Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 1055 in window, 100219345 - 100219354, 10 bps 
B D                     Human  gtctc----------------------aaaaa
B D                     Chimp  gtctc----------------------aaaaa
B D                   Gorilla  gtctc----------------------aaaaa
B D                 Orangutan  gtctc----------------------aaaaa
B D                    Gibbon  gtctc----------------------aaaaa
B D                    Rhesus  gtctc-aaaaaaaaaacaaaaacaaa-aaaca
B D       Crab-eating macaque  gtctcaaaaaaaaaaacaaaaacaaa-aaaca
B D                    Baboon  gtctcaaaaaaaaaaacaaaaacaaacaaaca
B D              Green monkey  gtctcaaaaa-----------------aaaaa
B D                  Marmoset  --------------------------------
B D           Squirrel monkey  --------------------------------
B D                       Rat  ================================
                Prairie vole  ================================
              Golden hamster  ================================
B D                     Mouse  ================================
      Lesser Egyptian jerboa  ================================
B D                      Pika  ================================
                Weddell seal  --------------------------------
B D                  Hedgehog  ================================
B D                     Shrew  ================================
B D                Guinea pig  ================================
B D                       Pig  ================================
B D                    Rabbit  --------------------------------
            Cape golden mole  ================================
                    Aardvark  --------------------------------
B D                Coelacanth  ================================
  D    Spiny softshell turtle  ================================
B D                   Megabat  ================================
B D                   Dolphin  --------------------------------
B D             X. tropicalis  ================================
B D              Atlantic cod  ================================
                 Spotted gar  ================================
B D               Stickleback  ================================
          Southern platyfish  ================================
      Yellowbelly pufferfish  ================================
B D                      Fugu  ================================
B D                 Tetraodon  ================================
B D                    Turkey  ================================
B D                   Chicken  ================================
  D              Mallard duck  ================================
          Tibetan ground jay  ================================
B D               Zebra finch  ================================
  D    White-throated sparrow  ================================
B D           Tasmanian devil  ================================
    Mexican tetra (cavefish)  ================================
B D                 Zebrafish  ================================
B D                    Medaka  ================================
         Pundamilia nyererei  ================================
                 Zebra mbuna  ================================
       Burton's mouthbreeder  ================================
         Princess of Burundi  ================================
B D              Nile tilapia  ================================
  D            Painted turtle  ================================
  D           Green seaturtle  ================================
B D        American alligator  ================================
B D                Budgerigar  ================================
B D                   Opossum  ================================
B D            Naked mole-rat  ================================
  D               Rock pigeon  ================================
  D       Collared flycatcher  ================================
B D       Medium ground finch  ================================
B D                    Lizard  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
  D                    Parrot  ================================
            Brush-tailed rat  ================================
                  Chinchilla  ================================
         Cape elephant shrew  ================================
          Chinese tree shrew  ================================
B D                  Platypus  ================================
B D                   Manatee  --------------------------------
B D                  Elephant  --------------------------------
B D           Chinese hamster  ================================
B D                    Tenrec  --------------------------------
B D                       Cat  ================================
B D                  Bushbaby  ================================
  D  Chinese softshell turtle  ================================
B D                   Ferret   --------------------------------
             Star-nosed mole  ================================
               Domestic goat  ================================
B D                     Sheep  ================================
            Tibetan antelope  ================================
              Bactrian camel  --------------------------------
B D                    Alpaca  --------------------------------
              Pacific walrus  --------------------------------
B D                     Panda  --------------------------------
                Killer whale  --------------------------------
B D                       Dog  --------------------------------
            Black flying-fox  ================================
B D          White rhinoceros  --------------------------------
B D                     Horse  ================================
B D                  Squirrel  ================================
B D                 Armadillo  ================================
        David's myotis (bat)  --------------------------------
               Big brown bat  --------------------------------
B D                  Microbat  --------------------------------
B D                       Cow  --------------------------------

Alignment block 2 of 1055 in window, 100219355 - 100219355, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Elephant  a
B D                   Manatee  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
                Weddell seal  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  -
            Cape golden mole  =
                    Aardvark  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                    Tenrec  -
B D                       Cat  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
B D                     Panda  -
                Killer whale  -
B D                       Dog  -
            Black flying-fox  =
B D          White rhinoceros  -
B D                     Horse  =
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D           Squirrel monkey  -
B D                  Marmoset  -
B D                       Cow  -

Alignment block 3 of 1055 in window, 100219356 - 100219356, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
           Chinese tree shrew  a
B D                  Elephant  a
B D                   Manatee  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
                Weddell seal  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  -
            Cape golden mole  =
                    Aardvark  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                    Tenrec  -
B D                       Cat  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
B D                     Panda  -
                Killer whale  -
B D                       Dog  -
            Black flying-fox  =
B D          White rhinoceros  -
B D                     Horse  =
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D           Squirrel monkey  -
B D                  Marmoset  -
B D                       Cow  -

Alignment block 4 of 1055 in window, 100219357 - 100219357, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  c
B D              Green monkey  a
           Chinese tree shrew  a
B D            Naked mole-rat  a
B D                  Elephant  a
B D                   Manatee  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
                Weddell seal  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  -
            Cape golden mole  =
                    Aardvark  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                    Tenrec  -
B D                       Cat  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
B D                     Panda  -
                Killer whale  -
B D                       Dog  -
            Black flying-fox  =
B D          White rhinoceros  -
B D                     Horse  =
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D           Squirrel monkey  -
B D                  Marmoset  -
B D                       Cow  -

Alignment block 5 of 1055 in window, 100219358 - 100219361, 4 bps 
B D                     Human  aaaa-
B D                     Chimp  a----
B D                   Gorilla  a-aa-
B D                 Orangutan  a--a-
B D                    Gibbon  a-aa-
B D                    Rhesus  aaaa-
B D       Crab-eating macaque  aaaa-
B D                    Baboon  aaaa-
B D              Green monkey  aaaa-
           Chinese tree shrew  atat-
B D            Naked mole-rat  taaa-
             Black flying-fox  -aaa-
B D                   Megabat  -aaa-
B D                  Elephant  -acac
B D                   Manatee  -acat
B D                       Rat  =====
                Prairie vole  =====
              Golden hamster  =====
B D                     Mouse  =====
      Lesser Egyptian jerboa  =====
B D                      Pika  =====
                Weddell seal  -----
B D                  Hedgehog  =====
B D                     Shrew  =====
B D                Guinea pig  =====
B D                       Pig  =====
B D                    Rabbit  -----
            Cape golden mole  =====
                    Aardvark  -----
B D                Coelacanth  =====
  D    Spiny softshell turtle  =====
B D                   Dolphin  -----
B D             X. tropicalis  =====
B D              Atlantic cod  =====
                 Spotted gar  =====
B D               Stickleback  =====
          Southern platyfish  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
B D                 Tetraodon  =====
B D                    Turkey  =====
B D                   Chicken  =====
  D              Mallard duck  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
  D    White-throated sparrow  =====
B D           Tasmanian devil  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D                    Medaka  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D              Nile tilapia  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D        American alligator  =====
B D                Budgerigar  =====
B D                   Opossum  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D       Medium ground finch  =====
B D                    Lizard  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
            Brush-tailed rat  =====
                  Chinchilla  =====
         Cape elephant shrew  =====
B D                  Platypus  =====
B D           Chinese hamster  =====
B D                    Tenrec  -----
B D                       Cat  =====
B D                  Bushbaby  =====
  D  Chinese softshell turtle  =====
B D                   Ferret   -----
             Star-nosed mole  =====
               Domestic goat  =====
B D                     Sheep  =====
            Tibetan antelope  =====
              Bactrian camel  -----
B D                    Alpaca  -----
              Pacific walrus  -----
B D                     Panda  -----
                Killer whale  -----
B D                       Dog  -----
B D          White rhinoceros  -----
B D                     Horse  =====
B D                  Squirrel  =====
B D                 Armadillo  =====
        David's myotis (bat)  -----
               Big brown bat  -----
B D                  Microbat  -----
B D           Squirrel monkey  -----
B D                  Marmoset  -----
B D                       Cow  -----

Inserts between block 5 and 6 in window
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 6 of 1055 in window, 100219362 - 100219362, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -g
B D           Squirrel monkey  -t
           Chinese tree shrew  -a
B D            Naked mole-rat  -t
B D                       Cat  -t
B D                       Dog  -t
B D                     Panda  -t
               Pacific walrus  -t
                 Weddell seal  -t
             Black flying-fox  -c
B D                   Megabat  -c
B D                  Elephant  a-
B D                   Manatee  g-
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                       Pig  ==
B D                    Rabbit  --
            Cape golden mole  ==
                    Aardvark  --
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
B D                   Dolphin  --
B D             X. tropicalis  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D           Chinese hamster  ==
B D                    Tenrec  --
B D                  Bushbaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   --
             Star-nosed mole  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
              Bactrian camel  --
B D                    Alpaca  --
                Killer whale  --
B D          White rhinoceros  --
B D                     Horse  ==
B D                  Squirrel  ==
B D                 Armadillo  ==
        David's myotis (bat)  --
               Big brown bat  --
B D                  Microbat  --
B D                       Cow  --

Alignment block 7 of 1055 in window, 100219363 - 100219364, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
           Chinese tree shrew  tt
B D            Naked mole-rat  tt
B D                     Horse  tt
B D                       Cat  tt
B D                       Dog  ct
B D                     Panda  tt
               Pacific walrus  tt
                 Weddell seal  tt
             Black flying-fox  at
B D                   Megabat  at
B D                  Elephant  tt
B D                   Manatee  tt
                     Aardvark  tt
B D                 Armadillo  tt
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  ==
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                       Pig  ==
B D                    Rabbit  --
            Cape golden mole  ==
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
B D                   Dolphin  --
B D             X. tropicalis  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                Budgerigar  ==
B D                   Opossum  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D           Chinese hamster  ==
B D                    Tenrec  --
B D                  Bushbaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   --
             Star-nosed mole  ==
               Domestic goat  ==
B D                     Sheep  ==
            Tibetan antelope  ==
              Bactrian camel  --
B D                    Alpaca  --
                Killer whale  --
B D          White rhinoceros  --
B D                  Squirrel  ==
        David's myotis (bat)  --
               Big brown bat  --
B D                  Microbat  --
B D                       Cow  --

Alignment block 8 of 1055 in window, 100219365 - 100219365, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
           Chinese tree shrew  g
B D            Naked mole-rat  a
B D                     Horse  g
B D                       Cat  g
B D                       Dog  c
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  a
             Black flying-fox  g
B D                   Megabat  g
B D                  Elephant  g
B D                   Manatee  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  -
            Cape golden mole  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  -
B D                    Alpaca  -
                Killer whale  -
B D          White rhinoceros  -
B D                  Squirrel  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D                       Cow  -

Alignment block 9 of 1055 in window, 100219366 - 100219366, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
           Chinese tree shrew  t
B D                    Rabbit  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
B D                     Horse  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Elephant  c
B D                   Manatee  c
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  t
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
            Cape golden mole  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D          White rhinoceros  -
B D                  Squirrel  =
B D                       Cow  -

Alignment block 10 of 1055 in window, 100219367 - 100219367, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
B D                     Horse  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
B D          White rhinoceros  -
B D                  Squirrel  =
B D                       Cow  -

Alignment block 11 of 1055 in window, 100219368 - 100219368, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
           Chinese tree shrew  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Elephant  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  c
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  =
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  =
B D                     Sheep  =
            Tibetan antelope  =
              Bactrian camel  -
B D                    Alpaca  -
                Killer whale  -
B D                  Squirrel  =
B D                       Cow  -

Alignment block 12 of 1055 in window, 100219369 - 100219370, 2 bps 
B D                     Human  -tt
B D                     Chimp  -tt
B D                   Gorilla  -tt
B D                 Orangutan  -tt
B D                    Gibbon  -tt
B D                    Rhesus  -tt
B D       Crab-eating macaque  -tt
B D                    Baboon  -tt
B D              Green monkey  -tt
B D                  Marmoset  -tt
B D           Squirrel monkey  -tt
           Chinese tree shrew  -ta
B D                Guinea pig  -tt
             Brush-tailed rat  -tt
B D                    Rabbit  -tt
B D                      Pika  -tt
B D                    Alpaca  -tt
               Bactrian camel  -tt
B D                   Dolphin  -tt
                 Killer whale  -tt
B D                     Horse  -tt
B D          White rhinoceros  -tt
B D                       Cat  -tt
B D                       Dog  -tt
B D                   Ferret   -tt
B D                     Panda  -tt
               Pacific walrus  -tt
                 Weddell seal  -tt
             Black flying-fox  -tt
B D                   Megabat  -tt
                Big brown bat  -tt
         David's myotis (bat)  -tt
B D                  Microbat  -tt
B D                  Elephant  at-
B D                   Manatee  at-
             Cape golden mole  at-
B D                    Tenrec  at-
                     Aardvark  at-
B D                 Armadillo  tt-
B D                       Rat  ===
                Prairie vole  ===
              Golden hamster  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                       Pig  ===
B D                Coelacanth  ===
  D    Spiny softshell turtle  ===
B D             X. tropicalis  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                Budgerigar  ===
B D                   Opossum  ===
B D            Naked mole-rat  ---
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
                  Chinchilla  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D           Chinese hamster  ===
B D                  Bushbaby  ===
  D  Chinese softshell turtle  ===
             Star-nosed mole  ===
               Domestic goat  ===
B D                     Sheep  ===
            Tibetan antelope  ===
B D                  Squirrel  ===
B D                       Cow  ---

Inserts between block 12 and 13 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp

Alignment block 13 of 1055 in window, 100219371 - 100219394, 24 bps 
B D                     Human  taaacatttt----tctaataaaattct
B D                     Chimp  taaacatttt----tctaataaaattct
B D                   Gorilla  taaacatttt----tctaataaaattct
B D                 Orangutan  taaacatttt----tctaataaaattct
B D                    Gibbon  taaacatttt----tctaataaaattct
B D                    Rhesus  tgaacatttt----tctaataaaattct
B D       Crab-eating macaque  tgaacatttt----tctaataaaattct
B D                    Baboon  tgaacatttt----tctaataaaattct
B D              Green monkey  taaacatttt----tctaataaaattct
B D                  Marmoset  taaacatttt----tctaataaaattcg
B D           Squirrel monkey  taaatatttt----tctaataaaattct
           Chinese tree shrew  taaatagttt----cctaataaagttct
B D            Naked mole-rat  aaaatatttc----cctaataagattct
B D                Guinea pig  aaaatagttc----cctgataagattct
             Brush-tailed rat  taaata----------taataagattct
B D                    Rabbit  tgagcatttt----tctaataaaat---
B D                      Pika  taaatatttt----tctaacaaaattct
B D                    Alpaca  taaatgtttt----cctaataaattcct
               Bactrian camel  taaatgtttt----cctaataaatttct
B D                   Dolphin  taaacatttt----cctaataaatttct
                 Killer whale  taaacatttt----cctaataaatttct
             Tibetan antelope  taaacatttt----cttaataaatttct
B D                       Cow  taaacatttt----cttaataaatttct
B D                     Sheep  taaacatttt----cttaataaatttct
                Domestic goat  taaacatttt----cttaataaatttct
B D                     Horse  taaccacttt----cttattaaatttct
B D          White rhinoceros  taaacacttt----cctaatgaatttct
B D                       Cat  taaacacttt----cctaataaatttct
B D                       Dog  taaatacttt----cttcataaatttct
B D                   Ferret   taaatacttc----cctgataaagttct
B D                     Panda  taaacactcc----cctaacaaatttct
               Pacific walrus  taaacacttc----cctaataaatttct
                 Weddell seal  taaacacttc----cctaataaatttct
             Black flying-fox  taaacacttt----cctaataaatttct
B D                   Megabat  taaacacttt----cctaataaatttct
                Big brown bat  taaacacttt----cctagtaaacttct
         David's myotis (bat)  taaacacttt----cctaataaatttct
B D                  Microbat  taaacacttt----cctaataaatttct
B D                  Elephant  taaacatttt----cctaatacattcct
B D                   Manatee  taaacatttt----cctaatatacttct
             Cape golden mole  taaacatttt----tctattacatttct
B D                    Tenrec  taaaca-ctt----cctaatgcatttcc
                     Aardvark  taaacatttttttccctaatacatttct
B D                 Armadillo  taaacatttt----cctaataaaattct
B D                       Rat  ============================
                Prairie vole  ============================
              Golden hamster  ============================
B D                     Mouse  ============================
      Lesser Egyptian jerboa  ============================
B D                  Hedgehog  ============================
B D                     Shrew  ============================
B D                       Pig  ============================
B D                Coelacanth  ============================
  D    Spiny softshell turtle  ============================
B D             X. tropicalis  ============================
B D              Atlantic cod  ============================
                 Spotted gar  ============================
B D               Stickleback  ============================
          Southern platyfish  ============================
      Yellowbelly pufferfish  ============================
B D                      Fugu  ============================
B D                 Tetraodon  ============================
B D                    Turkey  ============================
B D                   Chicken  ============================
  D              Mallard duck  ============================
          Tibetan ground jay  ============================
B D               Zebra finch  ============================
  D    White-throated sparrow  ============================
B D           Tasmanian devil  ============================
    Mexican tetra (cavefish)  ============================
B D                 Zebrafish  ============================
B D                    Medaka  ============================
         Pundamilia nyererei  ============================
                 Zebra mbuna  ============================
       Burton's mouthbreeder  ============================
         Princess of Burundi  ============================
B D              Nile tilapia  ============================
  D            Painted turtle  ============================
  D           Green seaturtle  ============================
B D        American alligator  ============================
B D                Budgerigar  ============================
B D                   Opossum  ============================
  D               Rock pigeon  ============================
  D       Collared flycatcher  ============================
B D       Medium ground finch  ============================
B D                    Lizard  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
  D                    Parrot  ============================
                  Chinchilla  ============================
         Cape elephant shrew  ============================
B D                  Platypus  ============================
B D           Chinese hamster  ============================
B D                  Bushbaby  ============================
  D  Chinese softshell turtle  ============================
             Star-nosed mole  ============================
B D                  Squirrel  ============================

Inserts between block 13 and 14 in window
B D                Armadillo 2bp

Alignment block 14 of 1055 in window, 100219395 - 100219401, 7 bps 
B D                     Human  catttat----
B D                     Chimp  cat--------
B D                   Gorilla  catttgt----
B D                 Orangutan  catttat----
B D                    Gibbon  catttat----
B D                    Rhesus  catttat----
B D       Crab-eating macaque  catttat----
B D                    Baboon  catttat----
B D              Green monkey  cattaat----
B D                  Marmoset  aatttac----
B D           Squirrel monkey  aacttac----
           Chinese tree shrew  tatttat----
B D            Naked mole-rat  tatttat----
B D                Guinea pig  tgtttac----
             Brush-tailed rat  catttgt----
B D                    Rabbit  -acttat----
B D                    Alpaca  catttat----
               Bactrian camel  catttat----
B D                   Dolphin  catatac----
                 Killer whale  catatac----
             Tibetan antelope  catattc----
B D                       Cow  cacattc----
B D                     Sheep  catattc----
                Domestic goat  catattc----
B D                     Horse  catttat----
B D          White rhinoceros  catttat----
B D                       Cat  c----at----
B D                       Dog  catttat----
B D                   Ferret   catttat----
B D                     Panda  catttat----
               Pacific walrus  catttat----
                 Weddell seal  catttat----
             Black flying-fox  c----------
B D                   Megabat  c----------
B D                  Elephant  --cttgtttac
B D                   Manatee  --cttgtttac
             Cape golden mole  --cttatttac
B D                    Tenrec  --cttattgac
                     Aardvark  --cttatatac
B D                 Armadillo  --cttat----
B D                       Rat  ===========
                Prairie vole  ===========
              Golden hamster  ===========
B D                     Mouse  ===========
      Lesser Egyptian jerboa  ===========
B D                      Pika  -----------
B D                  Hedgehog  ===========
B D                     Shrew  ===========
B D                       Pig  ===========
B D                Coelacanth  ===========
  D    Spiny softshell turtle  ===========
B D             X. tropicalis  ===========
B D              Atlantic cod  ===========
                 Spotted gar  ===========
B D               Stickleback  ===========
          Southern platyfish  ===========
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
B D                 Tetraodon  ===========
B D                    Turkey  ===========
B D                   Chicken  ===========
  D              Mallard duck  ===========
          Tibetan ground jay  ===========
B D               Zebra finch  ===========
  D    White-throated sparrow  ===========
B D           Tasmanian devil  ===========
    Mexican tetra (cavefish)  ===========
B D                 Zebrafish  ===========
B D                    Medaka  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D              Nile tilapia  ===========
  D            Painted turtle  ===========
  D           Green seaturtle  ===========
B D        American alligator  ===========
B D                Budgerigar  ===========
B D                   Opossum  ===========
  D               Rock pigeon  ===========
  D       Collared flycatcher  ===========
B D       Medium ground finch  ===========
B D                    Lizard  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
  D                    Parrot  ===========
                  Chinchilla  ===========
         Cape elephant shrew  ===========
B D                  Platypus  ===========
B D           Chinese hamster  ===========
B D                  Bushbaby  ===========
  D  Chinese softshell turtle  ===========
             Star-nosed mole  ===========
B D                  Squirrel  ===========
        David's myotis (bat)  -----------
               Big brown bat  -----------
B D                  Microbat  -----------

Inserts between block 14 and 15 in window
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 43bp
B D                      Cow 43bp
B D                    Sheep 43bp
               Domestic goat 43bp

Alignment block 15 of 1055 in window, 100219402 - 100219441, 40 bps 
B D                     Human  atttataaacagcacggaataaggatcaaatgtaagataa
B D                     Chimp  atttataaacagcatggaataaggatcaaatgtaagataa
B D                   Gorilla  atttataaacagcatggaataaggatcaaatgtaagataa
B D                 Orangutan  atttataaacagcatggaataaggatcaaatgtaagataa
B D                    Gibbon  atttataaacagcatggaataaggatcaaatgtaagataa
B D                    Rhesus  atttataagcagtgtggaataaggatcaaatgtaagataa
B D       Crab-eating macaque  atttataagcagtgtggaataaggatcaaatgtaagataa
B D                    Baboon  atttataagcagtgtggaataaggatcaaatgtaagataa
B D              Green monkey  atttacaaacagcatggaataaggatcaaatgtaagataa
B D                  Marmoset  atttataaacagcatgaaat----ttcaaatgtaagatag
B D           Squirrel monkey  atttataaacagaatgaaataaagatcaaatgtaagatag
           Chinese tree shrew  attt--aaatagcacgaaataagaatcaaacatcaaataa
B D            Naked mole-rat  atttatatgcagtataaaataagaatcaaatacaatgtga
B D                Guinea pig  atttatacaca-tgtaaaataagaatccaatgtgatataa
             Brush-tailed rat  atttatacacagtataaaatgagaatcaaatatgatgtga
B D                    Rabbit  atttacaaatagcatgaactaagactcaaatgtgaattaa
B D                       Pig  atatatatacggcatgaaat--gaatcgaatgcaagataa
B D                    Alpaca  ttatacatatggcataagacaagaatcaaatgtgaggtca
               Bactrian camel  ttatatatatggcataagacaagaatcaaatgtgaggtca
B D                   Dolphin  -------------atgaaatgagaatcaaatgtgaggtaa
                 Killer whale  -------------atgaaatgagaatcaaatgtgaggtaa
             Tibetan antelope  atgtataaatggcatgaattaataatcaaatgtgaggtaa
B D                       Cow  atgtatatatagcatgaattaagaatcaaatgtgaggtaa
B D                     Sheep  atgtatatatggcatgaattaataatcaaatgtgaggtaa
                Domestic goat  atgtatatatggcatgaattaataatcaaatgtgaggtaa
B D                     Horse  atttataaatagcatgaaataagaatcaaatgtgaggtaa
B D          White rhinoceros  atttataaatagc-----agaagaatcaaatgtgaggtaa
B D                       Cat  atttacaaatagtataaaataagagtcaaatgtaagacaa
B D                       Dog  atttacaagtagtataaaataagaataaaatgtgaggcaa
B D                   Ferret   actt--aaatagtatacaataagaatcatatgtgaggcaa
B D                     Panda  atttgcaaatggtaatcaataaaaatccaatgtgagacaa
               Pacific walrus  atttacaaatagtatagagtaagaatcaaatgtgaggcaa
                 Weddell seal  acttacaaatagtatagagtaagaatcaaatgtgaggcaa
             Black flying-fox  attaataagtagcatgaaataagaatcaaatgtgaggtga
B D                   Megabat  attaataagtagcatgaaataagaatcaaatgtgaggtga
                Big brown bat  -tttataagtagcatgaaataaggatcagaggggaggtaa
         David's myotis (bat)  -cttataagtcgcatgaaataaggaccagatgggaggtaa
B D                  Microbat  -tttataagtctcgtgaaataaggatcaggtgggaggtaa
B D                  Elephant  atctataaatagcacaaaataagactcaaatgtgaagcaa
B D                   Manatee  atctataaacagcacaaaataagaatcaaatgtgaggcaa
             Cape golden mole  atttttaaaaagcacaaaataagaaacaaatgcaaggtaa
B D                    Tenrec  atccata-----tatttaataagaagcgaatgtgaaataa
                     Aardvark  atctataaatagcacaaaataagattcaaatgtgaggtga
B D                 Armadillo  -----taaatagcatgaactaagaatcaaatgtggggtaa
B D                       Rat  ========================================
                Prairie vole  ========================================
              Golden hamster  ========================================
B D                     Mouse  ========================================
      Lesser Egyptian jerboa  ========================================
B D                      Pika  ----------------------------------------
B D                  Hedgehog  ========================================
B D                     Shrew  ========================================
B D                Coelacanth  ========================================
  D    Spiny softshell turtle  ========================================
B D             X. tropicalis  ========================================
B D              Atlantic cod  ========================================
                 Spotted gar  ========================================
B D               Stickleback  ========================================
          Southern platyfish  ========================================
      Yellowbelly pufferfish  ========================================
B D                      Fugu  ========================================
B D                 Tetraodon  ========================================
B D                    Turkey  ========================================
B D                   Chicken  ========================================
  D              Mallard duck  ========================================
          Tibetan ground jay  ========================================
B D               Zebra finch  ========================================
  D    White-throated sparrow  ========================================
B D           Tasmanian devil  ========================================
    Mexican tetra (cavefish)  ========================================
B D                 Zebrafish  ========================================
B D                    Medaka  ========================================
         Pundamilia nyererei  ========================================
                 Zebra mbuna  ========================================
       Burton's mouthbreeder  ========================================
         Princess of Burundi  ========================================
B D              Nile tilapia  ========================================
  D            Painted turtle  ========================================
  D           Green seaturtle  ========================================
B D        American alligator  ========================================
B D                Budgerigar  ========================================
B D                   Opossum  ========================================
  D               Rock pigeon  ========================================
  D       Collared flycatcher  ========================================
B D       Medium ground finch  ========================================
B D                    Lizard  ========================================
  D          Peregrine falcon  ========================================
  D              Saker falcon  ========================================
  D                    Parrot  ========================================
                  Chinchilla  ========================================
         Cape elephant shrew  ========================================
B D                  Platypus  ========================================
B D           Chinese hamster  ========================================
B D                  Bushbaby  ========================================
  D  Chinese softshell turtle  ========================================
             Star-nosed mole  ========================================
B D                  Squirrel  ========================================

Inserts between block 15 and 16 in window
B D                Armadillo 2bp

Alignment block 16 of 1055 in window, 100219442 - 100219444, 3 bps 
B D                     Human  att
B D                     Chimp  att
B D                   Gorilla  att
B D                 Orangutan  att
B D                    Gibbon  att
B D                    Rhesus  att
B D       Crab-eating macaque  att
B D                    Baboon  att
B D              Green monkey  att
B D                  Marmoset  att
B D           Squirrel monkey  att
           Chinese tree shrew  act
B D            Naked mole-rat  act
B D                Guinea pig  att
             Brush-tailed rat  act
B D                    Rabbit  gtc
B D                       Pig  att
B D                    Alpaca  att
               Bactrian camel  att
B D                   Dolphin  att
                 Killer whale  att
             Tibetan antelope  att
B D                       Cow  att
B D                     Sheep  att
                Domestic goat  att
B D                     Horse  ttt
B D          White rhinoceros  att
B D                       Cat  att
B D                       Dog  att
B D                   Ferret   atg
B D                     Panda  atg
               Pacific walrus  atg
                 Weddell seal  atg
             Black flying-fox  att
B D                   Megabat  att
                Big brown bat  att
         David's myotis (bat)  att
B D                  Microbat  att
B D                  Elephant  atg
B D                   Manatee  atg
             Cape golden mole  atg
B D                    Tenrec  atg
                     Aardvark  atg
B D                       Rat  ===
                Prairie vole  ===
              Golden hamster  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  ---
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Coelacanth  ===
  D    Spiny softshell turtle  ===
B D             X. tropicalis  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                Budgerigar  ===
B D                   Opossum  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
                  Chinchilla  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D           Chinese hamster  ===
B D                  Bushbaby  ===
  D  Chinese softshell turtle  ===
             Star-nosed mole  ===
B D                  Squirrel  ===
B D                 Armadillo  ===

Alignment block 17 of 1055 in window, 100219445 - 100219445, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  g
B D            Naked mole-rat  a
B D                Guinea pig  a
             Brush-tailed rat  g
B D                    Rabbit  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
             Tibetan antelope  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
                Killer whale  -
            Black flying-fox  -
B D                  Squirrel  =
B D                 Armadillo  =
B D                       Cow  -

Alignment block 18 of 1055 in window, 100219446 - 100219448, 3 bps 
B D                     Human  tat
B D                     Chimp  tat
B D                   Gorilla  tat
B D                 Orangutan  tat
B D                    Gibbon  tat
B D                    Rhesus  cat
B D       Crab-eating macaque  cat
B D                    Baboon  cat
B D              Green monkey  cat
B D                  Marmoset  tat
B D           Squirrel monkey  tat
           Chinese tree shrew  tat
B D            Naked mole-rat  tat
B D                Guinea pig  tat
             Brush-tailed rat  tat
B D                    Rabbit  tat
B D                       Pig  cat
             Tibetan antelope  cat
B D                     Sheep  cat
                Domestic goat  cat
B D                     Horse  tat
B D          White rhinoceros  cat
B D                       Cat  cat
B D                       Dog  cat
B D                   Ferret   cat
B D                     Panda  cat
               Pacific walrus  cat
                 Weddell seal  cat
B D                   Megabat  cat
                Big brown bat  cac
         David's myotis (bat)  cac
B D                  Microbat  cac
B D                  Elephant  tat
B D                   Manatee  tat
             Cape golden mole  tat
B D                    Tenrec  cat
                     Aardvark  tat
B D                       Rat  ===
                Prairie vole  ===
              Golden hamster  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
B D                      Pika  ---
B D                  Hedgehog  ===
B D                     Shrew  ===
B D                Coelacanth  ===
  D    Spiny softshell turtle  ===
B D                   Dolphin  ---
B D             X. tropicalis  ===
B D              Atlantic cod  ===
                 Spotted gar  ===
B D               Stickleback  ===
          Southern platyfish  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
B D                 Tetraodon  ===
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
B D           Tasmanian devil  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D                    Medaka  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D              Nile tilapia  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
B D                Budgerigar  ===
B D                   Opossum  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
B D                    Lizard  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
                  Chinchilla  ===
         Cape elephant shrew  ===
B D                  Platypus  ===
B D           Chinese hamster  ===
B D                  Bushbaby  ===
  D  Chinese softshell turtle  ===
             Star-nosed mole  ===
              Bactrian camel  ---
B D                    Alpaca  ---
                Killer whale  ---
            Black flying-fox  ---
B D                  Squirrel  ===
B D                 Armadillo  ===
B D                       Cow  ---

Alignment block 19 of 1055 in window, 100219449 - 100219449, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  t
B D           Squirrel monkey  t
           Chinese tree shrew  g
B D            Naked mole-rat  g
B D                Guinea pig  g
             Brush-tailed rat  g
B D                    Rabbit  a
B D                       Pig  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
                Killer whale  -
            Black flying-fox  -
B D                  Squirrel  =
B D                 Armadillo  =
B D                       Cow  -

Inserts between block 19 and 20 in window
            Brush-tailed rat 710bp

Alignment block 20 of 1055 in window, 100219450 - 100219450, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  a
B D            Naked mole-rat  a
B D                Guinea pig  a
B D                    Rabbit  a
B D                       Pig  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
B D                   Megabat  a
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Elephant  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D           Chinese hamster  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
                Killer whale  -
            Black flying-fox  -
B D                  Squirrel  =
B D                 Armadillo  =
B D                       Cow  -

Alignment block 21 of 1055 in window, 100219451 - 100219451, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  a
B D                Guinea pig  a
B D                    Rabbit  a
B D                       Pig  a
B D                     Horse  a
B D                       Dog  a
B D                     Panda  a
               Pacific walrus  a
B D                  Elephant  a
                     Aardvark  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
                Weddell seal  -
B D                  Hedgehog  =
B D                     Shrew  =
            Cape golden mole  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Megabat  -
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Manatee  -
B D           Chinese hamster  =
B D                    Tenrec  -
B D                       Cat  -
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
                Killer whale  -
            Black flying-fox  -
B D          White rhinoceros  -
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D                       Cow  -

Inserts between block 21 and 22 in window
B D                      Pig 1bp

Alignment block 22 of 1055 in window, 100219452 - 100219452, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
           Chinese tree shrew  a
B D                Guinea pig  a
B D                    Rabbit  a
B D                     Horse  a
B D                       Dog  a
B D                     Panda  a
               Pacific walrus  a
B D                   Megabat  a
B D                  Elephant  a
                     Aardvark  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
                Weddell seal  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                       Pig  =
            Cape golden mole  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Manatee  -
B D           Chinese hamster  =
B D                    Tenrec  -
B D                       Cat  -
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
                Killer whale  -
            Black flying-fox  -
B D          White rhinoceros  -
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D                       Cow  -

Inserts between block 22 and 23 in window
B D                  Megabat 1bp

Alignment block 23 of 1055 in window, 100219453 - 100219454, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  aa
B D           Squirrel monkey  aa
           Chinese tree shrew  ga
B D                Guinea pig  ta
B D                    Rabbit  aa
B D                     Horse  ga
B D                       Dog  ga
B D                     Panda  ga
               Pacific walrus  ga
B D                  Elephant  ga
                     Aardvark  ca
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  --
                Weddell seal  --
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                       Pig  ==
            Cape golden mole  --
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
B D                   Megabat  ==
B D                   Dolphin  --
B D             X. tropicalis  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                Budgerigar  ==
B D                   Opossum  ==
B D            Naked mole-rat  --
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D                   Manatee  --
B D           Chinese hamster  ==
B D                    Tenrec  --
B D                       Cat  --
B D                  Bushbaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   --
             Star-nosed mole  ==
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
              Bactrian camel  --
B D                    Alpaca  --
                Killer whale  --
            Black flying-fox  --
B D          White rhinoceros  --
B D                  Squirrel  ==
B D                 Armadillo  ==
        David's myotis (bat)  --
               Big brown bat  --
B D                  Microbat  --
B D                       Cow  --

Inserts between block 23 and 24 in window
B D                 Elephant 1bp

Alignment block 24 of 1055 in window, 100219455 - 100219455, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -c
B D           Squirrel monkey  -c
           Chinese tree shrew  -a
B D                Guinea pig  -a
B D                    Rabbit  -a
B D                     Horse  -a
B D                       Dog  -a
B D                     Panda  -a
               Pacific walrus  -a
                     Aardvark  c-
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  --
                Weddell seal  --
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                       Pig  ==
            Cape golden mole  --
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
B D                   Megabat  ==
B D                   Dolphin  --
B D             X. tropicalis  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                Budgerigar  ==
B D                   Opossum  ==
B D            Naked mole-rat  --
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
         Cape elephant shrew  ==
B D                  Platypus  ==
B D                   Manatee  --
B D                  Elephant  ==
B D           Chinese hamster  ==
B D                    Tenrec  --
B D                       Cat  --
B D                  Bushbaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   --
             Star-nosed mole  ==
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
              Bactrian camel  --
B D                    Alpaca  --
                Killer whale  --
            Black flying-fox  --
B D          White rhinoceros  --
B D                  Squirrel  ==
B D                 Armadillo  ==
        David's myotis (bat)  --
               Big brown bat  --
B D                  Microbat  --
B D                       Cow  --

Inserts between block 24 and 25 in window
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
B D                   Rabbit 63bp

Alignment block 25 of 1055 in window, 100219456 - 100219456, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
           Chinese tree shrew  t
B D                Guinea pig  t
B D                     Panda  t
                     Aardvark  t
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
                Weddell seal  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  -
B D                       Cat  -
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
                Killer whale  -
B D                       Dog  -
            Black flying-fox  -
B D          White rhinoceros  -
B D                     Horse  -
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D                       Cow  -

Inserts between block 25 and 26 in window
          Chinese tree shrew 10bp
B D               Guinea pig 93bp
B D                    Panda 108bp

Alignment block 26 of 1055 in window, 100219457 - 100219457, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
                     Aardvark  g
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
                Weddell seal  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
            Cape golden mole  -
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Megabat  =
B D                   Dolphin  -
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
B D            Naked mole-rat  -
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
         Cape elephant shrew  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                   Manatee  -
B D                  Elephant  =
B D           Chinese hamster  =
B D                    Tenrec  -
B D                       Cat  -
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
B D                   Ferret   -
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
B D                     Panda  =
                Killer whale  -
B D                       Dog  -
            Black flying-fox  -
B D          White rhinoceros  -
B D                     Horse  -
B D                  Squirrel  =
B D                 Armadillo  =
        David's myotis (bat)  -
               Big brown bat  -
B D                  Microbat  -
B D                       Cow  -

Inserts between block 26 and 27 in window
                    Aardvark 221bp

Alignment block 27 of 1055 in window, 100219458 - 100219693, 236 bps 
B D                     Human  ggctgggcacaatggctcatgcctgtaatcctaacactctagcaggccaaggtgggtggatcacttactt
B D                     Chimp  ggctgtgcacaatggctcacgcctgtaatcccaacactctagcaggccaaggtgggtggatcacttactt
B D                   Gorilla  ggctgggcacaatggcttatgcctgtaatcccaacactctagcaggccaaggtgggtggatcacttactt
B D                 Orangutan  ggctgggcacaatggctcacgcctgtaatcccaacactctaacaggccaaggtgggtggatcacttactt
B D                    Gibbon  ggctgggcacaatggctcatgcctgtaatcccaacactctagcaggccaaggtgggtggatcacttactt
B D                    Rhesus  ggcttggcaca-tggctcatgcctgtaatcccaatactctagcaggccaaggtgggtggatcacttactt
B D       Crab-eating macaque  ggcttggcaca-tggctcatgcctgtaatcccaatactctagcaggccaaggtgggtggatcacttactt
B D                    Baboon  ggcttggcacagtggctcatgaatgtaatcccaatactctagcaggccaaggtgggtggatcacttactt
B D              Green monkey  ggctgggcacaatggttcacacctgtaatcccaatactctagcaggccaaggtgggtggatcacttactt
B D                  Marmoset  ggctggatgcagtggctcacacctgtaatcccaacactctggcaagccaaggtgggtcaatcacttactt
B D           Squirrel monkey  ggctgggtgcagtggttcacacctgtaatcccaacactctggcaagccaaggtgggtgaatcactgactt
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ----------------------------------------------------------------------
                Weddell seal  ----------------------------------------------------------------------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D                   Megabat  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
B D            Naked mole-rat  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
         Cape elephant shrew  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Manatee  ----------------------------------------------------------------------
B D                  Elephant  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ----------------------------------------------------------------------
B D                       Cat  ----------------------------------------------------------------------
B D                  Bushbaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ----------------------------------------------------------------------
             Star-nosed mole  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
            Tibetan antelope  ----------------------------------------------------------------------
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
              Pacific walrus  ----------------------------------------------------------------------
B D                     Panda  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
            Black flying-fox  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                     Horse  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
B D                 Armadillo  ======================================================================
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------

                        Human  gagcctaggagtttaagaccagcctgggcaataaagtgagactccctatctctacaagtgaattttaaaa
                        Chimp  gagcctaggagtttaagaccagcctgggcaataaagtgagactccccatctctacaagtgaattttaaaa
                      Gorilla  gagcctaggagtttaagaccagcctgggcaacaaagtgagactccctatctctacaagtgaattttaaaa
                    Orangutan  gagcctaggagtttaagaccagcctgggcaataaagtgagattccccatctctacaagtgaattttaaaa
                       Gibbon  gagcctaggagtttaagaccagcctgagcgataaagtgagactccccgtctctacaagtgaattttaaaa
                       Rhesus  gagcctaggagtttaagaccagcctgggcaataaagtgagactccctgtctctacaagtgaattttaaaa
          Crab-eating macaque  gagcctaggagtttaagaccagcctgggcaataaagtgagactccctgtctctacaagtgaattttaaaa
                       Baboon  gagcctaggagtttaagaccagcctgggcaataaagtgagactccctgtctctacaagtgaattttaaaa
                 Green monkey  gagcctaggagtttaagaccagcctgggcaataaagtgagactccctgtctctacaagtgaatgttaaaa
                     Marmoset  gagccaaggagttcaagaccagcctgagcaataaaatgagactcc--gtctctacaagtgaattttaaaa
              Squirrel monkey  gagccaaggagttcaagagcagcctgagcaataaaatgagactccctgtctctacaagtgaattttaaaa
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Guinea pig  ======================================================================
                          Pig  ======================================================================
                       Rabbit  ======================================================================
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                      Megabat  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
               Naked mole-rat  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
          Cape elephant shrew  ======================================================================
           Chinese tree shrew  ======================================================================
                     Platypus  ======================================================================
                      Manatee  ----------------------------------------------------------------------
                     Elephant  ======================================================================
              Chinese hamster  ======================================================================
                       Tenrec  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                     Bushbaby  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ----------------------------------------------------------------------
              Star-nosed mole  ======================================================================
                Domestic goat  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                        Panda  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------

                        Human  attagctaggtacgatagcacacatctgtggtccaagctacacaggaagctgag-gcggggagaatcact
                        Chimp  attagctaggtatgacagcacacatctgtggtccaagctacacaggaagctgag-g-ggggagaatcact
                      Gorilla  attagctaggtacgatagcacacatctgtggtccaagctacacaggaagctgag-ggggggagaatcact
                    Orangutan  attagctaggtacgatagcacacatctgtggtccaagctacacaggaagctgac-a-ggggagaatc---
                       Gibbon  attagctgggtacgatagcacacatctgtggtccaagctacacaggaagctgag-g-ggggagaatcact
                       Rhesus  attagctgggtacgatagcacacatgtgtggtcccagctacacaggaagctgag-g-aaggagaatcact
          Crab-eating macaque  attagctgggtacgatagcacacatgtgtggtcccagctacacaggaagctgag-g-aaggagaatcact
                       Baboon  attagccgggtatgatagcacacatgtgtggtcccagctacacaggaagctgag-g-aaggagaatcact
                 Green monkey  attagctgggtacgatagcacacatctgtggtcccagctacacaggaagctggg-g-agggagaatcact
                     Marmoset  attagctcggtgtgatagcacatgcctgtggtcctagctacacaggaagatgagcg-ggggagaatcact
              Squirrel monkey  attagctgggtatgatagcacatgcctgtggtcctagctacacaggaagatgagtg-ggggagaatcact
                          Rat  ======================================================================
                 Prairie vole  ======================================================================
               Golden hamster  ======================================================================
                        Mouse  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                         Pika  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
                   Guinea pig  ======================================================================
                          Pig  ======================================================================
                       Rabbit  ======================================================================
             Cape golden mole  ----------------------------------------------------------------------
                     Aardvark  ======================================================================
                   Coelacanth  ======================================================================
       Spiny softshell turtle  ======================================================================
                      Megabat  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
                X. tropicalis  ======================================================================
                 Atlantic cod  ======================================================================
                  Spotted gar  ======================================================================
                  Stickleback  ======================================================================
           Southern platyfish  ======================================================================
       Yellowbelly pufferfish  ======================================================================
                         Fugu  ======================================================================
                    Tetraodon  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
              Tasmanian devil  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                    Zebrafish  ======================================================================
                       Medaka  ======================================================================
          Pundamilia nyererei  ======================================================================
                  Zebra mbuna  ======================================================================
        Burton's mouthbreeder  ======================================================================
          Princess of Burundi  ======================================================================
                 Nile tilapia  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
               Naked mole-rat  ----------------------------------------------------------------------
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
                       Lizard  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
          Cape elephant shrew  ======================================================================
           Chinese tree shrew  ======================================================================
                     Platypus  ======================================================================
                      Manatee  ----------------------------------------------------------------------
                     Elephant  ======================================================================
              Chinese hamster  ======================================================================
                       Tenrec  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                     Bushbaby  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ----------------------------------------------------------------------
              Star-nosed mole  ======================================================================
                Domestic goat  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                        Panda  ======================================================================
                 Killer whale  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
         David's myotis (bat)  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------

                        Human  taaacccaggaagtcaagcctgcagtg
                        Chimp  taagcccaggaagtcaagcctgcagtg
                      Gorilla  taagcccaggaagtcaagcctgcagtg
                    Orangutan  ----nnnnnnnnnncaagcctgcagtg
                       Gibbon  taagccccggaagtcaagcctgcagtg
                       Rhesus  taagcccaggaagttgagcatgcaatg
          Crab-eating macaque  taagcccaggaagtcgagcctgcaatg
                       Baboon  taagcccaggaagtcgagcctgcaatg
                 Green monkey  taagcccaggaaatcaagcctgcagtg
                     Marmoset  taagcctaggaagtcaagcctgcagtg
              Squirrel monkey  taagcctaggaagtcaagcctgcagtg
                          Rat  ===========================
                 Prairie vole  ===========================
               Golden hamster  ===========================
                        Mouse  ===========================
       Lesser Egyptian jerboa  ===========================
                         Pika  ---------------------------
                 Weddell seal  ---------------------------
                     Hedgehog  ===========================
                        Shrew  ===========================
                   Guinea pig  ===========================
                          Pig  ===========================
                       Rabbit  ===========================
             Cape golden mole  ---------------------------
                     Aardvark  ===========================
                   Coelacanth  ===========================
       Spiny softshell turtle  ===========================
                      Megabat  ===========================
                      Dolphin  ---------------------------
                X. tropicalis  ===========================
                 Atlantic cod  ===========================
                  Spotted gar  ===========================
                  Stickleback  ===========================
           Southern platyfish  ===========================
       Yellowbelly pufferfish  ===========================
                         Fugu  ===========================
                    Tetraodon  ===========================
                       Turkey  ===========================
                      Chicken  ===========================
                 Mallard duck  ===========================
           Tibetan ground jay  ===========================
                  Zebra finch  ===========================
       White-throated sparrow  ===========================
              Tasmanian devil  ===========================
     Mexican tetra (cavefish)  ===========================
                    Zebrafish  ===========================
                       Medaka  ===========================
          Pundamilia nyererei  ===========================
                  Zebra mbuna  ===========================
        Burton's mouthbreeder  ===========================
          Princess of Burundi  ===========================
                 Nile tilapia  ===========================
               Painted turtle  ===========================
              Green seaturtle  ===========================
           American alligator  ===========================
                   Budgerigar  ===========================
                      Opossum  ===========================
               Naked mole-rat  ---------------------------
                  Rock pigeon  ===========================
          Collared flycatcher  ===========================
          Medium ground finch  ===========================
                       Lizard  ===========================
             Peregrine falcon  ===========================
                 Saker falcon  ===========================
                       Parrot  ===========================
             Brush-tailed rat  ===========================
                   Chinchilla  ===========================
          Cape elephant shrew  ===========================
           Chinese tree shrew  ===========================
                     Platypus  ===========================
                      Manatee  ---------------------------
                     Elephant  ===========================
              Chinese hamster  ===========================
                       Tenrec  ---------------------------
                          Cat  ---------------------------
                     Bushbaby  ===========================
     Chinese softshell turtle  ===========================
                      Ferret   ---------------------------
              Star-nosed mole  ===========================
                Domestic goat  ---------------------------
                        Sheep  ---------------------------
             Tibetan antelope  ---------------------------
               Bactrian camel  ---------------------------
                       Alpaca  ---------------------------
               Pacific walrus  ---------------------------
                        Panda  ===========================
                 Killer whale  ---------------------------
                          Dog  ---------------------------
             Black flying-fox  ---------------------------
             White rhinoceros  ---------------------------
                        Horse  ---------------------------
                     Squirrel  ===========================
                    Armadillo  ===========================
         David's myotis (bat)  ---------------------------
                Big brown bat  ---------------------------
                     Microbat  ---------------------------
                          Cow  ---------------------------

Alignment block 28 of 1055 in window, 100219694 - 100219760, 67 bps 
B D                     Human  agacatg-ttggcgccacggcactctaggttgggtgaaaaagtgagacccagtctcaaa--aaaaaccgc
B D                     Chimp  agccatg-ttggtgccacagcactctaggttgggtgaaaaagtgagacccagtctcaaa--aaaaaccgc
B D                   Gorilla  agacatg-ttggcgccacggcactctaggttgggtgaaaaagtgagacccagtctcaaa--aaaaaccgc
B D                 Orangutan  acccatg-ttggcgccacagcactctaggttgggtgaaaaagtgagacccagtctcaaa--aaaaaccgc
B D                    Gibbon  agccatg-ttggcgccacagcactctaggttgggtgaaaaagtgagacccagtctcaaa--aaaaaccgc
B D                    Rhesus  agccatg-ttggcacctctacactctaggttgggtgaaaaagtgagacccagtctcaaa--aaaatccgc
B D       Crab-eating macaque  agccatg-ttggcacctctacactctaggttgggtgaaaaagtgagacccagtctcaaa--aaaatccgc
B D                    Baboon  agccatg-ttggcacctctgcactctaggttgggtgaaaaagtgagacccagtctcaaa--aaaatccgc
B D              Green monkey  agccatg-ttggcacctctgcactctaggttggctcaaaaagtgagacccagtctcaaa--aaaatccgc
B D                  Marmoset  agacacg-ttggtgccactgtactctatgttgggtgaaaaagtgagacctagtctcaaaagaaaaaccgc
B D           Squirrel monkey  agacatgtttggtgccactgtactctaggttgggtgaaaaagtgagatgcagtctcaaaa-aaaacctgc
          Cape elephant shrew  aaacatc-ttcccaacacatttctctagtttacatctataaataa--------cacaaa--agaatcaa-
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Golden hamster  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                      Pika  ----------------------------------------------------------------------
                Weddell seal  ----------------------------------------------------------------------
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
B D                Guinea pig  ======================================================================
B D                       Pig  ======================================================================
B D                    Rabbit  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
                    Aardvark  ======================================================================
B D                Coelacanth  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D                   Megabat  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================
B D              Atlantic cod  ======================================================================
                 Spotted gar  ======================================================================
B D               Stickleback  ======================================================================
          Southern platyfish  ======================================================================
      Yellowbelly pufferfish  ======================================================================
B D                      Fugu  ======================================================================
B D                 Tetraodon  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D           Tasmanian devil  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
B D                 Zebrafish  ======================================================================
B D                    Medaka  ======================================================================
         Pundamilia nyererei  ======================================================================
                 Zebra mbuna  ======================================================================
       Burton's mouthbreeder  ======================================================================
         Princess of Burundi  ======================================================================
B D              Nile tilapia  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
B D            Naked mole-rat  ----------------------------------------------------------------------
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Lizard  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
          Chinese tree shrew  ======================================================================
B D                  Platypus  ======================================================================
B D                   Manatee  ----------------------------------------------------------------------
B D                  Elephant  ======================================================================
B D           Chinese hamster  ======================================================================
B D                    Tenrec  ----------------------------------------------------------------------
B D                       Cat  ----------------------------------------------------------------------
B D                  Bushbaby  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ----------------------------------------------------------------------
             Star-nosed mole  ======================================================================
               Domestic goat  ----------------------------------------------------------------------
B D                     Sheep  ----------------------------------------------------------------------
            Tibetan antelope  ----------------------------------------------------------------------
              Bactrian camel  ----------------------------------------------------------------------
B D                    Alpaca  ----------------------------------------------------------------------
              Pacific walrus  ----------------------------------------------------------------------
B D                     Panda  ======================================================================
                Killer whale  ----------------------------------------------------------------------
B D                       Dog  ----------------------------------------------------------------------
            Black flying-fox  ----------------------------------------------------------------------
B D          White rhinoceros  ----------------------------------------------------------------------
B D                     Horse  ----------------------------------------------------------------------
B D                  Squirrel  ======================================================================
B D                 Armadillo  ======================================================================
        David's myotis (bat)  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                  Microbat  ----------------------------------------------------------------------
B D                       Cow  ----------------------------------------------------------------------

Inserts between block 28 and 29 in window
B D                   Rhesus 5bp
B D      Crab-eating macaque 5bp
B D                   Baboon 5bp
B D             Green monkey 5bp

Alignment block 29 of 1055 in window, 100219761 - 100219762, 2 bps 
B D                     Human  ac
B D                     Chimp  ac
B D                   Gorilla  ac
B D                 Orangutan  ac
B D                    Gibbon  ac
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  ac
B D              Green monkey  ac
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                   Dolphin  ac
                 Killer whale  ac
B D                       Cow  ac
             Black flying-fox  ac
          Cape elephant shrew  at
B D                       Rat  ==
                Prairie vole  ==
              Golden hamster  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                      Pika  --
                Weddell seal  --
B D                  Hedgehog  ==
B D                     Shrew  ==
B D                Guinea pig  ==
B D                       Pig  ==
B D                    Rabbit  ==
            Cape golden mole  --
                    Aardvark  ==
B D                Coelacanth  ==
  D    Spiny softshell turtle  ==
B D                   Megabat  ==
B D             X. tropicalis  ==
B D              Atlantic cod  ==
                 Spotted gar  ==
B D               Stickleback  ==
          Southern platyfish  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
B D                 Tetraodon  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
B D           Tasmanian devil  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D                    Medaka  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D              Nile tilapia  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
B D                Budgerigar  ==
B D                   Opossum  ==
B D            Naked mole-rat  --
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
B D                    Lizard  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Brush-tailed rat  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
B D                  Platypus  ==
B D                   Manatee  --
B D                  Elephant  ==
B D           Chinese hamster  ==
B D                    Tenrec  --
B D                       Cat  --
B D                  Bushbaby  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   --
             Star-nosed mole  ==
               Domestic goat  --
B D                     Sheep  --
            Tibetan antelope  --
              Bactrian camel  --
B D                    Alpaca  --
              Pacific walrus  --
B D                     Panda  ==
B D                       Dog  --
B D          White rhinoceros  --
B D                     Horse  --
B D                  Squirrel  ==
B D                 Armadillo  ==
        David's myotis (bat)  --
               Big brown bat  --
B D                  Microbat  --

Inserts between block 29 and 30 in window
         Cape elephant shrew 2bp

Alignment block 30 of 1055 in window, 100219763 - 100219763, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D            Naked mole-rat  a
B D                   Dolphin  a
                 Killer whale  a
B D                       Cow  a
B D          White rhinoceros  a
B D                       Cat  a
B D                   Ferret   a
                 Weddell seal  a
             Black flying-fox  a
                Big brown bat  a
B D                  Microbat  a
          Cape elephant shrew  g
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
B D                 Armadillo  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
                    Aardvark  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Megabat  =
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
B D                     Panda  =
B D                       Dog  -
B D                     Horse  -
B D                  Squirrel  =
        David's myotis (bat)  -

Inserts between block 30 and 31 in window
B D                  Dolphin 1bp
                Killer whale 1bp
B D                      Cow 1bp
            Black flying-fox 1bp

Alignment block 31 of 1055 in window, 100219764 - 100219764, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D            Naked mole-rat  a
B D          White rhinoceros  a
B D                       Cat  a
B D                   Ferret   a
                 Weddell seal  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
B D                 Armadillo  a
B D                       Rat  =
                Prairie vole  =
              Golden hamster  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
B D                      Pika  -
B D                  Hedgehog  =
B D                     Shrew  =
B D                Guinea pig  =
B D                       Pig  =
B D                    Rabbit  =
                    Aardvark  =
B D                Coelacanth  =
  D    Spiny softshell turtle  =
B D                   Megabat  =
B D                   Dolphin  =
B D             X. tropicalis  =
B D              Atlantic cod  =
                 Spotted gar  =
B D               Stickleback  =
          Southern platyfish  =
      Yellowbelly pufferfish  =
B D                      Fugu  =
B D                 Tetraodon  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
B D           Tasmanian devil  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D                    Medaka  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D              Nile tilapia  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
B D                Budgerigar  =
B D                   Opossum  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
B D                    Lizard  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Brush-tailed rat  =
                  Chinchilla  =
          Chinese tree shrew  =
B D                  Platypus  =
B D                  Elephant  =
B D           Chinese hamster  =
B D                  Bushbaby  =
  D  Chinese softshell turtle  =
             Star-nosed mole  =
               Domestic goat  -
B D                     Sheep  -
            Tibetan antelope  -
              Bactrian camel  -
B D                    Alpaca  -
              Pacific walrus  -
B D                     Panda  =
                Killer whale  =
B D                       Dog  -
            Black flying-fox  =
B D                     Horse  -
B D                  Squirrel  =
B D                       Cow  =

Alignment block 32 of 1055 in window, 100219765 - 100219765, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g