Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 939 in window, 4841821 - 4841825, 5 bps 
B D                     Human  gctgg
B D                     Chimp  gctgg
B D                   Gorilla  gctgg
B D                 Orangutan  gctgg
B D                    Gibbon  gctgg
B D                    Rhesus  gctgg
B D       Crab-eating macaque  gctgg
B D                    Baboon  gctgg
B D              Green monkey  gctgg
B D                  Marmoset  gttgg
B D           Squirrel monkey  gctag
           Chinese tree shrew  gctgg
B D                  Squirrel  gctgg
       Lesser Egyptian jerboa  ggaag
                 Prairie vole  ggtgg
B D           Chinese hamster  ggt-g
B D                     Mouse  ggtgg
B D                       Rat  ggtgg
B D            Naked mole-rat  ggtag
B D                Guinea pig  ggtgg
                   Chinchilla  ggtgg
             Brush-tailed rat  gatgg
B D                    Rabbit  gccag
B D                      Pika  gctgg
B D                       Pig  gctgg
B D                    Alpaca  gctgg
               Bactrian camel  gctgg
B D                   Dolphin  gctgg
                 Killer whale  gctgg
             Tibetan antelope  gctgg
B D                       Cow  gctgg
B D                     Sheep  gctgg
                Domestic goat  gctgg
B D                     Horse  gctgg
B D          White rhinoceros  gctgg
B D                       Dog  cctgg
B D                   Ferret   cctgt
B D                     Panda  cctgc
               Pacific walrus  cctgc
                 Weddell seal  cctgc
             Black flying-fox  gttgg
B D                   Megabat  gctgg
                Big brown bat  gcttg
         David's myotis (bat)  gcttg
B D                  Microbat  gcttg
B D                  Hedgehog  gctgg
B D                     Shrew  gttgg
              Star-nosed mole  gttga
B D                  Elephant  gcggg
          Cape elephant shrew  gctag
B D                   Manatee  gctgg
             Cape golden mole  gtgg-
B D                    Tenrec  gctg-
B D                   Opossum  tctag
B D                   Wallaby  tctag
              Golden hamster  NNNNN
B D                 Armadillo  =====
B D                       Cat  =====
B D                  Bushbaby  =====
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
                    Aardvark  =====
B D               Stickleback  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                    Medaka  =====
B D                Coelacanth  =====
B D                    Turkey  =====
                 Spotted gar  =====
  D              Mallard duck  =====
  D    Spiny softshell turtle  =====
          Southern platyfish  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D              Nile tilapia  =====
B D                 Tetraodon  =====
B D                   Chicken  =====
B D              Atlantic cod  =====
  D  Chinese softshell turtle  =====
  D           Green seaturtle  =====
B D       Medium ground finch  =====
B D        American alligator  =====
  D    White-throated sparrow  =====
          Tibetan ground jay  =====
B D           Tasmanian devil  =====

Inserts between block 1 and 2 in window
B D                 Elephant 1088bp
         Cape elephant shrew 1007bp

Alignment block 2 of 939 in window, 4841826 - 4841828, 3 bps 
B D                     Human  g-c------a
B D                     Chimp  g-c------a
B D                   Gorilla  g-c------a
B D                 Orangutan  g-c------a
B D                    Gibbon  g-c------a
B D                    Rhesus  g-c------a
B D       Crab-eating macaque  g-c------a
B D                    Baboon  g-c------a
B D              Green monkey  t-c------a
B D                  Marmoset  g-c------a
B D           Squirrel monkey  g-c------a
           Chinese tree shrew  g-c------a
B D                  Squirrel  g-c------c
       Lesser Egyptian jerboa  g-c------t
                 Prairie vole  g-c-------
B D           Chinese hamster  g-c-------
B D                     Mouse  g-c-------
B D                       Rat  g-c-------
B D            Naked mole-rat  g-c------c
B D                Guinea pig  g-c------c
                   Chinchilla  g-c------c
             Brush-tailed rat  g-c------c
B D                    Rabbit  a-c------c
B D                      Pika  acc------c
B D                       Pig  g-t------g
B D                    Alpaca  g-c------a
               Bactrian camel  g-c------a
B D                   Dolphin  g-c------a
                 Killer whale  g-c------a
             Tibetan antelope  g-c------a
B D                       Cow  g-c------a
B D                     Sheep  g-c------a
                Domestic goat  g-c------a
B D                     Horse  g-c------a
B D          White rhinoceros  g-c------a
B D                       Dog  g-c------c
B D                   Ferret   g-cagttccc
B D                     Panda  a-c-------
               Pacific walrus  a-c-------
                 Weddell seal  c-c-------
             Black flying-fox  a-c------a
B D                   Megabat  a-c------a
                Big brown bat  g-c------a
         David's myotis (bat)  g-c------g
B D                  Microbat  g-c------a
B D                  Hedgehog  g-c------a
B D                     Shrew  a-t------a
              Star-nosed mole  a-c------a
B D                   Opossum  g-c------a
B D                   Wallaby  g-c------a
B D                    Tenrec  ----------
              Golden hamster  NNNNNNNNNN
B D                  Elephant  ==========
         Cape elephant shrew  ==========
B D                 Armadillo  ==========
B D                   Manatee  ----------
B D                       Cat  ==========
B D                  Bushbaby  ==========
            Cape golden mole  ----------
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
                    Aardvark  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D    Spiny softshell turtle  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
B D                 Zebrafish  ==========
B D              Nile tilapia  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
  D  Chinese softshell turtle  ==========
  D           Green seaturtle  ==========
B D       Medium ground finch  ==========
B D        American alligator  ==========
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========
B D           Tasmanian devil  ==========

Inserts between block 2 and 3 in window
B D                  Opossum 21866bp

Alignment block 3 of 939 in window, 4841829 - 4841838, 10 bps 
B D                     Human  cgg-------tgggata
B D                     Chimp  cgg-------tgggata
B D                   Gorilla  cgg-------tgggata
B D                 Orangutan  ccg-------tgggata
B D                    Gibbon  ctg-------tgggata
B D                    Rhesus  ccg-------tgggatt
B D       Crab-eating macaque  ccg-------tgggatt
B D                    Baboon  ctg-------tgggatt
B D              Green monkey  ccg-------tgggatt
B D                  Marmoset  cca-------tgggatg
B D           Squirrel monkey  ccg-------tgggatg
           Chinese tree shrew  ctg-------tgggatg
B D                  Squirrel  cca-------tgggaca
       Lesser Egyptian jerboa  tca-------tggtaca
                 Prairie vole  cca-------tgggaaa
B D           Chinese hamster  cca-------tgggata
B D                     Mouse  cca-------ggggata
B D                       Rat  cca-------ggggata
B D            Naked mole-rat  ctg-------tgggaca
B D                Guinea pig  ccg-------ggggccc
                   Chinchilla  cca-------tgggaca
             Brush-tailed rat  cca-------tgggaca
B D                    Rabbit  gca-------cgggata
B D                      Pika  cca-------tgggata
B D                       Pig  cca-------tgtgaca
B D                    Alpaca  cca-------tgtgaca
               Bactrian camel  cca-------tgtgaca
B D                   Dolphin  ccg-------tgtgaca
                 Killer whale  ccg-------tgtgaca
             Tibetan antelope  cca-------tgtgaca
B D                       Cow  cca-------tgtgaca
B D                     Sheep  cca-------tgtgaca
                Domestic goat  cca-------tgtgaca
B D                     Horse  ccg-------tgcaaca
B D          White rhinoceros  ctg-------tgcgaca
B D                       Dog  ctg-------agcggtg
B D                   Ferret   tta-------tgcgggg
             Black flying-fox  cagt------ggcaaca
B D                   Megabat  cagt------ggcaaca
                Big brown bat  c---------tgcaaca
         David's myotis (bat)  c---------tgcaaca
B D                  Microbat  c---------tgcaaca
B D                  Hedgehog  ccg-------tgggac-
B D                     Shrew  cca-------cgggaca
              Star-nosed mole  gtg-------tgggacg
B D                   Manatee  ---gagccctggtggtg
             Cape golden mole  ----------cattgta
B D                    Tenrec  ----------ggtggga
B D                   Wallaby  tta-------taggaca
              Golden hamster  NNNNNNNNNNNNNNNNN
B D                  Elephant  =================
         Cape elephant shrew  =================
B D                 Armadillo  =================
              Pacific walrus  -----------------
B D                       Cat  =================
B D                  Bushbaby  =================
B D                     Panda  -----------------
                Weddell seal  -----------------
      Yellowbelly pufferfish  =================
B D                      Fugu  =================
                    Aardvark  =================
B D               Stickleback  =================
         Pundamilia nyererei  =================
                 Zebra mbuna  =================
       Burton's mouthbreeder  =================
         Princess of Burundi  =================
B D                    Medaka  =================
B D                Coelacanth  =================
B D                    Turkey  =================
                 Spotted gar  =================
  D              Mallard duck  =================
  D    Spiny softshell turtle  =================
          Southern platyfish  =================
    Mexican tetra (cavefish)  =================
B D                 Zebrafish  =================
B D              Nile tilapia  =================
B D                 Tetraodon  =================
B D                   Chicken  =================
B D              Atlantic cod  =================
  D  Chinese softshell turtle  =================
  D           Green seaturtle  =================
B D       Medium ground finch  =================
B D                   Opossum  =================
B D        American alligator  =================
  D    White-throated sparrow  =================
          Tibetan ground jay  =================
B D           Tasmanian devil  =================

Inserts between block 3 and 4 in window
            Cape golden mole 429bp
B D                   Tenrec 2bp

Alignment block 4 of 939 in window, 4841839 - 4841842, 4 bps 
B D                     Human  ca------aa
B D                     Chimp  ca------aa
B D                   Gorilla  ca------aa
B D                 Orangutan  ca------aa
B D                    Gibbon  ca------aa
B D                    Rhesus  ca------aa
B D       Crab-eating macaque  ca------aa
B D                    Baboon  ca------aa
B D              Green monkey  ca------aa
B D                  Marmoset  ca------aa
B D           Squirrel monkey  ca------ag
           Chinese tree shrew  ga------aa
B D                  Squirrel  ca------aa
       Lesser Egyptian jerboa  ca------gg
                 Prairie vole  ca------ca
B D           Chinese hamster  ca------ca
B D                     Mouse  ca------ga
B D                       Rat  ta------ga
B D            Naked mole-rat  ca--------
B D                Guinea pig  ca--------
                   Chinchilla  ca--------
             Brush-tailed rat  ca--------
B D                    Rabbit  ca------ga
B D                      Pika  ca------ga
B D                       Pig  ca------aa
B D                    Alpaca  cc------aa
               Bactrian camel  cc------aa
B D                   Dolphin  ca------aa
                 Killer whale  ca------aa
             Tibetan antelope  ca------aa
B D                       Cow  ca------aa
B D                     Sheep  ca------aa
                Domestic goat  ca------aa
B D                     Horse  ca------aa
B D          White rhinoceros  ca------aa
B D                       Dog  ca------gc
B D                   Ferret   -g------gt
             Black flying-fox  ca------aa
B D                   Megabat  ca------aa
                Big brown bat  ga------aa
         David's myotis (bat)  ga------aa
B D                  Microbat  ga------aa
B D                     Shrew  ga------ga
              Star-nosed mole  ta------aa
B D                   Manatee  cagtggttaa
B D                    Tenrec  --------aa
B D                   Wallaby  ta------ga
B D                  Hedgehog  ----------
              Golden hamster  NNNNNNNNNN
B D                  Elephant  ==========
         Cape elephant shrew  ==========
B D                 Armadillo  ==========
              Pacific walrus  ----------
B D                       Cat  ==========
B D                  Bushbaby  ==========
B D                     Panda  ----------
            Cape golden mole  ==========
                Weddell seal  ----------
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
                    Aardvark  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D    Spiny softshell turtle  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
B D                 Zebrafish  ==========
B D              Nile tilapia  ==========
B D                 Tetraodon  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
  D  Chinese softshell turtle  ==========
  D           Green seaturtle  ==========
B D       Medium ground finch  ==========
B D                   Opossum  ==========
B D        American alligator  ==========
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========
B D           Tasmanian devil  ==========

Alignment block 5 of 939 in window, 4841843 - 4841859, 17 bps 
B D                     Human  gcagtac-----ag-g----tg--ctgac
B D                     Chimp  gcagtac-----ag-g----tg--ctgac
B D                   Gorilla  gcagtac-----ag-g----tg--ctgac
B D                 Orangutan  gcaatac-----ag-g----tg--ctgac
B D                    Gibbon  gcaatac-----ag-g----tg--ctgac
B D                    Rhesus  gcaatac-----ag-g----tg--ctgac
B D       Crab-eating macaque  gcaatac-----ag-g----tg--ctgac
B D                    Baboon  gcaatac-----ag-g----tg--ctgac
B D              Green monkey  gcaatac-----ag-g----tg--ctgac
B D                  Marmoset  ttgatac-----ag-g----tg--atgac
B D           Squirrel monkey  ttgatac-----ag-g----tg--ctgac
           Chinese tree shrew  gcagttc-----cgag----ta--cagac
B D                  Squirrel  accatac-----aa-g----tg--tgtag
       Lesser Egyptian jerboa  gcagtac-----aa-c----tttcaatgc
                 Prairie vole  acagtac-----aa-g----tt--agtgc
B D           Chinese hamster  gcagtac-----ga-g----tt--agtgc
B D                     Mouse  gcactac-----aa-g----tg--agtgc
B D                       Rat  gcagtac-----aa-g----tt--aatgc
B D            Naked mole-rat  ---atat-----aa-a----ta--tgtac
B D                Guinea pig  ---gt-c-----cc-a----ta--tgtcc
                   Chinchilla  ---gtac-----ac-g----tg--tgtac
             Brush-tailed rat  ---gtat-----aa-g----ta--tatac
B D                    Rabbit  gcaatgt-----gg-g----tc--ctcac
B D                      Pika  gcagcat-----gg-g----tc-------
B D                       Pig  acagtac-----ag-g----tc--ctgac
B D                    Alpaca  aaagtac-----ag-g----ta--tttac
               Bactrian camel  aaagtac-----ag-g----ta--tttac
B D                   Dolphin  acagtac-----ag-g----tc--cttac
                 Killer whale  acagtac-----ag-g----tc--cttac
             Tibetan antelope  atagcat-----ag-t----tc--ctgac
B D                       Cow  atagcat-----tg-t----tc--ctgac
B D                     Sheep  atagcat-----ag-t----tc--ctgac
                Domestic goat  atagcat-----ag-t----tc--ctgac
B D                     Horse  acgatac-----ag-g---ttc--tt-ac
B D          White rhinoceros  acgatac-----aa-g---gcc--tt-ac
B D                       Dog  ccagcac-----ac-g---ttc--ct-ac
B D                   Ferret   cccttatgcagtgg-g---ttc--cttac
B D                     Panda  ------------tg-g---ttc--ctcac
               Pacific walrus  ------------ag-g---tcc--cttac
                 Weddell seal  ------------gg-g---tcc--cttac
             Black flying-fox  acaatac-----ag-gtactta--cttac
B D                   Megabat  acaatac-----ag-gtactta--cttac
                Big brown bat  acaatac-----ag-g---------ttat
         David's myotis (bat)  acaatac-----ag-g---------ttat
B D                  Microbat  acaatac-----ag-g---------tta-
B D                  Hedgehog  acaaaac-----ag-g----ta--cttac
B D                     Shrew  acaatac-----aa-g----ta--tggat
              Star-nosed mole  ataatac-----ag-g----tt--cttac
B D                   Manatee  gaactat-----gg-c----tg--ctaac
B D                    Tenrec  gag--ga-----gg-c----tg--tctgc
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Elephant  =============================
         Cape elephant shrew  =============================
B D                 Armadillo  =============================
B D                       Cat  =============================
B D                  Bushbaby  =============================
            Cape golden mole  =============================
      Yellowbelly pufferfish  =============================
B D                      Fugu  =============================
                    Aardvark  =============================
B D               Stickleback  =============================
         Pundamilia nyererei  =============================
                 Zebra mbuna  =============================
       Burton's mouthbreeder  =============================
         Princess of Burundi  =============================
B D                    Medaka  =============================
B D                Coelacanth  =============================
B D                    Turkey  =============================
                 Spotted gar  =============================
  D              Mallard duck  =============================
  D    Spiny softshell turtle  =============================
          Southern platyfish  =============================
    Mexican tetra (cavefish)  =============================
B D                 Zebrafish  =============================
B D              Nile tilapia  =============================
B D                 Tetraodon  =============================
B D                   Chicken  =============================
B D              Atlantic cod  =============================
  D  Chinese softshell turtle  =============================
  D           Green seaturtle  =============================
B D       Medium ground finch  =============================
B D                   Opossum  =============================
B D        American alligator  =============================
  D    White-throated sparrow  =============================
          Tibetan ground jay  =============================
B D           Tasmanian devil  =============================

Inserts between block 5 and 6 in window
B D                  Manatee 977bp

Alignment block 6 of 939 in window, 4841860 - 4841898, 39 bps 
B D                     Human  ---tc-------tggttctcagcc-ag-ggcaccgctggcctcc----a-----gg-gggt
B D                     Chimp  ---tc-------tggttctcagcc-ag-ggcaccgctggcctcc----a-----gg-gggt
B D                   Gorilla  ---tc-------tggttctcagcc-ag-ggcaccgctggcctcc----a-----gg-gggt
B D                 Orangutan  ---tc-ag----tggttctcagcc-ag-ggcaccactggcctcc----a-----gg-gggt
B D                    Gibbon  ---tc-ag----tggttctcagcc-ag-ggcaccgctggcctcc----a-----gg-gggt
B D                    Rhesus  ---tc-ag----tggttctcagcc-ag-ggcaccgctggcctcc----a-----gg-gggt
B D       Crab-eating macaque  ---tc-ag----tggttctcagcc-ag-ggcaccgctggcctcc----a-----gg-gggt
B D                    Baboon  ---tc-ag----tggttctcagcc-ag-ggcaccgctggcctcc----a-----gg-gggt
B D              Green monkey  ---tc-ag----tggttctcagcc-ag-ggcaccgctggccccc----a-----gg-gggt
B D                  Marmoset  ---tc-ag----tgactctcaacc-ag-ggcactgatggcctcc----a-----gg-gggt
B D           Squirrel monkey  ---tc-ag----tgactctcagcc-ag-ggcactgctggcctcc----a-----gg-gggt
           Chinese tree shrew  ---tc-gc----cggttcacagcc-ct-cgtggcactg--ctct----c-----at-gggt
B D                  Squirrel  ---tt--g----tggttctcaacc-ac-tctagcactgtctac----------------at
       Lesser Egyptian jerboa  ---tc-ag----t-cttctcggct-ga-g-aggctctgctctct----c-----tt-gcac
                 Prairie vole  ---tc-aa----tggtgctcagct-ga-g-tggcactacccccc----a-----ga-gtgt
B D           Chinese hamster  ---tc-ag----tggttctcagct-ga-g-tggcactgccctcc----a-----gg-gtgt
B D                     Mouse  ---tc-ag----tgagtcacagct-ga-g-tgccactgccctcc----a-----gg-gtac
B D                       Rat  ---tc-ag----tgattcacagct-ga-g-tggcactgccctcc----a-----gg-gtat
B D            Naked mole-rat  ---tc-ag----tgtttctcggcc-ag-gatgacagtgccctct----------ga-gggt
B D                Guinea pig  ---tc--g----tatttctcagcc-ag-ggtggcagtgcctgct----------ga-ggtt
                   Chinchilla  ---tc-ag----tgtttctcagcc-ag-ggcggcagtgtcctct----------ga-gcgt
             Brush-tailed rat  ---tc-ag----tgtttctcagcc-ac-agtggtagcacc---------------------
B D                    Rabbit  ---tcgag----gggtcctcagct-ag-ggcagcagtgcccttc----ccttattt-attt
B D                       Pig  ---tc-ag----tggttctcagct-gg-ggtggcactgccatcc----t-----ga-gggt
B D                    Alpaca  ---tc-ag----tggttctcctgt-gg-ggtggcactgccctcc----t-----agtgggt
               Bactrian camel  ---tc-ag----tggttctcctgtggg-ggtggcactgccctcc----t-----agtgggt
B D                   Dolphin  ---tc-ag----tgcttctcaact-ag-ggtggcactgccctcc----t-----gg-gggt
                 Killer whale  ---tc-ag----tgcttctcaact-ag-ggtggcactgccctcc----t-----gg-gggt
             Tibetan antelope  ---ta-ag----tgctttccaacc-cg-ggggtcactgctctcc----t-----gg-gagt
B D                       Cow  ---ta-ag----tgcttcccaacc-cagggggacactgccctcc----t-----gg-gggt
B D                     Sheep  ---ta-ag----tgcttcccaacc-ca-gggggcactgctctcc----t-----gg-gagt
                Domestic goat  ---ta-ag----tgcttcccaacc-caggggggcactgctctcc----t-----gg-gagt
B D                     Horse  ---tc-gg----tagttcccaact-ag-agtggccctg-cctcc----a-----gg-aggt
B D          White rhinoceros  ---tc-gg----tagttctcaact-ag-ggtggccctgccctcc----g-----gt-gggt
B D                       Dog  ---cc-gg----tggtcctcagcc-c--ggcgacacggcactcc----a-----gg-gg--
B D                   Ferret   ---gc-ag----ccgtccttggcc-aa-ggcagcaccgtcctccctctg-----gg-gact
B D                     Panda  ---tc-ag----tggtcctcggcc-ag-ggcggtgccgccctccctcca-----ag-ggc-
               Pacific walrus  ---tc-gg----tggtcctcggcc-g----------------------------gg-ggc-
                 Weddell seal  ---tc-gg----tggtcctcggcc-gg-ggcggcgctgccctcccccca-----gg-ggc-
             Black flying-fox  ---tc-ag----tgcttctcaact-ag-ggtggcactg-attcc----a-----gg-agat
B D                   Megabat  ---tc-ag----tgcttctcaact-ag-ggtggcactg-attcc----a-----gg-agat
                Big brown bat  ---tc-ag----t-------------------gcactgccttcc----a-----gg-gggt
         David's myotis (bat)  ---tc-ag----t-------------------gcactgccttcc----a-----gg-gggt
B D                  Microbat  ------------t-------------------gcactgccttcc----a-----gg-gggt
B D                  Hedgehog  ---tt-attcagtgcttctcaact-ag-ggtggcattgccctcc----g-----gg-gggt
B D                     Shrew  ---gc-attc--tgtttctcatct-ag-ggtggcattgctctcc----a-----gg-gggt
              Star-nosed mole  ---cc-ag----tagttctcaact-c--ggtggtactgtcctcc----a------------
B D                    Tenrec  tcttt-aa----agatttaca----aa-gacttggaacccctct----a-----ga-gggt
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Elephant  =============================================================
         Cape elephant shrew  =============================================================
B D                      Pika  -------------------------------------------------------------
B D                 Armadillo  =============================================================
B D                   Manatee  =============================================================
B D                       Cat  =============================================================
B D                  Bushbaby  =============================================================
            Cape golden mole  =============================================================
      Yellowbelly pufferfish  =============================================================
B D                      Fugu  =============================================================
                    Aardvark  =============================================================
B D               Stickleback  =============================================================
         Pundamilia nyererei  =============================================================
                 Zebra mbuna  =============================================================
       Burton's mouthbreeder  =============================================================
         Princess of Burundi  =============================================================
B D                    Medaka  =============================================================
B D                Coelacanth  =============================================================
B D                    Turkey  =============================================================
                 Spotted gar  =============================================================
  D              Mallard duck  =============================================================
  D    Spiny softshell turtle  =============================================================
          Southern platyfish  =============================================================
    Mexican tetra (cavefish)  =============================================================
B D                 Zebrafish  =============================================================
B D              Nile tilapia  =============================================================
B D                 Tetraodon  =============================================================
B D                   Chicken  =============================================================
B D              Atlantic cod  =============================================================
  D  Chinese softshell turtle  =============================================================
  D           Green seaturtle  =============================================================
B D       Medium ground finch  =============================================================
B D                   Opossum  =============================================================
B D        American alligator  =============================================================
  D    White-throated sparrow  =============================================================
          Tibetan ground jay  =============================================================
B D           Tasmanian devil  =============================================================

Inserts between block 6 and 7 in window
B D                 Microbat 34bp
B D                   Tenrec 11bp

Alignment block 7 of 939 in window, 4841899 - 4841915, 17 bps 
B D                     Human  gttcggaa-------atgctgagg---
B D                     Chimp  gttcggaa-------atgctgagg---
B D                   Gorilla  gttcggaa-------atgctgagg---
B D                 Orangutan  gttcagaa-------atgttgagg---
B D                    Gibbon  gttcggaa-------atgttgaag---
B D                    Rhesus  gtttggaa-------atgttgagg---
B D       Crab-eating macaque  gtttggaa-------atgttgagg---
B D                    Baboon  gtttggaa-------atgttgagg---
B D              Green monkey  gtttggaa-------atgttgagg---
B D                  Marmoset  gttcagaa-------atgttgagg---
B D           Squirrel monkey  gttcagaa-------atgttgagg---
           Chinese tree shrew  gtctgggt-------atgttgggg---
B D                  Squirrel  gtttgaaaa------atgttggag---
       Lesser Egyptian jerboa  gttcataa-------atgttgggg---
                 Prairie vole  gtttggaagcaacacacactggaa---
B D           Chinese hamster  atttggaa-------atgttgagg---
B D                     Mouse  gtttggaa-------cttttgagg---
B D                       Rat  gcttgaaa-------atgttgagg---
B D            Naked mole-rat  gtttggaa-------atgttgagg---
B D                Guinea pig  gtttggga-------acgttgagg---
                   Chinchilla  gtttggaa-------gcggtgagg---
B D                    Rabbit  atttatgacagttaggcagtgaga---
B D                       Pig  gtttagaa-------atggtgcgc---
B D                    Alpaca  gtttggaa-------atgttgggg---
               Bactrian camel  gtttggaa-------atgttgggg---
B D                   Dolphin  gtttggaa-------atgttgggg---
                 Killer whale  gtttggaa-------atgttgggg---
             Tibetan antelope  gtttggaa-------atgttgggg---
B D                       Cow  gtttgaaa-------atgttgggg---
B D                     Sheep  gtttggaa-------atgttgggg---
                Domestic goat  gtttggaa-------atgttgggg---
B D                     Horse  gtttggaa-------atgctgggg---
B D          White rhinoceros  gtttagaa-------atgttgggg---
B D                   Ferret   gtccagaa-------atgctgggc---
B D                     Panda  gtccggaa-------acgctgggg---
               Pacific walrus  gtccggaa-------acgc--------
                 Weddell seal  atctggaa-------acgc--------
             Black flying-fox  gtttggaa-------atgttgggg---
B D                   Megabat  gtttggaa-------atgttgggg---
                Big brown bat  gtttagaa-------at----ggg---
         David's myotis (bat)  gtttggaa-------at----ggg---
B D                  Hedgehog  gtttgaaa-------acattaagg---
B D                     Shrew  gcttggaa-------atgttagaa---
              Star-nosed mole  -----gaa-------atgtttggg---
B D                    Tenrec  ggttggaa-------ttgactggatgg
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Elephant  ===========================
         Cape elephant shrew  ===========================
B D                      Pika  ---------------------------
B D                 Armadillo  ===========================
B D                   Manatee  ===========================
            Brush-tailed rat  ---------------------------
B D                       Dog  ---------------------------
B D                       Cat  ===========================
B D                  Microbat  ===========================
B D                  Bushbaby  ===========================
            Cape golden mole  ===========================
      Yellowbelly pufferfish  ===========================
B D                      Fugu  ===========================
                    Aardvark  ===========================
B D               Stickleback  ===========================
         Pundamilia nyererei  ===========================
                 Zebra mbuna  ===========================
       Burton's mouthbreeder  ===========================
         Princess of Burundi  ===========================
B D                    Medaka  ===========================
B D                Coelacanth  ===========================
B D                    Turkey  ===========================
                 Spotted gar  ===========================
  D              Mallard duck  ===========================
  D    Spiny softshell turtle  ===========================
          Southern platyfish  ===========================
    Mexican tetra (cavefish)  ===========================
B D                 Zebrafish  ===========================
B D              Nile tilapia  ===========================
B D                 Tetraodon  ===========================
B D                   Chicken  ===========================
B D              Atlantic cod  ===========================
  D  Chinese softshell turtle  ===========================
  D           Green seaturtle  ===========================
B D       Medium ground finch  ===========================
B D                   Opossum  ===========================
B D        American alligator  ===========================
  D    White-throated sparrow  ===========================
          Tibetan ground jay  ===========================
B D           Tasmanian devil  ===========================

Inserts between block 7 and 8 in window
B D               Guinea pig 21bp
B D                   Rabbit 3bp

Alignment block 8 of 939 in window, 4841916 - 4841916, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
           Chinese tree shrew  -a
B D                  Squirrel  -a
       Lesser Egyptian jerboa  -a
                 Prairie vole  -g
B D           Chinese hamster  -a
B D                     Mouse  -a
B D                       Rat  -a
B D            Naked mole-rat  -a
                   Chinchilla  -a
B D                    Rabbit  -a
B D                       Pig  -g
B D                    Alpaca  -a
               Bactrian camel  -a
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -a
B D                       Cow  -a
B D                     Sheep  -a
                Domestic goat  -a
B D                     Horse  -a
B D          White rhinoceros  -a
B D                   Ferret   -a
B D                     Panda  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -g
         David's myotis (bat)  -a
B D                  Hedgehog  -a
B D                     Shrew  -a
              Star-nosed mole  -a
B D                    Tenrec  c-
B D                Guinea pig  ==
              Golden hamster  NN
B D                  Elephant  ==
         Cape elephant shrew  ==
B D                      Pika  --
B D                 Armadillo  ==
B D                   Manatee  ==
            Brush-tailed rat  --
              Pacific walrus  --
B D                       Dog  --
B D                       Cat  ==
B D                  Microbat  ==
B D                  Bushbaby  ==
            Cape golden mole  ==
                Weddell seal  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
                    Aardvark  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D              Nile tilapia  ==
B D                 Tetraodon  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
B D                   Opossum  ==
B D        American alligator  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==
B D           Tasmanian devil  ==

Inserts between block 8 and 9 in window
            Black flying-fox 20bp
B D                  Megabat 20bp
               Big brown bat 4bp
        David's myotis (bat) 1bp

Alignment block 9 of 939 in window, 4841917 - 4841921, 5 bps 
B D                     Human  ---gggag
B D                     Chimp  ---gggag
B D                   Gorilla  ---gggag
B D                 Orangutan  ---gggag
B D                    Gibbon  ---gagag
B D                    Rhesus  ---gggag
B D       Crab-eating macaque  ---gggag
B D                    Baboon  ---gggag
B D              Green monkey  ---gggag
B D                  Marmoset  ---gggag
B D           Squirrel monkey  ---gggag
           Chinese tree shrew  ---gggag
B D                  Squirrel  ---tggag
       Lesser Egyptian jerboa  ---gggag
                 Prairie vole  ---gggag
B D           Chinese hamster  ---ggagg
B D                     Mouse  ---gggag
B D                       Rat  ---gggag
B D            Naked mole-rat  ---aggag
                   Chinchilla  ---aggag
B D                    Rabbit  ---gagag
B D                       Pig  ---ggg--
B D                    Alpaca  ---ggatg
               Bactrian camel  ---ggatg
B D                   Dolphin  ---gggag
                 Killer whale  ---gggag
             Tibetan antelope  ---tggag
B D                       Cow  ---gggag
B D                     Sheep  ---gggag
                Domestic goat  ---gggag
B D                     Horse  ---gggag
B D          White rhinoceros  ---gggag
B D                   Ferret   ---gggcc
B D                     Panda  ---gggag
                Big brown bat  ---gggag
         David's myotis (bat)  ---gggag
B D                  Hedgehog  ---gggag
B D                     Shrew  ---gggag
              Star-nosed mole  ---gaaag
B D                    Tenrec  gatgg---
B D                Guinea pig  ========
              Golden hamster  NNNNNNNN
B D                  Elephant  ========
         Cape elephant shrew  ========
B D                      Pika  --------
B D                 Armadillo  ========
B D                   Manatee  ========
            Brush-tailed rat  --------
              Pacific walrus  --------
B D                       Dog  --------
B D                       Cat  ========
B D                  Microbat  ========
B D                  Bushbaby  ========
            Black flying-fox  ========
            Cape golden mole  ========
                Weddell seal  --------
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
                    Aardvark  ========
B D               Stickleback  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D                    Medaka  ========
B D                Coelacanth  ========
B D                    Turkey  ========
                 Spotted gar  ========
  D              Mallard duck  ========
  D    Spiny softshell turtle  ========
          Southern platyfish  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
B D              Nile tilapia  ========
B D                 Tetraodon  ========
B D                   Chicken  ========
B D              Atlantic cod  ========
  D  Chinese softshell turtle  ========
  D           Green seaturtle  ========
B D       Medium ground finch  ========
B D                   Opossum  ========
B D        American alligator  ========
  D    White-throated sparrow  ========
          Tibetan ground jay  ========
B D                   Megabat  ========
B D           Tasmanian devil  ========

Alignment block 10 of 939 in window, 4841922 - 4841928, 7 bps 
B D                     Human  gattaac
B D                     Chimp  gattaac
B D                   Gorilla  gattaac
B D                    Gibbon  gattaac
B D                    Rhesus  gattaac
B D       Crab-eating macaque  gattaac
B D                    Baboon  gattaac
B D              Green monkey  gattaac
B D                  Marmoset  gattaat
B D           Squirrel monkey  gattaat
           Chinese tree shrew  gcttaac
B D                  Squirrel  ttttaac
       Lesser Egyptian jerboa  atttagc
                 Prairie vole  -tttaac
B D           Chinese hamster  -tttaac
B D                     Mouse  ttttaac
B D                       Rat  ttttaac
B D            Naked mole-rat  gtttagc
                   Chinchilla  gtttaac
B D                    Rabbit  ----aaa
B D                    Alpaca  gtttcat
               Bactrian camel  gtttcat
B D                   Dolphin  gtttcat
                 Killer whale  gtttcat
             Tibetan antelope  gtttcat
B D                       Cow  gtttcat
B D                     Sheep  gtttcat
                Domestic goat  gttgcat
B D                     Horse  cttcaat
B D          White rhinoceros  gtttaat
B D                   Ferret   atgtagc
B D                     Panda  gtgtaac
               Pacific walrus  -cgtcac
                 Weddell seal  -tgtcac
                Big brown bat  gtttaat
         David's myotis (bat)  gtttaat
B D                  Hedgehog  gtgtaat
B D                     Shrew  ttttaat
              Star-nosed mole  atttaat
B D                    Tenrec  aatta--
B D                Guinea pig  =======
              Golden hamster  NNNNNNN
B D                  Elephant  =======
         Cape elephant shrew  =======
B D                      Pika  -------
B D                 Armadillo  =======
B D                   Manatee  =======
            Brush-tailed rat  -------
B D                       Dog  -------
B D                       Cat  =======
B D                  Microbat  =======
B D                  Bushbaby  =======
            Black flying-fox  =======
            Cape golden mole  =======
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
                    Aardvark  =======
B D               Stickleback  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                    Medaka  =======
B D                Coelacanth  =======
B D                    Turkey  =======
                 Spotted gar  =======
  D              Mallard duck  =======
  D    Spiny softshell turtle  =======
          Southern platyfish  =======
    Mexican tetra (cavefish)  =======
B D                 Zebrafish  =======
B D              Nile tilapia  =======
B D                 Tetraodon  =======
B D                   Chicken  =======
B D              Atlantic cod  =======
  D  Chinese softshell turtle  =======
  D           Green seaturtle  =======
B D       Medium ground finch  =======
B D                   Opossum  =======
B D        American alligator  =======
  D    White-throated sparrow  =======
          Tibetan ground jay  =======
B D                   Megabat  =======
B D                       Pig  -------
B D           Tasmanian devil  =======
B D                 Orangutan  NNNNNNN

Inserts between block 10 and 11 in window
B D                 Marmoset 8bp
B D           Naked mole-rat 8bp
B D                   Rabbit 2bp

Alignment block 11 of 939 in window, 4841929 - 4841931, 3 bps 
B D                     Human  tgt
B D                     Chimp  tgt
B D                   Gorilla  tgt
B D                    Gibbon  tgt
B D                    Rhesus  tgt
B D       Crab-eating macaque  tgt
B D                    Baboon  tgt
B D              Green monkey  tgt
B D           Squirrel monkey  tgt
           Chinese tree shrew  tat
B D                  Squirrel  tg-
       Lesser Egyptian jerboa  tg-
                 Prairie vole  tg-
B D           Chinese hamster  tg-
B D                       Rat  tg-
                   Chinchilla  tg-
B D                    Rabbit  tc-
B D                    Alpaca  tgt
               Bactrian camel  tgt
B D                   Dolphin  tgt
                 Killer whale  tgt
             Tibetan antelope  tat
B D                       Cow  tgc
B D                     Sheep  tat
                Domestic goat  tat
B D                     Horse  tgt
B D          White rhinoceros  tg-
B D                   Ferret   ggt
B D                     Panda  tgt
               Pacific walrus  tgt
                 Weddell seal  tgt
                Big brown bat  tgt
         David's myotis (bat)  tgt
B D                  Hedgehog  tgt
B D                     Shrew  tgt
              Star-nosed mole  tat
B D                    Tenrec  tat
B D                Guinea pig  ===
B D                     Mouse  ---
              Golden hamster  NNN
B D                  Elephant  ===
         Cape elephant shrew  ===
B D                      Pika  ---
B D                 Armadillo  ===
B D                   Manatee  ===
            Brush-tailed rat  ---
B D                       Dog  ---
B D                       Cat  ===
B D                  Microbat  ===
B D                  Bushbaby  ===
B D            Naked mole-rat  ===
            Black flying-fox  ===
            Cape golden mole  ===
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D    Spiny softshell turtle  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D              Nile tilapia  ===
B D                 Tetraodon  ===
B D                  Marmoset  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
  D  Chinese softshell turtle  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ===
B D                       Pig  ---
B D           Tasmanian devil  ===
B D                 Orangutan  NNN

Inserts between block 11 and 12 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 10bp
                Prairie vole 11bp
B D          Chinese hamster 2bp
B D                      Rat 10bp
                  Chinchilla 1bp
            Tibetan antelope 8bp
B D                      Cow 34bp
        David's myotis (bat) 29bp
             Star-nosed mole 65bp

Alignment block 12 of 939 in window, 4841932 - 4841932, 1 bps 
B D                     Human  -c
B D                     Chimp  -c
B D                   Gorilla  -c
B D                    Gibbon  -c
B D                    Rhesus  -c
B D       Crab-eating macaque  -c
B D                    Baboon  -c
B D              Green monkey  -c
B D           Squirrel monkey  -c
B D                   Dolphin  -c
             Tibetan antelope  -c
B D                     Sheep  -c
                Domestic goat  -c
B D                     Horse  -c
B D                   Ferret   -c
B D                     Panda  -c
               Pacific walrus  -g
                 Weddell seal  -g
                Big brown bat  -c
B D                  Hedgehog  -c
B D                    Tenrec  g-
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  --
              Golden hamster  NN
B D           Chinese hamster  ==
                Prairie vole  ==
B D                  Elephant  ==
         Cape elephant shrew  ==
B D                     Shrew  --
        David's myotis (bat)  ==
B D                       Cow  ==
B D                    Alpaca  --
             Star-nosed mole  ==
B D                  Squirrel  ==
B D                      Pika  --
B D                    Rabbit  --
B D                 Armadillo  ==
B D                   Manatee  ==
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
B D          White rhinoceros  --
            Brush-tailed rat  --
          Chinese tree shrew  --
B D                       Dog  --
B D                       Cat  ==
B D                  Microbat  ==
B D                  Bushbaby  ==
B D            Naked mole-rat  ==
                Killer whale  --
              Bactrian camel  --
            Black flying-fox  ==
            Cape golden mole  ==
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
                    Aardvark  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D              Nile tilapia  ==
B D                 Tetraodon  ==
B D                  Marmoset  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D  Chinese softshell turtle  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
B D                   Opossum  ==
B D        American alligator  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==
B D                   Megabat  ==
B D                       Pig  --
B D           Tasmanian devil  ==
B D                 Orangutan  NN

Inserts between block 12 and 13 in window
B D          Squirrel monkey 4bp
B D                    Horse 8bp
B D                  Ferret  9bp
B D                    Panda 10bp
              Pacific walrus 2bp
                Weddell seal 2bp
               Big brown bat 40bp
B D                 Hedgehog 4bp

Alignment block 13 of 939 in window, 4841933 - 4841941, 9 bps 
B D                     Human  ttgggagca-
B D                     Chimp  ttgggagca-
B D                   Gorilla  ttgggagca-
B D                    Gibbon  ttgggagcg-
B D                    Rhesus  ttgggagcg-
B D       Crab-eating macaque  ttgggagcg-
B D                    Baboon  ttgggagcg-
B D              Green monkey  ttgggagcg-
B D                    Rabbit  ttcattttt-
             Tibetan antelope  tcagaagca-
B D                     Horse  tggggagca-
B D                   Ferret   -gcaggggg-
               Pacific walrus  aacggggca-
                 Weddell seal  tacagagca-
B D                    Tenrec  ttgggagtcc
B D                  Hedgehog  ==========
B D                Guinea pig  ==========
B D                       Rat  ==========
B D                     Mouse  ----------
              Golden hamster  NNNNNNNNNN
B D           Chinese hamster  ==========
                Prairie vole  ==========
B D                  Elephant  ==========
         Cape elephant shrew  ==========
B D                     Shrew  ----------
        David's myotis (bat)  ==========
               Domestic goat  ----------
B D                     Sheep  ----------
B D                       Cow  ==========
B D                    Alpaca  ----------
             Star-nosed mole  ==========
B D                  Squirrel  ==========
B D                      Pika  ----------
B D                 Armadillo  ==========
B D                   Manatee  ==========
                  Chinchilla  ==========
      Lesser Egyptian jerboa  ==========
B D          White rhinoceros  ----------
            Brush-tailed rat  ----------
          Chinese tree shrew  ----------
B D                       Dog  ----------
B D                       Cat  ==========
B D                  Microbat  ==========
B D                  Bushbaby  ==========
               Big brown bat  ==========
B D            Naked mole-rat  ==========
                Killer whale  ----------
              Bactrian camel  ----------
B D                     Panda  ==========
            Black flying-fox  ==========
            Cape golden mole  ==========
B D                   Dolphin  ----------
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
                    Aardvark  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D    Spiny softshell turtle  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
B D                 Zebrafish  ==========
B D              Nile tilapia  ==========
B D                 Tetraodon  ==========
B D                  Marmoset  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
  D  Chinese softshell turtle  ==========
B D           Squirrel monkey  ==========
  D           Green seaturtle  ==========
B D       Medium ground finch  ==========
B D                   Opossum  ==========
B D        American alligator  ==========
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========
B D                   Megabat  ==========
B D                       Pig  ----------
B D           Tasmanian devil  ==========
B D                 Orangutan  NNNNNNNNNN

Inserts between block 13 and 14 in window
            Tibetan antelope 38bp

Alignment block 14 of 939 in window, 4841942 - 4841943, 2 bps 
B D                     Human  cc
B D                     Chimp  cc
B D                   Gorilla  cc
B D                    Gibbon  cc
B D                    Rhesus  ct
B D       Crab-eating macaque  ct
B D                    Baboon  ct
B D              Green monkey  cc
B D                    Rabbit  ct
B D                     Horse  cc
B D                   Ferret   ac
               Pacific walrus  cc
                 Weddell seal  cc
B D                    Tenrec  cc
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                       Rat  ==
B D                     Mouse  --
              Golden hamster  NN
B D           Chinese hamster  ==
                Prairie vole  ==
B D                  Elephant  ==
            Tibetan antelope  ==
         Cape elephant shrew  ==
B D                     Shrew  --
        David's myotis (bat)  ==
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
B D                    Alpaca  --
             Star-nosed mole  ==
B D                  Squirrel  ==
B D                      Pika  --
B D                 Armadillo  ==
B D                   Manatee  ==
                  Chinchilla  ==
      Lesser Egyptian jerboa  ==
B D          White rhinoceros  --
            Brush-tailed rat  --
          Chinese tree shrew  --
B D                       Dog  --
B D                       Cat  ==
B D                  Microbat  ==
B D                  Bushbaby  ==
               Big brown bat  ==
B D            Naked mole-rat  ==
                Killer whale  --
              Bactrian camel  --
B D                     Panda  ==
            Black flying-fox  ==
            Cape golden mole  ==
B D                   Dolphin  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
                    Aardvark  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D              Nile tilapia  ==
B D                 Tetraodon  ==
B D                  Marmoset  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
B D                   Opossum  ==
B D        American alligator  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==
B D                   Megabat  ==
B D                       Pig  --
B D           Tasmanian devil  ==
B D                 Orangutan  NN

Inserts between block 14 and 15 in window
B D                  Ferret  1bp

Alignment block 15 of 939 in window, 4841944 - 4841948, 5 bps 
B D                     Human  gggca
B D                     Chimp  gggca
B D                   Gorilla  gggca
B D                    Gibbon  aggtg
B D                    Rhesus  gggcg
B D       Crab-eating macaque  gggcg
B D                    Baboon  gggcg
B D              Green monkey  gggcg
           Chinese tree shrew  ---ca
B D                    Rabbit  gt---
B D                    Tenrec  gggca
B D                  Hedgehog  =====
B D                Guinea pig  =====
B D                       Rat  =====
B D                     Mouse  -----
              Golden hamster  NNNNN
B D           Chinese hamster  =====
                Prairie vole  =====
B D                  Elephant  =====
            Tibetan antelope  =====
         Cape elephant shrew  =====
B D                     Shrew  -----
        David's myotis (bat)  =====
B D                     Horse  -----
               Domestic goat  -----
B D                     Sheep  -----
B D                       Cow  =====
B D                    Alpaca  -----
             Star-nosed mole  =====
B D                  Squirrel  =====
B D                      Pika  -----
B D                 Armadillo  =====
B D                   Manatee  =====
                  Chinchilla  =====
      Lesser Egyptian jerboa  =====
B D          White rhinoceros  -----
            Brush-tailed rat  -----
              Pacific walrus  -----
B D                       Dog  -----
B D                       Cat  =====
B D                  Microbat  =====
B D                  Bushbaby  =====
               Big brown bat  =====
B D            Naked mole-rat  =====
                Killer whale  -----
              Bactrian camel  -----
B D                     Panda  =====
            Black flying-fox  =====
B D                   Ferret   =====
            Cape golden mole  =====
B D                   Dolphin  -----
                Weddell seal  -----
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
                    Aardvark  =====
B D               Stickleback  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                    Medaka  =====
B D                Coelacanth  =====
B D                    Turkey  =====
                 Spotted gar  =====
  D              Mallard duck  =====
  D    Spiny softshell turtle  =====
          Southern platyfish  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D              Nile tilapia  =====
B D                 Tetraodon  =====
B D                  Marmoset  =====
B D                   Chicken  =====
B D              Atlantic cod  =====
  D  Chinese softshell turtle  =====
B D           Squirrel monkey  =====
  D           Green seaturtle  =====
B D       Medium ground finch  =====
B D                   Opossum  =====
B D        American alligator  =====
  D    White-throated sparrow  =====
          Tibetan ground jay  =====
B D                   Megabat  =====
B D                       Pig  -----
B D           Tasmanian devil  =====
B D                 Orangutan  NNNNN

Inserts between block 15 and 16 in window
B D                   Tenrec 287bp

Alignment block 16 of 939 in window, 4841949 - 4841964, 16 bps 
B D                     Human  cggtggctcacgcctg
B D                     Chimp  cggtggctcacgcctg
B D                   Gorilla  cggttgctcacgcctg
B D                    Gibbon  tgg--------gcctg
B D                    Rhesus  cggtggctcacacctg
B D       Crab-eating macaque  cggtggctcacacctg
B D                    Baboon  cagtggctcacacctg
B D              Green monkey  tggtggctcacacctg
           Chinese tree shrew  ctgtgtcttg-----g
B D                    Rabbit  ---tggttcaccc---
B D                     Horse  --------aa------
B D                       Dog  --------cactcctg
B D                   Ferret   ---ggggacgttcatg
B D                    Tenrec  ================
B D                  Hedgehog  ================
B D                Guinea pig  ================
B D                       Rat  ================
B D                     Mouse  ----------------
              Golden hamster  NNNNNNNNNNNNNNNN
B D           Chinese hamster  ================
                Prairie vole  ================
B D                  Elephant  ================
            Tibetan antelope  ================
         Cape elephant shrew  ================
B D                     Shrew  ----------------
        David's myotis (bat)  ================
               Domestic goat  ----------------
B D                     Sheep  ----------------
B D                       Cow  ================
B D                    Alpaca  ----------------
             Star-nosed mole  ================
B D                  Squirrel  ================
B D                      Pika  ----------------
B D                 Armadillo  ================
B D                   Manatee  ================
                  Chinchilla  ================
      Lesser Egyptian jerboa  ================
B D          White rhinoceros  ----------------
            Brush-tailed rat  ----------------
              Pacific walrus  ----------------
B D                       Cat  ================
B D                  Microbat  ================
B D                  Bushbaby  ================
               Big brown bat  ================
B D            Naked mole-rat  ================
                Killer whale  ----------------
              Bactrian camel  ----------------
B D                     Panda  ================
            Black flying-fox  ================
            Cape golden mole  ================
B D                   Dolphin  ----------------
                Weddell seal  ----------------
      Yellowbelly pufferfish  ================
B D                      Fugu  ================
                    Aardvark  ================
B D               Stickleback  ================
         Pundamilia nyererei  ================
                 Zebra mbuna  ================
       Burton's mouthbreeder  ================
         Princess of Burundi  ================
B D                    Medaka  ================
B D                Coelacanth  ================
B D                    Turkey  ================
                 Spotted gar  ================
  D              Mallard duck  ================
  D    Spiny softshell turtle  ================
          Southern platyfish  ================
    Mexican tetra (cavefish)  ================
B D                 Zebrafish  ================
B D              Nile tilapia  ================
B D                 Tetraodon  ================
B D                  Marmoset  ================
B D                   Chicken  ================
B D              Atlantic cod  ================
  D  Chinese softshell turtle  ================
B D           Squirrel monkey  ================
  D           Green seaturtle  ================
B D       Medium ground finch  ================
B D                   Opossum  ================
B D        American alligator  ================
  D    White-throated sparrow  ================
          Tibetan ground jay  ================
B D                   Megabat  ================
B D                       Pig  ----------------
B D           Tasmanian devil  ================
B D                 Orangutan  NNNNNNNNNNNNNNNN

Inserts between block 16 and 17 in window
B D                  Ferret  2bp

Alignment block 17 of 939 in window, 4841965 - 4841975, 11 bps 
B D                     Human  taatcccagca
B D                     Chimp  taatcccagca
B D                   Gorilla  taatcccagca
B D                    Gibbon  taatcccagca
B D                    Rhesus  taatcccagca
B D       Crab-eating macaque  taatcccagca
B D                    Baboon  taatcccagca
B D              Green monkey  taatcccagca
           Chinese tree shrew  gagttccaaca
B D                  Squirrel  ------cacta
                   Chinchilla  ------cagca
B D                    Rabbit  ----tccaatg
B D                    Alpaca  ---------ca
               Bactrian camel  ---------ca
                 Killer whale  ---------ca
B D                     Horse  ------cagca
B D                    Tenrec  ===========
B D                  Hedgehog  ===========
B D                Guinea pig  ===========
B D                       Rat  ===========
B D                     Mouse  -----------
              Golden hamster  NNNNNNNNNNN
B D           Chinese hamster  ===========
                Prairie vole  ===========
B D                  Elephant  ===========
            Tibetan antelope  ===========
         Cape elephant shrew  ===========
B D                     Shrew  -----------
        David's myotis (bat)  ===========
               Domestic goat  -----------
B D                     Sheep  -----------
B D                       Cow  ===========
             Star-nosed mole  ===========
B D                      Pika  -----------
B D                 Armadillo  ===========
B D                   Manatee  ===========
      Lesser Egyptian jerboa  ===========
B D          White rhinoceros  -----------
            Brush-tailed rat  -----------
              Pacific walrus  -----------
B D                       Dog  -----------
B D                       Cat  ===========
B D                  Microbat  ===========
B D                  Bushbaby  ===========
               Big brown bat  ===========
B D            Naked mole-rat  ===========
B D                     Panda  ===========
            Black flying-fox  ===========
B D                   Ferret   ===========
            Cape golden mole  ===========
B D                   Dolphin  -----------
                Weddell seal  -----------
      Yellowbelly pufferfish  ===========
B D                      Fugu  ===========
                    Aardvark  ===========
B D               Stickleback  ===========
         Pundamilia nyererei  ===========
                 Zebra mbuna  ===========
       Burton's mouthbreeder  ===========
         Princess of Burundi  ===========
B D                    Medaka  ===========
B D                Coelacanth  ===========
B D                    Turkey  ===========
                 Spotted gar  ===========
  D              Mallard duck  ===========
  D    Spiny softshell turtle  ===========
          Southern platyfish  ===========
    Mexican tetra (cavefish)  ===========
B D                 Zebrafish  ===========
B D              Nile tilapia  ===========
B D                 Tetraodon  ===========
B D                  Marmoset  ===========
B D                   Chicken  ===========
B D              Atlantic cod  ===========
  D  Chinese softshell turtle  ===========
B D           Squirrel monkey  ===========
  D           Green seaturtle  ===========
B D       Medium ground finch  ===========
B D                   Opossum  ===========
B D        American alligator  ===========
  D    White-throated sparrow  ===========
          Tibetan ground jay  ===========
B D                   Megabat  ===========
B D                       Pig  -----------
B D           Tasmanian devil  ===========
B D                 Orangutan  NNNNNNNNNNN

Inserts between block 17 and 18 in window
B D                 Squirrel 2bp
B D                   Rabbit 5bp

Alignment block 18 of 939 in window, 4841976 - 4841978, 3 bps 
B D                     Human  ctt
B D                     Chimp  ctt
B D                   Gorilla  ctt
B D                    Gibbon  ctt
B D                    Rhesus  ctt
B D       Crab-eating macaque  ctt
B D                    Baboon  ctt
B D              Green monkey  ctt
           Chinese tree shrew  ctt
B D                  Squirrel  ttt
       Lesser Egyptian jerboa  --a
                 Prairie vole  --t
B D                       Rat  --t
             Brush-tailed rat  ctc
B D                       Pig  cgg
B D                    Alpaca  ctt
               Bactrian camel  ctt
                 Killer whale  ctt
B D                     Horse  ttt
B D                    Tenrec  ===
B D                  Hedgehog  ===
B D                Guinea pig  ===
B D                     Mouse  ---
              Golden hamster  NNN
B D           Chinese hamster  ===
B D                  Elephant  ===
            Tibetan antelope  ===
         Cape elephant shrew  ===
B D                     Shrew  ---
        David's myotis (bat)  ===
               Domestic goat  ---
B D                     Sheep  ---
B D                       Cow  ===
             Star-nosed mole  ===
B D                      Pika  ---
B D                    Rabbit  ===
B D                 Armadillo  ===
B D                   Manatee  ===
                  Chinchilla  ---
B D          White rhinoceros  ---
              Pacific walrus  ---
B D                       Dog  ---
B D                       Cat  ===
B D                  Microbat  ===
B D                  Bushbaby  ===
               Big brown bat  ===
B D            Naked mole-rat  ===
B D                     Panda  ===
            Black flying-fox  ===
B D                   Ferret   ===
            Cape golden mole  ===
B D                   Dolphin  ---
                Weddell seal  ---
      Yellowbelly pufferfish  ===
B D                      Fugu  ===
                    Aardvark  ===
B D               Stickleback  ===
         Pundamilia nyererei  ===
                 Zebra mbuna  ===
       Burton's mouthbreeder  ===
         Princess of Burundi  ===
B D                    Medaka  ===
B D                Coelacanth  ===
B D                    Turkey  ===
                 Spotted gar  ===
  D              Mallard duck  ===
  D    Spiny softshell turtle  ===
          Southern platyfish  ===
    Mexican tetra (cavefish)  ===
B D                 Zebrafish  ===
B D              Nile tilapia  ===
B D                 Tetraodon  ===
B D                  Marmoset  ===
B D                   Chicken  ===
B D              Atlantic cod  ===
  D  Chinese softshell turtle  ===
B D           Squirrel monkey  ===
  D           Green seaturtle  ===
B D       Medium ground finch  ===
B D                   Opossum  ===
B D        American alligator  ===
  D    White-throated sparrow  ===
          Tibetan ground jay  ===
B D                   Megabat  ===
B D           Tasmanian devil  ===
B D                 Orangutan  NNN

Inserts between block 18 and 19 in window
B D                    Horse 17bp

Alignment block 19 of 939 in window, 4841979 - 4841979, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D                       Rat  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
                 Killer whale  t
B D                    Tenrec  =
B D                  Hedgehog  =
B D                Guinea pig  =
B D                     Mouse  -
              Golden hamster  N
B D           Chinese hamster  =
B D                  Elephant  =
            Tibetan antelope  =
         Cape elephant shrew  =
B D                     Shrew  -
        David's myotis (bat)  =
B D                     Horse  =
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
             Star-nosed mole  =
B D                      Pika  -
B D                 Armadillo  =
B D                   Manatee  =
                  Chinchilla  -
B D          White rhinoceros  -
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Dog  -
B D                       Cat  =
B D                  Microbat  =
B D                  Bushbaby  =
               Big brown bat  =
B D            Naked mole-rat  =
B D                     Panda  =
            Black flying-fox  =
B D                   Ferret   =
            Cape golden mole  =
B D                   Dolphin  -
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D    Spiny softshell turtle  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D              Nile tilapia  =
B D                 Tetraodon  =
B D                  Marmoset  =
B D                   Chicken  =
B D              Atlantic cod  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  =
B D           Tasmanian devil  =
B D                 Orangutan  N

Inserts between block 19 and 20 in window
B D                      Pig 4bp

Alignment block 20 of 939 in window, 4841980 - 4841983, 4 bps 
B D                     Human  ggga
B D                     Chimp  ggga
B D                   Gorilla  cgga
B D                    Gibbon  ggga
B D                    Rhesus  ggga
B D       Crab-eating macaque  ggga
B D                    Baboon  ggga
B D              Green monkey  ggga
B D                  Squirrel  ggga
       Lesser Egyptian jerboa  ggga
                 Prairie vole  ggga
B D                       Rat  ggga
             Brush-tailed rat  gaga
B D                    Rabbit  gcgg
B D                    Tenrec  ====
B D                  Hedgehog  ====
B D                Guinea pig  ====
B D                     Mouse  ----
              Golden hamster  NNNN
B D           Chinese hamster  ====
B D                  Elephant  ====
            Tibetan antelope  ====
         Cape elephant shrew  ====
B D                     Shrew  ----
        David's myotis (bat)  ====
B D                     Horse  ====
               Domestic goat  ----
B D                     Sheep  ----
B D                       Cow  ====
B D                    Alpaca  ----
             Star-nosed mole  ====
B D                      Pika  ----
B D                 Armadillo  ====
B D                   Manatee  ====
                  Chinchilla  ----
B D          White rhinoceros  ----
          Chinese tree shrew  ----
              Pacific walrus  ----
B D                       Dog  ----
B D                       Cat  ====
B D                  Microbat  ====
B D                  Bushbaby  ====
               Big brown bat  ====
B D            Naked mole-rat  ====
                Killer whale  ----
              Bactrian camel  ----
B D                     Panda  ====
            Black flying-fox  ====
B D                   Ferret   ====
            Cape golden mole  ====
B D                   Dolphin  ----
                Weddell seal  ----
      Yellowbelly pufferfish  ====
B D                      Fugu  ====
                    Aardvark  ====
B D               Stickleback  ====
         Pundamilia nyererei  ====
                 Zebra mbuna  ====
       Burton's mouthbreeder  ====
         Princess of Burundi  ====
B D                    Medaka  ====
B D                Coelacanth  ====
B D                    Turkey  ====
                 Spotted gar  ====
  D              Mallard duck  ====
  D    Spiny softshell turtle  ====
          Southern platyfish  ====
    Mexican tetra (cavefish)  ====
B D                 Zebrafish  ====
B D              Nile tilapia  ====
B D                 Tetraodon  ====
B D                  Marmoset  ====
B D                   Chicken  ====
B D              Atlantic cod  ====
  D  Chinese softshell turtle  ====
B D           Squirrel monkey  ====
  D           Green seaturtle  ====
B D       Medium ground finch  ====
B D                   Opossum  ====
B D        American alligator  ====
  D    White-throated sparrow  ====
          Tibetan ground jay  ====
B D                   Megabat  ====
B D                       Pig  ====
B D           Tasmanian devil  ====
B D                 Orangutan  NNNN

Inserts between block 20 and 21 in window
      Lesser Egyptian jerboa 1bp
                Prairie vole 15bp
B D                      Rat 2bp
            Brush-tailed rat 1bp
B D                   Rabbit 2bp

Alignment block 21 of 939 in window, 4841984 - 4841984, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                    Tenrec  =
B D                  Hedgehog  =
B D                Guinea pig  =
B D                       Rat  =
B D                     Mouse  -
              Golden hamster  N
B D           Chinese hamster  =
                Prairie vole  =
B D                  Elephant  =
            Tibetan antelope  =
         Cape elephant shrew  =
B D                     Shrew  -
        David's myotis (bat)  =
B D                     Horse  =
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  =
B D                  Squirrel  -
B D                      Pika  -
B D                    Rabbit  =
B D                 Armadillo  =
B D                   Manatee  =
                  Chinchilla  -
      Lesser Egyptian jerboa  =
B D          White rhinoceros  -
            Brush-tailed rat  =
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Dog  -
B D                       Cat  =
B D                  Microbat  =
B D                  Bushbaby  =
               Big brown bat  =
B D            Naked mole-rat  =
                Killer whale  -
              Bactrian camel  -
B D                     Panda  =
            Black flying-fox  =
B D                   Ferret   =
            Cape golden mole  =
B D                   Dolphin  -
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D    Spiny softshell turtle  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D              Nile tilapia  =
B D                 Tetraodon  =
B D                  Marmoset  =
B D                   Chicken  =
B D              Atlantic cod  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  =
B D           Tasmanian devil  =
B D                 Orangutan  N

Alignment block 22 of 939 in window, 4841985 - 4842014, 30 bps 
B D                     Human  gccgaggcgggcggatcacgaggtcaggag
B D                     Chimp  gccgaggcgggcggatcacgaggtcaggag
B D                   Gorilla  gcggaggtgggcggatcacgaggtcaggag
B D                    Gibbon  gccgaggcg-----------------ggag
B D                    Rhesus  gccgaggcgggcggatcatgaggtcaggag
B D       Crab-eating macaque  gccaaggcgggcggatcatgaggtcaggag
B D                    Baboon  gccgaggcgggcggatcatgaggtcaggag
B D              Green monkey  gccgaggcgggcggatcatgaggtcaggag
                 Prairie vole  ---------------------agtaaggat
B D                    Rabbit  ggcgcactgcgctgatctgaaagccaggag
B D          White rhinoceros  ---------------tcactgtgtcggggg
B D                   Ferret   ------------------ccgagtgcgggc
B D                    Tenrec  ==============================
B D                  Hedgehog  ==============================
B D                Guinea pig  ==============================
B D                       Rat  ==============================
B D                     Mouse  ------------------------------
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D           Chinese hamster  ==============================
B D                  Elephant  ==============================
            Tibetan antelope  ==============================
         Cape elephant shrew  ==============================
B D                     Shrew  ------------------------------
        David's myotis (bat)  ==============================
B D                     Horse  ==============================
               Domestic goat  ------------------------------
B D                     Sheep  ------------------------------
B D                       Cow  ==============================
B D                    Alpaca  ------------------------------
             Star-nosed mole  ==============================
B D                  Squirrel  ------------------------------
B D                      Pika  ------------------------------
B D                 Armadillo  ==============================
B D                   Manatee  ==============================
                  Chinchilla  ------------------------------
      Lesser Egyptian jerboa  ==============================
            Brush-tailed rat  ==============================
          Chinese tree shrew  ------------------------------
              Pacific walrus  ------------------------------
B D                       Dog  ------------------------------
B D                       Cat  ==============================
B D                  Microbat  ==============================
B D                  Bushbaby  ==============================
               Big brown bat  ==============================
B D            Naked mole-rat  ==============================
                Killer whale  ------------------------------
              Bactrian camel  ------------------------------
B D                     Panda  ==============================
            Black flying-fox  ==============================
            Cape golden mole  ==============================
B D                   Dolphin  ------------------------------
                Weddell seal  ------------------------------
      Yellowbelly pufferfish  ==============================
B D                      Fugu  ==============================
                    Aardvark  ==============================
B D               Stickleback  ==============================
         Pundamilia nyererei  ==============================
                 Zebra mbuna  ==============================
       Burton's mouthbreeder  ==============================
         Princess of Burundi  ==============================
B D                    Medaka  ==============================
B D                Coelacanth  ==============================
B D                    Turkey  ==============================
                 Spotted gar  ==============================
  D              Mallard duck  ==============================
  D    Spiny softshell turtle  ==============================
          Southern platyfish  ==============================
    Mexican tetra (cavefish)  ==============================
B D                 Zebrafish  ==============================
B D              Nile tilapia  ==============================
B D                 Tetraodon  ==============================
B D                  Marmoset  ==============================
B D                   Chicken  ==============================
B D              Atlantic cod  ==============================
  D  Chinese softshell turtle  ==============================
B D           Squirrel monkey  ==============================
  D           Green seaturtle  ==============================
B D       Medium ground finch  ==============================
B D                   Opossum  ==============================
B D        American alligator  ==============================
  D    White-throated sparrow  ==============================
          Tibetan ground jay  ==============================
B D                   Megabat  ==============================
B D                       Pig  ==============================
B D           Tasmanian devil  ==============================
B D                 Orangutan  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 22 and 23 in window
B D                   Rabbit 209bp
B D                  Ferret  9bp

Alignment block 23 of 939 in window, 4842015 - 4842029, 15 bps 
B D                     Human  atcgagaccatcctg
B D                     Chimp  atcgagaccatcctg
B D                   Gorilla  atcgagaccatccta
B D                    Gibbon  atcaagaccatcctg
B D                    Rhesus  atcgagaccatcctg
B D       Crab-eating macaque  atcgagaccatcctg
B D                    Baboon  atcgagaccatcctg
B D              Green monkey  atcgagaccatcctg
                 Prairie vole  atta--accatcctg
B D                    Tenrec  ===============
B D                  Hedgehog  ===============
B D                Guinea pig  ===============
B D                       Rat  ===============
B D                     Mouse  ---------------
              Golden hamster  NNNNNNNNNNNNNNN
B D           Chinese hamster  ===============
B D                  Elephant  ===============
            Tibetan antelope  ===============
         Cape elephant shrew  ===============
B D                     Shrew  ---------------
        David's myotis (bat)  ===============
B D                     Horse  ===============
               Domestic goat  ---------------
B D                     Sheep  ---------------
B D                       Cow  ===============
B D                    Alpaca  ---------------
             Star-nosed mole  ===============
B D                  Squirrel  ---------------
B D                      Pika  ---------------
B D                    Rabbit  ===============
B D                 Armadillo  ===============
B D                   Manatee  ===============
                  Chinchilla  ---------------
      Lesser Egyptian jerboa  ===============
B D          White rhinoceros  ---------------
            Brush-tailed rat  ===============
          Chinese tree shrew  ---------------
              Pacific walrus  ---------------
B D                       Dog  ---------------
B D                       Cat  ===============
B D                  Microbat  ===============
B D                  Bushbaby  ===============
               Big brown bat  ===============
B D            Naked mole-rat  ===============
                Killer whale  ---------------
              Bactrian camel  ---------------
B D                     Panda  ===============
            Black flying-fox  ===============
B D                   Ferret   ===============
            Cape golden mole  ===============
B D                   Dolphin  ---------------
                Weddell seal  ---------------
      Yellowbelly pufferfish  ===============
B D                      Fugu  ===============
                    Aardvark  ===============
B D               Stickleback  ===============
         Pundamilia nyererei  ===============
                 Zebra mbuna  ===============
       Burton's mouthbreeder  ===============
         Princess of Burundi  ===============
B D                    Medaka  ===============
B D                Coelacanth  ===============
B D                    Turkey  ===============
                 Spotted gar  ===============
  D              Mallard duck  ===============
  D    Spiny softshell turtle  ===============
          Southern platyfish  ===============
    Mexican tetra (cavefish)  ===============
B D                 Zebrafish  ===============
B D              Nile tilapia  ===============
B D                 Tetraodon  ===============
B D                  Marmoset  ===============
B D                   Chicken  ===============
B D              Atlantic cod  ===============
  D  Chinese softshell turtle  ===============
B D           Squirrel monkey  ===============
  D           Green seaturtle  ===============
B D       Medium ground finch  ===============
B D                   Opossum  ===============
B D        American alligator  ===============
  D    White-throated sparrow  ===============
          Tibetan ground jay  ===============
B D                   Megabat  ===============
B D                       Pig  ===============
B D           Tasmanian devil  ===============
B D                 Orangutan  NNNNNNNNNNNNNNN

Alignment block 24 of 939 in window, 4842030 - 4842042, 13 bps 
B D                     Human  gctaacacggtga
B D                     Chimp  gctaacacggtga
B D                   Gorilla  gctaacacggtga
B D                    Gibbon  gctaacacagtga
B D                    Rhesus  gctaacatggtga
B D       Crab-eating macaque  gctaacatggtga
B D                    Baboon  gctaacacggtga
B D              Green monkey  gctaacatggtga
B D                      Pika  -ccaactcggtag
B D                       Pig  --------gggga
B D                   Ferret   -----------ga
B D                    Tenrec  =============
B D                  Hedgehog  =============
B D                Guinea pig  =============
B D                       Rat  =============
B D                     Mouse  -------------
              Golden hamster  NNNNNNNNNNNNN
B D           Chinese hamster  =============
                Prairie vole  -------------
B D                  Elephant  =============
            Tibetan antelope  =============
         Cape elephant shrew  =============
B D                     Shrew  -------------
        David's myotis (bat)  =============
B D                     Horse  =============
               Domestic goat  -------------
B D                     Sheep  -------------
B D                       Cow  =============
B D                    Alpaca  -------------
             Star-nosed mole  =============
B D                  Squirrel  -------------
B D                    Rabbit  =============
B D                 Armadillo  =============
B D                   Manatee  =============
                  Chinchilla  -------------
      Lesser Egyptian jerboa  =============
B D          White rhinoceros  -------------
            Brush-tailed rat  =============
          Chinese tree shrew  -------------
              Pacific walrus  -------------
B D                       Dog  -------------
B D                       Cat  =============
B D                  Microbat  =============
B D                  Bushbaby  =============
               Big brown bat  =============
B D            Naked mole-rat  =============
                Killer whale  -------------
              Bactrian camel  -------------
B D                     Panda  =============
            Black flying-fox  =============
            Cape golden mole  =============
B D                   Dolphin  -------------
                Weddell seal  -------------
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
                    Aardvark  =============
B D               Stickleback  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D                    Medaka  =============
B D                Coelacanth  =============
B D                    Turkey  =============
                 Spotted gar  =============
  D              Mallard duck  =============
  D    Spiny softshell turtle  =============
          Southern platyfish  =============
    Mexican tetra (cavefish)  =============
B D                 Zebrafish  =============
B D              Nile tilapia  =============
B D                 Tetraodon  =============
B D                  Marmoset  =============
B D                   Chicken  =============
B D              Atlantic cod  =============
  D  Chinese softshell turtle  =============
B D           Squirrel monkey  =============
  D           Green seaturtle  =============
B D       Medium ground finch  =============
B D                   Opossum  =============
B D        American alligator  =============
  D    White-throated sparrow  =============
          Tibetan ground jay  =============
B D                   Megabat  =============
B D           Tasmanian devil  =============
B D                 Orangutan  NNNNNNNNNNNNN

Alignment block 25 of 939 in window, 4842043 - 4842047, 5 bps 
B D                     Human  aaccc
B D                     Chimp  aaccc
B D                   Gorilla  aaccc
B D                    Gibbon  aaccc
B D                    Rhesus  aaccc
B D       Crab-eating macaque  aaccc
B D                    Baboon  aaccc
B D              Green monkey  aaccc
B D           Chinese hamster  aactg
B D                       Pig  gactt
B D                   Ferret   gactc
B D                    Tenrec  =====
B D                  Hedgehog  =====
B D                Guinea pig  =====
B D                       Rat  =====
B D                     Mouse  -----
              Golden hamster  NNNNN
                Prairie vole  -----
B D                  Elephant  =====
            Tibetan antelope  =====
         Cape elephant shrew  =====
B D                     Shrew  -----
        David's myotis (bat)  =====
B D                     Horse  =====
               Domestic goat  -----
B D                     Sheep  -----
B D                       Cow  =====
B D                    Alpaca  -----
             Star-nosed mole  =====
B D                  Squirrel  -----
B D                      Pika  -----
B D                    Rabbit  =====
B D                 Armadillo  =====
B D                   Manatee  =====
                  Chinchilla  -----
      Lesser Egyptian jerboa  =====
B D          White rhinoceros  -----
            Brush-tailed rat  =====
          Chinese tree shrew  -----
              Pacific walrus  -----
B D                       Dog  -----
B D                       Cat  =====
B D                  Microbat  =====
B D                  Bushbaby  =====
               Big brown bat  =====
B D            Naked mole-rat  =====
                Killer whale  -----
              Bactrian camel  -----
B D                     Panda  =====
            Black flying-fox  =====
            Cape golden mole  =====
B D                   Dolphin  -----
                Weddell seal  -----
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
                    Aardvark  =====
B D               Stickleback  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                    Medaka  =====
B D                Coelacanth  =====
B D                    Turkey  =====
                 Spotted gar  =====
  D              Mallard duck  =====
  D    Spiny softshell turtle  =====
          Southern platyfish  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D              Nile tilapia  =====
B D                 Tetraodon  =====
B D                  Marmoset  =====
B D                   Chicken  =====
B D              Atlantic cod  =====
  D  Chinese softshell turtle  =====
B D           Squirrel monkey  =====
  D           Green seaturtle  =====
B D       Medium ground finch  =====
B D                   Opossum  =====
B D        American alligator  =====
  D    White-throated sparrow  =====
          Tibetan ground jay  =====
B D                   Megabat  =====
B D           Tasmanian devil  =====
B D                 Orangutan  NNNNN

Alignment block 26 of 939 in window, 4842048 - 4842055, 8 bps 
B D                     Human  cgtctcta--
B D                     Chimp  cgtctcta--
B D                   Gorilla  cgtctcta--
B D                    Gibbon  cgtctcta--
B D                    Rhesus  tgtctcta--
B D       Crab-eating macaque  tgtctcta--
B D                    Baboon  tgtctcta--
B D              Green monkey  cgtctcta--
       Lesser Egyptian jerboa  ta--------
B D           Chinese hamster  tgtct-----
B D                     Mouse  cgtcacta--
B D                       Rat  -------a--
B D                      Pika  -gtctc----
B D                       Pig  -----catt-
B D                   Ferret   -----ctgtt
B D                    Tenrec  ==========
B D                  Hedgehog  ==========
B D                Guinea pig  ==========
              Golden hamster  NNNNNNNNNN
                Prairie vole  ----------
B D                  Elephant  ==========
            Tibetan antelope  ==========
         Cape elephant shrew  ==========
B D                     Shrew  ----------
        David's myotis (bat)  ==========
B D                     Horse  ==========
               Domestic goat  ----------
B D                     Sheep  ----------
B D                       Cow  ==========
B D                    Alpaca  ----------
             Star-nosed mole  ==========
B D                  Squirrel  ----------
B D                    Rabbit  ==========
B D                 Armadillo  ==========
B D                   Manatee  ==========
                  Chinchilla  ----------
B D          White rhinoceros  ----------
            Brush-tailed rat  ==========
          Chinese tree shrew  ----------
              Pacific walrus  ----------
B D                       Dog  ----------
B D                       Cat  ==========
B D                  Microbat  ==========
B D                  Bushbaby  ==========
               Big brown bat  ==========
B D            Naked mole-rat  ==========
                Killer whale  ----------
              Bactrian camel  ----------
B D                     Panda  ==========
            Black flying-fox  ==========
            Cape golden mole  ==========
B D                   Dolphin  ----------
                Weddell seal  ----------
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
                    Aardvark  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D    Spiny softshell turtle  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
B D                 Zebrafish  ==========
B D              Nile tilapia  ==========
B D                 Tetraodon  ==========
B D                  Marmoset  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
  D  Chinese softshell turtle  ==========
B D           Squirrel monkey  ==========
  D           Green seaturtle  ==========
B D       Medium ground finch  ==========
B D                   Opossum  ==========
B D        American alligator  ==========
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========
B D                   Megabat  ==========
B D           Tasmanian devil  ==========
B D                 Orangutan  NNNNNNNNNN

Alignment block 27 of 939 in window, 4842056 - 4842060, 5 bps 
B D                     Human  ctaaa
B D                     Chimp  ctaaa
B D                   Gorilla  ctaaa
B D                    Gibbon  ctaaa
B D                    Rhesus  ctaaa
B D       Crab-eating macaque  ctaaa
B D                    Baboon  ctaaa
B D              Green monkey  ctaaa
       Lesser Egyptian jerboa  ctaaa
B D           Chinese hamster  -tggg
B D                       Rat  ctaaa
B D                    Tenrec  =====
B D                  Hedgehog  =====
B D                Guinea pig  =====
B D                     Mouse  -----
              Golden hamster  NNNNN
                Prairie vole  -----
B D                  Elephant  =====
            Tibetan antelope  =====
         Cape elephant shrew  =====
B D                     Shrew  -----
        David's myotis (bat)  =====
B D                     Horse  =====
               Domestic goat  -----
B D                     Sheep  -----
B D                       Cow  =====
B D                    Alpaca  -----
             Star-nosed mole  =====
B D                  Squirrel  -----
B D                      Pika  -----
B D                    Rabbit  =====
B D                 Armadillo  =====
B D                   Manatee  =====
                  Chinchilla  -----
B D          White rhinoceros  -----
            Brush-tailed rat  =====
          Chinese tree shrew  -----
              Pacific walrus  -----
B D                       Dog  -----
B D                       Cat  =====
B D                  Microbat  =====
B D                  Bushbaby  =====
               Big brown bat  =====
B D            Naked mole-rat  =====
                Killer whale  -----
              Bactrian camel  -----
B D                     Panda  =====
            Black flying-fox  =====
B D                   Ferret   -----
            Cape golden mole  =====
B D                   Dolphin  -----
                Weddell seal  -----
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
                    Aardvark  =====
B D               Stickleback  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                    Medaka  =====
B D                Coelacanth  =====
B D                    Turkey  =====
                 Spotted gar  =====
  D              Mallard duck  =====
  D    Spiny softshell turtle  =====
          Southern platyfish  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D              Nile tilapia  =====
B D                 Tetraodon  =====
B D                  Marmoset  =====
B D                   Chicken  =====
B D              Atlantic cod  =====
  D  Chinese softshell turtle  =====
B D           Squirrel monkey  =====
  D           Green seaturtle  =====
B D       Medium ground finch  =====
B D                   Opossum  =====
B D        American alligator  =====
  D    White-throated sparrow  =====
          Tibetan ground jay  =====
B D                   Megabat  =====
B D                       Pig  -----
B D           Tasmanian devil  =====
B D                 Orangutan  NNNNN

Alignment block 28 of 939 in window, 4842061 - 4842065, 5 bps 
B D                     Human  aatac
B D                     Chimp  aatac
B D                   Gorilla  aatac
B D                    Gibbon  aatac
B D                    Rhesus  aatta
B D       Crab-eating macaque  aatta
B D                    Baboon  aatt-
B D              Green monkey  aatt-
B D           Chinese hamster  aacac
B D                       Rat  agcac
B D                    Tenrec  =====
B D                  Hedgehog  =====
B D                Guinea pig  =====
B D                     Mouse  -----
              Golden hamster  NNNNN
                Prairie vole  -----
B D                  Elephant  =====
            Tibetan antelope  =====
         Cape elephant shrew  =====
B D                     Shrew  -----
        David's myotis (bat)  =====
B D                     Horse  =====
               Domestic goat  -----
B D                     Sheep  -----
B D                       Cow  =====
B D                    Alpaca  -----
             Star-nosed mole  =====
B D                  Squirrel  -----
B D                      Pika  -----
B D                    Rabbit  =====
B D                 Armadillo  =====
B D                   Manatee  =====
                  Chinchilla  -----
      Lesser Egyptian jerboa  -----
B D          White rhinoceros  -----
            Brush-tailed rat  =====
          Chinese tree shrew  -----
              Pacific walrus  -----
B D                       Dog  -----
B D                       Cat  =====
B D                  Microbat  =====
B D                  Bushbaby  =====
               Big brown bat  =====
B D            Naked mole-rat  =====
                Killer whale  -----
              Bactrian camel  -----
B D                     Panda  =====
            Black flying-fox  =====
B D                   Ferret   -----
            Cape golden mole  =====
B D                   Dolphin  -----
                Weddell seal  -----
      Yellowbelly pufferfish  =====
B D                      Fugu  =====
                    Aardvark  =====
B D               Stickleback  =====
         Pundamilia nyererei  =====
                 Zebra mbuna  =====
       Burton's mouthbreeder  =====
         Princess of Burundi  =====
B D                    Medaka  =====
B D                Coelacanth  =====
B D                    Turkey  =====
                 Spotted gar  =====
  D              Mallard duck  =====
  D    Spiny softshell turtle  =====
          Southern platyfish  =====
    Mexican tetra (cavefish)  =====
B D                 Zebrafish  =====
B D              Nile tilapia  =====
B D                 Tetraodon  =====
B D                  Marmoset  =====
B D                   Chicken  =====
B D              Atlantic cod  =====
  D  Chinese softshell turtle  =====
B D           Squirrel monkey  =====
  D           Green seaturtle  =====
B D       Medium ground finch  =====
B D                   Opossum  =====
B D        American alligator  =====
  D    White-throated sparrow  =====
          Tibetan ground jay  =====
B D                   Megabat  =====
B D                       Pig  -----
B D           Tasmanian devil  =====
B D                 Orangutan  NNNNN

Alignment block 29 of 939 in window, 4842066 - 4842071, 6 bps 
B D                     Human  aaaaaa
B D                     Chimp  -aaaaa
B D                   Gorilla  aaaaaa
B D                    Gibbon  aaaaa-
B D                    Rhesus  aaaaaa
B D       Crab-eating macaque  aaaaaa
B D                    Baboon  -aaaaa
B D              Green monkey  aaaaaa
B D                    Tenrec  ======
B D                  Hedgehog  ======
B D                Guinea pig  ======
B D                       Rat  ------
B D                     Mouse  ------
              Golden hamster  NNNNNN
B D           Chinese hamster  ------
                Prairie vole  ------
B D                  Elephant  ======
            Tibetan antelope  ======
         Cape elephant shrew  ======
B D                     Shrew  ------
        David's myotis (bat)  ======
B D                     Horse  ======
               Domestic goat  ------
B D                     Sheep  ------
B D                       Cow  ======
B D                    Alpaca  ------
             Star-nosed mole  ======
B D                  Squirrel  ------
B D                      Pika  ------
B D                    Rabbit  ======
B D                 Armadillo  ======
B D                   Manatee  ======
                  Chinchilla  ------
      Lesser Egyptian jerboa  ------
B D          White rhinoceros  ------
            Brush-tailed rat  ======
          Chinese tree shrew  ------
              Pacific walrus  ------
B D                       Dog  ------
B D                       Cat  ======
B D                  Microbat  ======
B D                  Bushbaby  ======
               Big brown bat  ======
B D            Naked mole-rat  ======
                Killer whale  ------
              Bactrian camel  ------
B D                     Panda  ======
            Black flying-fox  ======
B D                   Ferret   ------
            Cape golden mole  ======
B D                   Dolphin  ------
                Weddell seal  ------
      Yellowbelly pufferfish  ======
B D                      Fugu  ======
                    Aardvark  ======
B D               Stickleback  ======
         Pundamilia nyererei  ======
                 Zebra mbuna  ======
       Burton's mouthbreeder  ======
         Princess of Burundi  ======
B D                    Medaka  ======
B D                Coelacanth  ======
B D                    Turkey  ======
                 Spotted gar  ======
  D              Mallard duck  ======
  D    Spiny softshell turtle  ======
          Southern platyfish  ======
    Mexican tetra (cavefish)  ======
B D                 Zebrafish  ======
B D              Nile tilapia  ======
B D                 Tetraodon  ======
B D                  Marmoset  ======
B D                   Chicken  ======
B D              Atlantic cod  ======
  D  Chinese softshell turtle  ======
B D           Squirrel monkey  ======
  D           Green seaturtle  ======
B D       Medium ground finch  ======
B D                   Opossum  ======
B D        American alligator  ======
  D    White-throated sparrow  ======
          Tibetan ground jay  ======
B D                   Megabat  ======
B D                       Pig  ------
B D           Tasmanian devil  ======
B D                 Orangutan  NNNNNN

Inserts between block 29 and 30 in window
B D                  Gorilla 10bp

Alignment block 30 of 939 in window, 4842072 - 4842084, 13 bps 
B D                     Human  aaattagccgggc
B D                     Chimp  aaattagccggac
B D                    Gibbon  aaattacccgggc
B D                    Rhesus  aaactagccgggc
B D       Crab-eating macaque  aaactagccgggc
B D                    Baboon  aaactagccgggc
B D              Green monkey  aaactagccgggc
B D           Chinese hamster  --------taa--
B D                      Pika  -----agccaggg
B D                   Ferret   --tccacctggg-
B D                    Tenrec  =============
B D                  Hedgehog  =============
B D                Guinea pig  =============
B D                       Rat  -------------
B D                     Mouse  -------------
              Golden hamster  NNNNNNNNNNNNN
                Prairie vole  -------------
B D                  Elephant  =============
            Tibetan antelope  =============
         Cape elephant shrew  =============
B D                     Shrew  -------------
        David's myotis (bat)  =============
B D                     Horse  =============
               Domestic goat  -------------
B D                     Sheep  -------------
B D                       Cow  =============
B D                    Alpaca  -------------
             Star-nosed mole  =============
B D                  Squirrel  -------------
B D                    Rabbit  =============
B D                 Armadillo  =============
B D                   Manatee  =============
                  Chinchilla  -------------
      Lesser Egyptian jerboa  -------------
B D          White rhinoceros  -------------
            Brush-tailed rat  =============
          Chinese tree shrew  -------------
              Pacific walrus  -------------
B D                       Dog  -------------
B D                       Cat  =============
B D                  Microbat  =============
B D                  Bushbaby  =============
               Big brown bat  =============
B D            Naked mole-rat  =============
                Killer whale  -------------
              Bactrian camel  -------------
B D                     Panda  =============
            Black flying-fox  =============
            Cape golden mole  =============
B D                   Dolphin  -------------
                Weddell seal  -------------
      Yellowbelly pufferfish  =============
B D                      Fugu  =============
                    Aardvark  =============
B D               Stickleback  =============
         Pundamilia nyererei  =============
                 Zebra mbuna  =============
       Burton's mouthbreeder  =============
         Princess of Burundi  =============
B D                    Medaka  =============
B D                Coelacanth  =============
B D                    Turkey  =============
                 Spotted gar  =============
  D              Mallard duck  =============
  D    Spiny softshell turtle  =============
          Southern platyfish  =============
    Mexican tetra (cavefish)  =============
B D                 Zebrafish  =============
B D              Nile tilapia  =============
B D                 Tetraodon  =============
B D                  Marmoset  =============
B D                   Chicken  =============
B D              Atlantic cod  =============
  D  Chinese softshell turtle  =============
B D           Squirrel monkey  =============
  D           Green seaturtle  =============
B D       Medium ground finch  =============
B D                   Opossum  =============
B D                   Gorilla  =============
B D        American alligator  =============
  D    White-throated sparrow  =============
          Tibetan ground jay  =============
B D                   Megabat  =============
B D                       Pig  -------------
B D           Tasmanian devil  =============
B D                 Orangutan  NNNNNNNNNNNNN

Inserts between block 30 and 31 in window
B D          Chinese hamster 2bp

Alignment block 31 of 939 in window, 4842085 - 4842092, 8 bps 
B D                     Human  gcggtggt
B D                     Chimp  gcggtggc
B D                    Gibbon  atggtggc
B D                    Rhesus  atggtggc
B D       Crab-eating macaque  atggtggc
B D                    Baboon  atggtggc
B D              Green monkey  atggtggc
B D                  Squirrel  gcagtagt
B D                      Pika  gcggccat
B D                   Ferret   ctgctggc
B D                    Tenrec  ========
B D                  Hedgehog  ========
B D                Guinea pig  ========
B D                       Rat  --------
B D                     Mouse  --------
              Golden hamster  NNNNNNNN
B D           Chinese hamster  ========
                Prairie vole  --------
B D                  Elephant  ========
            Tibetan antelope  ========
         Cape elephant shrew  ========
B D                     Shrew  --------
        David's myotis (bat)  ========
B D                     Horse  ========
               Domestic goat  --------
B D                     Sheep  --------
B D                       Cow  ========
B D                    Alpaca  --------
             Star-nosed mole  ========
B D                    Rabbit  ========
B D                 Armadillo  ========
B D                   Manatee  ========
                  Chinchilla  --------
      Lesser Egyptian jerboa  --------
B D          White rhinoceros  --------
            Brush-tailed rat  ========
          Chinese tree shrew  --------
              Pacific walrus  --------
B D                       Dog  --------
B D                       Cat  ========
B D                  Microbat  ========
B D                  Bushbaby  ========
               Big brown bat  ========
B D            Naked mole-rat  ========
                Killer whale  --------
              Bactrian camel  --------
B D                     Panda  ========
            Black flying-fox  ========
            Cape golden mole  ========
B D                   Dolphin  --------
                Weddell seal  --------
      Yellowbelly pufferfish  ========
B D                      Fugu  ========
                    Aardvark  ========
B D               Stickleback  ========
         Pundamilia nyererei  ========
                 Zebra mbuna  ========
       Burton's mouthbreeder  ========
         Princess of Burundi  ========
B D                    Medaka  ========
B D                Coelacanth  ========
B D                    Turkey  ========
                 Spotted gar  ========
  D              Mallard duck  ========
  D    Spiny softshell turtle  ========
          Southern platyfish  ========
    Mexican tetra (cavefish)  ========
B D                 Zebrafish  ========
B D              Nile tilapia  ========
B D                 Tetraodon  ========
B D                  Marmoset  ========
B D                   Chicken  ========
B D              Atlantic cod  ========
  D  Chinese softshell turtle  ========
B D           Squirrel monkey  ========
  D           Green seaturtle  ========
B D       Medium ground finch  ========
B D                   Opossum  ========
B D                   Gorilla  ========
B D        American alligator  ========
  D    White-throated sparrow  ========
          Tibetan ground jay  ========
B D                   Megabat  ========
B D                       Pig  --------
B D           Tasmanian devil  ========
B D                 Orangutan  NNNNNNNN

Inserts between block 31 and 32 in window
B D                  Ferret  13bp

Alignment block 32 of 939 in window, 4842093 - 4842093, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  a
B D                    Baboon  g
B D              Green monkey  g
B D                  Squirrel  g
B D                      Pika  a
B D                    Tenrec  =
B D                  Hedgehog  =
B D                Guinea pig  =
B D                       Rat  -
B D                     Mouse  -
              Golden hamster  N
B D           Chinese hamster  =
                Prairie vole  -
B D                  Elephant  =
            Tibetan antelope  =
         Cape elephant shrew  =
B D                     Shrew  -
        David's myotis (bat)  =
B D                     Horse  =
               Domestic goat  -
B D                     Sheep  -
B D                       Cow  =
B D                    Alpaca  -
             Star-nosed mole  =
B D                    Rabbit  =
B D                 Armadillo  =
B D                   Manatee  =
                  Chinchilla  -
      Lesser Egyptian jerboa  -
B D          White rhinoceros  -
            Brush-tailed rat  =
          Chinese tree shrew  -
              Pacific walrus  -
B D                       Dog  -
B D                       Cat  =
B D                  Microbat  =
B D                  Bushbaby  =
               Big brown bat  =
B D            Naked mole-rat  =
                Killer whale  -
              Bactrian camel  -
B D                     Panda  =
            Black flying-fox  =
B D                   Ferret   =
            Cape golden mole  =
B D                   Dolphin  -
                Weddell seal  -
      Yellowbelly pufferfish  =
B D                      Fugu  =
                    Aardvark  =
B D               Stickleback  =
         Pundamilia nyererei  =
                 Zebra mbuna  =
       Burton's mouthbreeder  =
         Princess of Burundi  =
B D                    Medaka  =
B D                Coelacanth  =
B D                    Turkey  =
                 Spotted gar  =
  D              Mallard duck  =
  D    Spiny softshell turtle  =
          Southern platyfish  =
    Mexican tetra (cavefish)  =
B D                 Zebrafish  =
B D              Nile tilapia  =
B D                 Tetraodon  =
B D                  Marmoset  =
B D                   Chicken  =
B D              Atlantic cod  =
  D  Chinese softshell turtle  =
B D           Squirrel monkey  =
  D           Green seaturtle  =
B D       Medium ground finch  =
B D                   Opossum  =
B D                   Gorilla  =
B D        American alligator  =
  D    White-throated sparrow  =
          Tibetan ground jay  =
B D                   Megabat  =
B D                       Pig  -
B D           Tasmanian devil  =
B D                 Orangutan  N

Alignment block 33 of 939 in window, 4842094 - 4842095, 2 bps 
B D                     Human  gg
B D                     Chimp  gg
B D                    Gibbon  gg
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  gg
B D           Chinese hamster  g-
B D                      Pika  g-
B D                    Tenrec  ==
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                       Rat  --
B D                     Mouse  --
              Golden hamster  NN
                Prairie vole  --
B D                  Elephant  ==
            Tibetan antelope  ==
         Cape elephant shrew  ==
B D                     Shrew  --
        David's myotis (bat)  ==
B D                     Horse  ==
               Domestic goat  --
B D                     Sheep  --
B D                       Cow  ==
B D                    Alpaca  --
             Star-nosed mole  ==
B D                  Squirrel  --
B D                    Rabbit  ==
B D                 Armadillo  ==
B D                   Manatee  ==
                  Chinchilla  --
      Lesser Egyptian jerboa  --
B D          White rhinoceros  --
            Brush-tailed rat  ==
          Chinese tree shrew  --
              Pacific walrus  --
B D                       Dog  --
B D                       Cat  ==
B D                  Microbat  ==
B D                  Bushbaby  ==
               Big brown bat  ==
B D            Naked mole-rat  ==
                Killer whale  --
              Bactrian camel  --
B D                     Panda  ==
            Black flying-fox  ==
B D                   Ferret   ==
            Cape golden mole  ==
B D                   Dolphin  --
                Weddell seal  --
      Yellowbelly pufferfish  ==
B D                      Fugu  ==
                    Aardvark  ==
B D               Stickleback  ==
         Pundamilia nyererei  ==
                 Zebra mbuna  ==
       Burton's mouthbreeder  ==
         Princess of Burundi  ==
B D                    Medaka  ==
B D                Coelacanth  ==
B D                    Turkey  ==
                 Spotted gar  ==
  D              Mallard duck  ==
  D    Spiny softshell turtle  ==
          Southern platyfish  ==
    Mexican tetra (cavefish)  ==
B D                 Zebrafish  ==
B D              Nile tilapia  ==
B D                 Tetraodon  ==
B D                  Marmoset  ==
B D                   Chicken  ==
B D              Atlantic cod  ==
  D  Chinese softshell turtle  ==
B D           Squirrel monkey  ==
  D           Green seaturtle  ==
B D       Medium ground finch  ==
B D                   Opossum  ==
B D                   Gorilla  ==
B D        American alligator  ==
  D    White-throated sparrow  ==
          Tibetan ground jay  ==
B D                   Megabat  ==
B D                       Pig  --
B D           Tasmanian devil  ==
B D                 Orangutan  NN

Alignment block 34 of 939 in window, 4842096 - 4842102, 7 bps 
B D                     Human  cgcctgt
B D                     Chimp  cacctgt
B D                    Gibbon  cgcctgt
B D                    Rhesus  cgcctgt
B D       Crab-eating macaque  cgcctgt
B D                    Baboon  cgcctgt
B D              Green monkey  cgcctgt
           Chinese tree shrew  catctgt
B D                    Tenrec  =======
B D                  Hedgehog  =======
B D                Guinea pig  =======
B D                       Rat  -------
B D                     Mouse  -------
              Golden hamster  NNNNNNN
B D           Chinese hamster  -------
                Prairie vole  -------
B D                  Elephant  =======
            Tibetan antelope  =======
         Cape elephant shrew  =======
B D                     Shrew  -------
        David's myotis (bat)  =======
B D                     Horse  =======
               Domestic goat  -------
B D                     Sheep  -------
B D                       Cow  =======
B D                    Alpaca  -------
             Star-nosed mole  =======
B D                  Squirrel  -------
B D                      Pika  -------
B D                    Rabbit  =======
B D                 Armadillo  =======
B D                   Manatee  =======
                  Chinchilla  -------
      Lesser Egyptian jerboa  -------
B D          White rhinoceros  -------
            Brush-tailed rat  =======
              Pacific walrus  -------
B D                       Dog  -------
B D                       Cat  =======
B D                  Microbat  =======
B D                  Bushbaby  =======
               Big brown bat  =======
B D            Naked mole-rat  =======
                Killer whale  -------
              Bactrian camel  -------
B D                     Panda  =======
            Black flying-fox  =======
B D                   Ferret   =======
            Cape golden mole  =======
B D                   Dolphin  -------
                Weddell seal  -------
      Yellowbelly pufferfish  =======
B D                      Fugu  =======
                    Aardvark  =======
B D               Stickleback  =======
         Pundamilia nyererei  =======
                 Zebra mbuna  =======
       Burton's mouthbreeder  =======
         Princess of Burundi  =======
B D                    Medaka  =======
B D                Coelacanth  =======
B D                    Turkey  =======
                 Spotted gar  =======
  D              Mallard duck  =======
  D    Spiny softshell turtle  =======
          Southern platyfish  =======
    Mexican tetra (cavefish)  =======
B D                 Zebrafish  =======
B D              Nile tilapia  =======
B D                 Tetraodon  =======
B D                  Marmoset  =======
B D                   Chicken  =======
B D              Atlantic cod  =======
  D  Chinese softshell turtle  =======
B D           Squirrel monkey  =======
  D           Green seaturtle  =======
B D       Medium ground finch  =======
B D                   Opossum  =======
B D                   Gorilla  =======
B D        American alligator  =======
  D    White-throated sparrow  =======
          Tibetan ground jay  =======
B D                   Megabat  =======
B D                       Pig  -------
B D           Tasmanian devil  =======
B D                 Orangutan  NNNNNNN

Alignment block 35 of 939 in window, 4842103 - 4842111, 9 bps 
B D                     Human  agtcccagc
B D                     Chimp  agtcccagc
B D                    Gibbon  agtcccagc
B D                    Rhesus  agtcccagc
B D       Crab-eating macaque  agtcccagc
B D                    Baboon  agtcccagc
B D              Green monkey  agtcccagc
B D                       Pig  -------gc
B D                       Dog  ------ggg
B D                   Ferret   ------agg
B D                    Tenrec  =========
B D                  Hedgehog  =========
B D                Guinea pig  =========
B D                       Rat  ---------
B D                     Mouse  ---------
              Golden hamster  NNNNNNNNN
B D           Chinese hamster  ---------
                Prairie vole  ---------
B D                  Elephant  =========
            Tibetan antelope  =========
         Cape elephant shrew  =========
B D                     Shrew  ---------
        David's myotis (bat)  =========
B D                     Horse  =========
               Domestic goat  ---------
B D                     Sheep  ---------
B D                       Cow  =========
B D                    Alpaca  ---------
             Star-nosed mole  =========
B D                  Squirrel  ---------
B D                      Pika  ---------
B D                    Rabbit  =========
B D                 Armadillo  =========
B D                   Manatee  =========
                  Chinchilla  ---------
      Lesser Egyptian jerboa  ---------
B D          White rhinoceros  ---------
            Brush-tailed rat  =========
          Chinese tree shrew  ---------
              Pacific walrus  ---------
B D                       Cat  =========
B D                  Microbat  =========
B D                  Bushbaby  =========
               Big brown bat  =========
B D            Naked mole-rat  =========
                Killer whale  ---------
              Bactrian camel  ---------
B D                     Panda  =========
            Black flying-fox  =========
            Cape golden mole  =========
B D                   Dolphin  ---------
                Weddell seal  ---------
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
                    Aardvark  =========
B D               Stickleback  =========
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D                    Medaka  =========
B D                Coelacanth  =========
B D                    Turkey  =========
                 Spotted gar  =========
  D              Mallard duck  =========
  D    Spiny softshell turtle  =========
          Southern platyfish  =========
    Mexican tetra (cavefish)  =========
B D                 Zebrafish  =========
B D              Nile tilapia  =========
B D                 Tetraodon  =========
B D                  Marmoset  =========
B D                   Chicken  =========
B D              Atlantic cod  =========
  D  Chinese softshell turtle  =========
B D           Squirrel monkey  =========
  D           Green seaturtle  =========
B D       Medium ground finch  =========
B D                   Opossum  =========
B D                   Gorilla  =========
B D        American alligator  =========
  D    White-throated sparrow  =========
          Tibetan ground jay  =========
B D                   Megabat  =========
B D           Tasmanian devil  =========
B D                 Orangutan  NNNNNNNNN

Alignment block 36 of 939 in window, 4842112 - 4842120, 9 bps 
B D                     Human  tacttggga
B D                     Chimp  tacttggga
B D                    Gibbon  tactcggga
B D                    Rhesus  tactcagga
B D       Crab-eating macaque  tactcagga
B D                    Baboon  tactcagga
B D              Green monkey  tactcggga
B D           Chinese hamster  tacttag--
             Brush-tailed rat  tgtttggaa
B D                       Pig  cactttgaa
B D                       Dog  cgtctggag
B D                   Ferret   ggtctgggt
B D                    Tenrec  =========
B D                  Hedgehog  =========
B D                Guinea pig  =========
B D                       Rat  ---------
B D                     Mouse  ---------
              Golden hamster  NNNNNNNNN
                Prairie vole  ---------
B D                  Elephant  =========
            Tibetan antelope  =========
         Cape elephant shrew  =========
B D                     Shrew  ---------
        David's myotis (bat)  =========
B D                     Horse  =========
               Domestic goat  ---------
B D                     Sheep  ---------
B D                       Cow  =========
B D                    Alpaca  ---------
             Star-nosed mole  =========
B D                  Squirrel  ---------
B D                      Pika  ---------
B D                    Rabbit  =========
B D                 Armadillo  =========
B D                   Manatee  =========
                  Chinchilla  ---------
      Lesser Egyptian jerboa  ---------
B D          White rhinoceros  ---------
          Chinese tree shrew  ---------
              Pacific walrus  ---------
B D                       Cat  =========
B D                  Microbat  =========
B D                  Bushbaby  =========
               Big brown bat  =========
B D            Naked mole-rat  =========
                Killer whale  ---------
              Bactrian camel  ---------
B D                     Panda  =========
            Black flying-fox  =========
            Cape golden mole  =========
B D                   Dolphin  ---------
                Weddell seal  ---------
      Yellowbelly pufferfish  =========
B D                      Fugu  =========
                    Aardvark  =========
B D               Stickleback  =========
         Pundamilia nyererei  =========
                 Zebra mbuna  =========
       Burton's mouthbreeder  =========
         Princess of Burundi  =========
B D                    Medaka  =========
B D                Coelacanth  =========
B D                    Turkey  =========
                 Spotted gar  =========
  D              Mallard duck  =========
  D    Spiny softshell turtle  =========
          Southern platyfish  =========
    Mexican tetra (cavefish)  =========
B D                 Zebrafish  =========
B D              Nile tilapia  =========
B D                 Tetraodon  =========
B D                  Marmoset  =========
B D                   Chicken  =========
B D              Atlantic cod  =========
  D  Chinese softshell turtle  =========
B D           Squirrel monkey  =========
  D           Green seaturtle  =========
B D       Medium ground finch  =========
B D                   Opossum  =========
B D                   Gorilla  =========
B D        American alligator  =========
  D    White-throated sparrow  =========
          Tibetan ground jay  =========
B D                   Megabat  =========
B D           Tasmanian devil  =========
B D                 Orangutan  NNNNNNNNN

Inserts between block 36 and 37 in window
            Brush-tailed rat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp

Alignment block 37 of 939 in window, 4842121 - 4842130, 10 bps 
B D                     Human  ggctgaggca
B D                     Chimp  ggctgaggca
B D                    Gibbon  ggctgaagca
B D                    Rhesus  ggctgagtca
B D       Crab-eating macaque  ggctgagtca
B D                    Baboon  ggctgaggca
B D              Green monkey  ggctgaggca
B D           Chinese hamster  tatgcaggga
             Brush-tailed rat  tgttgaggaa
B D                      Pika  tgttgggaaa
B D                       Dog  tgctgggg--
B D                   Ferret   gggagggg--
B D                    Tenrec  ==========
B D                  Hedgehog  ==========
B D                Guinea pig  ==========
B D                       Rat  ----------
B D                     Mouse  ----------
              Golden hamster  NNNNNNNNNN
                Prairie vole  ----------
B D                  Elephant  ==========
            Tibetan antelope  ==========
         Cape elephant shrew  ==========
B D                     Shrew  ----------
        David's myotis (bat)  ==========
B D                     Horse  ==========
               Domestic goat  ----------
B D                     Sheep  ----------
B D                       Cow  ==========
B D                    Alpaca  ----------
             Star-nosed mole  ==========
B D                  Squirrel  ----------
B D                    Rabbit  ==========
B D                 Armadillo  ==========
B D                   Manatee  ==========
                  Chinchilla  ----------
      Lesser Egyptian jerboa  ----------
B D          White rhinoceros  ----------
          Chinese tree shrew  ----------
              Pacific walrus  ----------
B D                       Cat  ==========
B D                  Microbat  ==========
B D                  Bushbaby  ==========
               Big brown bat  ==========
B D            Naked mole-rat  ==========
                Killer whale  ----------
              Bactrian camel  ----------
B D                     Panda  ==========
            Black flying-fox  ==========
            Cape golden mole  ==========
B D                   Dolphin  ----------
                Weddell seal  ----------
      Yellowbelly pufferfish  ==========
B D                      Fugu  ==========
                    Aardvark  ==========
B D               Stickleback  ==========
         Pundamilia nyererei  ==========
                 Zebra mbuna  ==========
       Burton's mouthbreeder  ==========
         Princess of Burundi  ==========
B D                    Medaka  ==========
B D                Coelacanth  ==========
B D                    Turkey  ==========
                 Spotted gar  ==========
  D              Mallard duck  ==========
  D    Spiny softshell turtle  ==========
          Southern platyfish  ==========
    Mexican tetra (cavefish)  ==========
B D                 Zebrafish  ==========
B D              Nile tilapia  ==========
B D                 Tetraodon  ==========
B D                  Marmoset  ==========
B D                   Chicken  ==========
B D              Atlantic cod  ==========
  D  Chinese softshell turtle  ==========
B D           Squirrel monkey  ==========
  D           Green seaturtle  ==========
B D       Medium ground finch  ==========
B D                   Opossum  ==========
B D                   Gorilla  ==========
B D        American alligator  ==========
  D    White-throated sparrow  ==========
          Tibetan ground jay  ==========
B D