Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 764 in window, 94769620 - 94769638, 19 bps 
B D                     Human  tgta----------------------aagaaaataatagct
B D                     Chimp  tgta----------------------aagaaaataatagct
B D                   Gorilla  tgta----------------------aagaaaataatagct
B D                 Orangutan  tgta----------------------aagaaaataatagct
B D                    Gibbon  tgta----------------------aagaaaataatagct
B D                    Rhesus  tgta----------------------aagaaaataatagct
B D       Crab-eating macaque  tgta----------------------aagaaaataatagct
B D                    Baboon  tgta----------------------aagaaaataatagct
B D              Green monkey  tgta----------------------aagaaaataatagct
B D                  Marmoset  tgta----------------------aagaaaataatagct
B D           Squirrel monkey  tgta----------------------aagaa---aatagct
B D                  Bushbaby  cata----------------------atgaaaatattagcg
           Chinese tree shrew  cata----------------------atgaaaatagtagct
B D                  Squirrel  -------------------------------------agct
       Lesser Egyptian jerboa  cgta----------------------aggtaacg-gtaact
                 Prairie vole  cata----------------------tgctaagaaagagct
B D           Chinese hamster  caga----------------------atgcaaggaagagtt
               Golden hamster  caga----------------------gtccatggaagagac
B D                     Mouse  catg----------------------gtgcaaggaatagtt
B D                       Rat  tagg----------------------aggcaaagaagagtt
B D            Naked mole-rat  cata----------------------atgaaaataatagct
B D                Guinea pig  cata----------------------atgcaaataatagct
                   Chinchilla  cata----------------------acgcaaataatagct
             Brush-tailed rat  caca----------------------gtgcaaacaatggct
B D                    Rabbit  cttg----------------------gtcaaagtaacagct
B D                      Pika  catg----------------------cggagaataaagcct
B D                       Pig  cgta----------------------acgaaaataaaagcc
B D                    Alpaca  c-ta----------------------aggcaaataaaagct
               Bactrian camel  c-ta----------------------atgcaaataaaagct
B D                   Dolphin  ctta----------------------atgaaaataaaagct
                 Killer whale  ctta----------------------atgaaaataaaagct
             Tibetan antelope  cgta----------------------atgaaaataaaagct
B D                       Cow  cgta----------------------atgaaaataaaagct
B D                     Sheep  cgta----------------------atgaaaataaaagct
                Domestic goat  cgta----------------------atgaaaataaaagct
B D                     Horse  cgta----------------------atgaaaataatagct
B D          White rhinoceros  cgta----------------------atgagaataatagct
B D                       Cat  cgta----------------------atgaaaataatagcc
B D                       Dog  tgta----------------------atgaaaataagagct
B D                   Ferret   cgta----------------------atgaaaatacgagct
B D                     Panda  tgta----------------------atggaaataagagtt
               Pacific walrus  tgta----------------------atgaaaataggagct
             Black flying-fox  cata----------------------atgaaaataagagct
B D                   Megabat  cata----------------------atgaaaataagaact
                Big brown bat  cggg----------------------acgaaaataataacg
B D                  Microbat  cgta----------------------atgaaaataataacg
B D                  Hedgehog  caca----------------------atgaaaaccagagct
B D                     Shrew  tgca----------------------atgaaaacactagct
              Star-nosed mole  catc----------------------atgaaaatgatcacc
B D                  Elephant  cgta----------------------atgacaactatggct
          Cape elephant shrew  tgta----------------------ataagaataatcgtc
B D                   Manatee  cgta----------------------atgaaaacaatagct
             Cape golden mole  tata----------------------at-gaactaagagct
B D                    Tenrec  catc----------------------atagaaatcataggt
                     Aardvark  tgta----------------------ataaaaataatagct
B D                 Armadillo  tgta----------------------atgaaaataatagct
B D                   Opossum  cataaggcttttaaataatcagatgttaaaaaaccctatat
B D           Tasmanian devil  cataaggcttttaagtaattagacg-gagaaaacaagaaat
B D                   Wallaby  cataagactttta-------------tagaaaaaaataaat
B D                  Platypus  tcct----------------------aaaagctcatgtgtt
           Southern platyfish  tata----------------------actaaaattg-----
     Mexican tetra (cavefish)  tctat---------------------act------------
        David's myotis (bat)  =========================================
B D                    Lizard  =========================================
                 Zebra mbuna  =========================================
B D              Nile tilapia  =========================================
         Pundamilia nyererei  =========================================
       Burton's mouthbreeder  =========================================
         Princess of Burundi  =========================================
                 Spotted gar  =========================================
B D             X. tropicalis  =========================================
B D                 Zebrafish  =========================================
B D                Coelacanth  =========================================
  D               Rock pigeon  =========================================
B D        American alligator  =========================================
B D                      Fugu  =========================================
  D             Scarlet macaw  =========================================
B D                    Medaka  =========================================
  D              Mallard duck  =========================================
B D                 Tetraodon  =========================================
B D               Stickleback  =========================================
  D       Collared flycatcher  =========================================
B D                    Turkey  =========================================
B D                   Chicken  =========================================
  D  Chinese softshell turtle  =========================================
          Tibetan ground jay  =========================================
B D                Budgerigar  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
  D                    Parrot  =========================================
B D       Medium ground finch  =========================================
  D    White-throated sparrow  =========================================
B D               Zebra finch  =========================================
  D            Painted turtle  =========================================
  D           Green seaturtle  =========================================
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 2 of 764 in window, 94769639 - 94769646, 8 bps 
B D                     Human  gt-atgctt
B D                     Chimp  gc-atgctt
B D                   Gorilla  gc-atgctg
B D                 Orangutan  gc-atgctt
B D                    Gibbon  gc-atgctt
B D                    Rhesus  gt-atgctt
B D       Crab-eating macaque  gt-atgctt
B D                    Baboon  gt-atgctt
B D              Green monkey  gt-atgctt
B D                  Marmoset  gc-atgctt
B D           Squirrel monkey  gc-atgttt
B D                  Bushbaby  gc-gtgctt
           Chinese tree shrew  gt-gtgctt
B D                  Squirrel  gc-atgctt
       Lesser Egyptian jerboa  cc-atgcct
                 Prairie vole  ac-atacct
B D           Chinese hamster  ac-atgcct
               Golden hamster  aa-atacct
B D                     Mouse  ac-atgcct
B D                       Rat  ag-aggcct
B D            Naked mole-rat  gt-gtgctt
B D                Guinea pig  at-gtgttt
                   Chinchilla  gc-gtgctt
             Brush-tailed rat  gc-gtgagt
B D                    Rabbit  gc-acattg
B D                      Pika  gtgatgttg
B D                       Pig  ac-atgctt
B D                    Alpaca  ac-atgctt
               Bactrian camel  ac-atgctt
B D                   Dolphin  ac-atgctt
                 Killer whale  ac-atgctt
             Tibetan antelope  ac-atgctt
B D                       Cow  ac-atgctt
B D                     Sheep  ac-atgctt
                Domestic goat  ac-atgctt
B D                     Horse  gc-atgctt
B D          White rhinoceros  gc-atgct-
B D                       Cat  gc-atgctt
B D                       Dog  gc-atgctc
B D                   Ferret   gc-ctgctc
B D                     Panda  gc-gtgctc
               Pacific walrus  gc-acgctc
             Black flying-fox  ac-gtgctg
B D                   Megabat  ac-gtgctt
                Big brown bat  ac-acgctt
B D                  Microbat  gc-acgctt
B D                  Hedgehog  gc-atg---
B D                     Shrew  gc-acgcag
              Star-nosed mole  ac-acattt
B D                  Elephant  gc-atgctt
          Cape elephant shrew  gt-ctgctt
B D                   Manatee  gc-atgttc
             Cape golden mole  gc-ctgttt
B D                    Tenrec  gc-atgtgc
                     Aardvark  ac-atgctt
B D                 Armadillo  ac-atgctt
B D                   Opossum  tt-ggg---
B D           Tasmanian devil  aa-atg---
B D                   Wallaby  gc-atg---
B D                  Platypus  gc-tccc--
B D                Budgerigar  gt-accctt
           Southern platyfish  gt-gaacaa
     Mexican tetra (cavefish)  gt-tcactc
        David's myotis (bat)  =========
B D                    Lizard  =========
                 Zebra mbuna  =========
B D              Nile tilapia  =========
         Pundamilia nyererei  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
                 Spotted gar  =========
B D             X. tropicalis  =========
B D                 Zebrafish  =========
B D                Coelacanth  =========
  D               Rock pigeon  =========
B D        American alligator  =========
B D                      Fugu  =========
  D             Scarlet macaw  =========
B D                    Medaka  =========
  D              Mallard duck  =========
B D                 Tetraodon  =========
B D               Stickleback  =========
  D       Collared flycatcher  =========
B D                    Turkey  =========
B D                   Chicken  =========
  D  Chinese softshell turtle  =========
          Tibetan ground jay  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
  D                    Parrot  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
B D               Zebra finch  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
                Weddell seal  NNNNNNNNN

Inserts between block 2 and 3 in window
            Black flying-fox 3bp
B D                  Megabat 3bp
               Big brown bat 3bp
B D                 Microbat 281bp

Alignment block 3 of 764 in window, 94769647 - 94769648, 2 bps 
B D                     Human  ag-
B D                     Chimp  ag-
B D                   Gorilla  ag-
B D                 Orangutan  at-
B D                    Gibbon  at-
B D                    Rhesus  at-
B D       Crab-eating macaque  at-
B D                    Baboon  at-
B D              Green monkey  at-
B D                  Marmoset  ct-
B D           Squirrel monkey  ct-
B D                  Bushbaby  at-
           Chinese tree shrew  at-
B D                  Squirrel  at-
       Lesser Egyptian jerboa  ag-
                 Prairie vole  at-
B D           Chinese hamster  at-
               Golden hamster  at-
B D                     Mouse  at-
B D                       Rat  at-
B D            Naked mole-rat  at-
B D                Guinea pig  at-
                   Chinchilla  gt-
             Brush-tailed rat  at-
B D                    Rabbit  at-
B D                       Pig  ag-
B D                    Alpaca  at-
               Bactrian camel  at-
B D                   Dolphin  ct-
                 Killer whale  ct-
             Tibetan antelope  ct-
B D                       Cow  ct-
B D                     Sheep  ct-
                Domestic goat  ct-
B D                     Horse  at-
B D                       Cat  at-
B D                       Dog  at-
B D                   Ferret   ag-
B D                     Panda  at-
               Pacific walrus  at-
B D                     Shrew  at-
              Star-nosed mole  at-
B D                  Elephant  ac-
          Cape elephant shrew  at-
B D                   Manatee  at-
             Cape golden mole  ag-
B D                    Tenrec  at-
                     Aardvark  aa-
B D                 Armadillo  at-
B D                   Opossum  g--
B D           Tasmanian devil  c--
B D                   Wallaby  g--
B D                Budgerigar  at-
           Southern platyfish  -ta
     Mexican tetra (cavefish)  -tg
B D                  Hedgehog  ---
B D                      Pika  ---
B D                  Microbat  ===
        David's myotis (bat)  ===
               Big brown bat  ===
B D                    Lizard  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
                 Spotted gar  ===
B D             X. tropicalis  ===
B D                 Zebrafish  ===
B D                Coelacanth  ===
  D               Rock pigeon  ===
B D        American alligator  ===
B D                      Fugu  ===
  D             Scarlet macaw  ===
B D                    Medaka  ===
  D              Mallard duck  ===
B D                 Tetraodon  ===
B D               Stickleback  ===
  D       Collared flycatcher  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D  Chinese softshell turtle  ===
          Tibetan ground jay  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D                  Platypus  ---
B D                   Megabat  ===
                Weddell seal  NNN
            Black flying-fox  ===
B D          White rhinoceros  ---

Inserts between block 3 and 4 in window
B D                    Horse 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
B D                  Opossum 12bp
B D          Tasmanian devil 6bp
B D                  Wallaby 14bp

Alignment block 4 of 764 in window, 94769649 - 94769672, 24 bps 
B D                     Human  ---------------aatttt-ctttgctt---agttcaat--gg
B D                     Chimp  ---------------aatttt-ctttgctt---agttcaat--gg
B D                   Gorilla  ---------------aatttt-ctttgctt---agttcaat--gg
B D                 Orangutan  ---------------aatttt-ctttgctt---agttcaat--gg
B D                    Gibbon  ---------------aatttt-ctttgctt---agttcaat--gg
B D                    Rhesus  ---------------aatttt-ctttggtt---agttcaat--gg
B D       Crab-eating macaque  ---------------aatttt-ctttggtt---agttcaat--gg
B D                    Baboon  ---------------aatttt-ctttggtt---agttcaat--gg
B D              Green monkey  ---------------aatttt-ctttggtt---agttcaac--ga
B D                  Marmoset  ---------------aatttt-ctatgcta---ggttcaat--gg
B D           Squirrel monkey  ---------------aatttt-ctttgcta---gattcagt--gg
B D                  Bushbaby  ---------------aatttc-ctttgctt---agttcaataaag
           Chinese tree shrew  ---------------aatttt-ctttgctt---agttcaataaag
B D                  Squirrel  ---------------aatcgt-ctttgcct---ggttggatgaag
       Lesser Egyptian jerboa  ---------------aatctg-ctttg-tt---ggttccatgaag
                 Prairie vole  ---------------ccgctc-ctttgctt---ggctccgtggag
B D           Chinese hamster  ---------------catctg-ttttgctt---ggttcattgaaa
               Golden hamster  ---------------aatctg-ctttgctt---ggttcactgaaa
B D                     Mouse  ---------------gttctg-ctttgctt---ggttcaatgtag
B D                       Rat  ---------------gatgtg-ctttgctt---gcttcgatgaag
B D            Naked mole-rat  ---------------aatctt-cttcgctt---ggttcaatgaaa
B D                Guinea pig  ---------------gatctt-ctccactt---ggttcaatgaaa
                   Chinchilla  ---------------gatctt-cttcactt---gcttcgatgaaa
             Brush-tailed rat  ---------------ggtctt-cttcactt---ggctcactgaag
B D                    Rabbit  ---------------aattgt-ctttgcag---agttcaatcaaa
B D                      Pika  ---------------agttgg-ctttgttg---ggttccatcaaa
B D                       Pig  ---------------tgtttt-ct-----a---agttcaagga--
B D                    Alpaca  ---------------tatctt-cttttcca---agttccatga--
               Bactrian camel  ---------------tatctt-cttttcca---agttccatga--
B D                   Dolphin  ---------------tatttt-cttttcta---gtttcaatga--
                 Killer whale  ---------------tatttt-cttttcta---gtttcaatga--
             Tibetan antelope  ---------------tatttt-cttttcta---ggtttcacga--
B D                       Cow  ---------------tatttt-cttttctg---ggcttcacga--
B D                     Sheep  ---------------tatttt-cttttcta---ggtttcacga--
                Domestic goat  ---------------tatttt-ctttccta---ggtttcacga--
B D                     Horse  ----------------ctttt-cttttctt---agttcactga--
B D          White rhinoceros  -----------------tctt-cttttctt---agttcaatga--
B D                       Cat  ---------------actt-t-ctttcctc---agttcagtga--
B D                       Dog  ---------------acttct-cttttctt---agttcaatga--
B D                   Ferret   ---------------acttct-ctttcctt---agttcagtga--
B D                     Panda  ---------------acttct-cttttgtt---agttcaatga--
               Pacific walrus  ---------------actgct-cttttctt---agttcaatga--
             Black flying-fox  ---------------attttc-cttttctt---agtacggcga--
B D                   Megabat  ---------------attttc-cttttctt---agtgtggcga--
                Big brown bat  ---------------gttctctctttttga---agttcaccga--
         David's myotis (bat)  ---------------attttctctttttga---agt---------
B D                  Hedgehog  -----------------------ctttttt---agttcagtgg--
B D                     Shrew  ---------------ta------ttttctt---agttcaacaa--
              Star-nosed mole  ---------------tatttt-cttttctt---aattcaatga--
B D                  Elephant  ---------------tatttt-ctttcctg---agttcaacgaag
          Cape elephant shrew  ---------------tacttt-ctttcctg---actccaatgaag
B D                   Manatee  ---------------tatttt-ctttcctg---ggttccacgaag
             Cape golden mole  ---------------tctttc-ctttcctg---tgttcaatgaag
B D                    Tenrec  ---------------gctttt-cttgcctg---ttttcaatccca
                     Aardvark  ---------------tatttt-cctttctc---agttcaatgaag
B D                 Armadillo  ---------------tatttt-cttttctt---agttcaacaaag
B D                   Opossum  ---------------gttata-ctattcct---actttaatga--
B D           Tasmanian devil  ----------------tttct-tttttcca---atgtccatga--
B D                   Wallaby  ---------------gtttct-tttttcca---acttcaatga--
B D                  Platypus  -----------------tatt-cttttccc---agtccaatga--
B D                Budgerigar  ---------------aaactt-ttatcctttaaaattcaatgg--
           Southern platyfish  tattgttagcagcccaaaaat-cag--caa---atct--------
     Mexican tetra (cavefish)  tattttt-tctatctaatttt-ctattcaa---acta--------
B D                  Microbat  =============================================
B D                    Lizard  =============================================
                 Zebra mbuna  =============================================
B D              Nile tilapia  =============================================
         Pundamilia nyererei  =============================================
       Burton's mouthbreeder  =============================================
         Princess of Burundi  =============================================
                 Spotted gar  =============================================
B D             X. tropicalis  =============================================
B D                 Zebrafish  =============================================
B D                Coelacanth  =============================================
  D               Rock pigeon  =============================================
B D        American alligator  =============================================
B D                      Fugu  =============================================
  D             Scarlet macaw  =============================================
B D                    Medaka  =============================================
  D              Mallard duck  =============================================
B D                 Tetraodon  =============================================
B D               Stickleback  =============================================
  D       Collared flycatcher  =============================================
B D                    Turkey  =============================================
B D                   Chicken  =============================================
  D  Chinese softshell turtle  =============================================
          Tibetan ground jay  =============================================
  D          Peregrine falcon  =============================================
  D              Saker falcon  =============================================
  D                    Parrot  =============================================
B D       Medium ground finch  =============================================
  D    White-throated sparrow  =============================================
B D               Zebra finch  =============================================
  D            Painted turtle  =============================================
  D           Green seaturtle  =============================================
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 4 and 5 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 4bp
B D                  Dolphin 4bp
                Killer whale 4bp
            Tibetan antelope 4bp
B D                      Cow 4bp
B D                    Sheep 4bp
               Domestic goat 4bp
B D                    Horse 3bp
B D         White rhinoceros 3bp
B D                      Cat 3bp
B D                      Dog 3bp
B D                  Ferret  3bp
B D                    Panda 3bp
              Pacific walrus 3bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 3bp
B D                 Hedgehog 6bp
B D                    Shrew 3bp
             Star-nosed mole 3bp
B D                  Opossum 4bp
B D          Tasmanian devil 6bp
B D                  Wallaby 7bp
B D                 Platypus 1bp
B D               Budgerigar 3bp

Alignment block 5 of 764 in window, 94769673 - 94769688, 16 bps 
B D                     Human  tcttt--------ttgaagac----aac-
B D                     Chimp  tcttt--------ttgaagac----aac-
B D                   Gorilla  tcttt--------ttgaagac----aac-
B D                 Orangutan  tcttt--------ttgaagac----aat-
B D                    Gibbon  tcttt--------ttgaagac----aac-
B D                    Rhesus  tcttt--------ttgaagac----aaa-
B D       Crab-eating macaque  tcttt--------ttgaagac----aaa-
B D                    Baboon  tcttt--------ttgaagac----aaa-
B D              Green monkey  tcttt--------ttgaagac----aac-
B D                  Marmoset  tcttt--------ttgaagaa----aac-
B D           Squirrel monkey  tcttt--------ttgaagac----aac-
B D                  Bushbaby  tcttt--------ttcaaggc----aac-
           Chinese tree shrew  tcttt--------ttcaggac----aac-
B D                  Squirrel  ttttt--------gtcaggac----aac-
       Lesser Egyptian jerboa  tcatt--------ttccagac----aac-
                 Prairie vole  acttt--------ttcaaggc----aac-
B D           Chinese hamster  acttt--------ttcaacac----aac-
               Golden hamster  acttt--------ttcaaaac----aag-
B D                     Mouse  tcttt--------ttcaagat----aac-
B D                       Rat  tcttt--------ttctatttaaccaac-
B D            Naked mole-rat  tgctt--------ttcaaaac----aac-
B D                Guinea pig  tcatt--------ttcaaaac----aac-
                   Chinchilla  tcggt--------ttcaaaac----agc-
             Brush-tailed rat  tcggt--------ttgaaaac----aac-
B D                    Rabbit  ccttt--------gtcaagac----aac-
B D                      Pika  ccttt--------ctcatgac----aac-
B D                       Pig  t-ttt--------ttcaagac----aac-
B D                    Alpaca  ttttt--------ttcaagac----cat-
               Bactrian camel  ttttt--------ttcaagac----cac-
B D                   Dolphin  t-ttt--------ttcaagac----aac-
                 Killer whale  t-ttt--------ttcaagac----aac-
             Tibetan antelope  tcttt--------ttcaagtc----aac-
B D                       Cow  tcttt--------ttcaagtc----aac-
B D                     Sheep  tcttt--------ttcaagtc----aac-
                Domestic goat  tcttt--------ttcaagtc----aac-
B D                     Horse  ctttt--------ttcaagac----aac-
B D          White rhinoceros  ctttt--------ttcaagac----aac-
B D                       Cat  ctttt--------tccgagat----gac-
B D                       Dog  ccttt--------ttcaagac----aac-
B D                   Ferret   ctttt--------ttcgagac----aac-
B D                     Panda  ctgtt--------tccgagac----aac-
               Pacific walrus  ctttt--------ctcgagac----aac-
             Black flying-fox  ttttt--------tttaagac----agc-
B D                   Megabat  ttttt--------tttaagac----agc-
                Big brown bat  ctttt--------ttaaaaag----aac-
         David's myotis (bat)  tcttt--------ttaaaaag----gac-
B D                  Microbat  ttttt--------taaaaaag----aac-
B D                  Hedgehog  ttttt--------ttaaagac----aac-
B D                     Shrew  ctttt--------ctcaaggc----aac-
              Star-nosed mole  ctttt--------tccaagac----aac-
B D                  Elephant  tcttt--------ttcgagac----aac-
          Cape elephant shrew  ccatt--------ttcatgac----aac-
B D                   Manatee  tcttt--------ttcgagac----aac-
             Cape golden mole  tcttt--------attaagac----tat-
B D                    Tenrec  tcttt--------gtcgaggc----aac-
                     Aardvark  tcttt--------ttcaagat----gat-
B D                 Armadillo  tcttt--------ttacggtc----aac-
B D                   Opossum  -tatt--------ctaga-------aaa-
B D           Tasmanian devil  -tgta--------ctagagac----aaa-
B D                   Wallaby  -tata--------cttgaa------aaa-
B D                  Platypus  tctgt--------tttagatg----aga-
B D                Budgerigar  gcaaa--------tgaaagac----caa-
B D                Coelacanth  tccta--------ttaggaac----agg-
           Southern platyfish  -cattggttcccactagcaaa----aaga
     Mexican tetra (cavefish)  -tatt--------ttagttaa----atta
                  Spotted gar  -tttt--------ttaaaaaa----aaac
B D                    Lizard  =============================
                 Zebra mbuna  =============================
B D              Nile tilapia  =============================
         Pundamilia nyererei  =============================
       Burton's mouthbreeder  =============================
         Princess of Burundi  =============================
B D             X. tropicalis  =============================
B D                 Zebrafish  =============================
  D               Rock pigeon  =============================
B D        American alligator  =============================
B D                      Fugu  =============================
  D             Scarlet macaw  =============================
B D                    Medaka  =============================
  D              Mallard duck  =============================
B D                 Tetraodon  =============================
B D               Stickleback  =============================
  D       Collared flycatcher  =============================
B D                    Turkey  =============================
B D                   Chicken  =============================
  D  Chinese softshell turtle  =============================
          Tibetan ground jay  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
  D                    Parrot  =============================
B D       Medium ground finch  =============================
  D    White-throated sparrow  =============================
B D               Zebra finch  =============================
  D            Painted turtle  =============================
  D           Green seaturtle  =============================
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 5 and 6 in window
B D               Budgerigar 11bp

Alignment block 6 of 764 in window, 94769689 - 94769716, 28 bps 
B D                     Human  ga-t-tt-ttaaaaattgaggagaggtttgg
B D                     Chimp  ga-t-tt-ttaaaaattgaggagaggtttgg
B D                   Gorilla  ga-t-tt-ttaaaaattgaggagaggtttgg
B D                 Orangutan  ga-t-tt-ttaaaaattgaggagaggtttgg
B D                    Gibbon  ga-t-tt-ttaaaaattgaggagaggtttgg
B D                    Rhesus  aatt-tt-ttaaaaattgaggagaggtttgg
B D       Crab-eating macaque  aa-t-tt-ttaaaaattgaggagaggtttgg
B D                    Baboon  aa-t-tt-ttaaaaatggaggagaggtttgg
B D              Green monkey  aa-t-tt-ttaaaaattgaggagaggtttgg
B D                  Marmoset  ta-t-tt-ctaaaactcgaggagaggtttgg
B D           Squirrel monkey  ta-t-tt-ttaaaaatcgagaagaggtttgg
B D                  Bushbaby  tc-t-tt-ttaaaaattgaggagaggtttgg
           Chinese tree shrew  ta-t-ttaaaaaaaattgacaagagatttga
B D                  Squirrel  ta-t-tt-ttaaaaattaaggagaggtttgg
       Lesser Egyptian jerboa  ta-t-tt-ttaaaaactgaggagaggtttgg
                 Prairie vole  ca-t-tt-cgagaaatggaggcgagggctag
B D           Chinese hamster  ca-t-tt-ctaaaaacagaggacagggctag
               Golden hamster  ca-t-tt-ctaaaaaccgaggacagggctag
B D                     Mouse  tg-t-ct-ctacagacagaggagagggctag
B D                       Rat  tg-c-ct-ccacaaacggaggcgagggctag
B D            Naked mole-rat  ta-t-tt-taaaaaattgaggagatgttcgg
B D                Guinea pig  ta-t-tt-ttaaaaactgaggagatgtttgg
                   Chinchilla  ta-t-at-ttagaaactgaagagacatttgg
             Brush-tailed rat  ta-t-tt-ttagaaattgaggagacatttgg
B D                    Rabbit  tg-t-tt-ttaaaaattgaggagagg-ttgg
B D                      Pika  ta-t-tt-ttaaaaattgagaagagg-ttgg
B D                       Pig  ta-t-tt-ttaaaaattcaggagaggtttgg
B D                    Alpaca  ta-t-tt-taaaaaattcaggagaggtttgg
               Bactrian camel  ta-t-tt-taaaaagttcaggagaggtttgg
B D                   Dolphin  ta-t-tt-ttaaaaattcaggagaggtttgg
                 Killer whale  ta-t-tt-ttaaaaattcaggagaggtttgg
             Tibetan antelope  ta-t-tt-ttaaaaattcaggaggggtttgg
B D                       Cow  ta-t-tt-ttaaaaattcaggaggcgtttgg
B D                     Sheep  ta-t-tt-ttaaaaattcaggaggggtttgg
                Domestic goat  ta-t-tt-ttaaaaattcaggaggggtttgg
B D                     Horse  ta-t-tt-ttaaaaattcaggagaagtttgg
B D          White rhinoceros  ca-t-tt-ttaaaaattcaggagaagtttgg
B D                       Cat  tg-t-tt-ttaaaaattcaggagaggtttgg
B D                       Dog  ta-t-tt-ttaaaaattcaggagaggtttgg
B D                   Ferret   ta-c-tt-ttaaaaattcaggagaggttcgg
B D                     Panda  ta-c-tt-ttaaaaattcaggagaggtttgg
               Pacific walrus  tg-c-tt-ttaaaaattcaggagaggtttgg
             Black flying-fox  ta-t-tt-taaaaatatcaggatcagtttgg
B D                   Megabat  ta-t-tt-taaaaatatcaggatcagtttgg
                Big brown bat  tg-t-tt-tcaaacatgccggagaggtttgg
         David's myotis (bat)  tg-t-tt-ttaaaaatgccggagaggtttgg
B D                  Microbat  tg-t-tt-ttaaaaatgccggagaggtttgg
B D                  Hedgehog  tt-t-tt-tt-taaattcaggagtggtttgg
B D                     Shrew  tc-c-tt-ttaaaaatgcaagagtgttatgg
              Star-nosed mole  ca-c-tt-ttaaaaattcaagagaggtttgg
B D                  Elephant  tg-tttt-ttaaaaatcaaggagacgtttgg
          Cape elephant shrew  tg-tttt-taaaaagtcaggaagcagcttag
B D                   Manatee  tg--ttt-taaaaaatcgaggagacgtttgg
             Cape golden mole  tg-tgtt-ttaaaagttggggcgctatgtgg
B D                    Tenrec  tg-t-tt-ttaaaaattgaggagaggctggg
                     Aardvark  ta-t-tt-ttaaaaatcaaggagaggtttgg
B D                 Armadillo  ta-t-tt-ttaaaaattgaggagacatttgg
B D                   Opossum  aa-t----taaaatactgggcaaaggtttgg
B D           Tasmanian devil  aa-c----taaaatactgagcaaaggtggag
B D                   Wallaby  aa-a----ttaaatactgcacaaaggtctgg
B D                  Platypus  ta-c--t-tcacaccccgaggaaaggcctga
B D                Budgerigar  ga-t-tt-atatcagtgtagtaaga---tgc
  D              Mallard duck  ga-t-tt-atatcagtgtagtgaga---tgt
B D                Coelacanth  ta-t-ta-atactagcaaaaaaatgcattga
           Southern platyfish  ac-t-ca-ttcaactttgatg----------
     Mexican tetra (cavefish)  aa-t-tt-ttaaaaatctaaa----------
                  Spotted gar  aa-t-tt-tatgacattga-g----------
B D                    Lizard  ===============================
                 Zebra mbuna  ===============================
B D              Nile tilapia  ===============================
         Pundamilia nyererei  ===============================
       Burton's mouthbreeder  ===============================
         Princess of Burundi  ===============================
B D             X. tropicalis  ===============================
B D                 Zebrafish  ===============================
  D               Rock pigeon  ===============================
B D        American alligator  ===============================
B D                      Fugu  ===============================
  D             Scarlet macaw  ===============================
B D                    Medaka  ===============================
B D                 Tetraodon  ===============================
B D               Stickleback  ===============================
  D       Collared flycatcher  ===============================
B D                    Turkey  ===============================
B D                   Chicken  ===============================
  D  Chinese softshell turtle  ===============================
          Tibetan ground jay  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
  D                    Parrot  ===============================
B D       Medium ground finch  ===============================
  D    White-throated sparrow  ===============================
B D               Zebra finch  ===============================
  D            Painted turtle  ===============================
  D           Green seaturtle  ===============================
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 7 of 764 in window, 94769717 - 94769738, 22 bps 
B D                     Human  acttgtgttaaatttattaac-a--
B D                     Chimp  acttgtgttaaatttattaac-a--
B D                   Gorilla  acttgtgttaaatttattaac-a--
B D                 Orangutan  acttgtgttaaatttattaac-a--
B D                    Gibbon  acttgtgttaaatttattaac-a--
B D                    Rhesus  acttgtgttaaatttattaac-a--
B D       Crab-eating macaque  acttgtgttaaatttattaac-a--
B D                    Baboon  acttgtgttaaatttattaac-a--
B D              Green monkey  acttgtgttaaatttattaac-a--
B D                  Marmoset  acttgtattaaatttattaac-a--
B D           Squirrel monkey  acttgtgttaaatttattaac-a--
B D                  Bushbaby  acttgtgttaaatttattaac-a--
           Chinese tree shrew  atttgtgttaaatttattaac-a--
B D                  Squirrel  actt-tgttaaatttattaac-a--
       Lesser Egyptian jerboa  tcttgtgttaaatttattaac-a--
                 Prairie vole  acttgcattaaatttactaac-a--
B D           Chinese hamster  acttgtgat-aatttattaac-a--
               Golden hamster  acttctgttaaatttattaac-a--
B D                     Mouse  acttgtgttaaatttattaac-a--
B D                       Rat  actagcgttaaatttattaac-a--
B D            Naked mole-rat  acttgcatgaaatttattaac-a--
B D                Guinea pig  acttgtgttaaatttattagc-a--
                   Chinchilla  acttgcattaaatttattaac-a--
             Brush-tailed rat  atttgcattgaatttatgaac-a--
B D                    Rabbit  gc-tgtgttaaatttattaac-a--
B D                      Pika  gcgtgtgttaaatttattaac-a--
B D                       Pig  acctgtgttaaatttattaac-a--
B D                    Alpaca  acccgtgttaaatttattaac-a--
               Bactrian camel  acccgtgttaaatttattaac-a--
B D                   Dolphin  acctgtgttaaatttattaac-a--
                 Killer whale  acctgtgttaaatttattaac-a--
             Tibetan antelope  acctgtgttaaatttattaac-a--
B D                       Cow  acctgtgttaaatttattaac-a--
B D                     Sheep  acctgtgttaaatttattaac-a--
                Domestic goat  acctgtgttaaatttattaac-a--
B D                     Horse  acctgtgttaaatttattaac-a--
B D          White rhinoceros  acctgtgttaaatttattaac-a--
B D                       Cat  acctgtgttaaatttattaac-a--
B D                       Dog  acctgtgttaaatttattaac-a--
B D                   Ferret   acctgtgttaaatttattaac-a--
B D                     Panda  acctgtgttaaatttattaac-a--
               Pacific walrus  acctgtgttaaatttattaac-a--
             Black flying-fox  acgtgcgttaaatttattaac-a--
B D                   Megabat  acgtgcgttaaatttattaac-a--
                Big brown bat  acctgtgttaagtttattaac-a--
         David's myotis (bat)  gcccgtgttacatttactaac-a--
B D                  Microbat  acccgtgttacatttattaac-a--
B D                  Hedgehog  acctatgttaaatttattaac-a--
B D                     Shrew  acctgtgttaaatttattaac-a--
              Star-nosed mole  acctgtgttaaatttattaac-a--
B D                  Elephant  acctgtattaaatgtagtaac-a--
          Cape elephant shrew  acctgtgttaaatttattaac-a--
B D                   Manatee  acctgtgttaaatttattaaa-g--
             Cape golden mole  acctgtgttaaatatattaac-a--
B D                    Tenrec  atctgtgttaaatttattaac-a--
                     Aardvark  acctgtgttaaatttattaac-a--
B D                 Armadillo  acctgtgttaaatttattaac-a--
B D                   Opossum  gatgaactttaatatattaaa-g--
B D           Tasmanian devil  gataaactttaatatgttaat-g--
B D                   Wallaby  gatgaactttaatgtgttaat-g--
B D                  Platypus  aacaaattttaatttattaat-g--
B D                Budgerigar  agctctgcacagtacatggttt---
  D              Mallard duck  agctttgctaagtatatcgct----
B D             X. tropicalis  atttctgtaaaatttagtgac----
B D                Coelacanth  --ttttgtgtaattt--tagc-a--
           Southern platyfish  --------tgacgtcattccc-a-a
     Mexican tetra (cavefish)  --------taatcttttttta-atg
                  Spotted gar  --------taaattaattctc-aga
B D                    Lizard  =========================
                 Zebra mbuna  =========================
B D              Nile tilapia  =========================
         Pundamilia nyererei  =========================
       Burton's mouthbreeder  =========================
         Princess of Burundi  =========================
B D                 Zebrafish  =========================
  D               Rock pigeon  =========================
B D        American alligator  =========================
B D                      Fugu  =========================
  D             Scarlet macaw  =========================
B D                    Medaka  =========================
B D                 Tetraodon  =========================
B D               Stickleback  =========================
  D       Collared flycatcher  =========================
B D                    Turkey  =========================
B D                   Chicken  =========================
  D  Chinese softshell turtle  =========================
          Tibetan ground jay  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
  D                    Parrot  =========================
B D       Medium ground finch  =========================
  D    White-throated sparrow  =========================
B D               Zebra finch  =========================
  D            Painted turtle  =========================
  D           Green seaturtle  =========================
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 7 and 8 in window
B D               Coelacanth 8bp

Alignment block 8 of 764 in window, 94769739 - 94769752, 14 bps 
B D                     Human  tt--ttaaaagtaatg
B D                     Chimp  tt--ttaaaagtaatg
B D                   Gorilla  tt--ctaaaagtaatg
B D                 Orangutan  tt--ttaaaa-----g
B D                    Gibbon  tt--ttaaaagtaatg
B D                    Rhesus  tt--ttgaaagtaatg
B D       Crab-eating macaque  tt--ttgaaagtaatg
B D                    Baboon  tc--ttgaaagtaatg
B D              Green monkey  tt--ttgaaagtaatg
B D                  Marmoset  tt--taaaaagtcatg
B D           Squirrel monkey  tt--ttaaaagtcatg
B D                  Bushbaby  tt--ttaaaagtcatg
           Chinese tree shrew  tt--ttaaaagtcatg
B D                  Squirrel  tt--tgaaaagtcaca
       Lesser Egyptian jerboa  tt--ttaaaagtcata
                 Prairie vole  tt--tgaaaagtcata
B D           Chinese hamster  tt--ttaaaagtcata
               Golden hamster  tt--ttaaaagtcata
B D                     Mouse  tt--ttaaaagtcata
B D                       Rat  tt--ttaaaagtcata
B D            Naked mole-rat  at--ttaaaagtcata
B D                Guinea pig  at--tt-aaagccata
                   Chinchilla  at--tt-aaagccata
             Brush-tailed rat  ct--tt-aaagtcata
B D                    Rabbit  tt--ttaaaagtcata
B D                      Pika  tt--ttaaaagtcata
B D                       Pig  tt--ttaaaagtcaca
B D                    Alpaca  tt--ttaaaagtcata
               Bactrian camel  tt--ttaaaagtcata
B D                   Dolphin  tt--ttaaaagtcata
                 Killer whale  tt--ttaaaagtcata
             Tibetan antelope  tt--ttaaaagtcata
B D                       Cow  tt--ttaaaagtcata
B D                     Sheep  tt--ttaaaagtcata
                Domestic goat  tt--ttaaaagtcata
B D                     Horse  tt--ttaaaagtcata
B D          White rhinoceros  tt--ttaaaagtcatg
B D                       Cat  tt--ttaaaagtcaca
B D                       Dog  tt--ttaaaagtcaca
B D                   Ferret   tt--ttaaaagtcaca
B D                     Panda  tt--ttaaaagtcaca
               Pacific walrus  tt--ttaaaagtcaca
             Black flying-fox  tt--ttaaaagtcata
B D                   Megabat  tt--ttaaaagtcata
                Big brown bat  tttattaaaagtcata
         David's myotis (bat)  tttattaaaagtcata
B D                  Microbat  tttattaaaagtcata
B D                  Hedgehog  tt--ttaaaagtcata
B D                     Shrew  tt--ttaaaagacaca
              Star-nosed mole  tt--ttaaaagtcatg
B D                  Elephant  tt--tttaaagtcata
          Cape elephant shrew  tt--ctaaaaggcgta
B D                   Manatee  tt--tttaaagtcata
             Cape golden mole  tt--tccaaaaccata
B D                    Tenrec  tt--ttaaaagtcata
                     Aardvark  tt--ttaaaagtcata
B D                 Armadillo  tt--ttaaaagtcata
B D                   Opossum  tt--tt--gagttata
B D           Tasmanian devil  tt--tt--aagttata
B D                   Wallaby  tt--tt--aagttatg
B D                  Platypus  tt--tt-aaagtcaca
  D       Collared flycatcher  tt--atggaagtagag
B D                Budgerigar  -t--atggaagttgaa
  D              Mallard duck  tt--ataaaagttgag
B D             X. tropicalis  ct--ttaaaagtagta
B D                Coelacanth  tt--ttgtaattagtg
           Southern platyfish  at--ttgaggctaatt
     Mexican tetra (cavefish)  ac--ctgatgagaatt
                  Spotted gar  at--tttaaagaaagg
B D                    Lizard  ================
                 Zebra mbuna  ================
B D              Nile tilapia  ================
         Pundamilia nyererei  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D                 Zebrafish  ================
  D               Rock pigeon  ================
B D        American alligator  ================
B D                      Fugu  ================
  D             Scarlet macaw  ================
B D                    Medaka  ================
B D                 Tetraodon  ================
B D               Stickleback  ================
B D                    Turkey  ================
B D                   Chicken  ================
  D  Chinese softshell turtle  ================
          Tibetan ground jay  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D                    Parrot  ================
B D       Medium ground finch  ================
  D    White-throated sparrow  ================
B D               Zebra finch  ================
  D            Painted turtle  ================
  D           Green seaturtle  ================
                Weddell seal  NNNNNNNNNNNNNNNN

Inserts between block 8 and 9 in window
B D            X. tropicalis 35bp

Alignment block 9 of 764 in window, 94769753 - 94769755, 3 bps 
B D                     Human  taa-
B D                     Chimp  taa-
B D                   Gorilla  taa-
B D                 Orangutan  taa-
B D                    Gibbon  taa-
B D                    Rhesus  taa-
B D       Crab-eating macaque  taa-
B D                    Baboon  taa-
B D              Green monkey  taa-
B D                  Marmoset  taa-
B D           Squirrel monkey  taa-
B D                  Bushbaby  taa-
           Chinese tree shrew  taa-
B D                  Squirrel  taa-
       Lesser Egyptian jerboa  taa-
                 Prairie vole  taa-
B D           Chinese hamster  tca-
               Golden hamster  taa-
B D                     Mouse  taa-
B D                       Rat  taa-
B D            Naked mole-rat  taa-
B D                Guinea pig  taa-
                   Chinchilla  tca-
             Brush-tailed rat  t---
B D                    Rabbit  taa-
B D                      Pika  taa-
B D                       Pig  taa-
B D                    Alpaca  taa-
               Bactrian camel  taa-
B D                   Dolphin  taa-
                 Killer whale  taa-
             Tibetan antelope  taa-
B D                       Cow  taa-
B D                     Sheep  taa-
                Domestic goat  taa-
B D                     Horse  taa-
B D          White rhinoceros  taa-
B D                       Cat  taa-
B D                       Dog  taa-
B D                   Ferret   taa-
B D                     Panda  taa-
               Pacific walrus  taa-
             Black flying-fox  taa-
B D                   Megabat  taa-
                Big brown bat  taa-
         David's myotis (bat)  taa-
B D                  Microbat  taa-
B D                  Hedgehog  taa-
B D                     Shrew  taa-
              Star-nosed mole  taa-
B D                  Elephant  taa-
          Cape elephant shrew  taa-
B D                   Manatee  taa-
             Cape golden mole  taa-
B D                    Tenrec  taa-
                     Aardvark  taa-
B D                 Armadillo  taa-
B D                   Opossum  taa-
B D           Tasmanian devil  taa-
B D                   Wallaby  taa-
B D                  Platypus  taa-
  D       Collared flycatcher  gat-
B D                Budgerigar  gat-
  D              Mallard duck  gat-
B D                Coelacanth  ta--
           Southern platyfish  -gaa
     Mexican tetra (cavefish)  -aaa
                  Spotted gar  -ata
B D                    Lizard  ====
                 Zebra mbuna  ====
B D              Nile tilapia  ====
         Pundamilia nyererei  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D             X. tropicalis  ====
B D                 Zebrafish  ====
  D               Rock pigeon  ====
B D        American alligator  ====
B D                      Fugu  ====
  D             Scarlet macaw  ====
B D                    Medaka  ====
B D                 Tetraodon  ====
B D               Stickleback  ====
B D                    Turkey  ====
B D                   Chicken  ====
  D  Chinese softshell turtle  ====
          Tibetan ground jay  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
B D               Zebra finch  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
                Weddell seal  NNNN

Inserts between block 9 and 10 in window
  D      Collared flycatcher 1bp
B D               Budgerigar 1bp
  D             Mallard duck 1bp

Alignment block 10 of 764 in window, 94769756 - 94769760, 5 bps 
B D                     Human  ttaac
B D                     Chimp  ttaac
B D                   Gorilla  ttaac
B D                 Orangutan  ttaac
B D                    Gibbon  ttaac
B D                    Rhesus  ttaac
B D       Crab-eating macaque  ttaac
B D                    Baboon  ttaac
B D              Green monkey  ttaac
B D                  Marmoset  ttaac
B D           Squirrel monkey  ttaac
B D                  Bushbaby  ttaac
           Chinese tree shrew  ttaac
B D                  Squirrel  ttaac
       Lesser Egyptian jerboa  ttaac
                 Prairie vole  ttaac
B D           Chinese hamster  ttaac
               Golden hamster  ttaac
B D                     Mouse  ttaac
B D                       Rat  ttaac
B D            Naked mole-rat  gtaac
B D                Guinea pig  ttaac
                   Chinchilla  tgaac
             Brush-tailed rat  --aac
B D                    Rabbit  ttaac
B D                      Pika  ttaac
B D                       Pig  ttaac
B D                    Alpaca  ttaac
               Bactrian camel  ttaac
B D                   Dolphin  ttaac
                 Killer whale  ttaac
             Tibetan antelope  ttaac
B D                       Cow  ttaac
B D                     Sheep  ttaac
                Domestic goat  ttaac
B D                     Horse  ttaac
B D          White rhinoceros  ttaac
B D                       Cat  ttaac
B D                       Dog  ttaac
B D                   Ferret   ttaac
B D                     Panda  ttaac
               Pacific walrus  ttaac
             Black flying-fox  ttaac
B D                   Megabat  ttaac
                Big brown bat  ttaac
         David's myotis (bat)  ttaac
B D                  Microbat  ttaac
B D                  Hedgehog  ttaac
B D                     Shrew  ttaac
              Star-nosed mole  ttaac
B D                  Elephant  ttaac
          Cape elephant shrew  ttaac
B D                   Manatee  ttaac
             Cape golden mole  tcaac
B D                    Tenrec  ttaac
                     Aardvark  ttaac
B D                 Armadillo  ttaac
B D                   Opossum  ttaac
B D           Tasmanian devil  ttaac
B D                   Wallaby  ttaac
B D                  Platypus  ttacc
  D              Saker falcon  ttgcc
  D          Peregrine falcon  ttgcc
  D       Collared flycatcher  ttgcc
B D                Budgerigar  ttacc
  D             Scarlet macaw  ttacc
  D              Mallard duck  taacc
           Southern platyfish  tgcag
     Mexican tetra (cavefish)  tttaa
                  Spotted gar  ttaa-
B D                    Lizard  =====
                 Zebra mbuna  =====
B D              Nile tilapia  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D             X. tropicalis  =====
B D                 Zebrafish  =====
B D                Coelacanth  -----
  D               Rock pigeon  =====
B D        American alligator  =====
B D                      Fugu  =====
B D                    Medaka  =====
B D                 Tetraodon  =====
B D               Stickleback  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D  Chinese softshell turtle  =====
          Tibetan ground jay  =====
  D                    Parrot  =====
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
B D               Zebra finch  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
                Weddell seal  NNNNN

Alignment block 11 of 764 in window, 94769761 - 94769766, 6 bps 
B D                     Human  cctaca-------
B D                     Chimp  cctaca-------
B D                   Gorilla  cctgca-------
B D                 Orangutan  cctgca-------
B D                    Gibbon  cctgca-------
B D                    Rhesus  cctgca-------
B D       Crab-eating macaque  cctgca-------
B D                    Baboon  cctgca-------
B D              Green monkey  cctgca-------
B D                  Marmoset  cctgca-------
B D           Squirrel monkey  cctgca-------
B D                  Bushbaby  ctggca-------
           Chinese tree shrew  cctgca-------
B D                  Squirrel  cctgca-------
       Lesser Egyptian jerboa  cccatg-------
                 Prairie vole  cctgga-------
B D           Chinese hamster  cctgaa-------
               Golden hamster  cctgaa-------
B D                     Mouse  cctgaa-------
B D                       Rat  cccgaa-------
B D            Naked mole-rat  cctgca-------
B D                Guinea pig  cctgca-------
                   Chinchilla  cctgca-------
             Brush-tailed rat  cctgca-------
B D                    Rabbit  cctgca-------
B D                      Pika  cctgtg-------
B D                       Pig  ccagcg-------
B D                    Alpaca  cctgca-------
               Bactrian camel  cctgca-------
B D                   Dolphin  cctgca-------
                 Killer whale  cctgca-------
             Tibetan antelope  cctgtg-------
B D                       Cow  cttatg-------
B D                     Sheep  cctgtg-------
                Domestic goat  cctgtg-------
B D                     Horse  cctgca-------
B D          White rhinoceros  cctgca-------
B D                       Cat  cctgcc-------
B D                       Dog  cctgcc-------
B D                   Ferret   cctact-------
B D                     Panda  cctgcc-------
               Pacific walrus  cctgcc-------
             Black flying-fox  tctgca-------
B D                   Megabat  cctgca-------
                Big brown bat  cctgca-------
         David's myotis (bat)  cctgca-------
B D                  Microbat  cctgca-------
B D                  Hedgehog  cctgca-------
B D                     Shrew  cctgca-------
              Star-nosed mole  cctgtg-------
B D                  Elephant  cctgca-------
          Cape elephant shrew  cctgca-------
B D                   Manatee  cctgcc-------
             Cape golden mole  ctgcca-------
B D                    Tenrec  cccgca-------
                     Aardvark  cctgca-------
B D                 Armadillo  cctgca-------
B D                   Opossum  cccatc-------
B D           Tasmanian devil  cctatc-------
B D                   Wallaby  tctatc-------
B D                  Platypus  acaacg-------
  D              Saker falcon  cctaca-------
  D          Peregrine falcon  cctaca-------
  D       Collared flycatcher  tctaca-------
B D                Budgerigar  cgttca-------
  D             Scarlet macaw  ctttca-------
  D              Mallard duck  tctgca-------
  D            Painted turtle  cctcta-------
  D  Chinese softshell turtle  cctcta-------
  D    Spiny softshell turtle  cctcta-------
B D                Coelacanth  --tata-------
           Southern platyfish  -caacaatatgct
     Mexican tetra (cavefish)  -agtcaaattatt
                  Spotted gar  ---------tata
B D                    Lizard  =============
                 Zebra mbuna  =============
B D              Nile tilapia  =============
         Pundamilia nyererei  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D             X. tropicalis  =============
B D                 Zebrafish  =============
  D               Rock pigeon  =============
B D        American alligator  =============
B D                      Fugu  =============
B D                    Medaka  =============
B D                 Tetraodon  =============
B D               Stickleback  =============
B D                    Turkey  =============
B D                   Chicken  =============
          Tibetan ground jay  =============
  D                    Parrot  =============
B D       Medium ground finch  =============
  D    White-throated sparrow  =============
B D               Zebra finch  =============
  D           Green seaturtle  =============
                Weddell seal  NNNNNNNNNNNNN

Inserts between block 11 and 12 in window
B D               Coelacanth 2bp

Alignment block 12 of 764 in window, 94769767 - 94769777, 11 bps 
B D                     Human  ------gtat------ag----gaaaa
B D                     Chimp  ------gtat------ag----gaaaa
B D                   Gorilla  ------gtat------ag----gaaaa
B D                 Orangutan  ------gtat------ag----gaaaa
B D                    Gibbon  ------gtat------ag----gaaaa
B D                    Rhesus  ------gtat------cg----gaaaa
B D       Crab-eating macaque  ------gtat------cg----gaaaa
B D                    Baboon  ------gtat------cg----gaaaa
B D              Green monkey  ------gtat------ag----gaaaa
B D                  Marmoset  ------gtag------ag----gaaaa
B D           Squirrel monkey  ------gtag------ag----gaaaa
B D                  Bushbaby  ------gtag------ag----gaaaa
           Chinese tree shrew  ------gtcg------ag----aaaaa
B D                  Squirrel  ------gtag------ag----gcaac
       Lesser Egyptian jerboa  ------gtca------ag----gaaaa
                 Prairie vole  ------gtag------ag----gcaaa
B D           Chinese hamster  ------gtag------ag----gaaaa
               Golden hamster  ------gtag------ag----gaaaa
B D                     Mouse  ------atag------ag----aaaaa
B D                       Rat  ------atag------ag----aaaaa
B D            Naked mole-rat  ------gtag------ag----gaaaa
B D                Guinea pig  ------gcca------ag----gaaaa
                   Chinchilla  ------gtgg------ag----gaaaa
             Brush-tailed rat  ------gtag------ag----gaaaa
B D                    Rabbit  ------gtac------ag----ggaag
B D                      Pika  ------gtac------ag----ggaaa
B D                       Pig  ------gtag------ag----gaaaa
B D                    Alpaca  ------gtag------ag----gaaaa
               Bactrian camel  ------gtag------ag----gaaaa
B D                   Dolphin  ------gtag------ag----gaaaa
                 Killer whale  ------gtag------ag----gaaaa
             Tibetan antelope  ------gtag------ag----gaaaa
B D                       Cow  ------gtag------ag----gaaaa
B D                     Sheep  ------gtag------ag----gaaaa
                Domestic goat  ------gtag------ag----gaaaa
B D                     Horse  ------gtag------ag----gaaaa
B D          White rhinoceros  ------gtag------ag----gaaaa
B D                       Cat  ------gtag------ag----gaaaa
B D                       Dog  ------gtag------aa----gaaaa
B D                   Ferret   ------gtag------ag----gaaaa
B D                     Panda  ------gtag------ag----gaaaa
               Pacific walrus  ------gtat------ag----gaaaa
             Black flying-fox  ------gtag------ag----gaaaa
B D                   Megabat  ------gtag------ag----gaaaa
                Big brown bat  ------gtcg------cg----gaata
         David's myotis (bat)  ------gtag------cg----gaata
B D                  Microbat  ------gtag------cg----gaaca
B D                  Hedgehog  ------gtag------ga----gaaaa
B D                     Shrew  ------gtag------aa----gaaaa
              Star-nosed mole  ------gtag------aa----gagaa
B D                  Elephant  ------gtag------ag----gaaaa
          Cape elephant shrew  ------ccag------aa----gaaaa
B D                   Manatee  ------gtag------ag----gaaaa
             Cape golden mole  ------atagagaaaaaa----aaaaa
B D                    Tenrec  ------atag------aa----gaaag
                     Aardvark  ------gtag------aa----gaaaa
B D                 Armadillo  ------gtag------aa----gaaaa
B D                   Opossum  ------atat------ta----taacc
B D           Tasmanian devil  ------atat------ta----taacc
B D                   Wallaby  ------acat------ta----taact
B D                  Platypus  ------atgt------ac----aaaaa
  D              Saker falcon  --------at------ag----ctatt
  D          Peregrine falcon  --------at------ag----ctatt
  D       Collared flycatcher  --------ac------ag----ctacc
B D                Budgerigar  --------at------ag----ctatt
  D             Scarlet macaw  --------at------ag----ctatt
  D              Mallard duck  --------ct------aa---------
  D           Green seaturtle  ------gtac------ag----aaaaa
  D            Painted turtle  ------gaac------ag----aaaaa
  D  Chinese softshell turtle  ------gcac------ag----aaaaa
  D    Spiny softshell turtle  ------gtac------ag----aaaaa
B D                Coelacanth  ------atat------aattctga---
           Southern platyfish  gccctggtgt------ca----taa--
     Mexican tetra (cavefish)  gtgc--aaag------ca----aag--
                  Spotted gar  gtca--acgg------aa----aaa--
B D                    Lizard  ===========================
                 Zebra mbuna  ===========================
B D              Nile tilapia  ===========================
         Pundamilia nyererei  ===========================
       Burton's mouthbreeder  ===========================
         Princess of Burundi  ===========================
B D             X. tropicalis  ===========================
B D                 Zebrafish  ===========================
  D               Rock pigeon  ===========================
B D        American alligator  ===========================
B D                      Fugu  ===========================
B D                    Medaka  ===========================
B D                 Tetraodon  ===========================
B D               Stickleback  ===========================
B D                    Turkey  ===========================
B D                   Chicken  ===========================
          Tibetan ground jay  ===========================
  D                    Parrot  ===========================
B D       Medium ground finch  ===========================
  D    White-throated sparrow  ===========================
B D               Zebra finch  ===========================
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 12 and 13 in window
  D             Saker falcon 4bp
  D         Peregrine falcon 4bp
  D      Collared flycatcher 1bp
B D               Budgerigar 6bp
  D            Scarlet macaw 6bp
  D             Mallard duck 9bp

Alignment block 13 of 764 in window, 94769778 - 94769778, 1 bps 
B D                     Human  -c
B D                     Chimp  -c
B D                   Gorilla  -c
B D                 Orangutan  -c
B D                    Gibbon  -c
B D                    Rhesus  -c
B D       Crab-eating macaque  -c
B D                    Baboon  -c
B D              Green monkey  -c
B D                  Marmoset  -c
B D           Squirrel monkey  -c
B D                  Bushbaby  -c
           Chinese tree shrew  -c
B D                  Squirrel  -c
       Lesser Egyptian jerboa  -c
                 Prairie vole  -c
B D           Chinese hamster  -c
               Golden hamster  -c
B D                     Mouse  -c
B D                       Rat  -c
B D                Guinea pig  -t
B D                    Rabbit  -c
B D                      Pika  -c
B D                       Pig  -c
B D                    Alpaca  -c
               Bactrian camel  -c
B D                   Dolphin  -c
                 Killer whale  -c
             Tibetan antelope  -c
B D                       Cow  -c
B D                     Sheep  -c
                Domestic goat  -c
B D                     Horse  -c
B D          White rhinoceros  -c
B D                       Cat  -t
B D                       Dog  -t
B D                   Ferret   -t
B D                     Panda  -t
               Pacific walrus  -c
             Black flying-fox  -c
B D                   Megabat  -c
                Big brown bat  -g
         David's myotis (bat)  -g
B D                  Microbat  -g
B D                  Hedgehog  -c
B D                     Shrew  -c
              Star-nosed mole  -c
B D                  Elephant  -g
          Cape elephant shrew  -g
B D                   Manatee  -g
             Cape golden mole  -a
B D                    Tenrec  -g
                     Aardvark  -g
B D                 Armadillo  -c
B D                   Opossum  -c
B D           Tasmanian devil  -c
B D                   Wallaby  -c
B D                  Platypus  -c
  D              Saker falcon  -c
  D          Peregrine falcon  -c
  D       Collared flycatcher  -c
  D    White-throated sparrow  -c
B D       Medium ground finch  -c
B D               Zebra finch  -c
           Tibetan ground jay  -c
B D                Budgerigar  -c
  D                    Parrot  -c
  D             Scarlet macaw  -c
  D              Mallard duck  -c
B D                   Chicken  -c
B D                    Turkey  -c
B D                Coelacanth  -t
           Southern platyfish  g-
     Mexican tetra (cavefish)  t-
                  Spotted gar  a-
B D                    Lizard  ==
                 Zebra mbuna  ==
B D              Nile tilapia  ==
         Pundamilia nyererei  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D             X. tropicalis  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
B D        American alligator  ==
B D                      Fugu  ==
B D                    Medaka  ==
B D                 Tetraodon  ==
B D               Stickleback  ==
  D    Spiny softshell turtle  --
  D  Chinese softshell turtle  --
  D            Painted turtle  --
  D           Green seaturtle  --
                Weddell seal  NN
            Brush-tailed rat  --
B D            Naked mole-rat  --
                  Chinchilla  --

Inserts between block 13 and 14 in window
          Southern platyfish 27bp
    Mexican tetra (cavefish) 42bp

Alignment block 14 of 764 in window, 94769779 - 94769784, 6 bps 
B D                     Human  c-ccatc---
B D                     Chimp  c-ccatc---
B D                   Gorilla  c-ccatc---
B D                 Orangutan  c-ccatc---
B D                    Gibbon  c-ccatc---
B D                    Rhesus  c-ccatc---
B D       Crab-eating macaque  c-ccatc---
B D                    Baboon  c-ccatc---
B D              Green monkey  c-ctatc---
B D                  Marmoset  c-ccatc---
B D           Squirrel monkey  c-ccatc---
B D                  Bushbaby  t-ctgtc---
           Chinese tree shrew  c-ccatt---
B D                  Squirrel  c-ccatc---
       Lesser Egyptian jerboa  c-caatc---
                 Prairie vole  c-tcatc---
B D           Chinese hamster  c-tcatc---
               Golden hamster  c-tcatc---
B D                     Mouse  c-tcatc---
B D                       Rat  c-tcatc---
B D            Naked mole-rat  ----tcc---
B D                Guinea pig  c-ctatc---
B D                    Rabbit  t-ccatc---
B D                      Pika  t-ccatc---
B D                       Pig  c-ccatc---
B D                    Alpaca  t-ccatc---
               Bactrian camel  c-ccatc---
B D                   Dolphin  c-ccatc---
                 Killer whale  c-ccatc---
             Tibetan antelope  c-ccatt---
B D                       Cow  c-ccatt---
B D                     Sheep  c-ccatt---
                Domestic goat  c-ccatt---
B D                     Horse  c-ccatc---
B D          White rhinoceros  c-ccatc---
B D                       Cat  c-ccatc---
B D                       Dog  c-ccatc---
B D                   Ferret   c-ccatc---
B D                     Panda  c-ccatc---
               Pacific walrus  c-ccatc---
             Black flying-fox  c-ccatc---
B D                   Megabat  c-ccatc---
                Big brown bat  c-ccatc---
         David's myotis (bat)  c-ccgtc---
B D                  Microbat  c-ccgtc---
B D                  Hedgehog  c-ccatt---
B D                     Shrew  c-ccatt---
              Star-nosed mole  c-ccatt---
B D                  Elephant  c-ccatc---
          Cape elephant shrew  c-ccatc---
B D                   Manatee  c-ccatc---
             Cape golden mole  a-ccatc---
B D                    Tenrec  c-ccgtc---
                     Aardvark  t-ccatc---
B D                 Armadillo  c-ccatc---
B D                   Opossum  ctccatg---
B D           Tasmanian devil  t-tcatc---
B D                   Wallaby  c-ccata---
B D                  Platypus  c-ccatc---
  D              Saker falcon  c-cctcc---
  D          Peregrine falcon  c-cctcc---
  D       Collared flycatcher  c-cctcc---
  D    White-throated sparrow  c-ccctc---
B D       Medium ground finch  c-ccccc---
B D               Zebra finch  c-ccacc---
           Tibetan ground jay  c-ccacc---
B D                Budgerigar  c-cctcc---
  D                    Parrot  c-tctcc---
  D             Scarlet macaw  c-tctcc---
  D              Mallard duck  c-cctcc---
B D                   Chicken  c-cctct---
B D                    Turkey  c-cctct---
  D           Green seaturtle  t-cctct---
  D            Painted turtle  t-cctct---
  D  Chinese softshell turtle  t-ccact---
  D    Spiny softshell turtle  t-ccact---
B D                Coelacanth  c-ccttc---
     Mexican tetra (cavefish)  ----ctcaat
                  Spotted gar  ----tcctgt
B D                    Lizard  ==========
          Southern platyfish  ==========
                 Zebra mbuna  ==========
B D              Nile tilapia  ==========
         Pundamilia nyererei  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D             X. tropicalis  ==========
B D                 Zebrafish  ==========
  D               Rock pigeon  ==========
B D        American alligator  ==========
B D                      Fugu  ==========
B D                    Medaka  ==========
B D                 Tetraodon  ==========
B D               Stickleback  ==========
                Weddell seal  NNNNNNNNNN
            Brush-tailed rat  ----------
                  Chinchilla  ----------

Inserts between block 14 and 15 in window
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
  D      Collared flycatcher 1bp
  D   White-throated sparrow 1bp
B D      Medium ground finch 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp
  D          Green seaturtle 10bp
  D           Painted turtle 10bp
  D Chinese softshell turtle 10bp
  D   Spiny softshell turtle 11bp
    Mexican tetra (cavefish) 6bp
                 Spotted gar 17bp

Alignment block 15 of 764 in window, 94769785 - 94769789, 5 bps 
B D                     Human  tactt
B D                     Chimp  tactt
B D                   Gorilla  tactt
B D                 Orangutan  tactt
B D                    Gibbon  tactt
B D                    Rhesus  tactt
B D       Crab-eating macaque  tactt
B D                    Baboon  tactt
B D              Green monkey  tactt
B D                  Marmoset  tactt
B D           Squirrel monkey  tactt
B D                  Bushbaby  tacta
           Chinese tree shrew  tactt
B D                  Squirrel  tactt
       Lesser Egyptian jerboa  tactt
                 Prairie vole  -ccct
B D           Chinese hamster  tcctt
               Golden hamster  tcctt
B D                     Mouse  tcctt
B D                       Rat  tcctt
B D            Naked mole-rat  aactt
B D                Guinea pig  tattt
B D                    Rabbit  tactt
B D                      Pika  tactt
B D                       Pig  tattt
B D                    Alpaca  tactt
               Bactrian camel  tactt
B D                   Dolphin  tactt
                 Killer whale  tactt
             Tibetan antelope  tactt
B D                       Cow  tactt
B D                     Sheep  tactt
                Domestic goat  tactt
B D                     Horse  tactt
B D          White rhinoceros  tactt
B D                       Cat  gactt
B D                       Dog  tactt
B D                   Ferret   tactt
B D                     Panda  tactt
               Pacific walrus  tactt
             Black flying-fox  tactt
B D                   Megabat  tactt
                Big brown bat  tcgtt
         David's myotis (bat)  tagtt
B D                  Microbat  tagtt
B D                  Hedgehog  tactt
B D                     Shrew  tactt
              Star-nosed mole  tgctt
B D                  Elephant  tgc--
          Cape elephant shrew  tactt
B D                   Manatee  tgctt
             Cape golden mole  tac--
B D                    Tenrec  tgc--
                     Aardvark  tactt
B D                 Armadillo  tactt
B D                   Opossum  tttct
B D           Tasmanian devil  ttcct
B D                   Wallaby  ttcct
B D                  Platypus  ttcct
  D              Saker falcon  ---tc
  D          Peregrine falcon  ---tc
  D       Collared flycatcher  ---tc
  D    White-throated sparrow  ---tc
B D       Medium ground finch  ---tc
B D               Zebra finch  ---tg
           Tibetan ground jay  ---cc
B D                Budgerigar  ---tc
  D                    Parrot  ---tt
  D             Scarlet macaw  ---tt
  D              Mallard duck  ---tc
B D                   Chicken  ---tc
B D                    Turkey  ---tc
B D        American alligator  ----t
  D           Green seaturtle  ---tt
  D            Painted turtle  ---tt
  D  Chinese softshell turtle  ---tt
  D    Spiny softshell turtle  ---tt
B D                Coelacanth  -cctt
B D                      Fugu  cacac
           Southern platyfish  catat
     Mexican tetra (cavefish)  taagt
                  Spotted gar  cagaa
B D                    Lizard  =====
                 Zebra mbuna  =====
B D              Nile tilapia  =====
         Pundamilia nyererei  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D             X. tropicalis  =====
B D                 Zebrafish  =====
  D               Rock pigeon  =====
B D                    Medaka  =====
B D                 Tetraodon  =====
B D               Stickleback  =====
                Weddell seal  NNNNN
            Brush-tailed rat  -----
                  Chinchilla  -----

Inserts between block 15 and 16 in window
B D               Coelacanth 2bp

Alignment block 16 of 764 in window, 94769790 - 94769797, 8 bps 
B D                     Human  ttatttta
B D                     Chimp  ttatttta
B D                   Gorilla  ttatttta
B D                 Orangutan  ttattgta
B D                    Gibbon  ttatttta
B D                    Rhesus  ttatttta
B D       Crab-eating macaque  ttatttta
B D                    Baboon  ttatttta
B D              Green monkey  ttatttta
B D                  Marmoset  ttatttta
B D           Squirrel monkey  ttatttta
B D                  Bushbaby  ttatttta
           Chinese tree shrew  ttatttta
B D                  Squirrel  t-----ta
       Lesser Egyptian jerboa  ttatttta
                 Prairie vole  ttattgta
B D           Chinese hamster  ttattgta
               Golden hamster  ttattgta
B D                     Mouse  tcattgta
B D                       Rat  ttattgta
B D            Naked mole-rat  ttatttta
B D                Guinea pig  ttatttta
B D                    Rabbit  ctatttta
B D                      Pika  ctatttta
B D                       Pig  ttatttta
B D                    Alpaca  ttatttta
               Bactrian camel  ttatttta
B D                   Dolphin  ttatttta
                 Killer whale  ttatttta
             Tibetan antelope  ttatttta
B D                       Cow  ttatttta
B D                     Sheep  ttatttta
                Domestic goat  ttatttta
B D                     Horse  tgatttta
B D          White rhinoceros  ttatttta
B D                       Cat  ttatttta
B D                       Dog  ttatttta
B D                   Ferret   ttatttta
B D                     Panda  ttatttta
               Pacific walrus  ttatttta
             Black flying-fox  ttatttta
B D                   Megabat  ttatttta
                Big brown bat  ttatttcc
         David's myotis (bat)  ttatttca
B D                  Microbat  ttatttca
B D                  Hedgehog  ttatttta
B D                     Shrew  tgatttta
              Star-nosed mole  ttatttta
B D                  Elephant  ---tttta
          Cape elephant shrew  ttatttta
B D                   Manatee  ttatttta
             Cape golden mole  ---tttta
B D                    Tenrec  ---ttttc
                     Aardvark  ttatttta
B D                 Armadillo  ttatttta
B D                   Opossum  ttattctc
B D           Tasmanian devil  ttattctc
B D                   Wallaby  ctattctc
B D                  Platypus  ttattccc
  D              Saker falcon  cttttctc
  D          Peregrine falcon  cttttctc
  D       Collared flycatcher  cttttttc
  D    White-throated sparrow  cttttttc
B D       Medium ground finch  cttttttc
B D               Zebra finch  cttttttc
           Tibetan ground jay  ctttttgc
B D                Budgerigar  cttttcac
  D                    Parrot  cttttcac
  D             Scarlet macaw  cttttcgc
  D              Mallard duck  c-------
B D                   Chicken  c-------
B D                    Turkey  c-------
B D        American alligator  attttttc
  D           Green seaturtle  tttttttc
  D            Painted turtle  tttttc--
  D  Chinese softshell turtle  tttttctc
  D    Spiny softshell turtle  tttttctc
B D             X. tropicalis  ttatttca
B D                Coelacanth  ttttttt-
B D                      Fugu  tctccttc
           Southern platyfish  ttatttta
     Mexican tetra (cavefish)  tcaatgaa
                  Spotted gar  ttaatcta
B D                    Lizard  ========
                 Zebra mbuna  ========
B D              Nile tilapia  ========
         Pundamilia nyererei  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D                 Zebrafish  ========
  D               Rock pigeon  ========
B D                    Medaka  ========
B D                 Tetraodon  ========
B D               Stickleback  ========
                Weddell seal  NNNNNNNN
            Brush-tailed rat  --------
                  Chinchilla  --------

Inserts between block 16 and 17 in window
  D             Saker falcon 2bp
  D         Peregrine falcon 2bp
  D      Collared flycatcher 2bp
  D   White-throated sparrow 2bp
B D      Medium ground finch 2bp
B D              Zebra finch 2bp
          Tibetan ground jay 2bp
B D               Budgerigar 2bp
  D                   Parrot 2bp
  D            Scarlet macaw 2bp
B D       American alligator 4bp

Alignment block 17 of 764 in window, 94769798 - 94769803, 6 bps 
B D                     Human  tt------tcct----
B D                     Chimp  tt------tcct----
B D                   Gorilla  tt------tcct----
B D                 Orangutan  tt------tcct----
B D                    Gibbon  tt------tcct----
B D                    Rhesus  tt------tcct----
B D       Crab-eating macaque  tt------tcct----
B D                    Baboon  tt------tcct----
B D              Green monkey  tt------tcct----
B D                  Marmoset  tt------t-ct----
B D           Squirrel monkey  tt------tcct----
B D                  Bushbaby  tt------tcct----
           Chinese tree shrew  tt------tcct----
B D                  Squirrel  tt------tcct----
       Lesser Egyptian jerboa  tt------tcct----
                 Prairie vole  tt------tccg----
B D           Chinese hamster  tt------ttct----
               Golden hamster  tt------tcct----
B D                     Mouse  tt------tcct----
B D                       Rat  tt------tctt----
B D            Naked mole-rat  tt------tcct----
B D                Guinea pig  tt------tcct----
                   Chinchilla  --------gtct----
             Brush-tailed rat  --------ccct----
B D                    Rabbit  tt------tcct----
B D                      Pika  tt------acct----
B D                       Pig  tt------tcct----
B D                    Alpaca  tt------tcct----
               Bactrian camel  tt------tcct----
B D                   Dolphin  tt------tcct----
                 Killer whale  tt------tcct----
             Tibetan antelope  tt------tcct----
B D                       Cow  tt------tcct----
B D                     Sheep  tt------tcct----
                Domestic goat  tt------tcct----
B D                     Horse  tt------tcct----
B D          White rhinoceros  tt------tcct----
B D                       Cat  tt------tccc----
B D                       Dog  tt------tccc----
B D                   Ferret   tt------tccc----
B D                     Panda  tt------tccc----
               Pacific walrus  tt------tccc----
             Black flying-fox  tt------tcct----
B D                   Megabat  tt------tcct----
                Big brown bat  gt------tcct----
         David's myotis (bat)  gt------tcct----
B D                  Microbat  gt------tcct----
B D                  Hedgehog  tt------tcct----
B D                     Shrew  tt------tcct----
              Star-nosed mole  tt------tcct----
B D                  Elephant  tt------tcct----
          Cape elephant shrew  tt------tcct----
B D                   Manatee  tt------tcct----
             Cape golden mole  tt------tcct----
B D                    Tenrec  tt------ttct----
                     Aardvark  tt------tctt----
B D                 Armadillo  tt------tcct----
B D                   Opossum  tt------gccc----
B D           Tasmanian devil  tt------gccc----
B D                   Wallaby  tt------gccc----
B D                  Platypus  ttc-----tcct----
  D           Green seaturtle  ---------cat----
  D            Painted turtle  -----------t----
  D  Chinese softshell turtle  ---------cat----
  D    Spiny softshell turtle  ---------cat----
B D             X. tropicalis  --gtacagccga----
B D                Coelacanth  -t------tggc----
B D                      Fugu  ----------cttctc
           Southern platyfish  ----------tttatt
     Mexican tetra (cavefish)  ----------cttaag
                  Spotted gar  ----------ctgaag
B D                    Lizard  ================
                 Zebra mbuna  ================
B D              Nile tilapia  ================
         Pundamilia nyererei  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D                 Zebrafish  ================
  D               Rock pigeon  ================
B D        American alligator  ================
  D             Scarlet macaw  ================
B D                    Medaka  ================
  D              Mallard duck  ----------------
B D                 Tetraodon  ================
B D               Stickleback  ================
  D       Collared flycatcher  ================
B D                    Turkey  ----------------
B D                   Chicken  ----------------
          Tibetan ground jay  ================
B D                Budgerigar  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
  D                    Parrot  ================
B D       Medium ground finch  ================
  D    White-throated sparrow  ================
B D               Zebra finch  ================
                Weddell seal  NNNNNNNNNNNNNNNN

Inserts between block 17 and 18 in window
B D                     Fugu 6bp
          Southern platyfish 12bp
    Mexican tetra (cavefish) 1bp
                 Spotted gar 15bp

Alignment block 18 of 764 in window, 94769804 - 94769806, 3 bps 
B D                     Human  tgg
B D                     Chimp  tgg
B D                   Gorilla  tgg
B D                 Orangutan  tga
B D                    Gibbon  tgg
B D                    Rhesus  tga
B D       Crab-eating macaque  tga
B D                    Baboon  tga
B D              Green monkey  tga
B D                  Marmoset  tga
B D           Squirrel monkey  tga
B D                  Bushbaby  tga
           Chinese tree shrew  tgc
B D                  Squirrel  tgc
       Lesser Egyptian jerboa  ggc
                 Prairie vole  tgc
B D           Chinese hamster  tgc
               Golden hamster  tgc
B D                     Mouse  tgg
B D                       Rat  tgg
B D            Naked mole-rat  tgc
B D                Guinea pig  tgc
                   Chinchilla  tgc
             Brush-tailed rat  tgc
B D                    Rabbit  ggc
B D                      Pika  ttc
B D                       Pig  agc
B D                    Alpaca  tgc
               Bactrian camel  tgc
B D                   Dolphin  cgc
                 Killer whale  cgc
             Tibetan antelope  cgc
B D                       Cow  cgc
B D                     Sheep  tgc
                Domestic goat  tgc
B D                     Horse  cac
B D          White rhinoceros  tgc
B D                       Cat  tgc
B D                       Dog  tgc
B D                   Ferret   tgc
B D                     Panda  ggc
               Pacific walrus  tgc
             Black flying-fox  tgc
B D                   Megabat  tgc
                Big brown bat  cgc
         David's myotis (bat)  cgc
B D                  Microbat  cgg
B D                  Hedgehog  tgc
B D                     Shrew  tgc
              Star-nosed mole  tgc
B D                  Elephant  tgc
          Cape elephant shrew  tgc
B D                   Manatee  tgc
             Cape golden mole  tgc
B D                    Tenrec  cat
                     Aardvark  tgc
B D                 Armadillo  tgc
B D                   Opossum  tgc
B D           Tasmanian devil  tgc
B D                   Wallaby  tgc
B D                  Platypus  tgc
  D               Rock pigeon  --t
  D              Mallard duck  --t
B D                   Chicken  --t
B D                    Turkey  --t
B D        American alligator  -tt
  D           Green seaturtle  ctt
  D            Painted turtle  ctt
  D  Chinese softshell turtle  ctt
  D    Spiny softshell turtle  ctt
B D             X. tropicalis  aac
B D                Coelacanth  tta
B D                      Fugu  agg
B D                    Medaka  tgg
           Southern platyfish  tgg
     Mexican tetra (cavefish)  tg-
                  Spotted gar  tga
B D                    Lizard  ===
                 Zebra mbuna  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                 Zebrafish  ===
  D             Scarlet macaw  ===
B D                 Tetraodon  ===
B D               Stickleback  ===
  D       Collared flycatcher  ===
          Tibetan ground jay  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D               Zebra finch  ===
                Weddell seal  NNN

Inserts between block 18 and 19 in window
B D                     Fugu 5bp
B D                   Medaka 1bp
          Southern platyfish 9bp

Alignment block 19 of 764 in window, 94769807 - 94769807, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  c
B D                  Squirrel  c
       Lesser Egyptian jerboa  c
                 Prairie vole  c
B D           Chinese hamster  c
               Golden hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  c
B D                Guinea pig  c
                   Chinchilla  c
             Brush-tailed rat  c
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  t
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  t
B D                     Shrew  c
              Star-nosed mole  c
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  a
B D                 Armadillo  c
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  t
B D                  Platypus  c
  D               Rock pigeon  t
  D              Mallard duck  t
B D                   Chicken  t
B D                    Turkey  t
B D        American alligator  c
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
  D    Spiny softshell turtle  t
B D             X. tropicalis  c
B D                Coelacanth  c
B D               Stickleback  c
     Mexican tetra (cavefish)  t
                  Spotted gar  c
B D                    Lizard  =
          Southern platyfish  =
                 Zebra mbuna  =
B D              Nile tilapia  =
         Pundamilia nyererei  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                 Zebrafish  =
B D                      Fugu  =
  D             Scarlet macaw  =
B D                    Medaka  =
B D                 Tetraodon  =
  D       Collared flycatcher  =
          Tibetan ground jay  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D               Zebra finch  =
                Weddell seal  N

Inserts between block 19 and 20 in window
  D              Rock pigeon 7bp
  D             Mallard duck 7bp
B D                  Chicken 7bp
B D                   Turkey 7bp
B D       American alligator 7bp
  D          Green seaturtle 7bp
  D           Painted turtle 7bp
  D Chinese softshell turtle 7bp
  D   Spiny softshell turtle 7bp
                 Spotted gar 1bp

Alignment block 20 of 764 in window, 94769808 - 94769809, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ca
           Chinese tree shrew  ta
B D                  Squirrel  aa
       Lesser Egyptian jerboa  aa
                 Prairie vole  aa
B D           Chinese hamster  aa
               Golden hamster  aa
B D                     Mouse  ag
B D                       Rat  ac
B D            Naked mole-rat  aa
B D                Guinea pig  aa
                   Chinchilla  aa
             Brush-tailed rat  aa
B D                    Rabbit  ca
B D                      Pika  ca
B D                       Pig  ca
B D                    Alpaca  ca
               Bactrian camel  ca
B D                   Dolphin  ca
                 Killer whale  ca
             Tibetan antelope  ta
B D                       Cow  ca
B D                     Sheep  ta
                Domestic goat  ta
B D                       Cat  ca
B D                       Dog  tg
B D                   Ferret   ca
B D                     Panda  ca
               Pacific walrus  ca
             Black flying-fox  ca
B D                   Megabat  ca
                Big brown bat  ca
         David's myotis (bat)  ca
B D                  Microbat  ca
B D                  Hedgehog  ca
B D                     Shrew  ca
              Star-nosed mole  ca
B D                  Elephant  ca
          Cape elephant shrew  ca
B D                   Manatee  gg
             Cape golden mole  ca
B D                    Tenrec  ca
                     Aardvark  ca
B D                 Armadillo  ca
B D                   Opossum  ga
B D           Tasmanian devil  ga
B D                   Wallaby  ga
B D                  Platypus  tg
  D               Rock pigeon  tg
  D              Saker falcon  tg
  D          Peregrine falcon  tg
  D       Collared flycatcher  tg
  D    White-throated sparrow  tg
B D       Medium ground finch  tg
B D               Zebra finch  tg
           Tibetan ground jay  tg
B D                Budgerigar  tg
  D                    Parrot  tg
  D             Scarlet macaw  tg
  D              Mallard duck  tg
B D                   Chicken  tg
B D                    Turkey  tg
B D        American alligator  tg
  D           Green seaturtle  tg
  D            Painted turtle  tg
  D  Chinese softshell turtle  tg
  D    Spiny softshell turtle  tg
B D             X. tropicalis  tg
B D                Coelacanth  ca
B D                      Fugu  ga
B D              Nile tilapia  ga
          Princess of Burundi  ga
        Burton's mouthbreeder  ga
                  Zebra mbuna  ga
          Pundamilia nyererei  ga
B D                    Medaka  ta
           Southern platyfish  ca
B D               Stickleback  ga
     Mexican tetra (cavefish)  ga
                  Spotted gar  g-
B D                    Lizard  ==
B D                 Zebrafish  ==
B D                 Tetraodon  ==
                Weddell seal  NN
B D          White rhinoceros  --
B D                     Horse  --

Inserts between block 20 and 21 in window
    Mexican tetra (cavefish) 29bp

Alignment block 21 of 764 in window, 94769810 - 94769844, 35 bps 
B D                     Human  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D                     Chimp  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D                   Gorilla  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D                 Orangutan  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D                    Gibbon  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D                    Rhesus  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D       Crab-eating macaque  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D                    Baboon  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D              Green monkey  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D                  Marmoset  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D           Squirrel monkey  g--tataaat------aatt-gaagt-gtgt----------ttta----atcatatttt
B D                  Bushbaby  g--tataaat------aatt-aaagt-ggat----------ttta----atcatatttt
           Chinese tree shrew  g--tataaat------aatt-gaaat-gggt----------ttta----atcagatttt
B D                  Squirrel  a--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
       Lesser Egyptian jerboa  g--tataaat------aatt-gaaat-aagt----------ttta----atcaaattta
                 Prairie vole  g--tataaat------aatt-gaggc-aggt----------ttta----ataatatttt
B D           Chinese hamster  g--tataaat------aatt-gagat-aggt----------ttta----atcatatttt
               Golden hamster  g--tataaat------aatt-gagat-aggt----------ttta----atcatctttt
B D                     Mouse  a--tataaat------aatt-gaaat-aggt----------tttg----atcatatttt
B D                       Rat  g--tataaat------aatt-gaaat-aggt----------tttg----atcatatttt
B D            Naked mole-rat  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatgtt
B D                Guinea pig  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatgtt
                   Chinchilla  a--tataaat------aatt-gaaat-gggt----------ttta----atcatat-tt
             Brush-tailed rat  g--tataaat------aatt-gaaat-gg------------ttta----atcatacgtt
B D                    Rabbit  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttc
B D                      Pika  c--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                       Pig  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                    Alpaca  g--gataaat------aatt-gaaac-gggt----------ttta----atcatatttt
               Bactrian camel  g--gataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                   Dolphin  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttg
                 Killer whale  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttg
             Tibetan antelope  c--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                       Cow  c--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                     Sheep  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
                Domestic goat  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                     Horse  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D          White rhinoceros  a--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                       Cat  g--tataaat------aatt-gaaat-gggc----------tgta----atcatatttt
B D                       Dog  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                   Ferret   g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                     Panda  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
               Pacific walrus  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
             Black flying-fox  gtatataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                   Megabat  gtatataaat------aatt-gaaat-gggt----------ttta----atcatatttt
                Big brown bat  g--catacat------aatt-gaaat-gggt----------ttta----atcatatttt
         David's myotis (bat)  g--cgtaaat------aatt-gaaatggggt----------ttta----atcatatttt
B D                  Microbat  g--cataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                  Hedgehog  g--tatgaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                     Shrew  g--tatgaat------aatt-gaaac-ggga----------ttta----atcatatttt
              Star-nosed mole  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                  Elephant  g--tataaat------aatt-gaaac-aggt----------ttta----atcatatttt
          Cape elephant shrew  g--tataaat------aatt-gaaat-catt----------ttta----atcatatttt
B D                   Manatee  g--tataaat------aatt-gaaat-aggt----------ttta----atcatatttt
             Cape golden mole  g--tataaat------aatt-gaaat-ggat----------ttta----atcatatttc
B D                    Tenrec  g--ggtaagt------aatt-gaaat-ggat----------ttta----atcatatttg
                     Aardvark  a--tataaat------aatt-gaaat-gaat----------ttta----atcatatttt
B D                 Armadillo  g--tataaat------aatt-gaaat-gggt----------ttta----atcatatttt
B D                   Opossum  g--cataaat------aatg-gaaat-gggt----------ttta----atcacatttt
B D           Tasmanian devil  g--cataaat------aatt-gaaat-ggat----------ttta----atcacatttt
B D                   Wallaby  t--cataaat------aatt-aaaat-ggat----------ttta----atcacatttt
B D                  Platypus  g--cataaat------aatt-gaaat-gggt----------ttta----atcacatttt
  D               Rock pigeon  g--tataaat------aaat-gaaaa-gtgt----------ccta----atcatatttt
  D              Saker falcon  g--tataaat------aaat-gaaag-gtgt----------ccta----ataatatttt
  D          Peregrine falcon  g--tataaat------aaat-gaaag-gtgt----------ccta----ataatatttt
  D       Collared flycatcher  t--tataaat------aaat-gaaag-gtat----------ccta----atcatatttt
  D    White-throated sparrow  t--tataaat------aagt-gaaag-gtat----------ccta----atcatatttt
B D       Medium ground finch  t--tataaat------aagt-gaaag-gtat----------ccta----atcatatttt
B D               Zebra finch  t--tataaat------aagt-gaaag-gtat----------ccta----atcatatttt
           Tibetan ground jay  t--tataaat------aaat-gaaag-gtac----------ccta----atcatatttt
B D                Budgerigar  g--tataaat------aaat-gaaaa-gtgt----------ccta----atcatatttt
  D                    Parrot  g--tataaat------aaat-gaaaa-gtgt----------ccta----atcatatttt
  D             Scarlet macaw  g--tataaat------aaat-gaaaa-gtgt----------ccta----atcatatttt
  D              Mallard duck  a--tataaat------aaat-gaaag-gtgt----------ccaa----atcatatttt
B D                   Chicken  g--tataaat------aaat-gaaag-gtgt----------ccta----atcatatttt
B D                    Turkey  g--tataaat------aaat-gaaag-gtgt----------ccta----atcatatttt
B D        American alligator  a--cataaat------aaat-gaaat-gttt----------ttta----atcatatttt
  D           Green seaturtle  g--aataaa----------t-gaaat-gtgt----------ttta----atcacatttt
  D            Painted turtle  g--cataaa----------t-gaaat-gtgt----------ttta----atcacatttt
  D  Chinese softshell turtle  g--cagaaa----------t-gaaat-gtgt----------ttta----atcacatttt
  D    Spiny softshell turtle  g--cagaaa----------t-gaaat-gtgt----------ttta----atcacatttt
B D             X. tropicalis  a--aataaat------attt-caa-t-atat----------tgga----attgcgctta
B D                Coelacanth  g--cataaat------aatt-taaat-gtgt----------ttta----atcacatttc
B D                      Fugu  a--aattgat------gtcttgaact-caga----------ttta----atcacatttc
B D              Nile tilapia  a--aatgaat------ggtttgaaca-agat----------ttta----atcacatttc
          Princess of Burundi  a--aatgaat------ggtttgaaca-agat----------ttta----atcacatttc
        Burton's mouthbreeder  a--aatgaat------ggtttgaaca-agat----------ttta----atcacatttc
                  Zebra mbuna  a--aatgaat------ggtttgaaca-agat----------ttta----atcacatttc
          Pundamilia nyererei  a--aatgaat------ggtttgaaca-agat----------ttta----atcacatttc
B D                    Medaka  a--aatcata------gatttaaatt-tgat----------ttta----attacatttc
           Southern platyfish  a--aatgaat------gatttgaatt-ttat----------ttta----attacatatc
B D               Stickleback  a--aacgaac------ggttcgaact-aggc----------tgca----atcgcaattc
B D                 Zebrafish  g--aatgaat------aattcagctt-atgc----------tata----atcacatctc
     Mexican tetra (cavefish)  a--aatgatttaagtaaattcagctt-atccaggcctgcagtgtagcgtataacatttc
                  Spotted gar  a--aatgaat------catttaattt-aggt----------ttta----atcacatccc
B D                    Lizard  ===========================================================
B D                 Tetraodon  ===========================================================
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 21 and 22 in window
  D              Rock pigeon 11bp
  D             Saker falcon 11bp
  D         Peregrine falcon 11bp
  D      Collared flycatcher 11bp
  D   White-throated sparrow 11bp
B D      Medium ground finch 11bp
B D              Zebra finch 11bp
          Tibetan ground jay 11bp
B D               Budgerigar 11bp
  D                   Parrot 11bp
  D            Scarlet macaw 11bp
  D             Mallard duck 11bp
B D                  Chicken 11bp
B D                   Turkey 11bp
B D       American alligator 11bp
  D          Green seaturtle 13bp
  D           Painted turtle 34bp
  D Chinese softshell turtle 12bp
  D   Spiny softshell turtle 35bp

Alignment block 22 of 764 in window, 94769845 - 94769855, 11 bps 
B D                     Human  t------------tg----g---------gg-----------aaaag---------------------
B D                     Chimp  t------------gg----g---------gg-----g-----aaaag---------------------
B D                   Gorilla  t------------tg----g---------gg-----g-----aaaag---------------------
B D                 Orangutan  t------------tt----g---------gg-----ga----aaaag---------------------
B D                    Gibbon  t------------gg----g---------gg-----g-----aaaag---------------------
B D                    Rhesus  t------------tt----g---------gg-----g-----ggaa----------------------
B D       Crab-eating macaque  t------------tg----g---------gg-----g-----ggaa----------------------
B D                    Baboon  t------------tg----g---------gg-----g-----gaaa----------------------
B D              Green monkey  t------------tg----g---------gg-----g-----aaaa----------------------
B D                  Marmoset  t------------gg----g---------gg-----g-----aaaac---------------------
B D           Squirrel monkey  g------------gg----g---------gg-----g-----aaaac---------------------
B D                  Bushbaby  a------------gg----g---------gg-----a-----aaag----------------------
           Chinese tree shrew  --------------a----g---------aa-----a-----aaag----------------------
B D                  Squirrel  a------------gg----g---------aa-----a-----aaacc---------------------
       Lesser Egyptian jerboa  a------------aa----a----------------------agaaa---------------------
                 Prairie vole  a------------ga----gg--------gg-----a-----aaaaa---------------------
B D           Chinese hamster  a------------ga----g---------aa-----a-----aaaaa---------------------
               Golden hamster  a------------ga----g----------t-----a-----aaaaa---------------------
B D                     Mouse  a------------ga----g---------g------------aaaaa---------------------
B D                       Rat  a------------gg----g---------gg-----a-----aaaaa---------------------
B D            Naked mole-rat  a------------gg----a---------aa-----a-----aa------------------------
B D                Guinea pig  t------------ag----g---------aa-----a-----aaa-----------------------
                   Chinchilla  a------------gg----a---------aa-----a-----aaaaa---------------------
             Brush-tailed rat  a------------gg----g---------aa-----a-----aaaaa---------------------
B D                    Rabbit  a------------ga----g---------aa-----a-----aaa-----------------------
B D                      Pika  a------------g-----g---------aa-----a-----aaa-----------------------
B D                       Pig  a------------gg----a---------aa-----a-----aaaa----------------------
B D                    Alpaca  a------------gc----g---------aa-----a-----aaaa----------------------
               Bactrian camel  a------------gg----g---------aa-----a-----aaaa----------------------
B D                   Dolphin  a------------gg----g---------ga-----a-----aaaa----------------------
                 Killer whale  a------------gg----g---------gg-----a-----aaaa----------------------
             Tibetan antelope  a------------gg----a---------aa-----a-----aaaa----------------------
B D                       Cow  a------------gg----g---------ga-----a-----aaaa----------------------
B D                     Sheep  a------------gg----g---------aa-----a-----aaaa----------------------
                Domestic goat  a------------gg----a---------aa-----a-----aaaa----------------------
B D                     Horse  a------------gg----g---------g-------------gaa----------------------
B D          White rhinoceros  a------------gg----a---------a-------------aaa----------------------
B D                       Cat  a------------gg----g---------a-------------aaa----------------------
B D                       Dog  a------------gg----g---------g-------------aaa----------------------
B D                   Ferret   g------------gg----g---------g------a-----aaaa----------------------
B D                     Panda  a------------gg----a---------a------a-----aaaa----------------------
               Pacific walrus  a------------gg----a---------a------a-----aaaa----------------------
             Black flying-fox  a------------gg---------------------a-----aaaa----------------------
B D                   Megabat  a------------gg----a---------aa-----a-----aaaa----------------------
                Big brown bat  a----tggggg-ggg----g---------gt-----g-----tgga----------------------
         David's myotis (bat)  a---gtgggggttgg----g---------gg-----g-----tgg-----------------------
B D                  Microbat  aggggtgggggtggg----g---------gg-----g-----cgga----------------------
B D                  Hedgehog  g------------gg----a---------aa-----a-----aaaa----------------------
B D                     Shrew  g------------gg----g---------ggggcacg-----gaaa----------------------
              Star-nosed mole  g------------gg----g---------ag-----a-----aaaa----------------------
B D                  Elephant  a------------gg----g---------ga-----a-----aaaa----------------------
          Cape elephant shrew  a------------gg----g---------gg-----a-----aaaa----------------------
B D                   Manatee  a------------gg----a---------aa-----a-----aaaa----------------------
             Cape golden mole  a------------gg----g---------aa-----a-----agaa----------------------
B D                    Tenrec  g------------ga----ggagaataaaaa-----a-----agaa----------------------
                     Aardvark  a------------gg----a---------aa-----a-----aaac----------------------
B D                 Armadillo  a------------gg----a---------aa-----a-----agca----------------------
B D                   Opossum  a------------gg----a---------aa-----a-----aa------------------------
B D           Tasmanian devil  a------------gg-gggg---------aa-----a-----aa------------------------
B D                   Wallaby  a------------ggaaaaa---------aa-----a-----aa------------------------
B D                  Platypus  a------------gc----a---------aa-----a-----a-------------------------
  D               Rock pigeon  a------------ga----g---------t--------------------------------------
  D              Saker falcon  a------------ga----a---------t--------------------------------------
  D          Peregrine falcon  a------------ga----a---------t--------------------------------------
  D       Collared flycatcher  a------------ga----g---------t--------------------------------------
  D    White-throated sparrow  a------------ga----g---------t--------------------------------------
B D       Medium ground finch  a------------ga----g---------t--------------------------------------
B D               Zebra finch  a------------ga----g---------t--------------------------------------
           Tibetan ground jay  a------------ga----g---------t--------------------------------------
B D                Budgerigar  a------------ga----g---------t--------------------------------------
  D                    Parrot  a------------ga----g---------t--------------------------------------
  D             Scarlet macaw  a------------ga----g---------t--------------------------------------
  D              Mallard duck  a------------aa----g---------t--------------------------------------
B D                   Chicken  a------------ga----g---------t--------------------------------------
B D                    Turkey  a------------ga----g---------t--------------------------------------
B D        American alligator  a------------ca----c---------t--------------------------------------
  D           Green seaturtle  a------------aa----t---------g--------------------------------------
  D  Chinese softshell turtle  a------------ca----t---------g--------------------------------------
B D             X. tropicalis  --------------------------------------------aa----------------------
B D                Coelacanth  -------------------------------------agcaaaaaa----------------------
B D                      Fugu  ----------------------------------------------gcga------------------
B D              Nile tilapia  ----------------------------------------------acaat-----------gagcat
          Princess of Burundi  ----------------------------------------------acaat-----------gagcat
        Burton's mouthbreeder  ----------------------------------------------acaat-----------gagcat
                  Zebra mbuna  ----------------------------------------------acaat-----------gagcat
          Pundamilia nyererei  ----------------------------------------------acaat-----------gagcat
B D                    Medaka  ----------------------------------------------a--gt-----------gtgaac
           Southern platyfish  ----------------------------------------------a------------------cat
B D               Stickleback  ----------------------------------------------acggt-----------gaaaat
B D                 Zebrafish  ----------------------------------------------atgacacagatttttaggacat
     Mexican tetra (cavefish)  ----------------------------------------------tttac-------tttaggacat
                  Spotted gar  ----------------------------------------------actaa-----------gagtca
B D                    Lizard  ====================================================================
B D                 Tetraodon  ====================================================================
  D    Spiny softshell turtle  ====================================================================
  D            Painted turtle  ====================================================================
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 22 and 23 in window
B D                   Rhesus 352bp
B D      Crab-eating macaque 2bp
B D                   Baboon 2bp
B D             Green monkey 1bp
B D                 Bushbaby 6bp
          Chinese tree shrew 3bp
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 2bp
                Prairie vole 2bp
B D          Chinese hamster 2bp
              Golden hamster 2bp
B D                    Mouse 2bp
B D                      Rat 2bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 5bp
            Brush-tailed rat 3bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                   Alpaca 5bp
              Bactrian camel 5bp
B D                  Dolphin 1bp
                Killer whale 2bp
B D                      Cow 1bp
B D                    Sheep 2bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 5bp
B D                      Dog 5bp
B D                  Ferret  5bp
B D                    Panda 5bp
              Pacific walrus 5bp
            Black flying-fox 5bp
B D                  Megabat 5bp
               Big brown bat 5bp
        David's myotis (bat) 2bp
B D                 Microbat 2bp
B D                 Elephant 2bp
         Cape elephant shrew 4bp
B D                  Manatee 3bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
                    Aardvark 1bp
  D              Rock pigeon 14bp
  D             Saker falcon 14bp
  D         Peregrine falcon 14bp
  D      Collared flycatcher 14bp
  D   White-throated sparrow 14bp
B D      Medium ground finch 14bp
B D              Zebra finch 14bp
          Tibetan ground jay 14bp
B D               Budgerigar 14bp
  D                   Parrot 14bp
  D            Scarlet macaw 14bp
  D             Mallard duck 14bp
B D                  Chicken 14bp
B D                   Turkey 14bp
B D       American alligator 14bp
  D          Green seaturtle 9bp
  D Chinese softshell turtle 9bp
B D            X. tropicalis 9bp

Alignment block 23 of 764 in window, 94769856 - 94769874, 19 bps 
B D                     Human  caatca---------cct-tgtattag-ag
B D                     Chimp  cgatca---------cgt-tgtattag-ag
B D                   Gorilla  caatca---------cct-tgtattag-ag
B D                 Orangutan  cagtca---------cct-cgtattag-ag
B D                    Gibbon  caatca---------cct-tgtattag-ag
B D                    Rhesus  caatca---------cct-tgtattag-ag
B D       Crab-eating macaque  taatca---------cct-tgtattag-ag
B D                    Baboon  caatca---------cct-tgtattag-ag
B D              Green monkey  caatca---------cct-tgtattag-ag
B D                  Marmoset  caatca---------cct-tgtattag-aa
B D           Squirrel monkey  caatca---------cct-tgtattag-aa
B D                  Bushbaby  caatca---------cct-tatattag-aa
           Chinese tree shrew  caatca---------cct-catattag-aa
B D                  Squirrel  caatca---------cct-tatattag-aa
       Lesser Egyptian jerboa  aaatca---------cct-tatattag-ta
                 Prairie vole  caatca---------cct-catattag-aa
B D           Chinese hamster  caatca---------cct-tatattag-aa
               Golden hamster  caatca---------cct-tatattag-aa
B D                     Mouse  caatca---------cct-tatattag-aa
B D                       Rat  taatca---------cct-tatattag-aa
B D            Naked mole-rat  caatca---------cct-tatattag-aa
B D                Guinea pig  caatca---------cct-tatattaa-aa
                   Chinchilla  caatca---------cct-tatgttag-aa
             Brush-tailed rat  caatca---------cct-tatattag-aa
B D                    Rabbit  caatcg---------tgc-tatattag-aa
B D                      Pika  caatca---------tgt-tgtattag-aa
B D                       Pig  caatca---------cct-tatatgag-aa
B D                    Alpaca  caatca---------cct-tatattag-aa
               Bactrian camel  caatca---------cct-tatattat-aa
B D                   Dolphin  -aatca---------cct-tatatgag-aa
                 Killer whale  caatca---------cct-tatatgag-aa
             Tibetan antelope  caatca---------cct-tatatgag-aa
B D                       Cow  ccatca---------cct-tatatgag-aa
B D                     Sheep  caatca---------cct-tatatgag-aa
                Domestic goat  caatca---------cct-tatatgag-aa
B D                     Horse  -aatca---------cct-tatattag-aa
B D          White rhinoceros  -aatca---------cc--tatattag-aa
B D                       Cat  caatca---------cct-tatattac-aa
B D                       Dog  caatca---------cct-tatattag-aa
B D                   Ferret   caatca---------cct-tacattag-aa
B D                     Panda  caatca---------cct-tatattag-aa
               Pacific walrus  caatca---------cct-tatattag-aa
             Black flying-fox  caatca---------cct-tatattag-aa
B D                   Megabat  caatca---------cct-tatattaa-aa
                Big brown bat  caatcg---------cct-tctattag-aa
         David's myotis (bat)  caatcg---------cct-tctattag-aa
B D                  Microbat  caatcg---------cct-tctattag-aa
B D                  Hedgehog  caatca---------cct-tctattag-aa
B D                     Shrew  taatca---------cct-tatattag-ag
              Star-nosed mole  caatcg---------cct-tatattag-aa
B D                  Elephant  --atca---------cct-tatattag-aa
          Cape elephant shrew  --atca---------cct-tacattag-ga
B D                   Manatee  ccatca---------cct-tatattag-aa
             Cape golden mole  caatca---------cct-tatattag-aa
B D                    Tenrec  caatca---------ccg-cgtatcagaaa
                     Aardvark  --atca---------cct-tatattag-aa
B D                 Armadillo  --atcc---------cct-tatattag-aa
B D                   Opossum  caatcc---------cca-tatattag-aa
B D           Tasmanian devil  caattt---------cca-tgttttag-aa
B D                   Wallaby  caatcc---------ccc-tatattag-aa
B D                  Platypus  caatct---------ctg-tatattaa-aa
  D               Rock pigeon  taatgt---------ctg-tatattag-aa
  D              Saker falcon  taatgt---------ctg-tatattag-aa
  D          Peregrine falcon  taatgt---------ctg-tatattag-aa
  D       Collared flycatcher  taatgt---------ctg-tatattag-aa
  D    White-throated sparrow  taatgt---------ctg-tatatgag-aa
B D       Medium ground finch  taatgt---------ctg-tatattag-aa
B D               Zebra finch  taatgt---------ctg-tatattag-aa
           Tibetan ground jay  taatgt---------ctg-tatattag-aa
B D                Budgerigar  taatgc---------ctg-tatattag-aa
  D                    Parrot  taatgc---------ctg-tatattag-aa
  D             Scarlet macaw  taatgc---------ctg-tatattag-aa
  D              Mallard duck  taatgt---------ctc-tatattcg-aa
B D                   Chicken  taatgt---------ctc-tgtattag-aa
B D                    Turkey  taatgt---------ctc-tgtattag-aa
B D        American alligator  taatct---------gtg-tatattag-aa
  D           Green seaturtle  taatct---------c--------------
  D  Chinese softshell turtle  taa---------------------------
B D             X. tropicalis  tagtca---------ctt-ctcaacag-tc
B D                Coelacanth  caatct---------cgtgtacattaa-aa
B D                      Fugu  ---tct------------------------
B D              Nile tilapia  --ctct---------cac------------
          Princess of Burundi  --ctct---------cac------------
        Burton's mouthbreeder  --ctct---------cac------------
                  Zebra mbuna  --ctct---------cac------------
          Pundamilia nyererei  --ctct---------cac------------
B D                    Medaka  --atct---------cct------------
           Southern platyfish  --atct---------cag------------
B D               Stickleback  --ctct---------cac------------
B D                 Zebrafish  --ctca---------gac------------
     Mexican tetra (cavefish)  ---tca---------atc------------
                  Spotted gar  --gtcttaggcacatcaa------------
B D                    Lizard  ==============================
B D                 Tetraodon  ==============================
  D    Spiny softshell turtle  ==============================
  D            Painted turtle  ==============================
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 24 of 764 in window, 94769875 - 94769875, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D                       Rat  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                       Pig  g
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  c
          Cape elephant shrew  c
B D                   Manatee  c
             Cape golden mole  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  t
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  t
B D                  Platypus  t
  D               Rock pigeon  c
  D              Saker falcon  c
  D          Peregrine falcon  c
  D       Collared flycatcher  c
  D    White-throated sparrow  c
B D       Medium ground finch  c
B D               Zebra finch  c
           Tibetan ground jay  c
B D                Budgerigar  c
  D                    Parrot  c
  D             Scarlet macaw  c
  D              Mallard duck  c
B D                   Chicken  c
B D                    Turkey  c
B D        American alligator  c
  D           Green seaturtle  t
  D            Painted turtle  t
  D  Chinese softshell turtle  t
B D             X. tropicalis  t
B D                Coelacanth  c
B D                    Lizard  =
          Southern platyfish  -
                 Zebra mbuna  -
B D              Nile tilapia  -
         Pundamilia nyererei  -
       Burton's mouthbreeder  -
         Princess of Burundi  -
                 Spotted gar  -
B D                 Zebrafish  -
B D                      Fugu  -
B D                    Medaka  -
    Mexican tetra (cavefish)  -
B D                 Tetraodon  =
B D               Stickleback  -
  D    Spiny softshell turtle  =
                Weddell seal  N

Inserts between block 24 and 25 in window
  D Chinese softshell turtle 4bp
B D            X. tropicalis 2bp

Alignment block 25 of 764 in window, 94769876 - 94769883, 8 bps 
B D                     Human  a---cata------cag
B D                     Chimp  a---cata------cag
B D                   Gorilla  a---cata------cag
B D                 Orangutan  a---cata------cag
B D                    Gibbon  a---cata------cag
B D                    Rhesus  a---cata------cag
B D       Crab-eating macaque  a---cata------cag
B D                    Baboon  a---cata------cag
B D              Green monkey  a---cata------cag
B D                  Marmoset  a---cata------cag
B D           Squirrel monkey  a---cata------cag
B D                  Bushbaby  g---cgta------cag
           Chinese tree shrew  a---cata------caa
B D                  Squirrel  g---cata------caa
       Lesser Egyptian jerboa  a---tgta------cag
                 Prairie vole  a---cata------cag
B D           Chinese hamster  a---cata------cag
               Golden hamster  a---cata------cag
B D                     Mouse  a---cata------cag
B D                       Rat  a---cata------cag
B D            Naked mole-rat  c---caca------caa
B D                Guinea pig  g---aata------caa
                   Chinchilla  g---cata------caa
             Brush-tailed rat  g---cata------caa
B D                    Rabbit  a---cata------caa
B D                      Pika  g---cata------cag
B D                       Pig  g---cata------caa
B D                    Alpaca  g---cata------caa
               Bactrian camel  g---cata------caa
B D                   Dolphin  g---cata------caa
                 Killer whale  g---cata------caa
             Tibetan antelope  g---tata------cag
B D                       Cow  g---tata------cag
B D                     Sheep  g---tata------cag
                Domestic goat  g---tata------cag
B D                     Horse  g---catg------caa
B D          White rhinoceros  g---catg------taa
B D                       Cat  a---cata------caa
B D                       Dog  a---cata------caa
B D                   Ferret   t---cgta------caa
B D                     Panda  a---cata------caa
               Pacific walrus  a---gata------caa
             Black flying-fox  g---cgta------cag
B D                   Megabat  g---cgta------cag
                Big brown bat  g---cata------cag
         David's myotis (bat)  g---cata------cag
B D                  Microbat  g---cata------cag
B D                  Hedgehog  g---cata------caa
B D                     Shrew  g---cata------caa
              Star-nosed mole  g---cata------caa
B D                  Elephant  t---cata------cag
          Cape elephant shrew  a---cata------caa
B D                   Manatee  a---cata------caa
             Cape golden mole  t---cata------caa
B D                    Tenrec  a---tata------gaa
                     Aardvark  a---cata------cag
B D                 Armadillo  a---cgta------caa
B D                   Opossum  a---tgtt------tgg
B D           Tasmanian devil  g---tgtt------caa
B D                   Wallaby  a---tgtt------cag
B D                  Platypus  a---catt------cag
  D               Rock pigeon  a---tgtg------gaa
  D              Saker falcon  a---tgag------gaa
  D          Peregrine falcon  a---tgag------gaa
  D       Collared flycatcher  a---tgtg------gaa
  D    White-throated sparrow  a---tgtg------gaa
B D       Medium ground finch  a---tgtg------gaa
B D               Zebra finch  a---tgtg------gaa
           Tibetan ground jay  a---tgtg------gaa
B D                Budgerigar  a---tgtg------gga
  D                    Parrot  a---tgtg------gga
  D             Scarlet macaw  a---tgtg------gga
  D              Mallard duck  a---tgta------gaa
B D                   Chicken  a---tgag------gaa
B D                    Turkey  a---tgtg------gaa
B D        American alligator  a---catg------gga
  D           Green seaturtle  g---tatg------gaa
  D            Painted turtle  g---tatg------gaa
  D  Chinese softshell turtle  g---tatg------gaa
  D    Spiny softshell turtle  g---tatg------gaa
B D             X. tropicalis  a---tctg------aga
B D                Coelacanth  ----catg------cga
B D              Nile tilapia  a---gaca------cag
          Princess of Burundi  a---gaca------cag
        Burton's mouthbreeder  a---gaca------cag
                  Zebra mbuna  a---gaca------cag
          Pundamilia nyererei  a---gaca------cag
B D                    Medaka  ttcgtatc------ctg
           Southern platyfish  t---gaca------ctg
B D               Stickleback  a---t------------
B D                 Zebrafish  a-------------cag
     Mexican tetra (cavefish)  a---aaagtacctccag
                  Spotted gar  a---aaca------tgg
B D                    Lizard  =================
B D                      Fugu  -----------------
B D                 Tetraodon  =================
                Weddell seal  NNNNNNNNNNNNNNNNN

Inserts between block 25 and 26 in window
B D            X. tropicalis 1bp

Alignment block 26 of 764 in window, 94769884 - 94769884, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -t
           Chinese tree shrew  -t
B D                  Squirrel  -t
       Lesser Egyptian jerboa  -t
                 Prairie vole  -t
B D           Chinese hamster  -t
               Golden hamster  -t
B D                     Mouse  -t
B D                       Rat  -t
B D            Naked mole-rat  -t
B D                Guinea pig  -t
                   Chinchilla  -t
             Brush-tailed rat  -t
B D                    Rabbit  -t
B D                      Pika  -t
B D                       Pig  -t
B D                    Alpaca  -t
               Bactrian camel  -t
B D                   Dolphin  -t
                 Killer whale  -t
             Tibetan antelope  -t
B D                       Cow  -t
B D                     Sheep  -t
                Domestic goat  -t
B D                     Horse  -t
B D          White rhinoceros  -t
B D                       Cat  -t
B D                       Dog  -t
B D                   Ferret   -t
B D                     Panda  -t
               Pacific walrus  -t
             Black flying-fox  -t
B D                   Megabat  -t
                Big brown bat  -t
         David's myotis (bat)  -t
B D                  Microbat  -t
B D                  Hedgehog  -t
B D                     Shrew  -t
              Star-nosed mole  -t
B D                  Elephant  -t
          Cape elephant shrew  -t
B D                   Manatee  -t
             Cape golden mole  -t
B D                    Tenrec  -t
                     Aardvark  -t
B D                 Armadillo  -t
B D                   Opossum  -t
B D           Tasmanian devil  -t
B D                   Wallaby  -t
B D                  Platypus  -t
  D               Rock pigeon  -t
  D              Saker falcon  -t
  D          Peregrine falcon  -t
  D       Collared flycatcher  -t
  D    White-throated sparrow  -t
B D       Medium ground finch  -t
B D               Zebra finch  -t
           Tibetan ground jay  -t
B D                Budgerigar  -t
  D                    Parrot  -t
  D             Scarlet macaw  -t
  D              Mallard duck  -t
B D                   Chicken  -t
B D                    Turkey  -t
B D        American alligator  -t
  D           Green seaturtle  -t
  D            Painted turtle  -t
  D  Chinese softshell turtle  -t
  D    Spiny softshell turtle  -t
B D                    Lizard  -t
B D             X. tropicalis  -t
B D                Coelacanth  -t
B D              Nile tilapia  a-
          Princess of Burundi  a-
        Burton's mouthbreeder  a-
                  Zebra mbuna  a-
          Pundamilia nyererei  a-
B D                    Medaka  g-
           Southern platyfish  g-
B D                 Zebrafish  a-
     Mexican tetra (cavefish)  a-
                  Spotted gar  a-
B D                      Fugu  --
B D                 Tetraodon  ==
B D               Stickleback  --
                Weddell seal  NN

Inserts between block 26 and 27 in window
B D             Nile tilapia 4bp
         Princess of Burundi 4bp
       Burton's mouthbreeder 4bp
                 Zebra mbuna 4bp
         Pundamilia nyererei 4bp
B D                   Medaka 3bp
          Southern platyfish 3bp
B D                Zebrafish 4bp
    Mexican tetra (cavefish) 4bp
                 Spotted gar 2bp

Alignment block 27 of 764 in window, 94769885 - 94770265, 381 bps 
B D                     Human  gacaaatggtgataaatctaaaattta-------------------------tag-------aa-aggga
B D                     Chimp  gacaaatggtgataaatctaaaattta-------------------------tag-------aa-aggga
B D                   Gorilla  gacaaatgctgataaatctaaaattta-------------------------tag-------aa-aggga
B D                 Orangutan  gacaaatggtgataaatctaaaattta-------------------------tag-------aa-aggga
B D                    Gibbon  gacaaatggtgataaatctaaaattta-------------------------tag-------aa-aggga
B D                    Rhesus  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D       Crab-eating macaque  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                    Baboon  gacaaattgagataaatctaaaattta-------------------------tag-------aa-aggga
B D              Green monkey  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                  Marmoset  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D           Squirrel monkey  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                  Bushbaby  gacaaatggagataaatctaaaattta-------------------------tag-------aa-agaga
           Chinese tree shrew  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                  Squirrel  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aagga
       Lesser Egyptian jerboa  gacaaatgtagataaatctaaaattta-------------------------tag-------aa-aagga
                 Prairie vole  gacgaatggagataaatctaaaattta-------------------------tag-------aa-aaggg
B D           Chinese hamster  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aagag
               Golden hamster  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aagag
B D                     Mouse  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aagag
B D                       Rat  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aagag
B D            Naked mole-rat  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aagga
B D                Guinea pig  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aagga
                   Chinchilla  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aagga
             Brush-tailed rat  gacaaatggagacaaatctaaaattta-------------------------tag-------aa-aagga
B D                    Rabbit  gacaaatggagataaatctaaaattta-------------------------tag-------aa-agggg
B D                      Pika  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggag
B D                       Pig  gacaaatggagataaatctaaaattta-------------------------tag-------aa-agaga
B D                    Alpaca  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
               Bactrian camel  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                   Dolphin  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
                 Killer whale  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
             Tibetan antelope  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                       Cow  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                     Sheep  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
                Domestic goat  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                     Horse  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D          White rhinoceros  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                       Cat  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                       Dog  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                   Ferret   gacaaatggagataaatctaaaattta-------------------------tag-------aa-agggg
B D                     Panda  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
               Pacific walrus  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
             Black flying-fox  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                   Megabat  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
                Big brown bat  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
         David's myotis (bat)  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                  Microbat  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                  Hedgehog  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aagga
B D                     Shrew  gacaaatggagataaatctaaaattta-------------------------tag-------aa-agaca
              Star-nosed mole  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                  Elephant  gattaatggagataaatctaaaattta-------------------------tag-------aa-aggga
          Cape elephant shrew  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                   Manatee  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
             Cape golden mole  gacaaatggagataaatctaaaattta-------------------------tag-------aa-acgga
B D                    Tenrec  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
                     Aardvark  gacaaatggagataaatctaaaattta-------------------------tgg-------aa-aggga
B D                 Armadillo  gacaaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                   Opossum  gataaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D           Tasmanian devil  gatgaatggagataaatctaaaattta-------------------------tag-------aa-aggga
B D                   Wallaby  gatgaatggagataaatctaaaattta-------------------------tag-------aa-aggaa
B D                  Platypus  gatgaatggagataaatctaaaattta-------------------------tag-------aacggggg
  D               Rock pigeon  gataaatggaaataaatctaaaattta-------------------------tag-------aa-catga
  D              Saker falcon  gataaatggagataaatctaaaattta-------------------------tag-------aa-cgtga
  D          Peregrine falcon  gataaatggagataaatctaaaattta-------------------------tag-------aa-cgtga
  D       Collared flycatcher  gataaatggagataaatctaaaattta-------------------------tag-------aa-cacga
  D    White-throated sparrow  gataaatggagataaatctaaaattta-------------------------tag-------aa-catga
B D       Medium ground finch  gataaatggagataaatctaaaattta-------------------------tag-------aa-catga
B D               Zebra finch  gataaatggagataaatctaaaattta-------------------------tag-------aa-catga
           Tibetan ground jay  gataaatggagataaatctaaaattta-------------------------tag-------aa-catga
B D                Budgerigar  gataaatggagataaatctaaaattta-------------------------tag-------aa-catga
  D                    Parrot  gataaatggagatgaatctaaaattta-------------------------tag-------aa-catga
  D             Scarlet macaw  gataaatggagataaatctaaaattta-------------------------tag-------aa-catga
  D              Mallard duck  gataaatggagataaatctaaaattta-------------------------tag-------aa-catga
B D                   Chicken  gataaatggagataaatctaaaattta-------------------------tag-------aa-catga
B D                    Turkey  gataaatggagataaatctaaaattta-------------------------tag-------aa-catga
B D        American alligator  gatgaatggagataaatctaaaattta-------------------------tag-------aa-catga
  D           Green seaturtle  gatgaatggagctaaatctaaaattta-------------------------tag-------aa-catga
  D            Painted turtle  gatgaatggagataaatctaaaattta-------------------------tag-------aa-catga
  D  Chinese softshell turtle  gatgaatggagataaatctaaaattta-------------------------tag-------aa-catga
  D    Spiny softshell turtle  gatgaatggagataaatctaaaattta-------------------------tag-------aa-catga
B D                    Lizard  gatgaatggagaggaatctaaaatgta-------------------------taa-------aa-ttgat
B D             X. tropicalis  gataaattgggatgaatctaaaattta-------------------------tag-------aa-tgcca
B D                Coelacanth  gatggatggagataaatctaaaattta-------------------------tag-------aa-cgggg
B D                 Tetraodon  gatgaatagagataaatttaaaattta-------------------------tag-------aa-atcca
B D                      Fugu  gatgaatagagataaatctaaaattta-------------------------tag-------aa-ttcca
B D              Nile tilapia  gatgaatagagacaaatctaaaattta-------------------------tag-------aa-ttcta
          Princess of Burundi  gatgaatagagacaaatctaaaattta-------------------------tag-------aa-ttcta
        Burton's mouthbreeder  gatgaatagagacaaatctaaaattta-------------------------tag-------aa-ttcta
                  Zebra mbuna  gatgaatagagacaaatctaaaattta-------------------------tag-------aa-ttcta
          Pundamilia nyererei  gatgaatagacacaaatctaaaattta-------------------------tag-------aa-ttcta
B D                    Medaka  gatgaattgagacaaatctaaaattta-------------------------tag-------aa-tttta
           Southern platyfish  gataaatagtgacaaatctaaaattta-------------------------tag-------aa-tttta
B D               Stickleback  gacgaatacagacaaatctaaaattta-------------------------tag-------aa-tccta
B D                 Zebrafish  gatggatgagggaaaatctaaaattta-------------------------tgg-------aa-ttaga
     Mexican tetra (cavefish)  aatgaataatt--aaatttaaggtttaatcacatctcgccacagagacactttgggcacctcaa-acaga
                  Spotted gar  gatggattgagacaaatctaaaattta-------------------------tag-------aa-ttaga
                Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  gcatttg-cat-aaactgcagaatccaaacaca------tagaacattaagagtaacaattgt--tgaaa
                        Chimp  gcatttg-cat-aaactgcagaatccaaacaca------tagaacattaagagtaacaatggt--tgaaa
                      Gorilla  gcatttg-cat-aaactgcagaatccaaacaca------tagaacattaagagtaaaaattgt--tgaga
                    Orangutan  gaatttg-cat-aaactgcagaatccaaacaca------tagaacattaagagtaacaattgt--tgcaa
                       Gibbon  gcattta-cat-aaactgcagaatccaaacaca------tagaacattaagagtaacaattgt--tgcaa
                       Rhesus  gcatttg-cat-aaactgcagaatccaaacaca------taggacattaagagtaacaattgt--tgcaa
          Crab-eating macaque  gcatttg-cat-aaactgcagaatccaaacaca------taggacattaagagtaacaattgt--tgcaa
                       Baboon  gcatttg-cat-aaactgcagaatccaaacaca------taggacattaagagtaacaattgt--tgcaa
                 Green monkey  gcatttg-cat-aaactgcggaatccaaacaca------taggacattaagagtaacaattgt--tacaa
                     Marmoset  gcatttg-cat-aaactgcagaatccaaacaca------tagaat-ttaagagtaacaatttt--tgcaa
              Squirrel monkey  gcatttg-cat-aaactgcagaatccaaacaca------tagaacattaagagtaacaattgt--tgcaa
                     Bushbaby  gcatttg-cat-aaactgcagaatccaaacaga------gagagcattaagagtaacaattgt--tgcaa
           Chinese tree shrew  acatttg-cat-aaactgcagaatccaaacata------tagaacattaagagtaacaattgt--tgtaa
                     Squirrel  gcatttg-cat-aaactgcagaatccaaactta------tagagcattaagagtaacaattgt--tgcaa
       Lesser Egyptian jerboa  tcatttg-cat-aa-ctgcagaatccaaactta------tagagtattaagagtaacaattgt--tgtaa
                 Prairie vole  gcatttg-cat-aagctgcaaaatccaaactta------tagggcattaagagtaacaattgt--tgcaa
              Chinese hamster  acatttg-cat-aagctgcaaaatccaaactta------tagggcattaagagtaacaattgt--tgcaa
               Golden hamster  acatttg-cat-atgctgcaaaatccaaactta------tagggcattaagagtaacaattgt--tgcaa
                        Mouse  acatttg-cat-aagctgcaaaatccaaactta------tagggcattaagagtaacaattgt--tgcaa
                          Rat  acatttg-cat-aagctgcaaaatccaaactta------tagggcattaagagtaacaattgt--tgcaa
               Naked mole-rat  acatttg-cat-aaactgcagaatccaaactta------tggagcattaagagtaacaattgt--tgcaa
                   Guinea pig  gcatttg-cat-aaactgcagaatgcaaactta------tggagtattaagagtaacaattgt--tgtaa
                   Chinchilla  acatttg-cat-aaactgtagaatccaaactta------tggggcattaagagtaacaattgt--tgcaa
             Brush-tailed rat  acatttg-cat-aaactgtagaatccaaactta------tggagcattaagagtaacaattgt--tgcaa
                       Rabbit  gcatttg-cat-aaactgcagaatctaaacata------cacaacattgaaaatggcaaatgt--ggtaa
                         Pika  gcatttg-cat-aaactgcagaatctaaacata------tagagtagtgagaacagcagttgt--ggcaa
                          Pig  gcatttg-cat-aaactgcagaatccaaacata------tagggtattaagagtaacaattgt--tgcaa
                       Alpaca  gcatttg-cat-aaactgcagaatccaaacata------tagggcattaagagtaacaattgt--tgcaa
               Bactrian camel  gcatttg-cat-aaactgcagaatccaaacata------tagggcattaagagtaacaattgt--tgcaa
                      Dolphin  gcatttg-cat--aactgcagaatctaaacata------tagggcattaagagtaacaattat--tgcaa
                 Killer whale  gcatttg-cat--aactgcagaatccaaacata------tagggcattaagagtaacaattat--tgcaa
             Tibetan antelope  gcatttg-cat-aaactgcagaatccaaacata------tagaacattaagagtaacaattgt--tgcaa
                          Cow  gcatttg-cat-aaactgcagaatccaaacata------taggacattaagagtaacaattgt--tgcaa
                        Sheep  gcatttg-cat-aaactgcagaatccaaacata------taggacattaagagtaacaattgt--tgcag
                Domestic goat  gcatttg-cat-aaactgcagaatccaaacata------taggacattaagagtaacaattgt--tgcag
                        Horse  gcatttg-cat-aaactacagaatccaaacata------tagagtatcaagagtaacaattgt--tgcaa
             White rhinoceros  gcatttg-cat-aaactgcagaatccaaacata------tagggcattaagagtaacaattgt--tgcaa
                          Cat  acatttg-cat-aaactgcggaatccaaacata------tagggcattaagagtaacaattgt--tgcaa
                          Dog  gtatttg-cat-aaactgcagaatccaaacata------tagggcagtaagagtaacaattgt--tgcaa
                      Ferret   gcatttg-cat-aaactgcagaatccaaacata------taggacattaagagtaacaattgt--tggaa
                        Panda  gcatttg-cat--aactgcagaatccaaacata------tagggcattaagagtaacaattgt--tgcaa
               Pacific walrus  gcatttg-cat-aaactgcagaacccaaacata------tagggcattaagagtaacaattgt--tgcaa
             Black flying-fox  gcatttg-cat-aaactgcagaatccaaacata------taggacattaagaataacaattgt--tgcaa
                      Megabat  gcatttg-cat-aaactgcagaatccaaacata------taggacattaagaataacaattgt--tgcaa
                Big brown bat  gcatttg-cat-aaactgcagaatccaaacata------taggacatggagagtcacagttgt--tgcaa
         David's myotis (bat)  gcatttg-cat-aaactgcagaatccaaacata------taggacattaagagccacaattgt--tgcaa
                     Microbat  gcatttg-cat-aaactgcagaatccaaacata------taggaccttaagagtcacaattgt--tgcaa
                     Hedgehog  taatttg-cat-aaacggcagaatccaaacata------tagggtattaagagtaacaattgt--tgcaa
                        Shrew  gcatttg-cat-aaaccgcggaattcaa----a------cagagtgctcagcggaacaactgt--tgcaa
              Star-nosed mole  gcatttg-cat-aaactacagaacccaaacaca------cagagtattaagagcaacacttgt--ggtga
                     Elephant  acatttg-cat-aaactgcagaatccaaacata------tagaatgttaagagtaacaattgt--tgcaa
          Cape elephant shrew  gcatttg-cat-aaactgcagaatccaaacatg------cagagtattaagagtaacaattgt--tgcaa
                      Manatee  gcatttg-cat-aaactgcagaatccaaacata------tagagcattaagagtaacaatcgt--tgtaa
             Cape golden mole  acatttg-cat-aaactgcagaatcgaaatgta------tggggcaataagagtaacaattgt--tgcaa
                       Tenrec  gcatttg-cat-aaactgtagaatccaaacaca------tagtgcaggaaaagtagcaattgt--tgcaa
                     Aardvark  gcatttg-cat-aaactgcagaatccaaacata------cagaacattaacagtaacaattgt--tgcaa
                    Armadillo  gcatttg-cat-aaactgcaggatccaaacata------tagagcaataagagtaacaattgt--tgcaa
                      Opossum  gcatttg-cat-aaactgcaatagccaaatgta------tagcacattaag--taacaattgt--tgcag
              Tasmanian devil  aaatttg-cat-aaactgcaatagctaaatgta------tagcatattaag--caacaattgt--tgcaa
                      Wallaby  gcatttg-cat-aaactgcagtagctaaatgta------tagcacattaag--caacaattgt--tgcaa
                     Platypus  gcatttg-cat-aaactgcaatatccaaacata------tagggcattaag--taacgattgt--tgcaa
                  Rock pigeon  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cacaa
                 Saker falcon  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cacaa
             Peregrine falcon  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cacaa
          Collared flycatcher  acatttg-cat-aaactgcaatatccaaacaca------taggctgttaag--taacaattgt--cacaa
       White-throated sparrow  acatttg-cat-aaactgcaatatccaaacaca------taggctgttaag--taacaattgt--cacaa
          Medium ground finch  atatttg-cat-aaactgcaatatccaaacaca------taggctgttaag--taacaattgt--cacaa
                  Zebra finch  acatttg-cat-aaactgcaatatccaaacaca------taggctgttaag--taacaattgt--cacaa
           Tibetan ground jay  acatttg-cat-aaactgcaatatccaaacaca------taggctgttaag--taacaattgt--cacaa
                   Budgerigar  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cacaa
                       Parrot  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cacaa
                Scarlet macaw  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cacaa
                 Mallard duck  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cacaa
                      Chicken  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cacaa
                       Turkey  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cacaa
           American alligator  acatttg-cat-aaactgcaatatccaaacata------taggccgttaag--taacaattgtcacacaa
              Green seaturtle  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cataa
               Painted turtle  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cagaa
     Chinese softshell turtle  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cagaa
       Spiny softshell turtle  acatttg-cat-aaactgcaatatccaaacata------taggctgttaag--taacaattgt--cagaa
                       Lizard  gcatttg-cat-caaatgtaatatgggaatgtattattttattttctaaag--tagttattgt--c----
                X. tropicalis  taattta-cat-aaactgtaatctgcaaacata------tagaatattaaa--------tagg--aacag
                   Coelacanth  gcatttg-cat-aaactgtaatatctaaacata------cagggcattaag--taa-aagtgt--cagaa
                    Tetraodon  gaatttg-c---tgagtgaattatctaaacaca------tcag---cgga--gtaagcg-tgc--tgaga
                         Fugu  gaatttg-cgttggggcacattatctaaacata------tcag---tga---------g-cgc--cgagg
                 Nile tilapia  caatttg-cat-aaagtgtattatctaaacata------taag---tgaaaggtaaggg-tgt--tgaaa
          Princess of Burundi  caatttg-cat-aaagtgtattatctaaacata------taag---tgaaaggtaaggg-tgt--tgaaa
        Burton's mouthbreeder  caatttg-cat-aaagtgtattatctaaacata------taag---tgaaaggtaaggg-tgt--tgaaa
                  Zebra mbuna  caatttg-cat-aaagtgtattatctaaacata------taag---tgaaaggtaaggg-tgt--tgaaa
          Pundamilia nyererei  caatttg-cat-aaagtgtattatctaaacata------taag---tgaaaggtaaggg-tgt--tgaaa
                       Medaka  ccatttg-cat-aaagtgcattatctaaacata------taag---taaaaggtaaggg-tgc--tcaaa
           Southern platyfish  caatttg-cat-aaagtgcattatctaaacata------aaag---tgaaaggtaatgg-tgg--caaag
                  Stickleback  caatttg-cat-aaagtgtattatctcaacatg------taag---cgaaaagtaagag-tgt--tgaaa
                    Zebrafish  gaattag-cat-aaagagtattatctaaacata------taaggctttaa--gcagggg-tgc--tgaaa
     Mexican tetra (cavefish)  gaaaaagacgt-atggagacaaatctaaaattt------atagaattgta--gcattag-cat--aaaga
                  Spotted gar  gcatttg-cat-aaactttattatctaaacata------taaggctttat--gtaacgg-tgt--cgaaa
                 Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                        Chimp  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                      Gorilla  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                    Orangutan  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                       Gibbon  agggcatgaaaa----------attcaactt--c-ggt------------------------------t-
                       Rhesus  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
          Crab-eating macaque  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                       Baboon  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                 Green monkey  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                     Marmoset  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
              Squirrel monkey  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                     Bushbaby  agggcatgaaaa----------attcaacct--t-ggt------------------------------t-
           Chinese tree shrew  aaggcatgaaaa----------attcaactt--g-ggt------------------------------t-
                     Squirrel  agggcatgaaaa----------attcaactt--t-agt------------------------------t-
       Lesser Egyptian jerboa  agggcatgacaa----------attcaactt--t-gta------------------------------t-
                 Prairie vole  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
              Chinese hamster  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
               Golden hamster  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                        Mouse  aaggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                          Rat  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
               Naked mole-rat  agggtataaaaa----------attcaactt--t-ggt------------------------------t-
                   Guinea pig  agggcatgaaaa----------attcaactt--t-ggt------------------------------c-
                   Chinchilla  agggcatgaaaa----------attcaactt--t-tgt------------------------------t-
             Brush-tailed rat  agagcatgaaaa----------attcaactt--t-ggt------------------------------t-
                       Rabbit  agggcgtgaaaa----------attcaactt--t-ggt------------------------------t-
                         Pika  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                          Pig  agagcatgaaaa----------attcaactt--t-ggt------------------------------t-
                       Alpaca  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
               Bactrian camel  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                      Dolphin  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                 Killer whale  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
             Tibetan antelope  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                          Cow  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                        Sheep  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                Domestic goat  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                        Horse  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
             White rhinoceros  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                          Cat  agggcatgaaaa----------attcaactt--c-ggc------------------------------t-
                          Dog  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                      Ferret   agggcatgaaaa----------attcaactt--c-agt------------------------------t-
                        Panda  agggcatgaaaa----------attcaactt--c-ggt------------------------------t-
               Pacific walrus  agggcatgaaaa----------attcaactt--c-ggt------------------------------t-
             Black flying-fox  agggcatgaaaa----------attcaacct--t-ggt------------------------------t-
                      Megabat  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                Big brown bat  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
         David's myotis (bat)  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                     Microbat  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                     Hedgehog  agggcatgaaaa----------attcaactt--t-ggt------------------------------tc
                        Shrew  agggcgtgaaaa----------attccactt--t-ggt------------------------------t-
              Star-nosed mole  gaggcatgaaaa----------attcaactt--t-agt------------------------------t-
                     Elephant  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
          Cape elephant shrew  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                      Manatee  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
             Cape golden mole  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                       Tenrec  agggcatgaaaa----------attcaagtt--t-ggt------------------------------t-
                     Aardvark  agggcataaaaa----------attcaactt--t-ggt------------------------------t-
                    Armadillo  agggcatgaaaa----------attcaactt--t-ggt------------------------------t-
                      Opossum  agggcatgaaaa----------attcaactt--t-tgt------------------------------t-
              Tasmanian devil  agggcatgaaaa----------attcaactt--tttgt------------------------------t-
                      Wallaby  agggcatgaaaa----------attcaactt--tctgt------------------------------t-
                     Platypus  agggcatgaaaa----------attcaactt--t--gt------------------------------a-
                  Rock pigeon  agggcataaaaa----------attcaactt--t--gt------------------------------t-
                 Saker falcon  agggcataaaaa----------attcaactt--t--gt------------------------------t-
             Peregrine falcon  agggcataaaaa----------attcaactt--t--gc------------------------------t-
          Collared flycatcher  agggcataaaaa----------atttaactt--t--gt------------------------------t-
       White-throated sparrow  agggcataaaaa----------attcaactt--t--gt------------------------------t-
          Medium ground finch  agggcataaaaa----------attcaactt--t--gt------------------------------t-
                  Zebra finch  tgggcataaaaa----------attcaactt--t--gt------------------------------t-
           Tibetan ground jay  agggcataaaaa----------attcaactt--t--gt------------------------------t-
                   Budgerigar  agggcataaaaa----------attcaactt--t--gt------------------------------t-
                       Parrot  agggcataaaaa----------attcaactt--t--gt------------------------------t-
                Scarlet macaw  agggcataaaaa----------attcaactt--t--gt------------------------------t-
                 Mallard duck  aagacataaaat----------attcaactt--t--gt------------------------------t-
                      Chicken  agggcataaaaa----------attcaactt--t--gt------------------------------t-
                       Turkey  agggcataaaaa----------attcaactt--t--gt------------------------------t-
           American alligator  agggcataaaaa----------attcaactt--t--gt------------------------------t-
              Green seaturtle  agggtataaaaa----------attcaactt--t--gt------------------------------t-
               Painted turtle  agggtataaaaa----------atgcaactt--t--gt------------------------------t-
     Chinese softshell turtle  agggtataaaaa----------attcaactt--t--gt------------------------------t-
       Spiny softshell turtle  agggtataaaaa----------attcaactt--t--gt------------------------------t-
                       Lizard  -ggggat---------------------ttt--t--tt------------------------------t-
                X. tropicalis  acggca--aaga----------atgtgactt--t--at------------------------------t-
                   Coelacanth  aggtcataaaaa----------atttaactt--t--gt------------------------------t-
                    Tetraodon  agatcattaaag----------tttaag--g--a-tat------------------------------t-
                         Fugu  agatcattaaaa----------tttaag--g--a-tat------------------------------t-
                 Nile tilapia  tggtcattaaaa----------atttag--t--a-tat------------------------------t-
          Princess of Burundi  tggtcattaaaa----------atttag--t--a-tat------------------------------t-
        Burton's mouthbreeder  tggtcattaaaa----------atttag--t--a-tat------------------------------t-
                  Zebra mbuna  tggtcattaaaa----------atttag--t--a-tat------------------------------t-
          Pundamilia nyererei  ttgtcattaaaa----------atttag--t--a-tat------------------------------t-
                       Medaka  aggtcattaaaa----------attgag--t--a-cac------------------------------t-
           Southern platyfish  aggtcattaaaa----------attgag--t--a-cac------------------------------t-
                  Stickleback  agctcattaaaa----------tttaag--t--g-tac------------------------------t-
                    Zebrafish  aggtcattaaaa----------tttaag--t--g-gat------------------------------t-
     Mexican tetra (cavefish)  gcattatctaaacatataaggccttaag--taag-ggtgtcaaaaaggtcattaaaatttaagtggatt-
                  Spotted gar  aggtcattaaaa----------atttaac-t--a-tat------------------------------t-
                 Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  tcacgataggg-----------gc-ccggat-----------t--tctaa--catgattaagataataca
                        Chimp  tcacgataggg-----------gc-ccggat-----------t--tctaa--catgattaagataataca
                      Gorilla  tcacgataggg-----------gc-ccggat-----------t--tctaa--catgattaagataataca
                    Orangutan  tcacgat-ggg-----------gc-ccggat-----------t--tctaa--catgattaagataataca
                       Gibbon  tcaccatagga-----------gc-ccggat-----------t--tctaa--catgattaagataataca
                       Rhesus  tcacgataggg-----------gc-ctggat-----------t--tctaa--catgattaagataataca
          Crab-eating macaque  tcacgatgggg-----------gc-ctggat-----------t--tctaa--catgattaagataataca
                       Baboon  tcacgataggg-----------gc-ctggat-----------t--tctaa--catgattaagataataca
                 Green monkey  tcacgataggg-----------gc-ctgga---------------tctaa--tatgattaagataataca
                     Marmoset  tcacgataggg-----------cc-ccggat-----------t--tctaa--catgattaagataataca
              Squirrel monkey  tcacattaggg-----------cc-ccggat-----------t--tctaa--catgattaagataataca
                     Bushbaby  tcatgatagga-----------gc-ccggac-----------t--cctaa--catgattaaaataatata
           Chinese tree shrew  tcgtgataggg-----------gc-ctggat-----------t--cctaa--catgattaagataatata
                     Squirrel  tcatgatggga-----------gc-ccagat-----------t--cctaa--gatgattaagataataca
       Lesser Egyptian jerboa  tctttatggga-----------gc-ccagat-----------t--cctac--catgattaagctaataca
                 Prairie vole  tcttgatggga-----------gc-ccagat-----------t--cctgg--catgattaagctaataca
              Chinese hamster  tcttgatggga-----------gc-ccagat-----------t--cctgg--catgattaagctaataca
               Golden hamster  tcttgatggga-----------gc-ccagat-----------t--cctgg--catgattaagctaataca
                        Mouse  tcttgatggga-----------gc-ccagat-----------t--cctgg--catgattaagctaataca
                          Rat  tcttgatggga-----------gc-ccagat-----------t--cctgg--catgattaagctaataca
               Naked mole-rat  ttatgatggga-----------gc-cccctt-----------a--cctaa--catgattaagataataca
                   Guinea pig  ttatgatcgga-----------gc-cccttt--------------cctaa--catgattaagataataca
                   Chinchilla  ttatgatggga-----------gc-cccttc--------------cctca--catgattaagataataca
             Brush-tailed rat  ttatgatggga-----------gc-cccttt-----------a--cctaa--catgattaagacaatata
                       Rabbit  tcctgatagaa-----------a--ccttat-----------t--cctaa--cgtgattaagataataca
                         Pika  tccggatagga-----------a--ccgtat-----------t--cttac--cgtgattaagataataca
                          Pig  tcatgacagga-----------gt-ccagat-----------t--cttaa--catgattaagataataca
                       Alpaca  tcatgacagga-----------gc-ccggat-----------t--cctaa--catgattaagacaataca
               Bactrian camel  tcatgacagga-----------gc-ccggat-----------t--cctaa--catgattaagacaataca
                      Dolphin  tcatgacggga-----------gc-ccggat-----------t--cctaa--catgattaagataataca
                 Killer whale  tcatgacggga-----------gc-ccgaat-----------t--cctaa--catgattaagataataca
             Tibetan antelope  tcatgacagga-----------gc-ccagat-----------t--cctaa--catgattaagataataca
                          Cow  tcatgacagga-----------gc-ccagat-----------t--cctaa--catgattaagataatata
                        Sheep  tcatgacagga-----------gc-ccagat-----------t--cctaa--catgattaagataataca
                Domestic goat  tcttgacagga-----------gc-ctagat-----------t--cctaa--catgattaagataataca
                        Horse  tcatgatagga-----------gc-ccagat-----------t--cctaa--catgattaagataataca
             White rhinoceros  tcatgatagga-----------gc-ccagat-----------t--cctaa--catgattaagctaataca
                          Cat  tcatgatagga-----------gc-ccggat-----------t--cctag--catgattaagataataca
                          Dog  tcatgatagga-----------gc-ctggat-----------t--cctaa--catgattaagataataca
                      Ferret   tcacgagtgga-----------gt-ctggat-----------t--cctaa--catgattaagataataca
                        Panda  tcgtgatagga-----------gc-ctggat-----------t--cctaa--catgattaagataataca
               Pacific walrus  tcatgatagga-----------gc-ctggat-----------t--cctaa--catgattaagataataca
             Black flying-fox  tcatgatagga-----------gc-ccagat-----------t--cctgc--cgtgatgaagataataca
                      Megabat  tcatgatagga-----------gc-ccagat-----------t--cctgc--cgtgatgaagataataca
                Big brown bat  tcgtgcgagga-----------gc-cgggct-----------t--cctca--catgattaagatcataca
         David's myotis (bat)  tcacgagagga-----------gc-caggcc-----------t--cctaa--catgattaagatcataca
                     Microbat  tcacgagagga-----------gc-cgggcc-----------t--cctca--catgattaagatcataca
                     Hedgehog  tcctgacagga-----------gc-cagtag-----------t--cctaa--catgattaagataatata
                        Shrew  tcatgatagga-----------gt-ccaaat-----------t--tttca--catgattaagacaataca
              Star-nosed mole  ttgtgacagga-----------ag-ctggat-----------t--cctaa--catgattaagataataca
                     Elephant  tcatgatagga-----------gc-tcggat-----------t--cctag--cgtgattaagataatata
          Cape elephant shrew  ccatgctagta-----------gc-cagggc-----------t--cctag--cctgattaagataataca
                      Manatee  tcacgatagga-----------gc-ctggat-----------t--cccag--tgtgattaaaataataca
             Cape golden mole  tcatggtagga-----------at-ccggat-----------t--cctag--catgattaagataataca
                       Tenrec  ccatgacaggc-----------gt-ctggat-----------t--ccggg--catgattaagataataca
                     Aardvark  tcatgatcgca-----------gc-ccagat-----------t--cctag--catgattaagataataca
                    Armadillo  tcatgatagga-----------gc-ctagat-----------t--cctaa--catgattaagataataca
                      Opossum  ttatgagtgga-----------ac-ctcagt-----------t--cctaa--catgattaagataatata
              Tasmanian devil  tcatgagtgga-----------ac-ctcaat-----------t---ctat--catgattaagataatata
                      Wallaby  tcacgagtgga-----------ac-ctcaat-----------t--cctaa--catgattaagataatata
                     Platypus  tcatgaaagaa-----------ac-ccaaat-----------t--cttaa--catgattaagatcatata
                  Rock pigeon  tcatgaaaaga-----------ac-tcaaat-----------t--cctag--catgattaagataatata
                 Saker falcon  tcatgaaaaga-----------ac-tcagat-----------t--cctaa--catgattaagataatata
             Peregrine falcon  tcatgaaaaga-----------ac-tcagat-----------t--cctaa--catgattaagataatata
          Collared flycatcher  tcatggaaaga-----------ac-tcaaat-----------t--cctaa--catgattaagataatata
       White-throated sparrow  tcatggaaaga-----------ac-tcaaat-----------t--cctaa--catgattaagataatata
          Medium ground finch  tcatggaaagg-----------ac-tcaaat-----------t--cctaa--catgattaagataatata
                  Zebra finch  tcatggaaaga-----------ac-tcaaat-----------t--cctaa--catgattaagataatata
           Tibetan ground jay  tcatggaaaga-----------ac-tcaaat-----------t--tctaa--catgattaagataatata
                   Budgerigar  tcatgaaaaga-----------ac-tcaaat-----------t--cctaa--catgattaagataatata
                       Parrot  tcatgaaaaga-----------ac-tcaaat-----------t--cctaa--catgattaagataatata
                Scarlet macaw  tcatgaaaaga-----------ac-tcaaat-----------t--cctaa--catgattaagataatata
                 Mallard duck  tcatgaaaaga-----------ac-tcaaat-----------t--cctaa--catgattaagataatata
                      Chicken  tcataaaaaga-----------tc-tcaaat-----------t--cctaa--catgattaagataatata
                       Turkey  tcataaaaaga-----------ac-tcaaat-----------t--cctaa--catgattaagataatata
           American alligator  tcatgaaagga-----------ac-ccaaat-----------t--cctaa--catgattaagaccatata
              Green seaturtle  tcatgaaagga-----------ac-ccaaat-----------t--cctaa--catgattaagataatata
               Painted turtle  tcatgaaagga-----------ac-ccagat-----------t--cctaa--catgattaagataatata
     Chinese softshell turtle  tcatgaaagga-----------ac-ccaaat-----------t--cctaa--catgattaagataatata
       Spiny softshell turtle  tcatgaaagga-----------ac-ccaaat-----------t--cctaa--catgattaagataatata
                       Lizard  ccccggcgagagtgagggagacac-cccatt-----------t--cacaactcatgattaagataacgtt
                X. tropicalis  caacaaaaaaa-----------ttgccaaat-----------c--ccttt--tatgattaacacaatatt
                   Coelacanth  taataaaagga-----------at-ccaaaa-----------taccttaa--tatgattaggataatata
                    Tetraodon  ---------ga-----------at-tcagaa-----------t--acagg--cgct-----atctatcca
                         Fugu  ---------ga-----------at-tcagaa-----------c--acgga--tgct-----atctatcca
                 Nile tilapia  ---------ga-----------at-gtagga-----------t--atgga--catt-----atcaatcca
          Princess of Burundi  ---------ga-----------at-gtagga-----------t--atgga--catt-----atcaatcca
        Burton's mouthbreeder  ---------ga-----------at-gtagga-----------t--atgga--catt-----atcaatcca
                  Zebra mbuna  ---------ga-----------at-gtagga-----------t--atgga--catt-----atcaatcca
          Pundamilia nyererei  ---------ga-----------at-gtagga-----------t--atgga--catt-----atcaatcca
                       Medaka  ---------ga-----------at-gcagaa-----------t--atgga--tattatct-atcaatcca
           Southern platyfish  ---------ga-----------at-gctgta-----------t--atgga--tgttatcc-atcaatctc
                  Stickleback  ---------ga-----------at-gcagaa-----------t--acgga--cattatct-atcaatcca
                    Zebrafish  ---------ga-----------at-aca-aaa---------cc--ttaga--cgtgatct-atcaatcaa
     Mexican tetra (cavefish)  ---------ga-----------at-acagaaa---------gc--ctcgg--cctgatct-gtcaatcta
                  Spotted gar  ---------ta-----------at-acaaaaacctccaaatcc--atggc--ttgattaa-aacagccta
                 Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  tcacttggcc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
                        Chimp  tcacttggcc--ctctcttattaaaggcataattgttgttg-------gaac----------cagaagtg
                      Gorilla  tcacttggcc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
                    Orangutan  tcacttggcc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
                       Gibbon  tcacttggcc--ctctcttattaaaggcataattgttgcta-------gaac----------cagaagtg
                       Rhesus  tcacttggcc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
          Crab-eating macaque  tcacttggcc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
                       Baboon  tcacttggcc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
                 Green monkey  tcacttggcc--cactcttattaaaggcataattgttgtta-------gaac----------cagaagtg
                     Marmoset  tcacttggcc--ctctcttattaaaggcataattgttatta-------gaac----------cagaagtg
              Squirrel monkey  tcacttggcc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
                     Bushbaby  tcacacggcc--ttctcttattcaaggcataattgttgtta-------aaac----------cagaagtg
           Chinese tree shrew  tcacacggtc--ctcttttattaaaggcataattgttgtta-------gaac----------cagaagtg
                     Squirrel  tcacacggcc--ctctcttattaaaggcataatagttgtta-------gaac----------cagaagtg
       Lesser Egyptian jerboa  tcatgcaggc--ctctcttattaaaggcataattgttgtta-------gaag----------cagaagtg
                 Prairie vole  tcatacagcc--ctcacttattaaaggcaagatggctgtta-------gaac----------cagaagtg
              Chinese hamster  tcatacagca--ctcacttattaaaggcaagatcgttgtta-------gacc----------cagaagtg
               Golden hamster  tcatacagcc--ctcacttattaaaggcaagatcgctgtta-------gacc----------cagaagta
                        Mouse  tcatacagcc--ctcacttattaaaggcaagtgcgttggta-------ggac----------tagaagtg
                          Rat  tcatacagcc--ctcacttattaaaggcaagttcgttggta-------ggac----------cagaagtg
               Naked mole-rat  tcatatagcc--ttctcttattaaaggcataattattgtta-------gagc----------cagaaatg
                   Guinea pig  tcatacagcc--atctcttattaaaggcataattgtcgttg-------gag-----------tagaaatg
                   Chinchilla  tcatgcagcc--ttctcttattaaaggcataattgttgtta-------ggac----------taaaaatg
             Brush-tailed rat  tcatccagcc--ttctcttattaaaggcataattgttgtta-------gagc----------tagaaatg
                       Rabbit  tcacatggcc--ctctcttattaaaggcataattgttgtta-------ggac----------cagaagtg
                         Pika  tcacgcagcc--ctctcttattaaaggcataattgttgtta-------ggag----------cagaagtg
                          Pig  tcacgcggcc--ttctcatattaaaggcataattgttgtta-------ggac----------cagaagt-
                       Alpaca  tcatgccgcc--ctctcttattaaaggcataattgttgtta-------ggac----------ctaaagtg
               Bactrian camel  tcatgccgcc--ctctcttattaaaggcataattgttgtta-------ggac----------ctaaagtg
                      Dolphin  tcatgagtcc--ctctcttattaaaggcataattgttgtta-------gggg----------cagaggtg
                 Killer whale  tcatgaggcc--ctctcttattaaaggcataattgttgtta-------gggg----------cagaagtg
             Tibetan antelope  tcacacggcc--ctctcttattaaaggcataattgttgtta-------ggac----------cagaagtg
                          Cow  tcatgcggcc--ctctcttattaaaggcataattgttgtta-------ggac----------cagaagtg
                        Sheep  tcacacggcc--ctctcttattaaaggcataattgttgtta-------ggac----------cagaagtg
                Domestic goat  tcacacggcc--ctctcttattaaaggcataattgttgtta-------ggac----------cagaagtg
                        Horse  tcacgcggcc--ctctcttattaaaggcataattgttgtta-------gaag----------cagaagtg
             White rhinoceros  tcacgcggcc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
                          Cat  tcacacggtc--gtctcttattaaaagcataattgttgtta-------gaac----------cagaagtg
                          Dog  tcacaaggcc--ctctcttattaaaggcataattgttggta-------gaac----------cagaagtg
                      Ferret   tcacacggcc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
                        Panda  tcacacggcc--ctctcttattaaaggcataattgttgtta-------gaac----------ccgaagtg
               Pacific walrus  tcacacgggc--ctctcttattaaaggcataattgttgtta-------gaac----------cagaagtg
             Black flying-fox  tcacgcggcc--ctctcttattaaaggcataattgttgtta-------aaag----------cagaagtg
                      Megabat  tcacgcggcc--ctctcttattaaaggcataattgttgtta-------aaag----------cagaagtg
                Big brown bat  tcacgcggccc-ccctcttattaaaggcataattgttgtga-------gaac----------ccgaagtg
         David's myotis (bat)  tcacacggccctctctcttattaaaggcataattgttgtga-------gaac----------ccgaagtg
                     Microbat  tcacgcggccctctctcttattaaaggcataattgttgtga-------gaac----------ccgaagtg
                     Hedgehog  tcactcagct--ctctcttattaaaggcatgattgttgcta-------ggac----------cagaagtg
                        Shrew  tcacgcagcc--ctctctgattagagacataattgttgtga-------gaag----------caggagtg
              Star-nosed mole  tcacgcaacc--ttctcttattaaaggcataattgtccttc-------gaag----------cagaagtg
                     Elephant  tcatgtggcc--ctctcttattaaaggcataattgttgtta-------gaac----------caaaagtg
          Cape elephant shrew  tcatgcggcc--ttctcttattaaaggcataattgttgtga-------gaac----------caaaagtg
                      Manatee  tcatgcggcc--ctctcttattaaagacataattgttgtta-------gaac----------caaaagtg
             Cape golden mole  tcatgtggcc--ttctcttattaaaggcataattgttgttg-------gaaa----------caaaagtg
                       Tenrec  tcatgcggcc--ttctcttattaaaggcataattgttgtta-------gaac----------caaaagtg
                     Aardvark  tcatgcggtc--ctctcttattaaaggcataattgttgtta-------gaac----------ccaaagtg
                    Armadillo  tcatgtggcc--ctctcttattaacggcataattgttgtta-------gaaa----------cagaagtg
                      Opossum  tcacttgttc--ctatcttattaaaagcataattgttgttc-------gaac----------tagaagtg
              Tasmanian devil  tcacttgttc--ctctcttattaaaggcataattgttgttc-------gaag----------tagaagtg
                      Wallaby  tcacttgttc--ctatcttattaaaggcataattgttgttc-------gaac----------tggaagtg
                     Platypus  tcacctggac--ctatcttattaaaagcataattgttgttc-------agaa----------cgggagcg
                  Rock pigeon  tcatttgttc--ctgtcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
                 Saker falcon  tcatttgttc--ctatcttattaaagacataattgttgtta-------gaca----------cagaagtg
             Peregrine falcon  tcatttgttc--ctatcttattaaagacataattgttgtta-------gaca----------cagaagtg
          Collared flycatcher  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
       White-throated sparrow  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
          Medium ground finch  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
                  Zebra finch  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
           Tibetan ground jay  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
                   Budgerigar  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
                       Parrot  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
                Scarlet macaw  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
                 Mallard duck  tcatttgttc--ctatcttattaaagacgtaattgttgtta-------gacg----------cagaagtg
                      Chicken  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
                       Turkey  tcatttgttc--ctatcttattaaaggcgtaattgttgtta-------gaca----------cagaagtg
           American alligator  tcatttgctc--ctatcttattaaaggcgtaattgttgtta-------gacg----------caggagtg
              Green seaturtle  tcatttgctc--ctttcttattaaaggtgtaattgttgtta-------gaca----------caggagtg
               Painted turtle  tcatttgctc--ctttcttattaaaggtgtaattgttgtta-------gaca----------caggagtg
     Chinese softshell turtle  tcatttgctc--ctttcttattaaaggtgtaattgttgcta-------gaca----------caagcgag
       Spiny softshell turtle  tcatttgctc--ctttcttattaaaggtgtaattgttgcta-------gaca----------caggagag
                       Lizard  tcactcatgc--catacttattaaaggcgtaattgttgttt-------gaca----------ctgaagcg
                X. tropicalis  tcattgggac--ttatcttattaaaagcataattgttttca-------gacg----------cacaagtg
                   Coelacanth  tctttagctc--ctttcttattaaaggaataattgttgtta-------agacgctgggctgtcagagttg
                    Tetraodon  tcaatctgtg-----acttacttaatgtctaattgtcataagcgggacggtg----------agtcgccg
                         Fugu  tcaatcggcg-----acttacttaacgtctaattgtcacgggcgggacgatg----------agccgccg
                 Nile tilapia  tcaatctgct-----agttactcagtgtataattgttataa-------gatg----------ggcaacag
          Princess of Burundi  tcaatctgct-----agttactcagtgtataattgttataa-------gatg----------ggcaacag
        Burton's mouthbreeder  tcaatctgct-----agttactcagtgtataattgttataa-------gatg----------ggcaacag
                  Zebra mbuna  tcaatctgct-----agttactcagtgtataattgttataa-------gatg----------ggcaacag
          Pundamilia nyererei  tcaatctgct-----agttactcagtgtataattgttataa-------gatg----------ggcaacag
                       Medaka  tcaatctgca-----agttacttaatgtataattgttataa-------gacg----------ggcaccag
           Southern platyfish  tcaatctgct-----tgttaccttatgtttaattgttgtaa-------gacg----------tgcagcag
                  Stickleback  tcaatctgc---------tacttaatgtattattgttataa-------tacg----------ggcagcag
                    Zebrafish  tcaatctgtc-----tgttatttgatgtgtaattgcagtaa-------gacg----------gaccgctg
     Mexican tetra (cavefish)  tcagtgggtt-----tgttattggatgtataattgttataa-------gatg----------ggcagccg
                  Spotted gar  tcaatccact-----tgtt--ctaatgtataattgttgtaa-------gatg----------ggcagccg
                 Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  ---------gcattaaa--gctaa--tc----tagttttatatatgtacaaatat-------------ga
                        Chimp  ---------gcattaaa--gctaa--tc----tagttttatatatgtacaaatat-------------ga
                      Gorilla  ---------gcattaaa--gctaa--tc----tagttttatatatgtacaaatat-------------ga
                    Orangutan  ---------gcattaaa--gctaa--tc----tagttttatatatgtacaaatat-------------ga
                       Gibbon  ---------gcattaaa--gctaa--tc----tagttttatatatgtacaaatat-------------ga
                       Rhesus  ---------gcgttaaa--gctaa--tc----tagttttatatacgtacaaatat-------------ga
          Crab-eating macaque  ---------gcgttaaa--gctaa--tc----tagttttatatacgtacaaatat-------------ga
                       Baboon  ---------gcgttaaa--gctaa--tc----tagttttatatacgtacaaatat-------------ga
                 Green monkey  ---------gcgttaaa--gctaa--tc----tagttttatatacgtacaaatat-------------ga
                     Marmoset  ---------gcattaaa--gctaa--tc----tagttttatatatgtacaaatat-------------ga
              Squirrel monkey  ---------gcattaaa--gctaa--tc----tagttttatatatgtacaaatat-------------ga
                     Bushbaby  ---------gcattaac--gctaa--tc----tagttttatatatgtacaaatat-------------ga
           Chinese tree shrew  ---------gcattaat--gctaa--tc----tagttttatatatgtacaaatat-------------ga
                     Squirrel  ---------gcattaac--gctaa--tc----tagttttatatatgtacaaatat-------------ga
       Lesser Egyptian jerboa  ---------gcattaac--actaa--tc----tagttttatatatgtacaaattc-------------aa
                 Prairie vole  ---------gcatgagc--gctaa--tc----tagctttatatatgtacaaatac-------------aa
              Chinese hamster  ---------gcattagc--gctaa--tc----tagctttatatatgtacaaatac-------------aa
               Golden hamster  ---------gcattagc--gctaa--tc----tagctttatatatgtacaaatac-------------aa
                        Mouse  ---------gcattaat--gctaa--tc----tagttttatatatgtacaaatac-------------aa
                          Rat  ---------gcattaat--gctaa--tc----tagctttatatatgtacaaatac-------------aa
               Naked mole-rat  ---------gcattaac--actaa--tc----tggttttatatatgtacaaatag---------------
                   Guinea pig  ---------gcatcaac--actaa--tc----tcattttgtatatgtacaaatag-------------ga
                   Chinchilla  ---------gcttgaac--actca--tc----tagttttatatatgtacaaatag-------------ga
             Brush-tailed rat  ---------gcattaac--gctaa--tc----tagttttatatatgtacaaatag-------------ga
                       Rabbit  ---------gcattaac--gctaa--tc----tagttttatatatgtacaaatag-------------ga
                         Pika  ---------gcattaac--gctaa--tc----tagttttatataagtacaaatag-------------gg
                          Pig  ---------gcgttaat--gctaa--tc----tcgttttatatatgtacaaatat-------------ga
                       Alpaca  ---------gcattaac--gctaa--tc----tagttttatatatgtccaaatat-------------ga
               Bactrian camel  ---------gcattaac--gctaa--tc----tagttttatatatgtccaaatat-------------aa
                      Dolphin  ---------gcgttaac--actaa--tc----tagctttatatatgtacaaatat-------------ag
                 Killer whale  ---------gcgttaac--actaa--tc----taactttatatatgtacaaatat-------------ag
             Tibetan antelope  ---------gtgttaac--gctaa--tc----tagttttatatatgtacaaatac-------------gg
                          Cow  ---------gcgttaac--actaa--tc----tagttttatatatgtacaaatac-------------gg
                        Sheep  ---------gtgttaac--gctaa--tc----tagttttatatatgtacaaatac-------------gg
                Domestic goat  ---------gtgttaac--gctaa--tc----tagttttatatatgtacaaatac-------------gg
                        Horse  ---------gcgttaat--gctaa--tc----tagttttatatatgtacaaatat-------------ga
             White rhinoceros  ---------gcattaat--gctaa--tc----tagttttatatatgtacaaatat-------------gg
                          Cat  ---------gcgttaat--gctaa--tc----tagttttatatatatacaaatat-------------ga
                          Dog  ---------gcgttaat--gctag--tg----tagttttatatacgtacaaatat-------------ga
                      Ferret   ---------gcgttaat--gctgg--tc----tcgttttatatcccggcaaacac-------------ga
                        Panda  ---------gcattaat--gctag--tt----tggttttatatacggacaagtat-------------ga
               Pacific walrus  ---------gcgttaat--gctag--tc----tagttttatatacggacaaatac-------------ga
             Black flying-fox  ---------ccattgac--gctaa--tc----tagttttatatatatacaaatat-------------ga
                      Megabat  ---------gcattgac--gctaa--tc----tagttttatatatgtacaaatat-------------ga
                Big brown bat  ---------gcgtcagc--gctaa--tc----tagctttatatacgtacaaatac-------------ga
         David's myotis (bat)  ---------gcgtgaac--gctaa--tc----tagttttatatatgtacacatac-------------ga
                     Microbat  ---------gcgttaac--gctaa--tc----tagttttatatatgtacaaatac-------------ga
                     Hedgehog  ---------gcgttagc--actaa--tc----tagttttatatatgtacaaatac-------------ga
                        Shrew  ---------gcattcac--actaa--tc----gagttttctatacgtacaaatag-------------ga
              Star-nosed mole  ---------gcgctcct--gctaa--tc----tggttttatatatatacaaatat-------------ga
                     Elephant  ---------gcattaac--gctaa--tctagttagttttatatatgtacaaatat-------------ga
          Cape elephant shrew  ---------gcattaac--actaa--tc----tagttttatatatgtacaaatac-------------ga
                      Manatee  ---------gcattaac--gctaa--tc----tagttttatatatgtacaaatat-------------ga
             Cape golden mole  ---------gcattaac--actaa--tc----tagttttatatatgtacaaatat-------------ga
                       Tenrec  ---------gcattaac--actaa--tc----tagttttatatgtatacaaatat-------------aa
                     Aardvark  ---------gcattaac--gctaa--tc----tagttttatatatgtacaaatat-------------ga
                    Armadillo  ---------gcattaat--gctaa--tc----tag-tttatacacacacacatacacacacaaaatcgga
                      Opossum  ---------gcattaac--tctaa--tc----tagttttatatatgtacaaatgt-------------ga
              Tasmanian devil  ---------gcattaac--tctaa--tc----taattttatatatgtacaaatgt-------------ga
                      Wallaby  ---------gcattaac--tctaa--tc----tagttttatatatgtacaaatgt-------------ga
                     Platypus  ---------gttttaac--tctaa--tc----tggctttatatatgtacaaatag-------------aa
                  Rock pigeon  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
                 Saker falcon  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
             Peregrine falcon  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
          Collared flycatcher  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
       White-throated sparrow  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
          Medium ground finch  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
                  Zebra finch  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
           Tibetan ground jay  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
                   Budgerigar  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
                       Parrot  ---------gcattaac--tctaa--tc----tggttttatatatgtacaaatag-------------ga
                Scarlet macaw  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------ga
                 Mallard duck  ---------gcattaac--tctaa--tc----tggctttatatatgtacaaatag-------------aa
                      Chicken  ---------gcattaag--tctaa--tc----tggctttatatatgtacaaatag-------------aa
                       Turkey  ---------gcattaag--tctaa--tc----tggctttatatatgtacaaatag-------------aa
           American alligator  ---------gtattagc--tctaa--tc----tggttttatatatgtacaaatag-------------ga
              Green seaturtle  ---------gcatgaac--tctaa--tc----tggctttatatatatacaaatag-------------ac
               Painted turtle  ---------gcatgaac--tctaa--tc----tggctttatagctatacaaatag-------------ga
     Chinese softshell turtle  ---------gcgtgagc--tctaa--gc----tggctttatatatgtacacatag-------------ga
       Spiny softshell turtle  ---------gcgtgagc--tctaa--gc----tggctttatatatgtacaaatag-------------ga
                       Lizard  ---------acgttcac--tctaa--tc----tggttttatatatgtatgaacat-------------gg
                X. tropicalis  tccaagccagcattaac--tataa--tc----tggctttttatttataccaacct-------------ga
                   Coelacanth  ---------acatta-----ctta--tg----ctgctgcgtatatggacaaatac-------------ga
                    Tetraodon  ------------tcaa---cctag--cc----tgcatgta-atatgcatgacaac-------------ac
                         Fugu  ------------tcaa---gctag--ca----cgcatgta-atatgcatagcgac-------------ac
                 Nile tilapia  ------------tcaag--cctag--tc----tacatata-atatgcatgactgt-------------ga
          Princess of Burundi  ------------tcaag--cctag--tc----tacatata-atatgcatgactgt-------------ga
        Burton's mouthbreeder  ------------tcaag--cctag--tc----tacatata-atatgcatgactgt-------------ga
                  Zebra mbuna  ------------tcaag--cctag--tc----tacatata-atatgcatgactgt-------------ga
          Pundamilia nyererei  ------------tcaag--cctag--tc----tacatata-atatgcatgactgt-------------ga
                       Medaka  ------------tcaag--cccag--tc----tgcatata-atatgcatgactgt-------------ga
           Southern platyfish  ------------tcaag--cccag--tg----tgaatata-atatgcatgactct-------------ga
                  Stickleback  ------------tcaag--cctag--tc----tacattta-aaatgcatgactat-------------ga
                    Zebrafish  ------------ctggattctctc--tc----catatgta-atatgcatgactac-------------ga
     Mexican tetra (cavefish)  ------------tcaagggcgtgt--gt----agtatgta-atatgcatgactat-------------ga
                  Spotted gar  ------------tcaag--actcgcccc----catatata-atatgcatgaatac-------------gg
                 Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  agagaagtgcactt-gcagacgg-ttgc--ttttgga-gatccataggcat-tt---------------t
                        Chimp  agagaagtgcactt-gcagacgg-ttgc--ttttgga-gatccataggcat-tt---------------t
                      Gorilla  agagaagtgcactt-gcagacgg-ttgc--ttttgga-gatccataggcat-tt---------------t
                    Orangutan  agagaagtgccctt-gcagacgg-ttgc--ttttgga-gatccataggcat-tt---------------t
                       Gibbon  agagaagtgcactt-ggagacgg-ttgc--ttttgga-gatccataggcat-tt---------------t
                       Rhesus  agagaagtgcactt-ggagacgg-ttgc--ttttgga-gatccataggcat-tt---------------t
          Crab-eating macaque  agagaagtgcactt-ggagacgg-ttgc--ttttgga-gatccataggcat-tt---------------t
                       Baboon  agagaagtgcactt-ggagacgg-ttgc--tttttga-gatccataggcat-tt---------------t
                 Green monkey  agagaagtgcactt-ggagacgg-ttgc--ttttgga-gatccataggcat-tt---------------t
                     Marmoset  aaataagtgaactt-ggagacgc-ttgc--ttttgga-gatccataggcat-tt---------------t
              Squirrel monkey  agagaagtgaactt-ggagacgc-ttgc--ttttgga-gatccataggcat-tt---------------t
                     Bushbaby  agagaagtgaactt-agagacgc-ttgc--ttttgga-gatccacaggcat-tt---------------t
           Chinese tree shrew  agaaaagtgaactc-ggagacgc-ctgc--ttttggt-gatccataggcat-tt---------------t
                     Squirrel  aaggaagtgaactt-ggagacgc-ttgc--ttttggt-gatccataggcat-tt---------------t
       Lesser Egyptian jerboa  aggcaagtgaactt-gaagatgc-ttgc--ttttggt-gatccataggcat-tt---------------t
                 Prairie vole  agagaagtgaactt-ggagacgc-ttgc--ttttgat-gatccatgggcat-tt---------------t
              Chinese hamster  agggaagtgaactt-ggagacgc-ttgc---tttgat-gatccacaggcat-tt---------------t
               Golden hamster  agagaagtgaactt-ggagacgc-ttgc---tttgat-gatccacaggcat-tt---------------t
                        Mouse  agt--agtgaactt-ggggacgc-ttgc---tttgat-gatccataggcat-tt---------------t
                          Rat  agt--agtgaactt-ggggacgc-ttgc---tttgat-gatccataggcat-tt---------------t
               Naked mole-rat  ---gaagtgaactt-ggggacac-ttgc--ttttggt-gatccataggcat-tt---------------t
                   Guinea pig  gaagaagtgaactt-acggacac-tcgc--tttaggt-gatccataggcat-tt---------------t
                   Chinchilla  agagaagtgaactt-ggggacac-ttgc--ttttggt-gatctataggcat-tt---------------t
             Brush-tailed rat  agggaagagaactt-gggcacac-ttgc--ttttggt-gatctataggcat-tt---------------t
                       Rabbit  agagaagtgaactt-ggagacgc-ttgc--ttttggt-gatccataggcat-tt---------------t
                         Pika  ggagaagggaagtt-ggagacgc-ttgc--tcttggt-gatccataggcat-tt---------------t
                          Pig  agagaagtgaactt-ggagacgc-ttgc--ttttggt-gatccataggcat-tt---------------t
                       Alpaca  agagaagtgaactt-ggagacgc-ttgc--tttcagt-aatccataagcat-tt---------------t
               Bactrian camel  ggagaagtgaactt-ggagacgc-ttgc--tttcagt-aatccataagcat-tt---------------t
                      Dolphin  agagaagcgaactt-ggagacgc-ttgc--ttttggt-gatccataggcat-tt---------------t
                 Killer whale  agagaagcgaactt-ggagacgc-ttgc--ttttggt-gatccataggcat-tt---------------t
             Tibetan antelope  agagaagcgaacttgggagacgt-gcgc---tttggt-gatccataggcat-tt---------------t
                          Cow  agagaagcgaacttgggagacgc-gcgc---tttggt-gatccataggcat-tt---------------t
                        Sheep  agagaagcgaacttgggagacgt-acgc---tttggt-gatccataggcat-tt---------------t
                Domestic goat  agagaagcgaacttgggagacgt-gcgc---tttggt-gatccataggcat-tt---------------t
                        Horse  agagaagtgaactt-ggagacgc-ttgc--ttttggt-gatccataggcat-tt---------------t
             White rhinoceros  agggaagtgaactt-ggagatgc-ttgc--ttttggt-gatccataggcat-tt---------------t
                          Cat  agagaagtgaactt-ggagacac-ttgc--ttttggt-gatccataggcat-tt---------------t
                          Dog  agagaagggaactt-agaaacgc-tcgc--ttgtggt-gatccataggcat-tt---------------t
                      Ferret   ggagaagggaactt-ggagacgctttgc--ttgtggt-gatccataggcat-tt---------------t
                        Panda  agagaagggaactt-ggagacgc-ttgc--ttgtagt-gatccatcggcat-tt---------------t
               Pacific walrus  agagaagggaactt-ggagacgc-tagc--ttgtggt-gatccataggcat-tt---------------t
             Black flying-fox  agagaagtgaactt-ggagacgc-tcgc--ttttggt-gatccataggcat-tt---------------t
                      Megabat  agagaagtgaactt-ggagacgc-tcgc--ttttggt-gatccataggcat-tt---------------t
                Big brown bat  agggaagtgaactt-ggagacgc-cggc--ttttggt-gatccgtcgtcat-tt---------------t
         David's myotis (bat)  agggacgggaactt-ggagacgc-cggc--tttgggt-gatccgcagtcat-tt---------------t
                     Microbat  agggaagggaactt-ggagacgc-cggc--tttgggt-gatccgcagtcat-tt---------------t
                     Hedgehog  agggaattgaactt-ggagacgc-ttgc--ttttggt-gatccataggcat-tt---------------t
                        Shrew  agagaagagaatgc-caaggcgc-gtgc--ttgtggt-gatccgtaggcat-tt---------------t
              Star-nosed mole  agagaagtgaactt-ggacatgc-ttgc--ttttggt-gatccataggcat-tt---------------t
                     Elephant  agagaagtgaactg-ggagaagc-acac--ttttagt-gatccataggcat-tt---------------t
          Cape elephant shrew  agagaagtgaactc-agagacgc-acgc--gtttggt-aatccataggcat-tt---------------t
                      Manatee  agagaagtgaactt-ggagacac-atgc--ttttagt-gatccataggcat-tt---------------t
             Cape golden mole  gaagagctgaactt-ggcaacgt-acgc--ttttggt-gatccacaggcat-tt---------------t
                       Tenrec  aaagagcagaacct-ggagactc-gtgc--gtttggt-gatccataagcat-tt---------------t
                     Aardvark  agaga--------t-ggagacgc-acgc--ttttggt-gatccataggcat-tt---------------t
                    Armadillo  agagaagtgaattt-ggagacgc-gtgg--ttttggt-gatccataggcat-tt---------------t
                      Opossum  ggagaggtgaatat-ggagactg-atgc--tttgggt-gatccataggcat-tt---------------t
              Tasmanian devil  agagaggtgaatat-ggagactg-atgc--tttgagt-gatccataggcat-tt---------------t
                      Wallaby  ggagaggtgaatat-ggagactg-atgc--tttgggt-gatccata-gcat-tt---------------t
                     Platypus  agagagtgatac---ggaaactg-atgc--ttttggt-gatccataggcat-tt---------------t
                  Rock pigeon  ggggaggtgaatgt-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
                 Saker falcon  cgggaggtgaatgt-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
             Peregrine falcon  cgggaggtgaatgt-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
          Collared flycatcher  ggggaggtggatct-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
       White-throated sparrow  ggggaggtggatct-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
          Medium ground finch  ggggaggtggatct-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
                  Zebra finch  ggggaggtggatct-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
           Tibetan ground jay  ggggaggtagatct-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
                   Budgerigar  ggggaggtgaatgt-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
                       Parrot  agggaggtgaatgt-gaaaattg-atgc--ttttggt-gatccata-gcat-tt---------------t
                Scarlet macaw  ggggaggtgaatgt-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
                 Mallard duck  ggggaggtgaatgt-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
                      Chicken  ggggaggtgaatgt-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
                       Turkey  taggaggtgaatgt-gaaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
           American alligator  ggagaggtgaatgt-ggaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
              Green seaturtle  ggagaggt-----t-ggaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
               Painted turtle  ggcgaggt-----t-ggaaattg-atgc--ttttggt-gatccataggcat-tt---------------t
     Chinese softshell turtle  ggagaggt-----t-ggaaatgg-atgc--ttttggt-gatccataggcat-tt---------------t
       Spiny softshell turtle  ggagaggt-----t-ggaaatgg-atgc--ttttggt-gatccataggcat-tt---------------t
                       Lizard  agagagctgactct-gggaatgg-atgc--tttcggtggatccgtagcctt-tcttttttcttcttttat
                X. tropicalis  gatggaagaaagtg-aaaaatgg-atgc--ttgcgtt-gatgcataggcat-tt---------------t
                   Coelacanth  gaagaggtgaacat-taaaattg-atgc--ttcttgt-gatacataggcat-tt---------------t
                    Tetraodon  atgggaacgaaagt-gaaagctg-acat--cttt--t-gatgtatagttct-tt-----------tt--t
                         Fugu  gtgggaggaaaagt-gaaagctg-acat--cttt--t-gatgtatcgttct-tt-----------tt--t
                 Nile tilapia  atggaggtaaaagt-gaaagctg-acac--tttt--t-gatgtacagttct-tt-----------tttat
          Princess of Burundi  atggaggtaaaagt-gaaagctg-acac--tttt--t-gatgtacagttct-tt-----------tttat
        Burton's mouthbreeder  atggaggtaaaagt-gaaagctg-acac--tttt--t-gatgtacagttct-tt-----------tttat
                  Zebra mbuna  atggaggtaaaagt-gaaagctg-acac--tttt--t-gatgtacagttct-tt-----------tttat
          Pundamilia nyererei  atggaggtaaaagt-gaaagctg-acac--tttt--t-gatgtacagttct-tt-----------tttat
                       Medaka  atggaggt--aagt-gaaagctg-acac--tttg--t-gatgtacagttct-tt-----------tttat
           Southern platyfish  atggaagtagaagt-gaaagctg-acac--tttg--t-gatgtacagttct-tt-----------tttat
                  Stickleback  atag------aagt-gaaagctg-acac--tttt--t-gatgtatagctccatt-----------tttat
                    Zebrafish  atgcaagcaaaagt-gaaacctg-aagc--tttt--t-gatgtatagggcc-tt---------------t
     Mexican tetra (cavefish)  gtg------aaagt-gtaacctg-aagctttttt--t-gatgtatagcttc-tt---------------t
                  Spotted gar  ctgtaagtgaatgt-gaaacctg-aagc-ttttt--t-gatgtataggtct-tt---------------t
                 Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  attaacgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                        Chimp  attaacgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                      Gorilla  attaacgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                    Orangutan  attaatgtttgaataataaccacctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                       Gibbon  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                       Rhesus  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
          Crab-eating macaque  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                       Baboon  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                 Green monkey  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-aagga-tt---gagatat
                     Marmoset  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acaga-tt---gagatat
              Squirrel monkey  attaatgtttgaataataactgcctaga--ggcctgttataaattaaaggg-acgga-tt---gagatat
                     Bushbaby  attaatg-ttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
           Chinese tree shrew  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acaga-tc---gagatat
                     Squirrel  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
       Lesser Egyptian jerboa  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgga-tt---gaggtat
                 Prairie vole  attaatgcttgaataatagctgcctaga-gggcctgttataaattaaaagg-acgga-tt---gagatat
              Chinese hamster  attaatgcttgaataataactgcctaga-gggcctgttataaattaaaggg-atgga-tt---gagatat
               Golden hamster  attaatgcttgaataataactgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                        Mouse  attaatgcttgaataataactgcctaga-gggcctgttataaattaaaggg-acaga-tt---gagatat
                          Rat  attaatgcttgaatagtaactgcctaga-gggcctgttataaattaaaggg-acaga-tt---gagatat
               Naked mole-rat  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                   Guinea pig  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                   Chinchilla  attaatgtttgaataataactgcctaga-gggcctgttataaattaacggg-acgga-tt---gagatat
             Brush-tailed rat  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                       Rabbit  attaatgtttgaataataaccgcctaga-gggcccgttataaattaaaggg-acgga-tt---gagatat
                         Pika  attaacgtttgaataataaccgcctaga-gggcccgttataaattaaaggg-acgga-tt---gagatat
                          Pig  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                       Alpaca  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
               Bactrian camel  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                      Dolphin  attaatgtttgaataataaccgcctaca-gggcctgttataaattaaaggg-acgga-tt---gagatat
                 Killer whale  attaatgtttgaataataaccgcctaca-gggcctgttataaattaaaggg-acgga-tt---gagatat
             Tibetan antelope  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                          Cow  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                        Sheep  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                Domestic goat  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                        Horse  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
             White rhinoceros  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                          Cat  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                          Dog  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-aagga-tt---gagatat
                      Ferret   attaatgtttgaataataaccgcctaga-gggcccgttataaattaaaggg-acgga-tt---gagatat
                        Panda  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
               Pacific walrus  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
             Black flying-fox  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                      Megabat  attaatgtttgaataataaccgcctaga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                Big brown bat  attaatgtttgaataataaccgcctaga-gggcctgttataaattcaaggg-acgga-tg---gagatat
         David's myotis (bat)  attaatgtttgaataatcaccgcctaga-gggcctgttataaattaaaggg-acgga-tg---gagatat
                     Microbat  attaatgtttgaataatcaccgcctaga-gggcctgttataaattaaaggg-acgga-tg---gagatat
                     Hedgehog  attaatgtttgaataataaccgcctgga-gggcctgttataaattaaaggg-acgga-tt---gagatat
                        Shrew  attcatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgga-tt---gagatat
              Star-nosed mole  attaatgtttgaataataaccgcctgga-gggcctgttataaattaaaggg-acgga-tg---gagatat
                     Elephant  attaatgtttgaataataaccgcccaga-gggcctgatataaattaaaggg-acgga-tt---gagatat
          Cape elephant shrew  attaatgtttgaataataactgcctaga-gggcctgatataaattaaaggg-aaaga-tt---gagatat
                      Manatee  attaatgtttgaataataaccgcctaga-gggcctgatataaattaaaggg-acgga-tt---gagatat
             Cape golden mole  attaatgtttgaataataaccgcctaga-gggcctgatataaattaaagga-acgga-tt---gagatat
                       Tenrec  attaatgtttgaataataaccgcctaga-gggcctgatataaattaaaggg-acgga-tg---gagatat
                     Aardvark  attaatgtttgaataataaccgcctaga-gggcctgatataaattaaaggg-acgga-tt---gagatat
                    Armadillo  attaatgtttgaataataactgcctaga-gggcttgttataaattaaaggg-acgga-tt---gagatat
                      Opossum  attaatgtttgaataataaccgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
              Tasmanian devil  attaatgtttgaataataaccgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
                      Wallaby  attaatgtttgaataataaccgcctgta-gggcctgttataaattaaaggg-acgaattt---gagatat
                     Platypus  attaatgtttgaataataaccacccgga-gggcctgttataaattaaaggg-atgaa-tt---gaggcat
                  Rock pigeon  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
                 Saker falcon  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
             Peregrine falcon  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
          Collared flycatcher  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
       White-throated sparrow  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
          Medium ground finch  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
                  Zebra finch  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
           Tibetan ground jay  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
                   Budgerigar  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
                       Parrot  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
                Scarlet macaw  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
                 Mallard duck  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-atgaa-tt---gagatat
                      Chicken  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
                       Turkey  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaggg-acgaa-tt---gagatat
           American alligator  attaatgtttgaataataactgcctgga-gggcctgttataaattaaaagg-acgaa-tt---gagatat
              Green seaturtle  attaatgtttgaataataactgcctgga-gggtctgttataaattaaaggg-acgaa-tt---gagatat
               Painted turtle  attaatgtttgaataataactgcctgga-gggtctgttataaattaaaggg-acgaa-tt---gagatat
     Chinese softshell turtle  attaatgtttgaataataactgcctgga-gggtctgttataaattaaaggg-acgaa-tt---gagatat
       Spiny softshell turtle  attaatgtttgaataataactgcctgga-gggtctgttataaattaaaggg-acgaa-tt---gagatat
                       Lizard  attaatgtttgaataataactgcctgga-gggtctgttataaattagaggg-acgaa-tt---gagatat
                X. tropicalis  attaatgtttgaataataactgcctaga-gggctcgtcataaattaaaggt-aagaa-tt---gagatat
                   Coelacanth  attaatgttcgaataatacatgcctaga-aggcctatcataaattaaaagg-gagta-tt---gagatat
                    Tetraodon  attaatgtgtgagtaatatgtaccccga-gggtgggatataaattaaaaca-gagaa-tg---aaggcat
                         Fugu  attaatgtgtgagtaatatgcaccccga-gggtggggtgtaaattaaaagt-gagaa-ta---gaggcat
                 Nile tilapia  attaatgtttgaataatatgtgcctgga-gggtgggctataaattaaaaca-tagaa-tc---gaggtat
          Princess of Burundi  attaatgtttgaataatatgtgcctgga-gggtgggctataaattaaaaca-tagaa-tt---gaggtat
        Burton's mouthbreeder  attaatgtttgaataatatgtgcctgga-gggtgggctataaattaaaaca-cagaa-tt---gaggtat
                  Zebra mbuna  attaatgtttgaataatatgtgcctgga-gggtgggctataaattaaaaca-cagaa-tt---gaggtat
          Pundamilia nyererei  attaatgtttgaataatatgtgcctgga-gggtgggctataaattaaaaca-cagaa-tt---gaggtat
                       Medaka  attaatgtttgaataatatgtgcctgga-aggagggctataaattaaaaaaggagaa-tt---gaggtat
           Southern platyfish  attaatgtttgaataatatgtgcctgga-gggtgtggcataaattaaaaa--gagag-gt---gaggtat
                  Stickleback  attaatgtttgaataatatgtgcctgga-gggtgggctacaaattaaagtt-aagaa-tt---gaggtat
                    Zebrafish  attaatgtttgaataatatgtgcctgga-gggaaggctataaattagaatt-gagga-tt---gagatat
     Mexican tetra (cavefish)  attaatgtttgaataatatgtgcctgga-ggggcagctataaattagaagg-gagaa-tt---gagatat
                  Spotted gar  attaatgtttgaataatatgtgcctggaggggttggccataaattaggagg-tagaa-ttatagagatat
                 Weddell seal  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                        Human  aaatttttatg
                        Chimp  aaatttttatg
                      Gorilla  aaatttttatg
                    Orangutan  aaatttttatg
                       Gibbon  aaatttttatg
                       Rhesus  aaatttttatg
          Crab-eating macaque  aaatttttatg
                       Baboon  aaatttttatg
                 Green monkey  aaatttttatg
                     Marmoset  aaatttttatg
              Squirrel monkey  aaatttttatg
                     Bushbaby  aaatttttatg
           Chinese tree shrew  aaatttttatg
                     Squirrel  aaatttttatg
       Lesser Egyptian jerboa  aaatttttatg
                 Prairie vole  aaatttttatg
              Chinese hamster  aaatttttatg
               Golden hamster  aaatttttatg
                        Mouse  aaatttttatg
                          Rat  aaatttttatg
               Naked mole-rat  aaatttttatg
                   Guinea pig  aaatttttatg
                   Chinchilla  aaatttttatg
             Brush-tailed rat  aaatttttatg
                       Rabbit  aaatttttatg
                         Pika  aaatttttatg
                          Pig  aaatttttatg
                       Alpaca  aaatttttatg
               Bactrian camel  aaatttttatg
                      Dolphin  aaatttttatg
                 Killer whale  aaatttttatg
             Tibetan antelope  aaatttttatg
                          Cow  aaatttttatg
                        Sheep  aaatttttatg
                Domestic goat  aaatttttatg
                        Horse  aaatttttatg
             White rhinoceros  aaatttttatg
                          Cat  aaatttttatg
                          Dog  aaatttttatg
                      Ferret   aaatttttatg
                        Panda  aaatttttatg
               Pacific walrus  aaatttttacg
             Black flying-fox  aaatttttatg
                      Megabat  aaatttttatg
                Big brown bat  aaatttttatg
         David's myotis (bat)  aaatttttatg
                     Microbat  aaatttttatg
                     Hedgehog  aaatttttatg
                        Shrew  aaatttttatg
              Star-nosed mole  aaatttttatg
                     Elephant  aaatttttatg
          Cape elephant shrew  aaatttttatg
                      Manatee  aaatttttatg
             Cape golden mole  aaatttttatg
                       Tenrec  aaatttttatg
                     Aardvark  aaatttttatg
                    Armadillo  aaatttttatg
                      Opossum  aaatttttatg
              Tasmanian devil  aaatttttatg
                      Wallaby  aaatttttatg
                     Platypus  aaatttttatg
                  Rock pigeon  aaatttttatg
                 Saker falcon  aaatttttatg
             Peregrine falcon  aaatttttatg
          Collared flycatcher  aaatttttatg
       White-throated sparrow  aaatttttatg
          Medium ground finch  aaatttttatg
                  Zebra finch  aaatttttatg
           Tibetan ground jay  aaatttttatg
                   Budgerigar  aaatttttatg
                       Parrot  aaatttttatg
                Scarlet macaw  aaatttttatg
                 Mallard duck  aaatttttatg
                      Chicken  aaatttttatg
                       Turkey  aaatttttatg
           American alligator  aaatttttatg
              Green seaturtle  aaatttttatg
               Painted turtle  aaatttttatg
     Chinese softshell turtle  aaatttttatg
       Spiny softshell turtle  aaatttttatg
                       Lizard  aaatttttatg
                X. tropicalis  aaatttttatg
                   Coelacanth  aaatttttatg
                    Tetraodon  atgtttctttg
                         Fugu  acgtttctctt
                 Nile tilapia  aaatttttatg
          Princess of Burundi  aaatttttatg
        Burton's mouthbreeder  aaatttttatg
                  Zebra mbuna  aaatttttatg
          Pundamilia nyererei  aaatttttatg
                       Medaka  aaatttttatg
           Southern platyfish  aaatttttatg
                  Stickleback  acatttttatg
                    Zebrafish  aaatttttatg
     Mexican tetra (cavefish)  aaatttttatg
                  Spotted gar  aaatttttatg
                 Weddell seal  NNNNNNNNNNN

Alignment block 28 of 764 in window, 94770266 - 94770301, 36 bps 
B D                     Human  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                     Chimp  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                   Gorilla  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                 Orangutan  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                    Gibbon  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                    Rhesus  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D       Crab-eating macaque  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                    Baboon  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D              Green monkey  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                  Marmoset  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D           Squirrel monkey  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                  Bushbaby  aggac-ta-gttatacatttccattatgtgttta-aaaa
           Chinese tree shrew  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                  Squirrel  aggac-ta-gttatacatttccattatgtgttta-aaaa
       Lesser Egyptian jerboa  aggac-ta-gttatacatttccattacgtgttta-aaaa
                 Prairie vole  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D           Chinese hamster  aggac-ta-gttatacatttccattatgtgttta-aaaa
               Golden hamster  aggac-ta-gttacacatttccattatgtgttta-aaaa
B D                     Mouse  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                       Rat  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D            Naked mole-rat  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                Guinea pig  aggac-ca-gttatacatttccattatgtgttta-aaaa
                   Chinchilla  agcac-ta-gttatacatttccattatgtgttta-aaaa
             Brush-tailed rat  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                    Rabbit  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                      Pika  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                       Pig  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                    Alpaca  aggac-ta-gttatacatttccattatgtgttta-aaaa
               Bactrian camel  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                   Dolphin  aggac-ta-gttatacatttccattatgtgttta-aaaa
                 Killer whale  aggac-ta-gttatacatttccattacgtgttta-aaaa
             Tibetan antelope  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                       Cow  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                     Sheep  aggac-ta-gttatacatttccattatgtgttta-aaaa
                Domestic goat  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                     Horse  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D          White rhinoceros  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                       Cat  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                       Dog  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                   Ferret   aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                     Panda  aggac-ta-gttatacatttccattatgtgttta-aaaa
               Pacific walrus  agaac-ta-gttatacatttccattatgtgttta-aaaa
             Black flying-fox  agaac-ta-gttatacatttccattatgtgttta-aaaa
B D                   Megabat  agaac-ta-gttatacatttccattatgtgttta-aaaa
                Big brown bat  aggac-ta-gttatacatttccattatgtgttta-aaaa
         David's myotis (bat)  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                  Microbat  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                  Hedgehog  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                     Shrew  aggac-ta-gttatacatttccattatgtgttta-aaaa
              Star-nosed mole  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                  Elephant  aggac-ta-gttatacgtttccattatgtgttta-aaaa
          Cape elephant shrew  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                   Manatee  aggac-ta-gttatacatttccattatgtgttta-aaaa
             Cape golden mole  aagac-ta-gttatacatttccattatgtgttta-aaaa
B D                    Tenrec  aagac-ca-gttatacatttccattatgtgttta-aaaa
                     Aardvark  aggac-ta-gttatacatttccattatgtgttta-aaaa
B D                 Armadillo  aggac-ta-gttatacatttccattatgtgttta-aaaa
B