Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 190 in window, 68590484 - 68597959, 7476 bps 
B D                     Human  tgcacagtgcaagctgttggtggatctaccattctggggtctggaggatggtggccttcttctcacagct
B D                     Chimp  tgcacagtgcaagctgtcggtggatctatcattctggggtctggaggatggtggccttcttctcacagct
B D                   Gorilla  tgcacagtgcaagctgtcagtggatctaccattctgggctctggaggatggtggccttcttctcacagct
B D                    Gibbon  tgcacagtgcaagctgtcggtggatctacccttctggggtctggaggatggtggcctttttctcacagct
B D                     Shrew  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
                  Chinchilla  ======================================================================
                Prairie vole  ======================================================================
B D                    Tenrec  ======================================================================
B D           Chinese hamster  ======================================================================
B D                     Mouse  ======================================================================
              Golden hamster  ======================================================================
B D                      Pika  ======================================================================
B D                       Rat  ======================================================================
             Star-nosed mole  ======================================================================
            Black flying-fox  ======================================================================
                Weddell seal  ======================================================================
                Killer whale  ======================================================================
B D                     Panda  ======================================================================
               Big brown bat  ======================================================================
B D                       Cow  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                 Armadillo  ======================================================================
B D                  Squirrel  ======================================================================
          Chinese tree shrew  ======================================================================
B D                       Dog  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
              Pacific walrus  ======================================================================
B D                   Dolphin  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D             X. tropicalis  ======================================================================
B D                    Lizard  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
B D                Budgerigar  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                  Platypus  ======================================================================
B D        American alligator  ======================================================================
B D                   Manatee  ======================================================================
B D                  Elephant  ======================================================================
B D                  Bushbaby  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                    Rabbit  ======================================================================
              Bactrian camel  ======================================================================
B D                   Megabat  ======================================================================
                    Aardvark  ======================================================================
B D                    Baboon  ======================================================================
            Cape golden mole  ======================================================================
B D                       Pig  ======================================================================
B D          White rhinoceros  ======================================================================
B D           Squirrel monkey  ======================================================================
B D              Green monkey  ======================================================================
B D       Crab-eating macaque  ======================================================================
B D                    Rhesus  ======================================================================
B D                     Horse  ======================================================================
B D                    Alpaca  ======================================================================
B D                  Marmoset  ======================================================================
B D                 Orangutan  ======================================================================

                        Human  ccagtaggcagtgccc---------------cagtagggactctgtgcgggggcttggaccccacatttc
                        Chimp  ccagtaggcagttccc---------------cagtagggactctgtgcgggggcttggacgccacatttc
                      Gorilla  ccagtaggcagtgcct---------------cagtagggactctgtgcgggggcttggaccccacatttc
                       Gibbon  ccagtaggcagtgccccagtaggcagtgctgcagtagggactctgtgtgggagctcagaccccacatttc
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  cctcctgcactcccctagcagaggttcttaatgagggctctgcccctgcagcaaacttctgcttggacct
                        Chimp  ccttctgcactcccctagcagaggttcttaatgagggctctgcccctgcagcaaacttctgcttggacct
                      Gorilla  cctcctgcactcccctagcagaggttcttaatgagggctctgcccctgcagcaaacttctgcttggacct
                       Gibbon  ccttcttcacttccctagcagaggttcttaatgagggctctgcccctgcagcaaacttctgcttggacct
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ctgggcatttccacacatcttctgaaatctaggtggaggttcccaaacatcaattcttgacttctgtgta
                        Chimp  ctgggcatttccacacatcttctgaaatctaggtggaggttcccaaacatcaattcttgacttctgtgta
                      Gorilla  ctgggcatttccacacatcttctgaaatctaggtggaggttcccaaacatcaattcttgacttctgtgta
                       Gibbon  ctgggcatttccacacatcttctgaaatctaggtggaggttcccaaacatcaattcttgacttctgtgta
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  cacacaggcccaacaacacatgtaaaccaccaaggcttgggtcttgcaccctctgaagcaatagcctaag
                        Chimp  cacacaggcccaacaacacatgtaaaccaccaaggcttgggtcttgcaccctctgaagcaatagcctaag
                      Gorilla  cacacaggcccaacaacacatgtaaaccaccaaggcttgggtcttgcaccctctgaagcaatagcctaag
                       Gibbon  cacacaggcccaacaacacatgtaaaccaccaaggcttgggtcttgcaccctctgaaacaatagcctgag
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ctgtacttggccccttttagccacggctggatctgaagcagctgagacacaaggcaccatgtcccaaggc
                        Chimp  ctgtacttggccccttttagccacggctggagctgaagcagctgagacacaaggcaccatgtcccaaggc
                      Gorilla  ctgtacttggccccttttagccacggctggagctgaagcagctgagacacaaggcaccatgtcccaaggc
                       Gibbon  ctgtacttggccccttttagccacggctggagctgaagcagctgagacacaaggcatcatgtcccagggc
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tgcgtagagaaagggggccttgggtcctgtccatgaagccatttttccccacaggccttcaggcctgtga
                        Chimp  tgc--agagaaagggggccttgggtcctgtccatgaagccatttttccccacaggcctccaggcctgtga
                      Gorilla  tgcatagagaaagggggccttgggtcctgtccatgaagccatttttccccacaggcctccaggcctgtga
                       Gibbon  tgcatagagaaatggggccttgggtcctgtccatgaaaccatttttccccacaggcctccaggcctgtga
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tgggagggacttctgtgaaaacccccaacattccctggagacatttttcccattgtcttggtgattaacg
                        Chimp  tgggagggacttctgtgaagacccgcgacattccctggagacatttttcccattgtcttggtgattaaag
                      Gorilla  tgggagggacttctgtgaagacccccaacattccctggagacatttttcccattgtcttggtgattaaca
                       Gibbon  agggagggacttctgtgaagacccctgacattccctggagacatttttcccattgtcttggtgattaaca
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttcagctcatcattacttatgcaaatttctgcagccagcttaaatttctgtctagaaaatggggttttat
                        Chimp  ttcagctcatcattacttatgcaaatttctgcagccagcttaaatttctgtctagaaaatggggttttat
                      Gorilla  ttcagctcatcattacttatgcaaatttctgcagccagcttaaatttctgtctagaaaatggggttttat
                       Gibbon  ttcagctcatcattacttatgcaaatttctgcagccagcttaaatttctctctagaaaatggggttttat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tttctgtcatattgtcagactgcaaatttttcaatcattatgctctgcctcctctcgaatgatttgccac
                        Chimp  tttctgtcatattgtcagactgcaaatttttcaaactttaggctctgcctcctctcgaatgatttgccac
                      Gorilla  tttctatcatattgtcagactgcaaatttttcaaactttatgctctgcctcctcttgaatgatttgccac
                       Gibbon  tttctatcatattgtcagactgcaaattcgtcaaactttgtgctctgcctcctctcagatgatttgccac
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttagaaatttctcctgccagataccccaaatcatctctctgacgttcaaagttagatctctagggcaggg
                        Chimp  ttagaaatttctcctgccagatatcccaaatcatctctctgaagttcaaagttagatctctaggccaggg
                      Gorilla  ttagaaatttctcctgccagataccccaaatcatctctctgaagttcaaagttagatctctagggcaggg
                       Gibbon  ttagaaatttctcctgccagataccccaaatcatctctctgaagttcaaagttagatctctagggcaggg
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  gcaaaatgctgccagtctcttcacatagcaagagtgacctttattccagttcaagaaaagttcctcatct
                        Chimp  gcaaaatgctgccagtctcttcacatagcaagagtgacctttattccagttcacgaaaagttcctcatct
                      Gorilla  gcaaaatgctgccagtctcttcacatagcaagagtgacctttattccagttcaagaaaagttcctcatct
                       Gibbon  gcaaaatgctgccagtctcttcacatagcaagagtgacctttattccagttcatgaaaagttcctcatct
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tcatctgagaccacctcagcctggacatctttgtccacatcattatctgcattttggtcaaagccattca
                        Chimp  tcatctgagaccacctcagcctggacatctttgtccacatcattatctgcattttggtcaaagccattca
                      Gorilla  tcatctgagaccacctcagcctggacatctttgtccacatcattatctgcattttggtcaaagccattca
                       Gibbon  tcatctgagaccacctcagcctggacatctttgtccacatcattatctgcattttggtcaaagccattca
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  acaagtctctaggaatttccaaactttcccacatcttcctgtcttctaagccttccaagtctctagtaag
                        Chimp  acaagtctctaggaatttccaaactttcccacatcttcctgtcttctaagccctccaagtctctagtaag
                      Gorilla  acaagtctctaggaatttccaaactttcccacatcttcctgtcttctaagccttccaagtctctagtaag
                       Gibbon  acaagtctctaggaatttccaaactttcccacatcttcctgtcttctaagccttccaagtctctggtaag
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttccaaactttcccagatttgcctgtcttcttctgagccctccaaatggttccaacctctgcctgttaca
                        Chimp  ttccaaactttcccagatttgcctgtcttcttctgaaccctccaaatggttccaacctctgcctgttaca
                      Gorilla  ttccaaactttcccagatttgcctgtcttcttctgagccctccaaatggttccaacctctgcctgttaca
                       Gibbon  ttccaaactttcccagacttgcctgtcttcttctgagccctccaaatggttccaacctctgcctgttaca
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  cagttcccaaattatttccacattttcaagtatctttacagctgtgccccactctgtggtacaaatttat
                        Chimp  cagttctcaaattatttccacattttcaagtatctttacagctgtgccccactctgtggtacaaatttac
                      Gorilla  cagttcccaaattatttccacattttcaagtatctttacagctgtgccccactctgtggtacaaatttat
                       Gibbon  cagttcccaaattatttccacattttcaagtatctttacagctgtgccccactctgtggtataaatttac
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ggtattagtttgttctcatactatgaagaaatacctgagactgggtaatttataaaggaaagaggtttaa
                        Chimp  ggtattagtttgttctcatactatgaagaaatacctgagactgggtaatttataaaggaaagaggtttaa
                      Gorilla  ggtattagtttgttctcatactatgaagaaatacctgagactgggtaatttataaaggaaagaggtttaa
                       Gibbon  tatattagtttgttctcatactatgaagacacacctgagactgggtaatttataaaggaaagaggtttaa
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttgactcacagttccacagtactggggaggcctcaggaaactt-acaatcatagtggaaggggaagcaaa
                        Chimp  ttgactcacagttccacagtactggggaggcctcaggaaactt-acaatcatagtggaaggggaagcaaa
                      Gorilla  ttgactcacagttccacagtactggggaggcctcaggaaactt-acaatcatagtggaagaggaagcaaa
                       Gibbon  ttgactcacaattccacagtactggggaggcctcaggaaacttaacaatcatagtggaaggggaagcaaa
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  cacattcttctttgcatggtgacagcaaggaaaaatgttgagtaaaatgggagaaagccacttataaaac
                        Chimp  cacattcttctttgcatggtgacagcaaggaaaaatgttgagtaaaaggggagaaagccacttataaaac
                      Gorilla  cacattcttctttgcatggtgacagcaaggaaaaatgttgagtaaaatgggagaaagccacttataaaac
                       Gibbon  cacattcttgtttgcatggtgacggcaaggaaaaatgttgagtaaaaggggagaaagccacttataaaac
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  catgggatcttgtgagaattcactcactatcatgagaacagcatgagagtaaccacccccatgattaaat
                        Chimp  catgggatcttgtgagaattcattcactatcatgagaacagcatgagagtaaccacccccatgattaaat
                      Gorilla  catgggatcttgtgagaattcactcactatcatgagaacagcatgagagtaaccacccccatgattaaat
                       Gibbon  catgagatcttgtgagaattcactcactatcatgagaacagcatgagagtaaccacccccatgattaaat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tacctccaaccaagtccttcccatgacacatggggattatgggaactattactcagtatgagatttgggt
                        Chimp  tacctccaaccaagtccttcccatgacacatggggattatgggaactattactcagtatgagatttgggt
                      Gorilla  tacctccaaccaattccttcccatgacacatggggattatgggaactattactcagtatgagatttgggt
                       Gibbon  tacctccaacaaagtccttcacatgacacatggggattatgggaactattactcagtatgagatttgggt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  agaaacatgaccaaactgtatcagaatccattccccattgcttgtttttgt-gacttggttgaagattaa
                        Chimp  agaaacatgaccaaactgtatcagaatccattccccattgcttgtttttgttgacttggttgaagattaa
                      Gorilla  aggaacatgaccaaactgtatcagaatccattccccattgcttgtttttgttgacttggttgaagattaa
                       Gibbon  aggaacatggccaaactgtatcagaatccattccccattgcttgtttttgttgacttggttgaagattaa
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  atggctgtaggttagtggctttatttctgtgttctataatctgtttcattagtctgtttgattttgcatg
                        Chimp  atggctgtaggttagtggctttatttctgtgttctataatctgtttcattagtctgtttgattttgcatg
                      Gorilla  atggctgtaggtttgtggctttatttcggtgttccataatctgtttcattagtctgtttgattttgcatg
                       Gibbon  atggctgtaggtttgtggctttatttctgtgttctataatctgtttcattagtctgtttgatttcgcatg
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  aatccatactcttttgtttactgtagccttgtagtgtagtttgaagtcagatagtgtaatagctttgtct
                        Chimp  aatccatactcttttgtttactgtagccttgtagtgtagtttgaagtcagatagtgtaatagctttgtct
                      Gorilla  aatccatactcttttggttactgtagccttgtactgtagtttgaagtcagatagtgtaatagctttgtct
                       Gibbon  aatccctactcttttggttactgtagccttgtagtgtagtttgaagtcagatagtgtaatagctttttct
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tttgtttgtttgctttggattttgttttttgtttttgattttgatatttgtttttgtttttgcttagaag
                        Chimp  tttgtttgtttgctttggattttgttttttgtttttgattttgatatttgtttttgtttttgcttagaag
                      Gorilla  tttgtttgtttgctttgga-------ttttgtttttgattttgatatttgtttttgtttttgcttagaag
                       Gibbon  tttgtttgtttgctttggattttgttctttgtttttgattttgatatttgtttttgtttttgcttagaag
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tgctttggccatttaggctcttttttggttcagtatgaattcgagactagtttttttttt---ctaattc
                        Chimp  tgctttggccatttaggctcttttttggttcagtatgaatttgagactagtttttttttt--tctaattc
                      Gorilla  tgctttggccatttaggctcttttttggttcagtatgaattcgagactagtttttttttttttctaattc
                       Gibbon  tgttttggccatttagcctcttttttggttcagtatgaattcgagactagtttttttttc----taattc
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tgtgaaaaactgggagtttgataggaatagcattgaatctttaaattctttggggcagtatggccattgt
                        Chimp  tgtgaaaaactgggagtttgataggaatagcgttgaatctttaaattctttggggcagtatggccgttgt
                      Gorilla  tgtgaaaaactgggagttcgataggaatagcattgaatctttaaattctttggggcagtatggccattgt
                       Gibbon  tctgaaaaattgggagtttgataggagtagcattgaatctttaaattctttggggcagtatggccattgt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  aacaatattgattcttcctgtccatgtgcatgggatgtttttctatttgtttgtggtatatctgatttct
                        Chimp  aacaatattgattcttcctgtccatatgcatgggatgtttttctatttgtttgtggtatatctgatttct
                      Gorilla  aacaatattgattcttcctgtccatgtgcatgggatgtttttctatttgtttgtggtatatctgatttct
                       Gibbon  aacaatattgattcttcctgtccatgtgcatgggatgtttttctatttgtttgtggtatatctgatttct
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttcatcagtggtttttaaatctagttgtggtgatctttcagctcccttgttagtactctaggtattttat
                        Chimp  ttcatcagtgttttttaaatctagttgtggtgatctttcaactcccttgttagtactctaggtattttat
                      Gorilla  ttcatcagtgttttttaaatctagttgtggtgatctttcaactcccttgttagtactctaggtattttat
                       Gibbon  ttcatcagtgttttttaaatctagttgtagtgatcttttgactcccttgttagtactctaggtattttat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tctatttttttgtggctatcataagtgggactgtgttcttgacatggctctcagcttggatgctgttggt
                        Chimp  tctatttttt-gtggctatcataagtgggactgtgttcttgacatggctctcagcttggatgctgttggt
                      Gorilla  tctatttttttgtggctatcataagtgggactgtgttcttgacatggatttcagcttggatgctgttggt
                       Gibbon  tctattttcttgtggctatcataagtgggactgtgttcttaacatggctctcagcttggatgctgttggt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  gtatagaaatgctactgatttttgtacactgattttgtatcctgaaactttcctgaag-tttttttcaaa
                        Chimp  gtatagaaatgctactgatttttgtacactgattttatgtcctgaaactttcctgaag-tttttttcaaa
                      Gorilla  gtatagaaatgctactgatttttgtacactgattttgtatcctgaaattttcctgaagttttttttcaaa
                       Gibbon  gtatagaaatgctactgatttttgtacactgattttgtatcctgaaactttcctgaagttttttttcaaa
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tctaggggcttttgggcagagactggggttttgtaggcataaaattatgtccttggcaaagagagatagg
                        Chimp  tctaggggcttttgggcagagactggggttttgtaggcataaaattatgtccttggcaaagagagatagg
                      Gorilla  tctaagggcttttgggcagagactggggttttgtaggcataaaattatgtccttggcaaagagagatagg
                       Gibbon  tctaggggcttttgggcagagactggggttttgtaggcataaaattatgtccttggcaaagagagatatg
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttgacttcctctcttcctattcggatgccttttatattttatcttgcctgattgctctgtctaggacttc
                        Chimp  ttgacttcctctcttcctattcggatgccttttatattttatcttgcctgattgctctgtctaggacttc
                      Gorilla  ttgacttcctctcttcctatttggatgccttttatattttatcttgcctgattgctctgtctaggacttc
                       Gibbon  ttgacttcctctcttcctatttggatgccttttatattttatcttgcctgattgctctgtctaggacttc
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  cagtactatgttaaatagaatagacaagtgggcatccttgtcttattccagttcttaaggggaatgtttc
                        Chimp  cagtactatgttaaatagaatagaaaagtgggcatccttgtcttattccagttcttaaggggaatgtttc
                      Gorilla  cagtactatgttaaatagaatagacaagtgggcatccttgtcttattccagttctgaaggggaatgtttc
                       Gibbon  cagtactatattaaatagaagagacaagtgggcatccttgtcttattccagttcttaaggggaatgtttc
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  cagcttttccccgttcagtataatgttggctgtgggtttctcatagatggctcttattattttgaggtat
                        Chimp  cagcttttccccgttcagtataatgttggctgtgggtttctcatagatggctcttattattttgaggtat
                      Gorilla  caacttttccccattcagtataatgttggctgtgggtttctcatagatggctcttattattttgaggtat
                       Gibbon  cagcttttccccattcagtataatgttggctgtgggtttctcatagatggctcttattattttgaggtat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  gttccttcaatgcctagtttcttgagggtttttaatgtaaagggatatttaatttaatcaaactctttca
                        Chimp  gttccttcaatgcctagtttcttgagggtttttaatgtaaagggatatttaatttaatcaaactctttca
                      Gorilla  gttccttcaatgcctagtttcttgagggtttgtaatgtaaagggatatttaatttaatcaaactctttca
                       Gibbon  gttccttcaatgcctaatttcttgagggtttttaatgtaaagggatgttgaatttaatcaaactctttca
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tgcatctgtagagaaaatcatgtggtttttatttttagttctgtttatgtgatgaattacatttattgat
                        Chimp  tgcatctgtagagaaaatcatgtggtttttatttttagttctctttatgtgatgaattacatttattgat
                      Gorilla  tgcatctgtagggaaaatcatgtggttttaatttttagttctgtttatgtgatgaattacatttatttat
                       Gibbon  aggatctgtagagaaaattatgtggtttttatttttagttctgtttatgtgatgaattacatttattgat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttgcatatgttgagccaaccatgcattccaggtataaagcctacttgattgtactgaattagctttttga
                        Chimp  ttgcatatgttgagccaaccatgcattccaggtataaagcctacttgattgtactgaattagctttttga
                      Gorilla  ttgcatatgttgagccaaccatgcattccaggtataaagcctacttggttatactgaattag--------
                       Gibbon  ttgcatacgttgagccaaccatgcattccaggtataaagtgtacttgattgtactgaattagctttttga
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tgtgctgttggattcagtttgctagtattctgttaagaaattttgcatatatgtttctcaggaatactgg
                        Chimp  tgtgctgttggattcagtttgctagtattctgttaagaaattttgcatatatgtttctcaggaatactgg
                      Gorilla  ------------------------------------------------------------------ctgg
                       Gibbon  tgtgctgttggattcagtttgctagtattctgttaagaaattttgcatatacgtttctcgggaatactgg
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  cctgaagttttcctttttggttgtgactttgccaggttttggtatcagaataatgctgcttacatagaat
                        Chimp  cctgaagttttcctttttggttgtgactttgccaggttttggtatcagaataatgctgcttacatagaat
                      Gorilla  cctgaagttttcctttttggttgcgactttcccaggttttggtatcagaataatgctgcttacatagaat
                       Gibbon  cctgaagttttcctttttggttgtgactttgccaggttttggtatcagaataatgctgcttacatagaat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  gagttagggaggagttcccctttcttaatttttggaataatttcagtaggcttagtaccagttatttttt
                        Chimp  gagttagggaggagttcccctttcttaatttttggaataatttcagtaggcttagtaccagttatttttt
                      Gorilla  gagttagggaggagttcccctttcttaatttttggaataatttcagtaggcttagtaccagttatttttt
                       Gibbon  gagttagggaggagttcccctttcttgatttttggaataatttcagcagacttagtaccagttatttttt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  atatgtctggtagagtttggctctgaatccatatgtcccagggattttctggttcatcactaattcaatt
                        Chimp  atatgtctggtagagtttggctctgaatccatatgccccagggattttctggtttattgctaattcaatt
                      Gorilla  atatgtctggtagagtttggctctgaatacatatgtcccagggattttctggtttattactaattcaatt
                       Gibbon  atatgcttggtagagtttggctctgaatccatatgtcccagggattttctggtttattactaattcaatt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttagaactagttattagtccatacagggttttaatttctcatttttgtaaattgattttgtatcctgaaa
                        Chimp  ttagaactagttattagtccatactgggttttaatttctcatttttgtaaattgattttgtatcctgaaa
                      Gorilla  ttagaactagttattagtccatacagagttttaatttctcatttttgtaaattgattttgtatcctgaaa
                       Gibbon  ttagaactagttattagcccatacagggttttaatttctcatttttgtaaattgattttgtgtcctgaaa
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  cattactgaagttatttatcagatctatgagcttttaggaagaaactaaggagttttatagctataaaat
                        Chimp  cattactgaagttatttatcagatctatgagcttttaggaagaaactatggagttttctaggtataaaat
                      Gorilla  cattactgaagttatttatcagatctatgagcttttaggaagaaactatggagctttctagctgtaaaat
                       Gibbon  gattactgaagttatttatcagatctatgagcttttacgaagaaattatggagttttctagctataaaat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  catata-tttggcaaagatagatagtttaacttcctctcaatcttggaaggtttaatcttgggattgaat
                        Chimp  cctatc-tttggcaaagatagatagtttaacttcctctcaatcttggaaggtttaatcttgggattgaat
                      Gorilla  cgtatc-tttggcaaagatagatagtttaacttcctctcaatcttggaaggtttaatcttgggattgaat
                       Gibbon  cgtatcttttggcaaagatagatagtttaacttcctctcaatcttggaaggtttagtcttgggattgaat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  cttgattcagtcttgagaggttgcatgtttccaggaatttattcatttcttctaggttttctagtttctg
                        Chimp  cttgattcagtcttgagaggttacatgtttccaggaatttattcatttcttctaggttttctagtttctg
                      Gorilla  cttgattcagtcttgagaggctgcatgtttccaggaatttattcatttctgctaggttttctagtttctg
                       Gibbon  cttgattcagtcttgagaggttgcatgtttccaggaatttattcatttcttctaggttttctagtttctg
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttcaaagaagtgtttgtaatagcctctgaggatttttt-tgtttttatttttgtttttggtatttttgtg
                        Chimp  ttcaaagaagtgtttgtaatagcctctgaggatttttt--gtttttatttttgtttttggtatttttgtg
                      Gorilla  ttcaaagaagtgtttgtaatagcgtctgaggatttttt-tgtttttatttttgtttttggtatttttgtg
                       Gibbon  ttcaaagaagtgtttgtaatagcctctgaggattttttttgtttttatttttgtttttggtatttttgtg
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  atgatgtcacctttatcaattctaattgtttttatttggatcttcttttttttctttatcaatttagcta
                        Chimp  atgatgtcacctttatcaattctaattgtgtttatttggatcttcttttttttctttatcaatttagcta
                      Gorilla  attatgtcacctttatcaattctaattgtgtttatttggatcttcttttttttctttatcaatttagcta
                       Gibbon  atgatgtcacttttatcaattctaattgtgtttatttggatcttcttttttttctttatcaatttagcta
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  gcaatttatcaaacttatttattctttgggagaaacaacttttggttttcttgatccgttatatgttttt
                        Chimp  gcaatttatcaaacttatttattctttgggagaaacaactttcggttttcttgatctgttatatgttttt
                      Gorilla  gcaatttatcaaacttatttatgctttgggagaaacagcttttggttttcttgatccgttatatgttttt
                       Gibbon  gcaatttatcaaacttatttattctttgggagaaacaacttttggttttcttgatccgttatatgttttt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tctcatcttaatttgattcagttcagctcagctctgatttcagttattca-cttttttctgatagctgtg
                        Chimp  tctcatcttaatttgattcagttcagctcagctctgatttcagttattca-tttttttctgatagctgtg
                      Gorilla  tctcatcttaatttgattcagttcagctcagctctgatttcagctattcattttttttctgatagctgtg
                       Gibbon  tctc-----aatttgattcagttcagctcagctctgatttcagttattca-tttttttctgatagctgtg
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  aagtactttggtttgacttatttttctagttcctct-aggtgagatattagattcttaatttgagatact
                        Chimp  aagtactttggtttgacttatttttctagttcctct-aggtgagatattagattcttaatttgagatact
                      Gorilla  aagtactttggtttgacttatttttctagttcctct-aggtgagatattagattcttaatttgagatact
                       Gibbon  aagcactttggtttgacttatttttctagttcctctaaggtgagatattagattcttaatttgagatact
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tcttaac-tttttgatatgggcacttaacactataaactttcctcttaacactgccttagctgggtccca
                        Chimp  tcttaac-tttttgatatgggcatttaacactataaactttcctcttaacactgccttagctgggtccca
                      Gorilla  tcttaacttttttgatatgggcatttaacactataaactttcctcttaacactgccttagctgggtccca
                       Gibbon  tcttaac-tttttggtatgggcatttaacactataaagtttcctcttaacactgccttagctgggtccca
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  gagattctgatatcttgtatctttgttttcattagtttcaaataatttattgatttcagacttaatttta
                        Chimp  gagattctgatatcttgtatctttgtttttattagtttcaaataatttattgatttcagacttaatttta
                      Gorilla  gagattctgatatcttgtatctttgttttcattagtttcaaataatttattgatttcagacttaatttta
                       Gibbon  gagattctgatatcttgtatctttgttttcattagtttcaaagaatttattgatttcagacttaatttta
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttatttacacagaaatcattcaggagctggttttgtaatttccatgtaatcctatggttttgagt-atct
                        Chimp  ttatttacacagaaatcattcaggagcaggttttttaatttccatgtaatcctacggttttgagtgatct
                      Gorilla  ttatttacacagaaatcattcaggagcaggttttttaatttccatgtaatcctatggttttgagtgatct
                       Gibbon  ttatttacacagaaatcattcaggagcaggttttttaatttccatgtaatcctatggttttgagtgatct
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tcttagtattgatttttatttttattgcactgtggtccaagactgtagttggtataatttta-ttttttt
                        Chimp  tcttagtattgatttttatttttattgcactgtggtccaagactgtagttggtataatttta-ttttttt
                      Gorilla  tcttagtattgatttttatttttattgcactgtggtccaagactgtagttggtataatttta-ttttttt
                       Gibbon  tcttagtattgatttttatttttattgcactgtggtccaagactgtagttggtataattttatttttttt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  taatttgttgagaactgttttatggctgatcatgtggttgattttaggttatgtgtcacatgcagaagac
                        Chimp  taatttgttgagaactgttttatggctgatcatgtggttgattttaggttatgtgtcacgtgcagaagac
                      Gorilla  taatttgttgagaactgttttatggctgatcatgtggttgattttaggttatgtgtcacgtgcagatgac
                       Gibbon  taatttgttgagaactgttttatggctgatcatgtggctgattttaggttatgtgtcacgtgcagatgac
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  aagaatatgtattgttgttgttgggtggagtgttctgtaggtatctgttaggaccatttggtcaagtgtc
                        Chimp  aagaatatatattgttgttgttgggtggagtgttctgtaggtatctgttaggaccatttggtcaagtgtc
                      Gorilla  aagaatatatattgttgttgttgggtggagtgttctgtaggtatctgttaggaccatttggtcaagtgtc
                       Gibbon  aagaatatatattgttgttgttgggtggagtgttctgtaggtatctgttaggaccatttggtcaagcatc
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  aagttcatgtcctaaatatctttgttagatttctgccttgatgatctgtctagtattgtcagcatggtgt
                        Chimp  aagttcatgtcctaaatatctttgttagttttctgccttgatgatctgtctagtattgtcagcatggtgt
                      Gorilla  aagttcatgtcctaaatatctttgttagttttctgccttgatgatctgtctagtattgtcggtatggtgt
                       Gibbon  aagttcatgtcctaaatctctttgttagttttctgccttgatgatctgtctagtattgtcagtatggtgt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tgaagtcttctactattattgtgtggttatctaaatacctttgtaggtctctaagaacttgctttatgaa
                        Chimp  ttaagtcttctactattattgtgtggttatctaagtacctttgtaggtctctaagaacttgctttatgaa
                      Gorilla  tgaagtcttctactattattgtgtggttatctaagtacctttgtaggtctctaagaacttgctttatgaa
                       Gibbon  tgaagtcttctactattattgtgtggttatctaagtacctttgtaggtctctaagaacttgctttatgaa
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tctggtgctcctgtgttgggtgcatatacatttaggattgttaagtcttttttt-ttatttattattata
                        Chimp  tctggtgctcctgtgttgggtgcatatacatttaggattgttaagtctttttttattatttattattata
                      Gorilla  tctggtgctcctgtgttgggtgcatatacatttaggattgttaagtctttttt--ttacttattattata
                       Gibbon  tctggtgctcctgtgtcgggtgcatatacatttaagattgttaagtcttttt---ttacttattattata
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ctttaagttctggggtacatgtgcacaacgtgcaggtttgttacataggtatacatgtgctatgttggtt
                        Chimp  ctttaagttctggggtacatgtgcacaacgtgcaggtttgttacgtaggtatacatgtgctatgttggtt
                      Gorilla  ctttaagttctggggtacatgtgcacaacatgcaggtttgttacataggtatacatgtgctatgttggtt
                       Gibbon  ctttaagttctggggtacatgtgcacaatgtgcaagtttgttacataagtatacatgtgctatgttggtt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tcctgtgcccatcaactcatcatttacattaggtatgtctcctaatgctatccctcccccagccctccac
                        Chimp  tcctgtgcccatcaactcatcatttacattaggtatgtctcctaatgctatccctcccccagccctccac
                      Gorilla  tcctgtgcccatcaactcgtcatttacattaggtatgtctcctaatgctattcctcccccagccctccac
                       Gibbon  tcctgtgcccatcaactcgtcat-------------------tgatgctatccctcccccagccctccac
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ccccttacaggccctggtgtgtgatgttcccctccctgtgtccatgtattctcattgttcaactctcact
                        Chimp  ccccttacaggccctggtgtgtgatgttcccctccctgtgtccatgtgttctcattgttcaactctcact
                      Gorilla  ccccttaaaggccctggtgtgtgatgttcccctccctgtgtccatgtgttctcattgttcaactctcact
                       Gibbon  ccccttacaggccctggtgtgtgatgttcccctccctgtgtccatgtgttctcattgttcaactcccact
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tatgagtgagaacatgtggtgtttggttttctgttcttgtgttactttgctgagaatgatggtttccagt
                        Chimp  tatgagtgagaacatgtggtgtttggttttctgttcttgtgttactttgctgagaatgatggtttccagt
                      Gorilla  tatgagtgagaacatgtggtgttttgtttcctcttcttgtgttactttgctgagaatgatggtttccagt
                       Gibbon  tatgagtgagaacatgtggtgtttggttttctcttcttgcattactttgctgagaatgatggtttccagt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttcatccatgtccctacaaaggacatgaactcatccttttttgtggatgcatagtatttcatggtgtata
                        Chimp  ttcatccatgtccctacaaaggacatgaactcatccttttttgtggatgcatagtatttcatggtgtata
                      Gorilla  ttcatccatgtccctacaaaggacatgaactcctccttttttgtggatgcatagtatttcttggtgtata
                       Gibbon  ttcatccatgtccctacaaaggacatgaactcatccttttttgtggatgcatattatttcatagtgtata
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tgtgtcattttctttatccagtctatcattgatgggcatttgggttgattccaagactttgctactgtga
                        Chimp  tgtgccattttctttatccagtctatcattgatgggcatttgggttgattccaagactttgctactgtga
                      Gorilla  tgtgccattttctttatccagtctatcattgatggacatttgggttgattccaagactttgctactgtga
                       Gibbon  tgtgccattttctttatacagtctatcattgatgggcatttgggttgattccaagactttgctactgtga
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  acagtgctgcaataaacatacgtgtgcatgtgtctttatagtagaatgatttttaatcctttgggtatat
                        Chimp  acagtgctgcaataaacatacgtgtgcatgtgtctttatagtagaatgatttttaatcctttgggtatat
                      Gorilla  acagtgctgcaataaacatacgtgtgcatgtgtctttatagtagaatgatttttaatcctttgggtatat
                       Gibbon  acagtgctgcagtaaacatacgtgtgcatgtgtctttatagtagaatgatttttaatcctttgggtacat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  acccagtaacagtattgctgagtcaaatggtatttctatttctagatccttgaggagtcgccacactgtc
                        Chimp  acccagtaacagtattgctgagtcaaatggtatttctatttctagatccttgaggagtcgccgcactgtc
                      Gorilla  acctagtaacgggattgctgggtcaaatggtatttctatttctagatccttgaggagtcgccgcactgtc
                       Gibbon  acccagtaacgggattgctgggtcgaatggtatttctatttctagatccttgaggagtcgccgcactgtc
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttccacgatggttgaactaatttacactcccaccaacagtgtaaaagtgttcctatttctccacatcttc
                        Chimp  ttccacgatggttgaactaatttacactcccaccaacagtgtaaaagtgttcctatttctccacatcttc
                      Gorilla  ttccatgatggttgaactaatttacactcccaccaacagtgtaaaagtgttcctatttctccacatcttc
                       Gibbon  ttccacgatggttgaactaatttacactcccaccaacagtgtagaactgttcctatttctccacatcttc
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tccagcatctgttgtttcctgacttttttttttttttttttttttctgagatggagtcttgctctgtcac
                        Chimp  tccagcatctgttgtttcctgactttttttttttttt--------ctgagatggagtcttgctctgtcac
                      Gorilla  tccagcatctgttgtttcctgactttttttttttttt------ttctgagatggagtcttgctctgtcac
                       Gibbon  tccagcatctgttgtttcctgactttttttttttttt-----tttctgagatggagtcttgctctgtcac
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ccaggctggagtgcagtggcacaatctcagctcactgcaagctctgcctcccaggttcatgccattctcc
                        Chimp  ccaggctggagtgcagtggcacaatctcagctcactgcaagctctgcctcccaggttcatgccattctcc
                      Gorilla  ccaggttggagtgcagtggcacaatctcagctcactgcaagctttgcctcccgggttcatgccattctcc
                       Gibbon  ccagaccggagtgcagtggtgcaatctcagctcactgcaagctctgcctcctgggttcatgccattctcc
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tgcctcagcttcccgagtagctggaactgcaggcacccaccaccgtgcccggctaatttttttgtatttt
                        Chimp  tgcctcagcttcccgagtagctgggactgcaggcacccaccaccgtgcccggctaatttttttgtatttt
                      Gorilla  tgcctcagcttcccgagtagctgggactacaggaacccaccaccgtgcctggctaatttttttgtatttt
                       Gibbon  tgcctcagcttcccgactagctgggactacaggcacccaccaccgtgcccagctaatctttttgtatttt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tagtagagacggggtttcaccatggtctcaatctcctgaccttgtgatccgcccgcctcggcctcccaaa
                        Chimp  tagtagagacggggtttcaccacggtctcaatctcctgaccttgtgatccgcccgcctcggcctcccaaa
                      Gorilla  tagtggagacagggtttcaccatggtctcaatctcgtgaccttgtgatccgcccacctcggactcccaaa
                       Gibbon  tagtagagatggggtttcaccatggtctcaatctcctgaccttgtgatctgcctgcctcggcctcccaaa
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  gtgctaagattacaggcatgagccactgtgcccggcctttcctgactttttaatgatgcccattctaact
                        Chimp  gtgctaagattacaggcatgagccactgtgccctgcctttcctgactttttaatgatgcccattctaact
                      Gorilla  gtactaagattacaggcatgagccactgtgcccggcctttcctgactttttaatgatgcccattctaact
                       Gibbon  gtgctgagattacaggcatgagccactgtgtccggcctttcctgactttctaatgatgcccattctaact
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ggtgtgagatggtgtctcattgtggttttgatttgcatttctctaatgatcagagatgatgagctttttt
                        Chimp  ggtgtgagatggtgtctcattgtcgttttgatttgcatttctctaatgatcagagatgatgagctttttt
                      Gorilla  ggtgtgagatggtatctcattgtggttttgattttcatttctctaatgatcagagatgatgagctttttt
                       Gibbon  ggtgtgagatggtatctcattgtggttttgatttgcatttctctaatgatcagagatgatgagctttttt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tcacacgtttgttggctgtataaatgtcttcttttgagaagtgtctgttcatatcctttgcccacttttt
                        Chimp  tcacacgtttgttggctgtataaatgtcttcttttgagaagtgtctgttcatatcctttgcccacttttt
                      Gorilla  tcacatgtttgttggctgtataaatgtcttcttttgagaagtgtctgttcatatcctttgcccacttttt
                       Gibbon  tcacacatttgttggctgtataaatgtcttcttttgagaagtatctgttcatatcccttgcccacttttt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  gatggggttgtttgcttttttcttatgaatttgtttaaggttctttgtagattctggatattagcctttt
                        Chimp  gatggggttatttgtttttatcttgtgaatttgtttaaggttctttgtagattctggatattagcctttt
                      Gorilla  gatggggttgtttgtttttttcttgtgaatttgtttaaggttcttcatagattctggatattagcctttt
                       Gibbon  gatggggttgtttgtttttttcttgtgaatttctttaaggttctttatagattctggatattagcctttt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  gtcagatggatagattgcaaaaattttctcccattctgtaggttgcctgttcactctgctgatagtttgt
                        Chimp  gtcagatggatagattgcaaaaattttctcccattctgtaggttgcctgttcactctgctgatagtttgt
                      Gorilla  gtcagatggatagattgcaaaaattttctcccattttgtagattgcctgttcactctgctgatagtttgt
                       Gibbon  gtcagatggatagattgcaaaaattttctcccattctgtaggttgcctgttcactttgctgatagtttct
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  tttgctgtgcagaagctctttagtttaattagatcccatttgtctatttgggcttttgttgccattactt
                        Chimp  tttgctgtgcagaagctctttagtttaattagatcccatttgtctattttggcttttgttgccattactt
                      Gorilla  tttgctgtgcagaagctctttagtttaattagatcccatttgtctattttggctttcgttgccattactt
                       Gibbon  tttgctgtgcagaagctctttagtttaattagatcccatttgtctattttggcttttgttgccattactt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttgctgttttagtcatgaggtatttgcccatgcctatgtcctaaatggtattgcttaggttttcttctag
                        Chimp  ttgctgttttagtcatgaggtctttgcccatgcctatgtcctgaatggtattgcttaggttttcttctag
                      Gorilla  ttgctgttttagtcatgaagtctttgcccatgcctatgtcctgaatggtattgcttaggttttcttctag
                       Gibbon  ttgctgttttagtcatgaagtctttgcccatgcctatgtcctgaatggtattgcttaggttttcttctag
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ggtttttatggttgtaggtcttacatttaagtctttgatccactttgagttaatttttgtgtaaggcgta
                        Chimp  ggtttttatggttgtaggtcttacatttaagtctttgatccactttgagttaatttttgtgtaaggcgta
                      Gorilla  ggtttttatggttgtaggtcttacatttaagtctttgatccactttgagttaatttttgtataaggtgta
                       Gibbon  ggtttttatggttgtaggtcttacatttaagtctttaatcccctttgagttaaattttgtataaggtg--
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  aggaagggatacggtttcagctttctgcttatggctagccagttttctcaacaccatttattaaataggg
                        Chimp  aggaagggatacggtttcagctttctgcttatggctagccagttttctcaacaccatttattaaatgggg
                      Gorilla  aggaagggatatggtttcagctttctgcttatggctagccagttttctcaacaccatttattaaataggg
                       Gibbon  ------------------------ctgcttatggctagccagttttctcaacaccattgattaaataggg
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  aatcttttccccagtgcttgtttttgtcaggtttgtcaaagatcagatggttgtaggtgtgtggtgttat
                        Chimp  aatcttttccccagtgcttgtttttgtcaggtttgtcaaagatcagatggttgtaggtgtgtggtgttat
                      Gorilla  aatcctttccccattgcttgtttttgtcaggtttgtcaaagatcagatggctgtaggagtgtggtgttat
                       Gibbon  aatcctctccccatttcttgtttttgtcaggtttgtcaaagatcagatggttgtgggtgtatggtgttat
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttctgagatctctgttctgttgcattggtctgtatctctgttttggtaccagtaccatgctgttttggtt
                        Chimp  ttctgagatctctgttctgttgcattggtctgtatctctgttttggtacaagtaccatgctgttttggtt
                      Gorilla  ttctgaggtctctgttctgttgtactggtctatatctctgttttggtaccagtgccatgctgtttttgtt
                       Gibbon  ttctgaggtctctgttctgttgcattggtccatatctctgttttggtaccaataccatgctgttttggtt
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  actgaagcctcgtagtatagtttgaagtcagttagtgtgatgcctccagatttgttctttttgcttaaga
                        Chimp  actgtagcctcgtagtatagtttgaagtccgttagtgtgatgcctccagatttgttctttttgcttaaga
                      Gorilla  actgtagccttgtagtatagtttgaagtcagttagtgtgatgcctccagatttgttctttttgcttaaga
                       Gibbon  actgtaggcttgtagtatagtttgaagtcagttagtgtgatgtctccagatttgttctttttgcttaaga
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                   Chinchilla  ======================================================================
                 Prairie vole  ======================================================================
                       Tenrec  ======================================================================
              Chinese hamster  ======================================================================
                        Mouse  ======================================================================
               Golden hamster  ======================================================================
                         Pika  ======================================================================
                          Rat  ======================================================================
              Star-nosed mole  ======================================================================
             Black flying-fox  ======================================================================
                 Weddell seal  ======================================================================
                 Killer whale  ======================================================================
                        Panda  ======================================================================
                Big brown bat  ======================================================================
                          Cow  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                    Armadillo  ======================================================================
                     Squirrel  ======================================================================
           Chinese tree shrew  ======================================================================
                          Dog  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
               Pacific walrus  ======================================================================
                      Dolphin  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                X. tropicalis  ======================================================================
                       Lizard  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
                   Budgerigar  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
                     Platypus  ======================================================================
           American alligator  ======================================================================
                      Manatee  ======================================================================
                     Elephant  ======================================================================
                     Bushbaby  ======================================================================
               Naked mole-rat  ======================================================================
                       Rabbit  ======================================================================
               Bactrian camel  ======================================================================
                      Megabat  ======================================================================
                     Aardvark  ======================================================================
                       Baboon  ======================================================================
             Cape golden mole  ======================================================================
                          Pig  ======================================================================
             White rhinoceros  ======================================================================
              Squirrel monkey  ======================================================================
                 Green monkey  ======================================================================
          Crab-eating macaque  ======================================================================
                       Rhesus  ======================================================================
                        Horse  ======================================================================
                       Alpaca  ======================================================================
                     Marmoset  ======================================================================
                    Orangutan  ======================================================================

                        Human  ttgtcttgaatatataggctcttcatccccatcaagctaccactgactttcttcacagaattggaaaaaa
                        Chimp  ttgtcttgaatatataggctcttcatccccatcaagctaccactgactttcttcacagaattggaaaaaa
                      Gorilla  ttgtcttgaatatataggctcttcatccccatcaagctaccactgactttcttcacagaattggaaaaaa
                       Gibbon  ttgtcttgaatatataggctcttcatccccatcaagctaccactgactttcttcacagaattggaaaaaa
                        Shrew  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Cape elephant shrew  ======================================================================
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================