
                 Prairie vole  ======================================================================
                        Mouse  ======================================================================
                          Rat  ======================================================================
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Chinese hamster  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
           Chinese tree shrew  ======================================================================
                     Hedgehog  ======================================================================
                Big brown bat  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                        Shrew  ======================================================================
                          Cow  ======================================================================
                   Guinea pig  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                  Spotted gar  ======================================================================
           American alligator  ======================================================================
          Crab-eating macaque  ======================================================================
           Tibetan ground jay  ======================================================================
             Cape golden mole  ======================================================================
                       Rabbit  ======================================================================
             Tibetan antelope  ======================================================================
                      Dolphin  ======================================================================
             Brush-tailed rat  ======================================================================
              Star-nosed mole  ======================================================================
                 Killer whale  ======================================================================
               Naked mole-rat  ======================================================================
                     Aardvark  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                 Weddell seal  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                       Baboon  ======================================================================
               Pacific walrus  ======================================================================
                   Chinchilla  ======================================================================
             Black flying-fox  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                    Armadillo  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                     Bushbaby  ======================================================================
                 Green monkey  ======================================================================
                       Rhesus  ======================================================================

                        Human  gtaatcctagcactttgggaggctgaggcagaaggatcacttgagcccaggagttccagactagcctggg
                        Chimp  gtaatcctagcactttgggaggctgaggcagaaggatcgcttgagcccaggagttccagaccagcctggg
                      Gorilla  gtaatcctagcactttgggaggctgaggcagaaggatcacttgagcccaggagttccagaccagcctggg
                    Orangutan  gtaatcctagcactttgggaggctgaggcagaaggatcacttgagcccaggagttccagaccagcctggg
                       Gibbon  gtaatcctagcactttgggaggctgaggcagaaggatcgcttgagcccaggagttccagaccagcctggg
                     Marmoset  gtaatcctagcactttcagaggctgaggcaggaggatcacttgagcccaggagttccagaccagcctaag
              Squirrel monkey  gtaatcctagcactttgggaggttgaggcaggaggatcgcttgagcccaggaattccagaccagcctaag
          Cape elephant shrew  ======================================================================
               Golden hamster  ======================================================================
                 Prairie vole  ======================================================================
                        Mouse  ======================================================================
                          Rat  ======================================================================
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Chinese hamster  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
           Chinese tree shrew  ======================================================================
                     Hedgehog  ======================================================================
                Big brown bat  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                        Shrew  ======================================================================
                          Cow  ======================================================================
                   Guinea pig  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                  Spotted gar  ======================================================================
           American alligator  ======================================================================
          Crab-eating macaque  ======================================================================
           Tibetan ground jay  ======================================================================
             Cape golden mole  ======================================================================
                       Rabbit  ======================================================================
             Tibetan antelope  ======================================================================
                      Dolphin  ======================================================================
             Brush-tailed rat  ======================================================================
              Star-nosed mole  ======================================================================
                 Killer whale  ======================================================================
               Naked mole-rat  ======================================================================
                     Aardvark  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                 Weddell seal  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                       Baboon  ======================================================================
               Pacific walrus  ======================================================================
                   Chinchilla  ======================================================================
             Black flying-fox  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                    Armadillo  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                     Bushbaby  ======================================================================
                 Green monkey  ======================================================================
                       Rhesus  ======================================================================

                        Human  caacatag
                        Chimp  caacgcag
                      Gorilla  caacatag
                    Orangutan  caacatag
                       Gibbon  caacatag
                     Marmoset  caatgtag
              Squirrel monkey  caacatag
          Cape elephant shrew  ========
               Golden hamster  ========
                 Prairie vole  ========
                        Mouse  ========
                          Rat  ========
                       Medaka  ========
     Mexican tetra (cavefish)  ========
              Chinese hamster  ========
       Lesser Egyptian jerboa  ========
                         Pika  ========
                       Tenrec  ========
           Chinese tree shrew  ========
                     Hedgehog  ========
                Big brown bat  ========
                Domestic goat  ========
                        Sheep  ========
                        Shrew  ========
                          Cow  ========
                   Guinea pig  ========
                X. tropicalis  ========
                       Lizard  ========
                 Mallard duck  ========
       Yellowbelly pufferfish  ========
                         Fugu  ========
                      Wallaby  ========
              Tasmanian devil  ========
                      Opossum  ========
             Peregrine falcon  ========
                 Saker falcon  ========
                  Rock pigeon  ========
     Chinese softshell turtle  ========
              Green seaturtle  ========
               Painted turtle  ========
                    Tetraodon  ========
                 Atlantic cod  ========
                  Stickleback  ========
           Southern platyfish  ========
          Pundamilia nyererei  ========
                  Zebra mbuna  ========
        Burton's mouthbreeder  ========
          Princess of Burundi  ========
                 Nile tilapia  ========
                  Spotted gar  ========
           American alligator  ========
          Crab-eating macaque  ========
           Tibetan ground jay  ========
             Cape golden mole  ========
                       Rabbit  ========
             Tibetan antelope  ========
                      Dolphin  ========
             Brush-tailed rat  ========
              Star-nosed mole  ========
                 Killer whale  ========
               Naked mole-rat  ========
                     Aardvark  ========
                      Megabat  ========
                          Pig  ========
                     Microbat  ========
         David's myotis (bat)  ========
                 Weddell seal  ========
                        Panda  ========
                      Ferret   ========
                       Baboon  ========
               Pacific walrus  ========
                   Chinchilla  ========
             Black flying-fox  ========
                          Dog  ========
                          Cat  ========
               Bactrian camel  ========
                       Alpaca  ========
                    Armadillo  ========
                      Manatee  ========
                     Elephant  ========
             White rhinoceros  ========
                        Horse  ========
                     Squirrel  ========
                     Bushbaby  ========
                 Green monkey  ========
                       Rhesus  ========

Alignment block 28 of 247 in window, 10212138 - 10212177, 40 bps 
B D                     Human  tgagaccttggttctacagaaagg-tttttcggtttttgtt
B D                     Chimp  tgagaccttggttctacagaaagg-tttttcggtttttgtt
B D                   Gorilla  tgagacctcggttctacagaaagg-tttttcggtttttgtt
B D                 Orangutan  tgagaccttggttctacagaaagg-ttttttggtttttgtt
B D                    Gibbon  tgagaccttggttctacagaaagg-ttttctgggttttgtt
B D                  Marmoset  tatgaccttggttctacaaaaagg-ttttttggtttttgtt
B D           Squirrel monkey  tgtgaccttggttctacaaaaaggtttttttggtttttgtt
B D                  Bushbaby  tgatacttttgataagtataaggg-tattgtggttaaattt
         Cape elephant shrew  =========================================
              Golden hamster  =========================================
                Prairie vole  =========================================
B D                     Mouse  =========================================
B D                       Rat  =========================================
B D                    Medaka  =========================================
    Mexican tetra (cavefish)  =========================================
B D           Chinese hamster  =========================================
      Lesser Egyptian jerboa  =========================================
B D                      Pika  =========================================
B D                    Tenrec  =========================================
          Chinese tree shrew  =========================================
B D                  Hedgehog  =========================================
               Big brown bat  =========================================
               Domestic goat  =========================================
B D                     Sheep  =========================================
B D                     Shrew  =========================================
B D                       Cow  =========================================
B D                Guinea pig  =========================================
B D             X. tropicalis  =========================================
B D                    Lizard  =========================================
  D              Mallard duck  =========================================
      Yellowbelly pufferfish  =========================================
B D                      Fugu  =========================================
B D                   Wallaby  =========================================
B D           Tasmanian devil  =========================================
B D                   Opossum  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
  D               Rock pigeon  =========================================
  D  Chinese softshell turtle  =========================================
  D           Green seaturtle  =========================================
  D            Painted turtle  =========================================
B D                 Tetraodon  =========================================
B D              Atlantic cod  =========================================
B D               Stickleback  =========================================
          Southern platyfish  =========================================
         Pundamilia nyererei  =========================================
                 Zebra mbuna  =========================================
       Burton's mouthbreeder  =========================================
         Princess of Burundi  =========================================
B D              Nile tilapia  =========================================
                 Spotted gar  =========================================
B D        American alligator  =========================================
B D       Crab-eating macaque  =========================================
          Tibetan ground jay  =========================================
            Cape golden mole  =========================================
B D                    Rabbit  =========================================
            Tibetan antelope  =========================================
B D                   Dolphin  =========================================
            Brush-tailed rat  =========================================
             Star-nosed mole  =========================================
                Killer whale  =========================================
B D            Naked mole-rat  =========================================
                    Aardvark  =========================================
B D                   Megabat  =========================================
B D                       Pig  =========================================
B D                  Microbat  =========================================
        David's myotis (bat)  =========================================
                Weddell seal  =========================================
B D                     Panda  =========================================
B D                   Ferret   =========================================
B D                    Baboon  =========================================
              Pacific walrus  =========================================
                  Chinchilla  =========================================
            Black flying-fox  =========================================
B D                       Dog  =========================================
B D                       Cat  =========================================
              Bactrian camel  =========================================
B D                    Alpaca  =========================================
B D                 Armadillo  =========================================
B D                   Manatee  =========================================
B D                  Elephant  =========================================
B D          White rhinoceros  =========================================
B D                     Horse  =========================================
B D                  Squirrel  =========================================
B D              Green monkey  =========================================
B D                    Rhesus  =========================================

Alignment block 29 of 247 in window, 10212178 - 10212219, 42 bps 
B D                     Human  ttgttttgcttttgagat-ggggggtctcactctgtcacccag
B D                     Chimp  ttgttttgcttttgagatgggggggtctcactctgtcacccag
B D                   Gorilla  ttgttttgcttttgagat-ggggggtctcactctgtcacccag
B D                 Orangutan  ttgttttgcttttgagatggggaggtctcactctgtcacccag
B D                    Gibbon  ttgttttgcttttgagat-ggggggtctcactctgtcacccag
B D       Crab-eating macaque  ttgttttgcttttaagat--gggggtctcactctgtcacccag
B D                  Marmoset  ttgttttgctttttggat--gagggtctcagtctgtcacccag
B D           Squirrel monkey  ctgttttgcttttc-cat--aagggtcttagtccgtcacccag
B D                  Bushbaby  ----tttttttcatagag-acagagtctcactttatcaccctc
         Cape elephant shrew  ===========================================
              Golden hamster  ===========================================
                Prairie vole  ===========================================
B D                     Mouse  ===========================================
B D                       Rat  ===========================================
B D                    Medaka  ===========================================
    Mexican tetra (cavefish)  ===========================================
B D           Chinese hamster  ===========================================
      Lesser Egyptian jerboa  ===========================================
B D                      Pika  ===========================================
B D                    Tenrec  ===========================================
          Chinese tree shrew  ===========================================
B D                  Hedgehog  ===========================================
               Big brown bat  ===========================================
               Domestic goat  ===========================================
B D                     Sheep  ===========================================
B D                     Shrew  ===========================================
B D                       Cow  ===========================================
B D                Guinea pig  ===========================================
B D             X. tropicalis  ===========================================
B D                    Lizard  ===========================================
  D              Mallard duck  ===========================================
      Yellowbelly pufferfish  ===========================================
B D                      Fugu  ===========================================
B D                   Wallaby  ===========================================
B D           Tasmanian devil  ===========================================
B D                   Opossum  ===========================================
  D          Peregrine falcon  ===========================================
  D              Saker falcon  ===========================================
  D               Rock pigeon  ===========================================
  D  Chinese softshell turtle  ===========================================
  D           Green seaturtle  ===========================================
  D            Painted turtle  ===========================================
B D                 Tetraodon  ===========================================
B D              Atlantic cod  ===========================================
B D               Stickleback  ===========================================
          Southern platyfish  ===========================================
         Pundamilia nyererei  ===========================================
                 Zebra mbuna  ===========================================
       Burton's mouthbreeder  ===========================================
         Princess of Burundi  ===========================================
B D              Nile tilapia  ===========================================
                 Spotted gar  ===========================================
B D        American alligator  ===========================================
          Tibetan ground jay  ===========================================
            Cape golden mole  ===========================================
B D                    Rabbit  ===========================================
            Tibetan antelope  ===========================================
B D                   Dolphin  ===========================================
            Brush-tailed rat  ===========================================
             Star-nosed mole  ===========================================
                Killer whale  ===========================================
B D            Naked mole-rat  ===========================================
                    Aardvark  ===========================================
B D                   Megabat  ===========================================
B D                       Pig  ===========================================
B D                  Microbat  ===========================================
        David's myotis (bat)  ===========================================
                Weddell seal  ===========================================
B D                     Panda  ===========================================
B D                   Ferret   ===========================================
B D                    Baboon  ===========================================
              Pacific walrus  ===========================================
                  Chinchilla  ===========================================
            Black flying-fox  ===========================================
B D                       Dog  ===========================================
B D                       Cat  ===========================================
              Bactrian camel  ===========================================
B D                    Alpaca  ===========================================
B D                 Armadillo  ===========================================
B D                   Manatee  ===========================================
B D                  Elephant  ===========================================
B D          White rhinoceros  ===========================================
B D                     Horse  ===========================================
B D                  Squirrel  ===========================================
B D              Green monkey  ===========================================
B D                    Rhesus  ===========================================

Inserts between block 29 and 30 in window
B D                   Gibbon 1623bp

Alignment block 30 of 247 in window, 10212220 - 10212351, 132 bps 
B D                     Human  gctggagcgcaggtgggcagtctctgctcactgcagcctctgcctcctgggctcaagcaatcctccctgc
B D                     Chimp  gctggaacgcaggtgggcaatctctgctcactgcagcttctgcctcctgggctcaagcaatcctccccgc
B D                   Gorilla  gctggagcgcaggtgggcaatctctgctcactgcagcctctgcctcctgggctcaagcaatcctccccac
B D                 Orangutan  gctggagtgcaggtgtgcaatctttgctcactgcagcctctgcctcctgggctcaagcaatcctccccac
B D       Crab-eating macaque  gctggagtgcaggggtgcaatctctgctcactgcagcctccacctcctgggctcaagcaatcctccccac
B D                  Marmoset  gcgggagtgcagggacacaatctcagctcactgcaacctccgagtcctgggctcaagcaatcctcccccc
B D           Squirrel monkey  tctggaatgcaggggcacgatctcagctcactgcaacctccgagtcctgggctcaagcaatcctcccacc
B D                  Bushbaby  agtagagtgctgtggc---atcacagctcacagcaatctccaactcctgggcttaggcaattctcttgcc
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                     Shrew  ======================================================================
B D                       Cow  ======================================================================
B D                Guinea pig  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Tibetan antelope  ======================================================================
B D                   Dolphin  ======================================================================
            Brush-tailed rat  ======================================================================
             Star-nosed mole  ======================================================================
                Killer whale  ======================================================================
B D            Naked mole-rat  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
                Weddell seal  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
B D                    Baboon  ======================================================================
              Pacific walrus  ======================================================================
                  Chinchilla  ======================================================================
            Black flying-fox  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D              Green monkey  ======================================================================
B D                    Rhesus  ======================================================================
B D                    Gibbon  ======================================================================

                        Human  tcagcctcctgagtagctgggactacaggtgcatgccac---------c---------atgcccagcttt
                        Chimp  tcagcctcccgagtagctgggactacaggtgcatgccac---------c---------atgcccagcttt
                      Gorilla  tcagcctccggagtagctgggactacaggtgcatgccac---------c---------atgcccagcttt
                    Orangutan  tcagcctcccgagtagctgggactacagatgcatgccac---------c---------atgcccagcttt
          Crab-eating macaque  tcagcctcccaagcagctaggactacaggcacatgccaccatgcccagc---------atgcccagcttt
                     Marmoset  tcagcctcctgagtagctgggactacaggcacatgccac---------cacc------atgcccagcttt
              Squirrel monkey  tcagcctcctgagtagctgggactacaggaatatgccac---------cacccccagtatgcccagcttt
                     Bushbaby  tcagcctcccaagtagctgagactacaggcgcctgccac---------a---------acact--acttt
          Cape elephant shrew  ======================================================================
               Golden hamster  ======================================================================
                 Prairie vole  ======================================================================
                        Mouse  ======================================================================
                          Rat  ======================================================================
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Chinese hamster  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
           Chinese tree shrew  ======================================================================
                     Hedgehog  ======================================================================
                Big brown bat  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                        Shrew  ======================================================================
                          Cow  ======================================================================
                   Guinea pig  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                  Spotted gar  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
             Cape golden mole  ======================================================================
                       Rabbit  ======================================================================
             Tibetan antelope  ======================================================================
                      Dolphin  ======================================================================
             Brush-tailed rat  ======================================================================
              Star-nosed mole  ======================================================================
                 Killer whale  ======================================================================
               Naked mole-rat  ======================================================================
                     Aardvark  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                 Weddell seal  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                       Baboon  ======================================================================
               Pacific walrus  ======================================================================
                   Chinchilla  ======================================================================
             Black flying-fox  ======================================================================
                          Dog  ======================================================================
                          Cat  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                    Armadillo  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Green monkey  ======================================================================
                       Rhesus  ======================================================================
                       Gibbon  ======================================================================

                        Human  tttttttttt
                        Chimp  tttttttttt
                      Gorilla  tttttttttt
                    Orangutan  tttttttttt
          Crab-eating macaque  tttttttttt
                     Marmoset  tttttttttt
              Squirrel monkey  tttttttttt
                     Bushbaby  ttt-------
          Cape elephant shrew  ==========
               Golden hamster  ==========
                 Prairie vole  ==========
                        Mouse  ==========
                          Rat  ==========
                       Medaka  ==========
     Mexican tetra (cavefish)  ==========
              Chinese hamster  ==========
       Lesser Egyptian jerboa  ==========
                         Pika  ==========
                       Tenrec  ==========
           Chinese tree shrew  ==========
                     Hedgehog  ==========
                Big brown bat  ==========
                Domestic goat  ==========
                        Sheep  ==========
                        Shrew  ==========
                          Cow  ==========
                   Guinea pig  ==========
                X. tropicalis  ==========
                       Lizard  ==========
                 Mallard duck  ==========
       Yellowbelly pufferfish  ==========
                         Fugu  ==========
                      Wallaby  ==========
              Tasmanian devil  ==========
                      Opossum  ==========
             Peregrine falcon  ==========
                 Saker falcon  ==========
                  Rock pigeon  ==========
     Chinese softshell turtle  ==========
              Green seaturtle  ==========
               Painted turtle  ==========
                    Tetraodon  ==========
                 Atlantic cod  ==========
                  Stickleback  ==========
           Southern platyfish  ==========
          Pundamilia nyererei  ==========
                  Zebra mbuna  ==========
        Burton's mouthbreeder  ==========
          Princess of Burundi  ==========
                 Nile tilapia  ==========
                  Spotted gar  ==========
           American alligator  ==========
           Tibetan ground jay  ==========
             Cape golden mole  ==========
                       Rabbit  ==========
             Tibetan antelope  ==========
                      Dolphin  ==========
             Brush-tailed rat  ==========
              Star-nosed mole  ==========
                 Killer whale  ==========
               Naked mole-rat  ==========
                     Aardvark  ==========
                      Megabat  ==========
                          Pig  ==========
                     Microbat  ==========
         David's myotis (bat)  ==========
                 Weddell seal  ==========
                        Panda  ==========
                      Ferret   ==========
                       Baboon  ==========
               Pacific walrus  ==========
                   Chinchilla  ==========
             Black flying-fox  ==========
                          Dog  ==========
                          Cat  ==========
               Bactrian camel  ==========
                       Alpaca  ==========
                    Armadillo  ==========
                      Manatee  ==========
                     Elephant  ==========
             White rhinoceros  ==========
                        Horse  ==========
                     Squirrel  ==========
                 Green monkey  ==========
                       Rhesus  ==========
                       Gibbon  ==========

Inserts between block 30 and 31 in window
B D          Squirrel monkey 1883bp

Alignment block 31 of 247 in window, 10212352 - 10212361, 10 bps 
B D                     Human  -tttttgtttt
B D                     Chimp  -t---------
B D                 Orangutan  -tttttttttt
B D       Crab-eating macaque  -tttttttttt
B D                  Marmoset  -------tttt
B D                  Bushbaby  gttgcagttt-
         Cape elephant shrew  ===========
              Golden hamster  ===========
                Prairie vole  ===========
B D                     Mouse  ===========
B D                       Rat  ===========
B D                    Medaka  ===========
    Mexican tetra (cavefish)  ===========
B D           Chinese hamster  ===========
      Lesser Egyptian jerboa  ===========
B D                      Pika  ===========
B D                    Tenrec  ===========
          Chinese tree shrew  ===========
B D                  Hedgehog  ===========
               Big brown bat  ===========
               Domestic goat  ===========
B D                     Sheep  ===========
B D                     Shrew  ===========
B D                       Cow  ===========
B D                Guinea pig  ===========
B D                   Gorilla  -----------
B D             X. tropicalis  ===========
B D                    Lizard  ===========
  D              Mallard duck  ===========
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
B D                   Wallaby  ===========
B D           Tasmanian devil  ===========
B D                   Opossum  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D               Rock pigeon  ===========
  D  Chinese softshell turtle  ===========
  D           Green seaturtle  ===========
  D            Painted turtle  ===========
B D                 Tetraodon  ===========
B D              Atlantic cod  ===========
B D               Stickleback  ===========
          Southern platyfish  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D              Nile tilapia  ===========
                 Spotted gar  ===========
B D        American alligator  ===========
B D           Squirrel monkey  ===========
          Tibetan ground jay  ===========
            Cape golden mole  ===========
B D                    Rabbit  ===========
            Tibetan antelope  ===========
B D                   Dolphin  ===========
            Brush-tailed rat  ===========
             Star-nosed mole  ===========
                Killer whale  ===========
B D            Naked mole-rat  ===========
                    Aardvark  ===========
B D                   Megabat  ===========
B D                       Pig  ===========
B D                  Microbat  ===========
        David's myotis (bat)  ===========
                Weddell seal  ===========
B D                     Panda  ===========
B D                   Ferret   ===========
B D                    Baboon  ===========
              Pacific walrus  ===========
                  Chinchilla  ===========
            Black flying-fox  ===========
B D                       Dog  ===========
B D                       Cat  ===========
              Bactrian camel  ===========
B D                    Alpaca  ===========
B D                 Armadillo  ===========
B D                   Manatee  ===========
B D                  Elephant  ===========
B D          White rhinoceros  ===========
B D                     Horse  ===========
B D                  Squirrel  ===========
B D              Green monkey  ===========
B D                    Rhesus  ===========
B D                    Gibbon  ===========

Alignment block 32 of 247 in window, 10212362 - 10212501, 140 bps 
B D                     Human  ggtagacacagagtttcaccatgttgcccaggatggcctccaacctctgtgctcaagctattttcccacc
B D                     Chimp  -gtagacacagggtttcaccatgttgcccaggatggcctccaacctctgtgctcaagctattttcccacc
B D                   Gorilla  -gtagacacagggtttcaccatgttgcccaggatggcctccaacctctgtgctcaagctattttcccacc
B D       Crab-eating macaque  --tagaaacagggtttcaccatgttgcccagactggcctccaacctctgtgctcaagctgtttgcccacc
B D                  Marmoset  -ggagacacagggtttcaccatgttgcccaggttggtctccaacctctgtgctcaagctatttgcctgcc
B D                  Bushbaby  ggctggggccaagttcgaacctgccacc---attggtatatgaggccagtgccctactcactgaaccaca
         Cape elephant shrew  ======================================================================
              Golden hamster  ======================================================================
                Prairie vole  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
B D                    Medaka  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ======================================================================
B D                    Tenrec  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Hedgehog  ======================================================================
               Big brown bat  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                     Shrew  ======================================================================
B D                       Cow  ======================================================================
B D                Guinea pig  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D              Mallard duck  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                 Tetraodon  ======================================================================
B D              Atlantic cod  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
                 Spotted gar  ======================================================================
B D        American alligator  ======================================================================
B D           Squirrel monkey  ======================================================================
          Tibetan ground jay  ======================================================================
            Cape golden mole  ======================================================================
B D                    Rabbit  ======================================================================
            Tibetan antelope  ======================================================================
B D                   Dolphin  ======================================================================
            Brush-tailed rat  ======================================================================
             Star-nosed mole  ======================================================================
                Killer whale  ======================================================================
B D            Naked mole-rat  ======================================================================
                    Aardvark  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
                Weddell seal  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
B D                    Baboon  ======================================================================
              Pacific walrus  ======================================================================
                  Chinchilla  ======================================================================
            Black flying-fox  ======================================================================
B D                       Dog  ======================================================================
B D                       Cat  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D              Green monkey  ======================================================================
B D                    Rhesus  ======================================================================
B D                    Gibbon  ======================================================================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  tcagccacccaaagtgctgggattacaggagtcagccaccacaccctgcccaaaaaaggtattgtagca-
                        Chimp  tcagccacccaaagtgctgggattacaggagtcagccaccacaccctgcccaaaaaaggtattgtagca-
                      Gorilla  tcagccacccaaagtgctgggattacaggagtcagccaccacaccctgcccaaaaaaggtattgtagca-
          Crab-eating macaque  tcaaccacccaaagtgttgggattacaggagtgagccaccacgccctgcgcaaaaaaggtattgcagca-
                     Marmoset  tcagccgctcaaactgctggcattat-ggagtgagccaccacgccctgactaaaaaagatattgtatagt
                     Bushbaby  gacaccgccca------tgtggttaaat------------------------------------------
          Cape elephant shrew  ======================================================================
               Golden hamster  ======================================================================
                 Prairie vole  ======================================================================
                        Mouse  ======================================================================
                          Rat  ======================================================================
                       Medaka  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
              Chinese hamster  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ======================================================================
                       Tenrec  ======================================================================
           Chinese tree shrew  ======================================================================
                     Hedgehog  ======================================================================
                Big brown bat  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                        Shrew  ======================================================================
                          Cow  ======================================================================
                   Guinea pig  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
                 Mallard duck  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
     Chinese softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
               Painted turtle  ======================================================================
                    Tetraodon  ======================================================================
                 Atlantic cod  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
                  Spotted gar  ======================================================================
           American alligator  ======================================================================
              Squirrel monkey  ======================================================================
           Tibetan ground jay  ======================================================================
             Cape golden mole  ======================================================================
                       Rabbit  ======================================================================
             Tibetan antelope  ======================================================================
                      Dolphin  ======================================================================
             Brush-tailed rat  ======================================================================
              Star-nosed mole  ======================================================================
                 Killer whale  ======================================================================
               Naked mole-rat  ======================================================================
                     Aardvark  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                 Weddell seal  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                       Baboon  ======================================================================
               Pacific walrus  ======================================================================
                   Chinchilla  ==============================================