Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 751 in window, 79217278 - 79217300, 23 bps 
B D                     Human  tag-caat---a------------acaatactcattcat
B D                     Chimp  tag-caat---a------------acaatactcattcat
B D                   Gorilla  tag-caat---a------------acaatactcattcat
B D                 Orangutan  tag-caat---a------------acaatactcattcat
B D                    Gibbon  tag-caat---a------------acaatactcattcat
B D                    Rhesus  tag-caat---a------------acaatcctcattcat
B D       Crab-eating macaque  tag-caat---a------------acaatcctcattcat
B D                    Baboon  tag-caat---a------------acaatcctcattcat
B D                  Marmoset  tag-caat---a------------ataacactcattcat
B D           Squirrel monkey  tag-caat---a------------ataacactcattcat
B D                  Bushbaby  tag-caat---a------------ataatattcattcat
           Chinese tree shrew  taattaat---a------------aaaatactcat---c
B D                  Squirrel  taa-taacaaca------------ggaata-ttatttat
                 Prairie vole  --a-tatc-------------------------------
B D           Chinese hamster  taa-tatc-------------------------------
               Golden hamster  taa-tatc-------------------------------
B D                     Mouse  --t-catc-------------------------------
B D                       Rat  --t-cacc-------------------------------
B D                    Rabbit  taa-tact------------------------cagttac
B D                      Pika  tca-tatt------------------------cattcac
B D                     Horse  taa-caac---a---------ataataatactcattcat
B D          White rhinoceros  taa-caaa---a---------ataataatactcattcat
B D                       Cat  tga-caac---a---acaataataataataatact---c
B D                       Dog  tag-caac---a---ataacaataataatactcat---t
B D                   Ferret   taa-caac---aacaacaacaagaataataccca-----
B D                     Panda  taa-caac---a---acgacaataataatacccat---t
               Pacific walrus  taa-caac---a------acaataataataccgat---t
B D                     Shrew  ----cgat---a---------ataatagttttcattcat
             Cape golden mole  tca-tcac---c---------------atgcttgtttat
                     Aardvark  taa-taat---a---------------atattcattca-
B D                 Armadillo  tca-tcat---a---------------ttgttcatttac
B D                  Microbat  =======================================
        David's myotis (bat)  =======================================
B D                    Tenrec  =======================================
         Cape elephant shrew  =======================================
B D                  Hedgehog  =======================================
      Lesser Egyptian jerboa  =======================================
B D                     Sheep  =======================================
               Domestic goat  =======================================
B D                       Cow  =======================================
            Tibetan antelope  =======================================
B D                  Elephant  =======================================
B D            Naked mole-rat  =======================================
                  Chinchilla  =======================================
             Star-nosed mole  =======================================
               Big brown bat  =======================================
B D                    Alpaca  =======================================
            Black flying-fox  =======================================
B D                   Manatee  =======================================
              Bactrian camel  =======================================
                Killer whale  =======================================
B D                Guinea pig  =======================================
            Brush-tailed rat  =======================================
                Weddell seal  =======================================
B D                       Pig  =======================================
B D              Green monkey  =======================================
B D                   Megabat  =======================================
B D                   Wallaby  =======================================
B D                  Platypus  =======================================
B D                    Turkey  =======================================
  D              Mallard duck  =======================================
B D                Coelacanth  =======================================
B D                    Lizard  =======================================
  D            Painted turtle  =======================================
  D           Green seaturtle  =======================================
B D                   Chicken  =======================================
B D                   Opossum  =======================================
  D  Chinese softshell turtle  =======================================
B D        American alligator  =======================================
  D          Peregrine falcon  =======================================
  D              Saker falcon  =======================================
B D           Tasmanian devil  =======================================
B D                Budgerigar  =======================================
  D               Rock pigeon  =======================================
          Tibetan ground jay  =======================================
B D               Zebra finch  =======================================
B D       Medium ground finch  =======================================
  D    White-throated sparrow  =======================================
  D       Collared flycatcher  =======================================

Inserts between block 1 and 2 in window
            Cape golden mole 11837bp

Alignment block 2 of 751 in window, 79217301 - 79217339, 39 bps 
B D                     Human  cttctttag-ggtgttcttgtgaggctcc-aaaagaagca-a
B D                     Chimp  cttctttag-ggtgttctagtgaggctcc-aaaagaagca-a
B D                   Gorilla  cttctttag-ggtgttcttgtgaggctcc-aaaagaagta-a
B D                 Orangutan  cttctttag-ggtgttcttgtgaggctcc-aaaagaagta-a
B D                    Gibbon  cttctttag-ggtgttcttgtgagcctcc-aaaagaagta-a
B D                    Rhesus  cttcgttag-ggtgttcttgtgaggctcc-aaaagaagta-a
B D       Crab-eating macaque  cttcgttag-ggtgttcttgtgaggctcc-aaaagaagta-a
B D                    Baboon  cttcgttag-ggtgttcttgtgaggctcc-aaaagaagta-a
B D                  Marmoset  cttctttcg-ggtgttcttgtgaggttcc-aaaaggagta-a
B D           Squirrel monkey  cttctttag-ggtgttcttgtggggttcc-aaaagaagta-a
B D                  Bushbaby  cttctttag-gcagttctt-tgatgttcc-aaaggagat--a
           Chinese tree shrew  cttcttcag-ggtgttcttg--------c-agaagaggt--a
B D                  Squirrel  cttctttag-taaattcttatgaagctca-aaaagaaacaa-
                 Prairie vole  tgcccttaa-gatgttctattgaggctcccaaaaaggata--
B D           Chinese hamster  catccttaa-gatattcatgtgaggctcc-caacaagatg--
               Golden hamster  catccttaa-gatattcttgtgaggctccaaaacaagatg--
B D                     Mouse  catctttaa-aatgttcttgtggggtttc-aaaagaaatg--
B D                       Rat  cacctttaa-aatgttcttgtggggttcc-aaaagaaatg--
B D                    Rabbit  cttcttaag-ggtgttcttgtaacgctcc-aaaagacata--
B D                      Pika  cttctt------taattttgtgaagctcc-aaaagacata--
B D                     Horse  cttctttag-agtgttcttgtgaggccac-aaaagaggta--
B D          White rhinoceros  cttctttag-agtcttcttgtgaggctcc-aaaagaggta--
B D                       Cat  cttctttagaagtgttcttgtgaggttcc-aaaagtggta--
B D                       Dog  cttctatag-agtgttcttgtgagctttc-aaaaattgta--
B D                   Ferret   -ttctttag-agtgttcttgtgagccttc-gaaagtagta--
B D                     Panda  cttctttag-agtgttcttgtgagccttc-aaaagtggta--
               Pacific walrus  cttcttcac-agtgttcttgtgagccttc-aaaagtggtt--
B D                     Shrew  tttctttag-agcactttcttcagagtcc-aatagaagta--
                     Aardvark  --tctttag-ggtgctttagtaaggctcc-aaaagagtta--
B D                 Armadillo  cttctttag-ggtatatttgtgaggctcc-aaaa-acaaa--
B D                  Microbat  ==========================================
        David's myotis (bat)  ==========================================
B D                    Tenrec  ==========================================
         Cape elephant shrew  ==========================================
B D                  Hedgehog  ==========================================
      Lesser Egyptian jerboa  ==========================================
B D                     Sheep  ==========================================
               Domestic goat  ==========================================
B D                       Cow  ==========================================
            Tibetan antelope  ==========================================
B D                  Elephant  ==========================================
B D            Naked mole-rat  ==========================================
                  Chinchilla  ==========================================
             Star-nosed mole  ==========================================
               Big brown bat  ==========================================
B D                    Alpaca  ==========================================
            Black flying-fox  ==========================================
B D                   Manatee  ==========================================
              Bactrian camel  ==========================================
                Killer whale  ==========================================
B D                Guinea pig  ==========================================
            Brush-tailed rat  ==========================================
                Weddell seal  ==========================================
B D                       Pig  ==========================================
            Cape golden mole  ==========================================
B D              Green monkey  ==========================================
B D                   Megabat  ==========================================
B D                   Wallaby  ==========================================
B D                  Platypus  ==========================================
B D                    Turkey  ==========================================
  D              Mallard duck  ==========================================
B D                Coelacanth  ==========================================
B D                    Lizard  ==========================================
  D            Painted turtle  ==========================================
  D           Green seaturtle  ==========================================
B D                   Chicken  ==========================================
B D                   Opossum  ==========================================
  D  Chinese softshell turtle  ==========================================
B D        American alligator  ==========================================
  D          Peregrine falcon  ==========================================
  D              Saker falcon  ==========================================
B D           Tasmanian devil  ==========================================
B D                Budgerigar  ==========================================
  D               Rock pigeon  ==========================================
          Tibetan ground jay  ==========================================
B D               Zebra finch  ==========================================
B D       Medium ground finch  ==========================================
  D    White-throated sparrow  ==========================================
  D       Collared flycatcher  ==========================================

Inserts between block 2 and 3 in window
B D                 Squirrel 548bp

Alignment block 3 of 751 in window, 79217340 - 79217377, 38 bps 
B D                     Human  atgtat----gagaccacactttgtaaactgcaatgtgccat
B D                     Chimp  atgtat----gagaccacactttgtaaactgcaatgtgccat
B D                   Gorilla  atgtat----gagaccacactttgtaaactgcaacgtgccat
B D                 Orangutan  atgtat----gagaccacactttgtaaactgcaatgtgctat
B D                    Gibbon  atgtat----gagaccacactttgtaaaccgcaatgtgccat
B D                    Rhesus  atgtat----gagaccacactttgtaaactgcaatgtgccat
B D       Crab-eating macaque  atgtat----gagaccacactttgtaaactgcaatgtgccat
B D                    Baboon  atgtat----gagaccacactttgtaaactgcaatgtgccat
B D                  Marmoset  acatac----gagaccaccctttgtaaactgcaaggtgccat
B D           Squirrel monkey  acatac----aagaccaccctttgtaaactgcaaggtgccat
B D                  Bushbaby  atgtat----gtgacagcactttataaactgtaatgtgtcat
           Chinese tree shrew  atatat----gagacaacagtttataaactgtaatgtaccac
                 Prairie vole  atactt----acaatagaactttctaaactatc---------
B D           Chinese hamster  atacat----tcaataaaactttctaaacaatc---------
               Golden hamster  atacat----tcaataaacctttctaaacaatc---------
B D                     Mouse  atacat----agtatagaatttcccaaattaac---------
B D                       Rat  atgcat----ggtactgaacttcccaaactatc---------
B D                    Rabbit  ctatat----aaaatggcatgttataaactg-tatgtaccat
B D                      Pika  ttataa----aagacagcattttactaactgttatgtacc-t
B D                     Horse  atgtat----gagacagcactttctaaactgtaatgtgcccc
B D          White rhinoceros  atgtat----gagacagcactttataaactgtgatgtgccat
B D                       Cat  atgtat----gagacagcactttataaactggaatatgccat
B D                       Dog  atatat----gagagagcactttataaattgtgatgtgccat
B D                   Ferret   atgtat----gaaatagcactttataaattgtaatgtgccat
B D                     Panda  acatat----gagacaacactttataaattgtaatgtgccat
               Pacific walrus  atgtat----gagacagcactttataaattgtaatgtgccat
B D                     Shrew  atacatgtgagtgactacaatttataa--------gtgtgct
                     Aardvark  atttat----gaggcagtgctttataaactgtaatgtgccac
B D                 Armadillo  atatat----gaggcagcactttataaactataatgtgccaa
B D                  Microbat  ==========================================
        David's myotis (bat)  ==========================================
B D                    Tenrec  ==========================================
         Cape elephant shrew  ==========================================
B D                  Hedgehog  ==========================================
      Lesser Egyptian jerboa  ==========================================
B D                     Sheep  ==========================================
               Domestic goat  ==========================================
B D                       Cow  ==========================================
            Tibetan antelope  ==========================================
B D                  Elephant  ==========================================
B D            Naked mole-rat  ==========================================
                  Chinchilla  ==========================================
             Star-nosed mole  ==========================================
               Big brown bat  ==========================================
B D                    Alpaca  ==========================================
            Black flying-fox  ==========================================
B D                  Squirrel  ==========================================
B D                   Manatee  ==========================================
              Bactrian camel  ==========================================
                Killer whale  ==========================================
B D                Guinea pig  ==========================================
            Brush-tailed rat  ==========================================
                Weddell seal  ==========================================
B D                       Pig  ==========================================
            Cape golden mole  ==========================================
B D              Green monkey  ==========================================
B D                   Megabat  ==========================================
B D                   Wallaby  ==========================================
B D                  Platypus  ==========================================
B D                    Turkey  ==========================================
  D              Mallard duck  ==========================================
B D                Coelacanth  ==========================================
B D                    Lizard  ==========================================
  D            Painted turtle  ==========================================
  D           Green seaturtle  ==========================================
B D                   Chicken  ==========================================
B D                   Opossum  ==========================================
  D  Chinese softshell turtle  ==========================================
B D        American alligator  ==========================================
  D          Peregrine falcon  ==========================================
  D              Saker falcon  ==========================================
B D           Tasmanian devil  ==========================================
B D                Budgerigar  ==========================================
  D               Rock pigeon  ==========================================
          Tibetan ground jay  ==========================================
B D               Zebra finch  ==========================================
B D       Medium ground finch  ==========================================
  D    White-throated sparrow  ==========================================
  D       Collared flycatcher  ==========================================

Alignment block 4 of 751 in window, 79217378 - 79217391, 14 bps 
B D                     Human  atgaattct------------------------------------------acttg
B D                     Chimp  atgaattct------------------------------------------acttg
B D                   Gorilla  ttgaattct------------------------------------------acttg
B D                 Orangutan  atgaattct------------------------------------------acttg
B D                    Gibbon  atgaattct------------------------------------------acttg
B D                    Rhesus  atgaattct------------------------------------------acttg
B D       Crab-eating macaque  atgaattct------------------------------------------acttg
B D                    Baboon  atgaattct------------------------------------------acttg
B D                  Marmoset  atgaattct------------------------------------------acttg
B D           Squirrel monkey  atgaattct------------------------------------------acttg
B D                  Bushbaby  acaaattct------------------------------------------agttg
           Chinese tree shrew  atgaactctagctattgttacaaatttttaaaatgtattatatagtagagcacttg
       Lesser Egyptian jerboa  attaatttt------------------------------------------ccttg
                 Prairie vole  attaattct------------------------------------------gattt
B D           Chinese hamster  attaattca------------------------------------------agtcg
               Golden hamster  gttaattct------------------------------------------agttg
B D                     Mouse  attaattct------------------------------------------agttg
B D                       Rat  ataaattct------------------------------------------agttg
B D                    Rabbit  atgaattct------------------------------------------agttg
B D                      Pika  atgaattct------------------------------------------cactg
B D                     Horse  atgaattct------------------------------------------aatta
B D          White rhinoceros  atgaattct------------------------------------------gatta
B D                       Cat  atgaattct------------------------------------------agtta
B D                       Dog  atgaattct------------------------------------------attta
B D                   Ferret   atgaattct------------------------------------------agtta
B D                     Panda  atgaattct------------------------------------------agtta
               Pacific walrus  atgaattct------------------------------------------agtta
B D                     Shrew  ataatttct------------------------------------------agtga
                     Aardvark  atgaattct------------------------------------------aatta
B D                 Armadillo  atgaattct------------------------------------------ggtta
B D                  Microbat  ========================================================
        David's myotis (bat)  ========================================================
B D                    Tenrec  ========================================================
         Cape elephant shrew  ========================================================
B D                  Hedgehog  ========================================================
B D                     Sheep  ========================================================
               Domestic goat  ========================================================
B D                       Cow  ========================================================
            Tibetan antelope  ========================================================
B D                  Elephant  ========================================================
B D            Naked mole-rat  ========================================================
                  Chinchilla  ========================================================
             Star-nosed mole  ========================================================
               Big brown bat  ========================================================
B D                    Alpaca  ========================================================
            Black flying-fox  ========================================================
B D                  Squirrel  ========================================================
B D                   Manatee  ========================================================
              Bactrian camel  ========================================================
                Killer whale  ========================================================
B D                Guinea pig  ========================================================
            Brush-tailed rat  ========================================================
                Weddell seal  ========================================================
B D                       Pig  ========================================================
            Cape golden mole  ========================================================
B D              Green monkey  ========================================================
B D                   Megabat  ========================================================
B D                   Wallaby  ========================================================
B D                  Platypus  ========================================================
B D                    Turkey  ========================================================
  D              Mallard duck  ========================================================
B D                Coelacanth  ========================================================
B D                    Lizard  ========================================================
  D            Painted turtle  ========================================================
  D           Green seaturtle  ========================================================
B D                   Chicken  ========================================================
B D                   Opossum  ========================================================
  D  Chinese softshell turtle  ========================================================
B D        American alligator  ========================================================
  D          Peregrine falcon  ========================================================
  D              Saker falcon  ========================================================
B D           Tasmanian devil  ========================================================
B D                Budgerigar  ========================================================
  D               Rock pigeon  ========================================================
          Tibetan ground jay  ========================================================
B D               Zebra finch  ========================================================
B D       Medium ground finch  ========================================================
  D    White-throated sparrow  ========================================================
  D       Collared flycatcher  ========================================================

Inserts between block 4 and 5 in window
          Chinese tree shrew 227bp

Alignment block 5 of 751 in window, 79217392 - 79217397, 6 bps 
B D                     Human  ctatta
B D                     Chimp  ctatta
B D                   Gorilla  ctatta
B D                 Orangutan  ctatta
B D                    Gibbon  ctatta
B D                    Rhesus  ctatta
B D       Crab-eating macaque  ctatta
B D                    Baboon  ctatta
B D                  Marmoset  ctatta
B D           Squirrel monkey  ctatta
B D                  Bushbaby  ct-cta
           Chinese tree shrew  ctatta
B D                     Horse  ctatta
B D          White rhinoceros  atatta
B D                       Cat  ctatta
B D                       Dog  --acta
B D                   Ferret   --atta
B D                     Panda  --atca
               Pacific walrus  --atta
B D                     Shrew  tcatta
                     Aardvark  ccatga
B D                 Armadillo  ctgtta
B D                       Rat  ------
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                    Tenrec  ======
         Cape elephant shrew  ======
B D                      Pika  ------
B D                  Hedgehog  ======
      Lesser Egyptian jerboa  ------
B D                     Sheep  ======
               Domestic goat  ======
B D                       Cow  ======
            Tibetan antelope  ======
B D                    Rabbit  ------
              Golden hamster  ------
                Prairie vole  ------
B D           Chinese hamster  ------
B D                  Elephant  ======
B D                     Mouse  ------
B D            Naked mole-rat  ======
                  Chinchilla  ======
             Star-nosed mole  ======
               Big brown bat  ======
B D                    Alpaca  ======
            Black flying-fox  ======
B D                  Squirrel  ======
B D                   Manatee  ======
              Bactrian camel  ======
                Killer whale  ======
B D                Guinea pig  ======
            Brush-tailed rat  ======
                Weddell seal  ======
B D                       Pig  ======
            Cape golden mole  ======
B D              Green monkey  ======
B D                   Megabat  ======
B D                   Wallaby  ======
B D                  Platypus  ======
B D                    Turkey  ======
  D              Mallard duck  ======
B D                Coelacanth  ======
B D                    Lizard  ======
  D            Painted turtle  ======
  D           Green seaturtle  ======
B D                   Chicken  ======
B D                   Opossum  ======
  D  Chinese softshell turtle  ======
B D        American alligator  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
B D           Tasmanian devil  ======
B D                Budgerigar  ======
  D               Rock pigeon  ======
          Tibetan ground jay  ======
B D               Zebra finch  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
  D       Collared flycatcher  ======

Inserts between block 5 and 6 in window
B D                    Horse 1499bp

Alignment block 6 of 751 in window, 79217398 - 79217399, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  ca
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                  Bushbaby  ca
           Chinese tree shrew  ca
       Lesser Egyptian jerboa  ca
                 Prairie vole  ca
B D           Chinese hamster  ca
               Golden hamster  ca
B D                     Mouse  ca
B D                       Rat  tg
B D                    Rabbit  ct
B D                      Pika  ct
B D          White rhinoceros  ca
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
B D                     Shrew  ca
                     Aardvark  ca
B D                 Armadillo  ca
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                     Sheep  ==
               Domestic goat  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
             Star-nosed mole  ==
               Big brown bat  ==
B D                    Alpaca  ==
            Black flying-fox  ==
B D                  Squirrel  ==
B D                   Manatee  ==
B D                     Horse  ==
              Bactrian camel  ==
                Killer whale  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
                Weddell seal  ==
B D                       Pig  ==
            Cape golden mole  ==
B D              Green monkey  ==
B D                   Megabat  ==
B D                   Wallaby  ==
B D                  Platypus  ==
B D                    Turkey  ==
  D              Mallard duck  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Chicken  ==
B D                   Opossum  ==
  D  Chinese softshell turtle  ==
B D        American alligator  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==

Inserts between block 6 and 7 in window
B D                    Shrew 2001bp

Alignment block 7 of 751 in window, 79217400 - 79217400, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D                    Rabbit  g
B D                      Pika  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                     Aardvark  a
B D                 Armadillo  a
B D                  Microbat  =
        David's myotis (bat)  =
B D                    Tenrec  =
         Cape elephant shrew  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                     Sheep  =
               Domestic goat  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Elephant  =
B D            Naked mole-rat  =
                  Chinchilla  =
             Star-nosed mole  =
               Big brown bat  =
B D                    Alpaca  =
            Black flying-fox  =
B D                  Squirrel  =
B D                   Manatee  =
B D                     Horse  =
              Bactrian camel  =
                Killer whale  =
B D                Guinea pig  =
            Brush-tailed rat  =
                Weddell seal  =
B D                       Pig  =
            Cape golden mole  =
B D              Green monkey  =
B D                   Megabat  =
B D                   Wallaby  =
B D                  Platypus  =
B D                    Turkey  =
  D              Mallard duck  =
B D                Coelacanth  =
B D                    Lizard  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Chicken  =
B D                   Opossum  =
  D  Chinese softshell turtle  =
B D        American alligator  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D           Tasmanian devil  =
B D                Budgerigar  =
  D               Rock pigeon  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =

Inserts between block 7 and 8 in window
B D                      Cat 882bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp

Alignment block 8 of 751 in window, 79217401 - 79217402, 2 bps 
B D                     Human  at
B D                     Chimp  at
B D                   Gorilla  at
B D                 Orangutan  at
B D                    Gibbon  at
B D                    Rhesus  at
B D       Crab-eating macaque  at
B D                    Baboon  at
B D                  Marmoset  at
B D           Squirrel monkey  at
B D                  Bushbaby  ac
           Chinese tree shrew  at
       Lesser Egyptian jerboa  at
                 Prairie vole  at
B D           Chinese hamster  at
               Golden hamster  at
B D                     Mouse  at
B D                       Rat  gt
B D                    Rabbit  tt
B D                      Pika  tt
B D          White rhinoceros  at
B D                       Dog  at
B D                   Ferret   at
B D                     Panda  at
               Pacific walrus  at
                     Aardvark  at
B D                 Armadillo  at
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                     Sheep  ==
               Domestic goat  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
             Star-nosed mole  ==
               Big brown bat  ==
B D                    Alpaca  ==
            Black flying-fox  ==
B D                  Squirrel  ==
B D                   Manatee  ==
B D                     Horse  ==
              Bactrian camel  ==
B D                       Cat  ==
                Killer whale  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
                Weddell seal  ==
B D                       Pig  ==
            Cape golden mole  ==
B D              Green monkey  ==
B D                   Megabat  ==
B D                   Wallaby  ==
B D                  Platypus  ==
B D                    Turkey  ==
  D              Mallard duck  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Chicken  ==
B D                   Opossum  ==
  D  Chinese softshell turtle  ==
B D        American alligator  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==

Alignment block 9 of 751 in window, 79217403 - 79217403, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
       Lesser Egyptian jerboa  g
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  g
B D                       Rat  g
B D                    Rabbit  g
B D                      Pika  g
B D          White rhinoceros  a
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  t
               Pacific walrus  a
         David's myotis (bat)  a
B D                  Microbat  a
                     Aardvark  a
B D                 Armadillo  a
B D                    Tenrec  =
         Cape elephant shrew  =
B D                     Shrew  =
B D                  Hedgehog  =
B D                     Sheep  =
               Domestic goat  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Elephant  =
B D            Naked mole-rat  =
                  Chinchilla  =
             Star-nosed mole  =
               Big brown bat  =
B D                    Alpaca  =
            Black flying-fox  =
B D                  Squirrel  =
B D                   Manatee  =
B D                     Horse  =
              Bactrian camel  =
B D                       Cat  =
                Killer whale  =
B D                Guinea pig  =
            Brush-tailed rat  =
                Weddell seal  =
B D                       Pig  =
            Cape golden mole  =
B D              Green monkey  =
B D                   Megabat  =
B D                   Wallaby  =
B D                  Platypus  =
B D                    Turkey  =
  D              Mallard duck  =
B D                Coelacanth  =
B D                    Lizard  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Chicken  =
B D                   Opossum  =
  D  Chinese softshell turtle  =
B D        American alligator  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D           Tasmanian devil  =
B D                Budgerigar  =
  D               Rock pigeon  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =

Inserts between block 9 and 10 in window
              Pacific walrus 678bp
B D                Armadillo 1621bp

Alignment block 10 of 751 in window, 79217404 - 79217409, 6 bps 
B D                     Human  t-------taa-----cg
B D                     Chimp  t-------taa-----cg
B D                   Gorilla  t-------taa-----cg
B D                 Orangutan  t-------taa-----cg
B D                    Gibbon  t-------taa-----ca
B D                    Rhesus  t-------taa-----tg
B D       Crab-eating macaque  t-------taa-----tg
B D                    Baboon  t-------taa-----tg
B D                  Marmoset  t-------taa-----tg
B D           Squirrel monkey  t-------taa-----tg
B D                  Bushbaby  t-------taa-----tg
           Chinese tree shrew  t-------taa-----tg
       Lesser Egyptian jerboa  c-------ag------tg
                 Prairie vole  t-------aga-----ta
B D           Chinese hamster  t-------agattc--tg
               Golden hamster  t-------agattc--tg
B D                     Mouse  t-------gga-----tg
B D                       Rat  t-------gga-----tg
B D                    Rabbit  ctattgcaaagtttaata
B D                      Pika  c-------aaattttacg
B D          White rhinoceros  a-------taa-----tg
B D                       Dog  t-------taa-----tg
B D                   Ferret   c-------taa-----tg
B D                     Panda  t-------taa-----tg
         David's myotis (bat)  t-------tga-----tc
B D                  Microbat  t-------tga-----tc
                     Aardvark  t-------taa-----tg
B D                 Armadillo  t-------tgc-----cc
B D                    Tenrec  ==================
         Cape elephant shrew  ==================
B D                     Shrew  ==================
B D                  Hedgehog  ==================
B D                     Sheep  ==================
               Domestic goat  ==================
B D                       Cow  ==================
            Tibetan antelope  ==================
B D                  Elephant  ==================
B D            Naked mole-rat  ==================
                  Chinchilla  ==================
             Star-nosed mole  ==================
               Big brown bat  ==================
B D                    Alpaca  ==================
            Black flying-fox  ==================
B D                  Squirrel  ==================
B D                   Manatee  ==================
B D                     Horse  ==================
              Bactrian camel  ==================
B D                       Cat  ==================
                Killer whale  ==================
B D                Guinea pig  ==================
            Brush-tailed rat  ==================
              Pacific walrus  ==================
                Weddell seal  ==================
B D                       Pig  ==================
            Cape golden mole  ==================
B D              Green monkey  ==================
B D                   Megabat  ==================
B D                   Wallaby  ==================
B D                  Platypus  ==================
B D                    Turkey  ==================
  D              Mallard duck  ==================
B D                Coelacanth  ==================
B D                    Lizard  ==================
  D            Painted turtle  ==================
  D           Green seaturtle  ==================
B D                   Chicken  ==================
B D                   Opossum  ==================
  D  Chinese softshell turtle  ==================
B D        American alligator  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
B D           Tasmanian devil  ==================
B D                Budgerigar  ==================
  D               Rock pigeon  ==================
          Tibetan ground jay  ==================
B D               Zebra finch  ==================
B D       Medium ground finch  ==================
  D    White-throated sparrow  ==================
  D       Collared flycatcher  ==================

Inserts between block 10 and 11 in window
B D         White rhinoceros 1536bp

Alignment block 11 of 751 in window, 79217410 - 79217411, 2 bps 
B D                     Human  tt
B D                     Chimp  tt
B D                   Gorilla  tt
B D                 Orangutan  tt
B D                    Gibbon  tt
B D                    Rhesus  tt
B D       Crab-eating macaque  tt
B D                    Baboon  tt
B D                  Marmoset  tt
B D           Squirrel monkey  tt
B D                  Bushbaby  tt
           Chinese tree shrew  tc
       Lesser Egyptian jerboa  tt
                 Prairie vole  tt
B D           Chinese hamster  tt
               Golden hamster  tt
B D                     Mouse  tt
B D                       Rat  tt
B D                    Rabbit  tt
B D                      Pika  tt
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
             Tibetan antelope  tt
B D                       Cow  tt
B D                     Sheep  tt
                Domestic goat  tt
B D                     Horse  tt
B D          White rhinoceros  tt
B D                       Dog  tt
B D                   Ferret   tt
B D                     Panda  tt
             Black flying-fox  tt
B D                   Megabat  tt
                Big brown bat  tt
         David's myotis (bat)  tt
B D                  Microbat  tt
                     Aardvark  tt
B D                 Armadillo  tt
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                     Shrew  ==
B D                  Hedgehog  ==
B D                  Elephant  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
             Star-nosed mole  ==
B D                  Squirrel  ==
B D                   Manatee  ==
B D                       Cat  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
                Weddell seal  ==
            Cape golden mole  ==
B D              Green monkey  ==
B D                   Wallaby  ==
B D                  Platypus  ==
B D                    Turkey  ==
  D              Mallard duck  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Chicken  ==
B D                   Opossum  ==
  D  Chinese softshell turtle  ==
B D        American alligator  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==

Inserts between block 11 and 12 in window
B D                      Dog 774bp
B D                  Ferret  1094bp
B D                    Panda 663bp

Alignment block 12 of 751 in window, 79217412 - 79217415, 4 bps 
B D                     Human  aatc
B D                     Chimp  aatc
B D                   Gorilla  aatc
B D                 Orangutan  aatc
B D                    Gibbon  aatc
B D                    Rhesus  aatc
B D       Crab-eating macaque  aatc
B D                    Baboon  aatc
B D                  Marmoset  aatc
B D           Squirrel monkey  aatc
B D                  Bushbaby  aatt
           Chinese tree shrew  aacc
       Lesser Egyptian jerboa  aatt
                 Prairie vole  aata
B D           Chinese hamster  aatc
               Golden hamster  aatc
B D                     Mouse  aatc
B D                       Rat  aatc
B D                    Rabbit  aatc
B D                      Pika  aatc
B D                       Pig  attc
B D                    Alpaca  attt
               Bactrian camel  attt
B D                   Dolphin  attc
                 Killer whale  attc
             Tibetan antelope  attc
B D                       Cow  attc
B D                     Sheep  attc
                Domestic goat  attc
B D                     Horse  aatc
B D          White rhinoceros  aatc
             Black flying-fox  aatc
B D                   Megabat  aatc
                Big brown bat  aatc
         David's myotis (bat)  aatc
B D                  Microbat  aatc
                     Aardvark  tttc
B D                 Armadillo  aatc
B D                    Tenrec  ====
         Cape elephant shrew  ====
B D                     Shrew  ====
B D                  Hedgehog  ====
B D                  Elephant  ====
B D            Naked mole-rat  ====
                  Chinchilla  ====
             Star-nosed mole  ====
B D                       Dog  ====
B D                  Squirrel  ====
B D                   Manatee  ====
B D                     Panda  ====
B D                       Cat  ====
B D                   Ferret   ====
B D                Guinea pig  ====
            Brush-tailed rat  ====
              Pacific walrus  ====
                Weddell seal  ====
            Cape golden mole  ====
B D              Green monkey  ====
B D                   Wallaby  ====
B D                  Platypus  ====
B D                    Turkey  ====
  D              Mallard duck  ====
B D                Coelacanth  ====
B D                    Lizard  ====
  D            Painted turtle  ====
  D           Green seaturtle  ====
B D                   Chicken  ====
B D                   Opossum  ====
  D  Chinese softshell turtle  ====
B D        American alligator  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D           Tasmanian devil  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
          Tibetan ground jay  ====
B D               Zebra finch  ====
B D       Medium ground finch  ====
  D    White-throated sparrow  ====
  D       Collared flycatcher  ====

Alignment block 13 of 751 in window, 79217416 - 79217417, 2 bps 
B D                     Human  ta
B D                     Chimp  ta
B D                   Gorilla  ta
B D                 Orangutan  ta
B D                    Gibbon  ta
B D                    Rhesus  ta
B D       Crab-eating macaque  ta
B D                    Baboon  ta
B D                  Marmoset  ta
B D           Squirrel monkey  ta
B D                  Bushbaby  ta
           Chinese tree shrew  tg
       Lesser Egyptian jerboa  ga
                 Prairie vole  ta
B D           Chinese hamster  tg
               Golden hamster  tg
B D                     Mouse  ta
B D                       Rat  ta
B D                    Rabbit  tc
B D                      Pika  ta
B D                       Pig  ta
B D                    Alpaca  ta
               Bactrian camel  ta
B D                   Dolphin  ta
                 Killer whale  ta
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  ta
B D          White rhinoceros  ta
             Black flying-fox  ta
B D                   Megabat  ta
                Big brown bat  ta
         David's myotis (bat)  ta
B D                  Microbat  ta
B D                     Shrew  ta
                     Aardvark  ta
B D                 Armadillo  tg
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
B D                  Elephant  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
             Star-nosed mole  ==
B D                       Dog  ==
B D                  Squirrel  ==
B D                   Manatee  ==
B D                     Panda  ==
B D                       Cat  ==
B D                   Ferret   ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
                Weddell seal  ==
            Cape golden mole  ==
B D              Green monkey  ==
B D                   Wallaby  ==
B D                  Platypus  ==
B D                    Turkey  ==
  D              Mallard duck  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Chicken  ==
B D                   Opossum  ==
  D  Chinese softshell turtle  ==
B D        American alligator  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==

Inserts between block 13 and 14 in window
                    Aardvark 2509bp

Alignment block 14 of 751 in window, 79217418 - 79217463, 46 bps 
B D                     Human  g--tggagaagaggaaa-cctatgaaaagc-taattgtg-tataactttat---
B D                     Chimp  g--tggagaagaggaaa-cctatgaaaagc-taattgta-tataactttat---
B D                   Gorilla  g--tggagaagaggaaa-cctatgaaaagc-taattgta-tataactttat---
B D                 Orangutan  g--tggaggaggggaaa-cctatgaaaagt-taattgta-tataactttat---
B D                    Gibbon  g--tggaggagaggaaa-cctatgaaaagt-taatttta-tataactttat---
B D                    Rhesus  g--tggaggagaggaaa-cctatgaaaact-taattgta-tgtg----------
B D       Crab-eating macaque  g--tggaggagaggaaa-cctatgaaaact-taattgta-tgtg----------
B D                    Baboon  g--tggagcagaggaaa-cctatgaaaact-taattgta-tgtg----------
B D                  Marmoset  g--tgaagaagaggaaa-cctatgaaaagg-tcattgta-aatg----------
B D           Squirrel monkey  g--tgaagaagaggaaa-cctaggaaaagt-tcattgta-aatg----------
B D                  Bushbaby  g--tggagg------ga-cctat-aaaagt-taattatattatg----------
           Chinese tree shrew  g--tggcgaagaggaag-cc-ataaacagt-tgattgtactatg----------
       Lesser Egyptian jerboa  gtagtggataggaaacc-t--ataaaaagtaatgttctattgt-----------
                 Prairie vole  g--ggaggtagggaaaa-cctataaaaagt-ttatcatcttgt-----------
B D           Chinese hamster  g--ggaggtgggg--------acaaaaggt-ttgttatcctgt-----------
               Golden hamster  g--ggaggtaggg--------ataaaaggt-ttgttatcttgt-----------
B D                     Mouse  g--ggaaatagggga------ctaaaaggt-ttattatctcgt-----------
B D                       Rat  g--ggagatggggga------ataaaaggt-ttattatctcag-----------
B D                    Rabbit  t--tggggcagattaaa-cctacaaaaagt-gtattgtattat-----------
B D                      Pika  t--gaaggaagatgaaa-cctataaaaatc-tcattgcattat-----------
B D                       Pig  g--ggcgggagataaaagcctatcaaaatt-aatctgtagtat-----------
B D                    Alpaca  g--tggggaagataaaa-cctacaaaaact-taattgtatcat-----------
               Bactrian camel  g--tagggaagataaaa-cctacaaaaact-tgattgtatcat-----------
B D                   Dolphin  g--tgggggagatagaa-cctatgaaaact-taattgtattat-----------
                 Killer whale  g--tgggggagatagaa-cctatgaaaact-taattgtattat-----------
             Tibetan antelope  g--tggaggagataaaa-cctataaaaact-taattgtattat-----------
B D                       Cow  g--tggaggagataaaa-cctataaaaact-taatcatattaa-----------
B D                     Sheep  g--tggaggagataaaa-cctataaaaact-taattgtattat-----------
                Domestic goat  g--tggaggagataaaa-cctataaaaact-taattgtattat-----------
B D                     Horse  g--tggggaagatgaaa-cctataaaaagt-taattgtattat-----------
B D          White rhinoceros  g--tgggggagatgtaa-cctataacaagt-taattgaattat-----------
             Black flying-fox  c--tgggggagatgaaa-tctacaaaaagt-taattgtatggt-----------
B D                   Megabat  c--tgggggagatgaaa-tctacaaaaagt-taattgtatggt-----------
                Big brown bat  g--tgggggagatcaaa-cctataagaagt-taattgtctggt-----------
         David's myotis (bat)  g--tgggggagatcaaa-cccctaagaagt-tagttgtctggt-----------
B D                  Microbat  g--tgggggagatcaaa-cctataagaagt-tagttgtctggt-----------
B D                     Shrew  a--tggatgagatcaaa-gccatagaaagt-acattgtatttt-----------
B D                 Armadillo  g--tgctggagatgaaa-tctatacaaagt-taattgtagtat--------gac
B D                    Tenrec  ======================================================
         Cape elephant shrew  ======================================================
B D                  Hedgehog  ======================================================
B D                  Elephant  ======================================================
B D            Naked mole-rat  ======================================================
                  Chinchilla  ======================================================
             Star-nosed mole  ======================================================
B D                       Dog  ======================================================
B D                  Squirrel  ======================================================
B D                   Manatee  ======================================================
B D                     Panda  ======================================================
B D                       Cat  ======================================================
B D                   Ferret   ======================================================
B D                Guinea pig  ======================================================
            Brush-tailed rat  ======================================================
              Pacific walrus  ======================================================
                Weddell seal  ======================================================
            Cape golden mole  ======================================================
                    Aardvark  ======================================================
B D              Green monkey  ======================================================
B D                   Wallaby  ======================================================
B D                  Platypus  ======================================================
B D                    Turkey  ======================================================
  D              Mallard duck  ======================================================
B D                Coelacanth  ======================================================
B D                    Lizard  ======================================================
  D            Painted turtle  ======================================================
  D           Green seaturtle  ======================================================
B D                   Chicken  ======================================================
B D                   Opossum  ======================================================
  D  Chinese softshell turtle  ======================================================
B D        American alligator  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
B D           Tasmanian devil  ======================================================
B D                Budgerigar  ======================================================
  D               Rock pigeon  ======================================================
          Tibetan ground jay  ======================================================
B D               Zebra finch  ======================================================
B D       Medium ground finch  ======================================================
  D    White-throated sparrow  ======================================================
  D       Collared flycatcher  ======================================================

Inserts between block 14 and 15 in window
      Lesser Egyptian jerboa 34bp
                Prairie vole 34bp
B D          Chinese hamster 44bp
              Golden hamster 44bp
B D                    Mouse 70bp
B D                      Rat 60bp
B D                   Rabbit 1bp
B D                     Pika 1bp

Alignment block 15 of 751 in window, 79217464 - 79217465, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
           Chinese tree shrew  ac
B D                  Squirrel  aa
       Lesser Egyptian jerboa  aa
B D                     Mouse  -a
B D                       Rat  -a
B D                    Rabbit  aa
B D                      Pika  aa
B D                       Pig  ga
B D                    Alpaca  ga
               Bactrian camel  ga
B D                   Dolphin  ga
                 Killer whale  ga
             Tibetan antelope  ga
B D                       Cow  ga
B D                     Sheep  ga
                Domestic goat  ga
B D                     Horse  ga
B D          White rhinoceros  ga
             Black flying-fox  ga
B D                   Megabat  ga
                Big brown bat  ga
         David's myotis (bat)  ga
B D                  Microbat  ga
B D                     Shrew  ga
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                  Hedgehog  ==
              Golden hamster  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                  Elephant  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
             Star-nosed mole  ==
B D                 Armadillo  --
B D                       Dog  ==
B D                   Manatee  ==
B D                     Panda  ==
B D                       Cat  ==
B D                   Ferret   ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
              Pacific walrus  ==
                Weddell seal  ==
            Cape golden mole  ==
                    Aardvark  ==
B D              Green monkey  ==
B D                   Wallaby  ==
B D                  Platypus  ==
B D                    Turkey  ==
  D              Mallard duck  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Chicken  ==
B D                   Opossum  ==
  D  Chinese softshell turtle  ==
B D        American alligator  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==

Inserts between block 15 and 16 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                    Shrew 1bp

Alignment block 16 of 751 in window, 79217466 - 79217470, 5 bps 
B D                     Human  ataat
B D                     Chimp  ataat
B D                   Gorilla  ataat
B D                 Orangutan  ataat
B D                    Gibbon  ataat
B D                    Rhesus  ataat
B D       Crab-eating macaque  ataat
B D                    Baboon  ataat
B D                  Marmoset  at---
B D           Squirrel monkey  atagt
B D                  Bushbaby  atggt
           Chinese tree shrew  at-gt
B D                  Squirrel  aaaaa
       Lesser Egyptian jerboa  aggtt
                 Prairie vole  ---at
B D           Chinese hamster  ---at
               Golden hamster  ---at
B D                     Mouse  gggat
B D                       Rat  gggat
B D                    Rabbit  atggt
B D                      Pika  atggt
B D                       Pig  atggc
B D                    Alpaca  atgtc
               Bactrian camel  atgtc
B D                   Dolphin  atggt
                 Killer whale  atggc
             Tibetan antelope  acagc
B D                       Cow  acagc
B D                     Sheep  acagc
                Domestic goat  acagc
B D                     Horse  atggt
B D          White rhinoceros  atggt
             Black flying-fox  ataat
B D                   Megabat  ataat
                Big brown bat  acagt
         David's myotis (bat)  gcagt
B D                  Microbat  gcagt
B D                  Hedgehog  acagg
B D                     Shrew  gtggt
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                  Elephant  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
             Star-nosed mole  =====
B D                 Armadillo  -----
B D                       Dog  =====
B D                   Manatee  =====
B D                     Panda  =====
B D                       Cat  =====
B D                   Ferret   =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
              Pacific walrus  =====
                Weddell seal  =====
            Cape golden mole  =====
                    Aardvark  =====
B D              Green monkey  =====
B D                   Wallaby  =====
B D                  Platypus  =====
B D                    Turkey  =====
  D              Mallard duck  =====
B D                Coelacanth  =====
B D                    Lizard  =====
  D            Painted turtle  =====
  D           Green seaturtle  =====
B D                   Chicken  =====
B D                   Opossum  =====
  D  Chinese softshell turtle  =====
B D        American alligator  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D           Tasmanian devil  =====
B D                Budgerigar  =====
  D               Rock pigeon  =====
          Tibetan ground jay  =====
B D               Zebra finch  =====
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
  D       Collared flycatcher  =====

Alignment block 17 of 751 in window, 79217471 - 79217585, 115 bps 
B D                     Human  aagaacaatgatgg----agatat------gt--gtgtgcaa-ttat-------ggaagca--gagacgt
B D                     Chimp  aagaacaatgatgg----agatat------gt--gtgtgcaa-ttat-------ggaagca--gagacgt
B D                   Gorilla  aagaacaatgatgg----agatat------gt--gtgtgcaa-ttat-------ggaagca--gagaagt
B D                 Orangutan  aagaacaatgatgg----agatat------gt--gtgtgcaa-ttat-------ggaagca--gagaagt
B D                    Gibbon  aagaacaatgatgg----agatac------gt--gtgtgcaa-ttat-------ggaagca--gagaagt
B D                    Rhesus  aagaacaatgatgg----agatgt------gt--gtgtgcaa-ttat-------ggcagca--gagaagt
B D       Crab-eating macaque  aagaacaatgatgg----agatgt------gt--gtgtgcaa-ttat-------ggcagca--gagaagt
B D                    Baboon  aagaacaatgatgg----agatgt------gt--gtgtgaaa-ttat-------ggcagca--gagaagt
B D                  Marmoset  -agaaaaatgattg----agatgt------gt--gtgtgcaa-ttac-------agaagca--gaga---
B D           Squirrel monkey  aagaacaatgactg----atatgt------gt--gtgtgcaa-ttat-------agaagca--gagaagt
B D                  Bushbaby  aaaaacaattattg----gtgtgc------ct--gtg--------at-------gggaaca--gatgagt
           Chinese tree shrew  gagagcagtgatgg----agatgt------gt--gtggacta-tcacctggccgtggagca--gggatgt
B D                  Squirrel  aagaataatgatgg----aactct------gt--gt-------------------ggag-a--gagaagt
       Lesser Egyptian jerboa  aagaacaatgatgg----agctgt------tt--ggaggc-a-ttgt-------ttg-g-a--aagaagt
                 Prairie vole  aagaacaaggatgg----agctat------at--ttatgc-a-tttt-------ggaag-a--cagaagt
B D           Chinese hamster  aagaaaaatgatgg----agctat------at--ttatgc-a-tttt-------gggag-a--cagaagt
               Golden hamster  aagaacaatgatgg----agctgt------at--ttatgc-a-tttt-------ggg-g-a--cagaagt
B D                     Mouse  aagaacaatgatgg----agctat------at--ttatg--a-tttt-------ggaag-a--cagaagc
B D                       Rat  aagatcgatgatgg----agcttt------gt--ctacgc-a-ttgt-------ggaaa-g--cagaagt
B D                    Rabbit  aagaaaaatggtgg----agatgttatgcatc--atagga-a-ttat-------ggagc-a--aagaaat
B D                      Pika  aagaacaatggtgg----cgatattaagcatt--atggga-a-ttag-------ggaac-a--aagaaat
B D                       Pig  a--aatgatgaagg----agatgt----------gtggac-a-ttgt-------gggagca--gagaagc
B D                    Alpaca  aagaacagtgatgg----tgatgc------gt--gtgggc-a-ttgt-------gggagca--gtaaagt
               Bactrian camel  aagaacagtgatgg----tgatgc------gt--gtgggc-t-ttgt-------gggagca--gtaaagt
B D                   Dolphin  aagaacaatgatgg----agatgt------gg--gtggac-a-ctgt-------gggaga----agtatg
                 Killer whale  aagaacaatgttgg----agatgt------gg--gtggac-a-ctgt-------gggaga----agtatg
             Tibetan antelope  aagaactacgatgg----agatgt------gt--gtggtc-a-tcgt-------gggagaa--gagaaga
B D                       Cow  aagaacaacgatgg----agatgt------gt--gtgggc-a-tcat-------gggagaa--gagaaga
B D                     Sheep  aagaactacgatgg----agatgt------gt--gtggtc-a-tcgt-------gggagaa--gagaaga
                Domestic goat  aagaactacgatgg----agatgt------gt--gtggtc-a-tcgt-------gggagaa--gagaaga
B D                     Horse  aagaacaacgatga----cgatgt------gt--gtgggc-a-ttgt-------gggagaa--gagaagt
B D          White rhinoceros  aagaacaatgatgg----agatgt------gt--gtgggc-a-ttgt-------gcgaaca--gagaagt
             Black flying-fox  aaaaacaatgatggagctagctgt------gt--gtgggc-a-ctgt-------gggatca--gagaagt
B D                   Megabat  aaaaacaatgatgg----agctgt------gt--gtgggc-a-ctgt-------gggatca--gagaagt
                Big brown bat  aaaaac--cggtgg----aagtgt------gt--gtgagc-a-ttgt-------ggtggca--gagaagt
         David's myotis (bat)  aaaaac--tggtgg----aaatgt------gcgagggggc-atttgt-------gggggca--gagaagt
B D                  Microbat  aaaaac--tgatgg----aaatgt------gtgagggggc-a-ttgt-------ggtggca--gagaagt
B D                  Hedgehog  aaaaacaatgatgg----agctat------at--gtggac-a-ctgt-------gggagaa--aagaagt
B D                     Shrew  aagagcaatggtgg----atttgt------gt--acagat-g-tcac-------aggaacatctgaaagt
              Star-nosed mole  aagggcaatgatag----agttga------at--gtgggc-a-ctga-------gggagtg---gagaag
B D                 Armadillo  -agagcaatgatgg----agatat------gt--ttggat-a-ttgt-------gacagca--gagaact
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Elephant  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                       Dog  ======================================================================
B D                   Manatee  ======================================================================
B D                     Panda  ======================================================================
B D                       Cat  ======================================================================
B D                   Ferret   ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
              Pacific walrus  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
                    Aardvark  ======================================================================
B D              Green monkey  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
B D                    Turkey  ======================================================================
  D              Mallard duck  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  -gtgagtgaatacctg--------------gtgatggaaccagtgaatgaatatgtcaacccagtttgga
                        Chimp  -gtgagtgaatacctg--------------gtgatggaaccagtgaatgaatatgtcaacccagtttgga
                      Gorilla  -gtgagtgaatacctg--------------gcgatggaaccagtgaatgaatatgtcaacccagtttgga
                    Orangutan  -gtgagtgaatacctg--------------gcgatggaaccagtgaatgaatatgtcaacccaatttgga
                       Gibbon  -gtgaatgaatacctg--------------gcgatggaaccagtgaatgaatatgtcaacccactttgga
                       Rhesus  -gtgaatgaatatctg--------------gcgatggaaccagtgaatgaatatgtcaagccagcttggg
          Crab-eating macaque  -gtgaatgaatatctg--------------gcgatggaaccagtgaatgaatatgtcaagccagcttggg
                       Baboon  -gtgaatgaatatctg--------------gcgatggaaccagtgaatgaatatgtcaaaccagcttggg
                     Marmoset  --------agtacctg--------------gcaacggaatcagtgaatgaatgtgtcaacccagccagga
              Squirrel monkey  -gtgaaggagtacctg--------------gcaatggaaccagtgaatgaatgtgtcagcccagctggga
                     Bushbaby  -acggatgagtacctg--------------gctatggacccagggaaagaatatgtaaatccaacttgga
           Chinese tree shrew  -gtggactatcacctg--------------gccgtggagtgagtaaatgactacatgaatccagcctgag
                     Squirrel  -gtgggtaaggacctg--------------gctgtggaactaaggaaggaatacttgaactcagctcagg
       Lesser Egyptian jerboa  -gtgggtgagta-ctt--------------tctatgagtccaatgaaggagtacttggaggctgctcaaa
                 Prairie vole  -atgagcaaaca-ttc--------------tctaagaattcaagaaatggattcttgaagctcaaccaga
              Chinese hamster  -ttgagtgagta-ttc--------------tctgtgaatccaagaactggattcttgaaggtcaaccaga
               Golden hamster  -ttgagtgggta-ttc--------------tctatgaatccaataactggattcttgaagctcaaccaga
                        Mouse  -atgagggctta-ttc--------------tc--tgaatccaaggaatggattcttgaagctcgacccca
                          Rat  -atgagtgtgta-ttc--------------tctatgaatccaaggagtggattcctgaagctcgaccaga
                       Rabbit  -gtggatgagttcttg--------------gctatggcaccattgaa-ggctgtgtaaaccaagcctggg
                         Pika  -gtggatgtgttcttg--------------gctatggcactgctgaatggctacgtaagccaagcctggg
                          Pig  -gtgagtgaatacctg--------------gccatgaaacaaacaaatgaatgtgtgaactcaacttggg
                       Alpaca  -atgggtgagtttctg--------------gctatggaacaaatgaatgaatatgtgaacccagcttggg
               Bactrian camel  -atcagtgagtttctg--------------gctatggaacaaatgaatgaatatgtgaacccagcttggg
                      Dolphin  -gttagtg----cctg--------------gctat-gcataacttagtgaatatgtgaagccagctcggt
                 Killer whale  -gttagtg----cctg--------------gctat-gcataaattagtgaatatgtgaagccagctcggt
             Tibetan antelope  -gtgagtaagaacctg--------------gctatggaacaaatgaatggatatgtgaacccaacttgag
                          Cow  -gtgagtgagaacctg--------------gctatagaacaaatgaatgaatatgtgaacccagcttgag
                        Sheep  -gtgagtgagaacctg--------------gctatggagcaaatgaatggatatgtgaacccaacttgag
                Domestic goat  -gtgagtgagaacctg--------------gctatggaacaaatgaatggatatgtaaacccaacttgag
                        Horse  -gtggatgtgtacctg--------------gctgtgggacaaaggaatgaatatgtgaacccagcttcgg
             White rhinoceros  -gtgggtgagcacctg--------------gctat-gaacgaatgaacga--atgtgaacccagctttgg
             Black flying-fox  -gtgggtgagtacctg--------------gctatgaaacaaa----tgaatatgtgaccccagcctggg
                      Megabat  -gtgggtgagtacctg--------------gctatgaaacaaa----tgaatatgtgaccccagcctggg
                Big brown bat  -gtgggtgaacacttgagtcagtgaacacggctatggaacaaatgagtgaatatgtgggcccagcttaga
         David's myotis (bat)  -gtgggtgaacacttgagtcagtgaacaccgctaaggaacaaatgaatgaatatgtggacccagcttagg
                     Microbat  -gtgggtgaacacttgagtcagtgaacacggctatggaacaaatgaatgaatttgtggacccagcttagg
                     Hedgehog  -acagctaagtgcctg--------------attatgg----agaaaagtaaaacataag-ccagctcggg
                        Shrew  -agaggtgggagcttg--------------actatgaaat-aataaat-------------cagattagg
              Star-nosed mole  -ttggctgagtacttg--------------gcgaggggatgaataaatgaatgtgtgag-ccagcttggg
                    Armadillo  ggtaattcagtacctg--------------gctgtggaacaaatgaacaaacttgtgaacccagtttgga
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                     Elephant  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                          Dog  ======================================================================
                      Manatee  ======================================================================
                        Panda  ======================================================================
                          Cat  ======================================================================
                      Ferret   ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Pacific walrus  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                     Aardvark  ======================================================================
                 Green monkey  ======================================================================
                      Wallaby  ======================================================================
                     Platypus  ======================================================================
                       Turkey  ======================================================================
                 Mallard duck  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
              Tasmanian devil  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================

                        Human  tgtttgtgaatg
                        Chimp  tgtttgtgaatg
                      Gorilla  tgtttgtgaatg
                    Orangutan  tgcttgtgaatg
                       Gibbon  tgtttgtgaatg
                       Rhesus  tgtttgtgaatg
          Crab-eating macaque  tgtttgtgaatg
                       Baboon  tgtttgtgaatg
                     Marmoset  tgttcatgaatg
              Squirrel monkey  tgttcatgaatg
                     Bushbaby  tatt-gggaatg
           Chinese tree shrew  agttcctaagag
                     Squirrel  tgctcatgaaca
       Lesser Egyptian jerboa  tcattctgaaca
                 Prairie vole  tctttgtgaaga
              Chinese hamster  tctttgtgaaga
               Golden hamster  tctttgtgaaga
                        Mouse  tgtttgtaaagt
                          Rat  tgtctgtgaggt
                       Rabbit  tgttcataaata
                         Pika  tgtttataaacg
                          Pig  tgtttgtaaaca
                       Alpaca  cgtttgtgagca
               Bactrian camel  cgtttgtgagca
                      Dolphin  tatttataaaca
                 Killer whale  tatttataaaca
             Tibetan antelope  agtttgtaaata
                          Cow  agtttgtaaata
                        Sheep  ggtttgtaaata
                Domestic goat  agtttgtaaata
                        Horse  tgtttgcgaaca
             White rhinoceros  tgttcttgaata
             Black flying-fox  tgtccatgaatg
                      Megabat  tgtccatgaatg
                Big brown bat  tgtccatgaatg
         David's myotis (bat)  tgtccatgaatg
                     Microbat  tgtccatg-acg
                     Hedgehog  tatgcctgtatg
                        Shrew  tgttcatgaatg
              Star-nosed mole  tggttgtgaaca
                    Armadillo  -gtccataaaca
                       Tenrec  ============
          Cape elephant shrew  ============
                     Elephant  ============
               Naked mole-rat  ============
                   Chinchilla  ============
                          Dog  ============
                      Manatee  ============
                        Panda  ============
                          Cat  ============
                      Ferret   ============
                   Guinea pig  ============
             Brush-tailed rat  ============
               Pacific walrus  ============
                 Weddell seal  ============
             Cape golden mole  ============
                     Aardvark  ============
                 Green monkey  ============
                      Wallaby  ============
                     Platypus  ============
                       Turkey  ============
                 Mallard duck  ============
                   Coelacanth  ============
                       Lizard  ============
               Painted turtle  ============
              Green seaturtle  ============
                      Chicken  ============
                      Opossum  ============
     Chinese softshell turtle  ============
           American alligator  ============
             Peregrine falcon  ============
                 Saker falcon  ============
              Tasmanian devil  ============
                   Budgerigar  ============
                  Rock pigeon  ============
           Tibetan ground jay  ============
                  Zebra finch  ============
          Medium ground finch  ============
       White-throated sparrow  ============
          Collared flycatcher  ============

Alignment block 18 of 751 in window, 79217586 - 79217612, 27 bps 
B D                     Human  gctt---------cttgagagtatcaagactgagtt
B D                     Chimp  gctt---------cttgaaagtatcaagactgagtt
B D                   Gorilla  gctt---------cttgagagtatcaagactgagtt
B D                 Orangutan  gctt---------cttgagagtatcaagactgagtt
B D                    Gibbon  gctt---------cttgagagtatcaagactgagtt
B D                    Rhesus  cctt---------cttgagagtatcaagactgagtt
B D       Crab-eating macaque  cctt---------cttgagagtatcaagactgagtt
B D                    Baboon  cctt---------ctttagagtatcaagactgagtt
B D                  Marmoset  gctt---------cttgagagaatcaagactaagtt
B D           Squirrel monkey  gctt---------cttgagagaatcaagactgagtt
B D                  Bushbaby  gctt---------ctgggaagtagcaataatgagtt
           Chinese tree shrew  gctc---------cttagaagtaacaatactgaaat
B D                  Squirrel  cttt---------cttggaagtaaccatactaagtc
       Lesser Egyptian jerboa  actt---------cttagaag---taatactaagcg
                 Prairie vole  gcct---------cttagaagattcaatgctgactg
B D           Chinese hamster  gact---------cttggaggaatcaatactgactg
               Golden hamster  gcct---------cttggaggaaccgatggtgactg
B D                     Mouse  gcttgaagaaacaattggaagaaacaatgctgactg
B D                       Rat  gctt---------ctcggaagaaacaatgccgaccg
B D                    Rabbit  ac-t---------cttgggagtaacaatactgagtt
B D                      Pika  actt---------cttggaagtaacaatactgagtt
B D                       Pig  gctt---------cttggaggtaataacactgaatt
B D                    Alpaca  gctt---------cttggaggtaataatactgagtt
               Bactrian camel  gctt---------cttggaggtaataatactgagtt
B D                   Dolphin  gctt---------cttggaggtactaatactgagtt
                 Killer whale  gctt---------cttggaggtactaatactga-tt
             Tibetan antelope  gctt---------cttggaggtactaatactgagtt
B D                       Cow  gctt---------cttggaggtgctaatactgagtt
B D                     Sheep  gctt---------cctggaggtactaatactgagtt
                Domestic goat  gctt---------cttggaggtattaatactgagtt
B D                     Horse  ggtt---------cttggaggtaatagtaccaagtc
B D          White rhinoceros  gcta---------cttggaggtaatagtgctgagtt
             Black flying-fox  gctt---------cttggcggtagtagtactgaatt
B D                   Megabat  gctt---------cttggcagtagtagtactgaatt
                Big brown bat  gctt---------cttggagttaatagcattgaatt
         David's myotis (bat)  gctt---------cttggaggtaacagcattgaatt
B D                  Microbat  gctt---------cttggaggtaatagcattgaatt
B D                  Hedgehog  gatt---------cttagcaataatgat-atgagtt
B D                     Shrew  attt---------cttagaggtaata---atga-tt
              Star-nosed mole  gctt---------cttggaggtaata---atgagtt
                     Aardvark  gctc---------cccagaagtggcaatactgaatt
B D                 Armadillo  gctt---------cttggaggtaaaaatattgagtt
B D                    Tenrec  ====================================
         Cape elephant shrew  ====================================
B D                  Elephant  ====================================
B D            Naked mole-rat  ====================================
                  Chinchilla  ====================================
B D                       Dog  ====================================
B D                   Manatee  ====================================
B D                     Panda  ====================================
B D                       Cat  ====================================
B D                   Ferret   ====================================
B D                Guinea pig  ====================================
            Brush-tailed rat  ====================================
              Pacific walrus  ====================================
                Weddell seal  ====================================
            Cape golden mole  ====================================
B D              Green monkey  ====================================
B D                   Wallaby  ====================================
B D                  Platypus  ====================================
B D                    Turkey  ====================================
  D              Mallard duck  ====================================
B D                Coelacanth  ====================================
B D                    Lizard  ====================================
  D            Painted turtle  ====================================
  D           Green seaturtle  ====================================
B D                   Chicken  ====================================
B D                   Opossum  ====================================
  D  Chinese softshell turtle  ====================================
B D        American alligator  ====================================
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
B D           Tasmanian devil  ====================================
B D                Budgerigar  ====================================
  D               Rock pigeon  ====================================
          Tibetan ground jay  ====================================
B D               Zebra finch  ====================================
B D       Medium ground finch  ====================================
  D    White-throated sparrow  ====================================
  D       Collared flycatcher  ====================================

Alignment block 19 of 751 in window, 79217613 - 79217656, 44 bps 
B D                     Human  aatatttaaatgcatcagaggttattgtttatctcgtt--c----tttaa
B D                     Chimp  aatatttaaatgcatcagaggttattgtttatctcgtt--c----tttaa
B D                   Gorilla  aatatttaaatgcatcagaggttattgtttatctcgtt--c----tttaa
B D                 Orangutan  aatatttaaatgcatcagaggttattgtttatcttgtt--c----ttttt
B D                    Gibbon  aatacttaaatgcatcagaggttattgtttatctcgtt--c----tttta
B D                    Rhesus  attatttaaatgcatcagagggtattgttcatctcctc--c----tgttt
B D       Crab-eating macaque  attatttaaatgcatcagagggtattgttcatctcctc--c----tgttt
B D                    Baboon  gttatttaaatgcatcagagggtattgtttatctcctc--c----tgttt
B D                  Marmoset  aatacttacatgcatcagagggtattgtttatcttgtc--c----cttct
B D           Squirrel monkey  aatacttatatgcatcagagggtattgtttatcttgtc--c----tttct
B D                  Bushbaby  catatttaaatgacttggacagtattgcttttcatgtc--c----ctttt
           Chinese tree shrew  aatatataaatgccttggtcagtgttgcttatattatc--c----ttttc
B D                  Squirrel  aatattcaaatgtc-caaagggctctacttatcttgtc--c----ttctc
       Lesser Egyptian jerboa  --------aataactcagagaatattgcttatcttgat--c----tttgc
                 Prairie vole  aatacttcaatgccttagagggtattgctcaccttgtt--c----ttttg
B D           Chinese hamster  aatatttaaatatatcaga-ggtgttgcttttcttgct--c----ttttt
               Golden hamster  aatatgtaaatgccttagagggcattcctttccttgct--ct---ttttt
B D                     Mouse  agattgtaaatgcctcaaagggtactgcttaccttgtt--c----catct
B D                       Rat  aacgtttaaatgc----------actgcttaccttgtt--c----ttctt
B D                    Rabbit  aatatttatgtgcctcagagggtattgtttatcttatc--c----ttttc
B D                      Pika  aatatttatatgtctcagagggtattgcttatcttttc--a----ttttc
B D                       Pig  aacatttaaatgcctggga-ggtattg-tcatcgagtc--t----gtttc
B D                    Alpaca  agtatttaaatgccttgca-agcattgctcatctggtcttt----ttttc
               Bactrian camel  agtatttaaatgccttgca-agcattgctcatctggtcttt----ttttc
B D                   Dolphin  aatatttcaatgccttggg-ggtattggtcatctggtc--c----tcttc
                 Killer whale  aatatttcagtgccttggg-ggtattgctcctctggtc--c----tcttc
             Tibetan antelope  aacatttaaatgccttggg-ggtattgctcacttggtc--c----tcttc
B D                       Cow  aacatttaaatgccttgcg-ggtattgctcacttggtc--c----tcttc
B D                     Sheep  aacatttaaatgccttggg-ggtattgctcacttggtc--c----tcttc
                Domestic goat  aacatttaaatgccttgag-ggtattgctcacttggtc--c----tcttc
B D                     Horse  actatttaaatgccttgaggagtattgctcatctggtc--c----ttttc
B D          White rhinoceros  catatttaaatgccgtggggtggattgctcatctggtc--c----ttttc
B D                       Cat  aacatttaca---cctgggtcagat--attatgtactg--t----ttttt
             Black flying-fox  aatatttgaatgctttgggaggtattgctcatctggtc--c----ttttc
B D                   Megabat  aatatttgaatgctttgggaggtattgctcatctggtc--c----ttttc
                Big brown bat  catattt--atgccttgggaggaactgctcatctagtc--ccttattttc
         David's myotis (bat)  catattt--acgccttgggaggaattgctcatctcgtc--cattattttc
B D                  Microbat  catattt--atgccttgggaggaattgctcatctcatc--cattattttc
B D                  Hedgehog  aaaattcatatgttttgaagg-----gatcatctgatt--c----tttac
B D                     Shrew  aa------------ttggaagattttgttcatctggtt--c----ttttc
              Star-nosed mole  aatactcacataccttggaggaaattgctcatctggct--c----ttttc
                     Aardvark  aatttttaaatgcctcagaaggtatcattcatctggtc--c----ttttc
B D                 Armadillo  aa-ttttaaatgcctcaaagagtatt-ctcttctggtc--c----ttttc
B D                    Tenrec  ==================================================
         Cape elephant shrew  ==================================================
B D                  Elephant  ==================================================
B D            Naked mole-rat  ==================================================
                  Chinchilla  ==================================================
B D                       Dog  ==================================================
B D                   Manatee  ==================================================
B D                     Panda  ==================================================
B D                   Ferret   ==================================================
B D                Guinea pig  ==================================================
            Brush-tailed rat  ==================================================
              Pacific walrus  ==================================================
                Weddell seal  ==================================================
            Cape golden mole  ==================================================
B D              Green monkey  ==================================================
B D                   Wallaby  ==================================================
B D                  Platypus  ==================================================
B D                    Turkey  ==================================================
  D              Mallard duck  ==================================================
B D                Coelacanth  ==================================================
B D                    Lizard  ==================================================
  D            Painted turtle  ==================================================
  D           Green seaturtle  ==================================================
B D                   Chicken  ==================================================
B D                   Opossum  ==================================================
  D  Chinese softshell turtle  ==================================================
B D        American alligator  ==================================================
  D          Peregrine falcon  ==================================================
  D              Saker falcon  ==================================================
B D           Tasmanian devil  ==================================================
B D                Budgerigar  ==================================================
  D               Rock pigeon  ==================================================
          Tibetan ground jay  ==================================================
B D               Zebra finch  ==================================================
B D       Medium ground finch  ==================================================
  D    White-throated sparrow  ==================================================
  D       Collared flycatcher  ==================================================

Inserts between block 19 and 20 in window
B D                      Cat 4bp

Alignment block 20 of 751 in window, 79217657 - 79217676, 20 bps 
B D                     Human  caaaaga--------------ct------gaataatt-ctg
B D                     Chimp  caaaaga--------------ct------gaataatt-ctg
B D                   Gorilla  cgaaaga--------------ct------gaataatt-cta
B D                 Orangutan  caaaaga--------------ct------gaataatt-cta
B D                    Gibbon  caaaaga--------------ct------gaataatt-cta
B D                    Rhesus  caaaaga--------------ct------gaagaatt-cta
B D       Crab-eating macaque  caaaaga--------------ct------gaagaatt-cta
B D                    Baboon  caaaaga--------------ct------gaagaatt-cta
B D                  Marmoset  caaaaga--------------ca------gaataatt-cta
B D           Squirrel monkey  caaaaga--------------ct------gaataatt-cta
B D                  Bushbaby  caaaaca--------------gt------gaaaaatt-cta
           Chinese tree shrew  caaaaga--------------ct------gaaaaatg-tta
B D                  Squirrel  caaaaca--------------ct------gaaaaatt-cta
       Lesser Egyptian jerboa  caaaaca--------------ct------aaaaaatt-ttc
                 Prairie vole  gggagga--------------ct------gaaaattt-gtg
B D           Chinese hamster  gaaagga--------------ct------gaaaaatt-ctg
               Golden hamster  gaaagga--------------ct------gaaaaatt-cta
B D                     Mouse  caaatga--------------ct------gaaaaatt-cta
B D                       Rat  caaatga--------------ct------t----ttt-cga
B D                    Rabbit  caaaaga--------------ct------gaaaagct-cta
B D                      Pika  caaaata--------------tt-aaaaaaaaaagct-tta
B D                       Pig  caaaaga--------------ct------gaaaaa-t-caa
B D                    Alpaca  caaaaga--------------ct------gaaaaatt-cta
               Bactrian camel  tgaaaga--------------ct------gaaaaatt-cta
B D                   Dolphin  caaaaga--------------ct------gaaaaatt-caa
                 Killer whale  caaaaga--------------ct------gaaaaatt-caa
             Tibetan antelope  caaaaga--------------ct------gaaatttt-taa
B D                       Cow  cgaaaga--------------ct------gaaatttt-tta
B D                     Sheep  caaaaga--------------ct------gaaatttt-taa
                Domestic goat  caaaaga--------------ct------gaaatttt-taa
B D                     Horse  caaaaga--------------ct------gaaaaatt-taa
B D          White rhinoceros  caaaaga--------------ct------g--gaact-caa
B D                       Cat  caaaaga--------------ct------aaaatatt-caa
B D                       Dog  caaaaaa--------------ct------aaaacatt-cca
B D                   Ferret   caaaaga--------------tt------aaaacatt-caa
B D                     Panda  cgaaaga--------------ct------aaaatatt-caa
               Pacific walrus  caaaaga--------------ct------aaaacagt-caa
             Black flying-fox  caaatga--------------ct------gaaaagtt-caa
B D                   Megabat  caaatga--------------ct------gaaaagtt-caa
                Big brown bat  caaaaga--------------ct------gaaaatttgtaa
         David's myotis (bat)  caaaaga--------------ct------gaaaatttgtaa
B D                  Microbat  caaaaga--------------ct------gaaaatttgtaa
B D                  Hedgehog  caaaaga--------------ct------aaaatttt-caa
B D                     Shrew  caagtgatttcattcatctggctcttttccaaaaatt-caa
              Star-nosed mole  taataga-----------tgaat------aaaaaaat-caa
                     Aardvark  caaaaga--------------ct------gaaaaatt-caa
B D                 Armadillo  caaaagg--------------ca------ggaatatt-caa
B D                    Tenrec  =========================================
         Cape elephant shrew  =========================================
B D                  Elephant  =========================================
B D            Naked mole-rat  =========================================
                  Chinchilla  =========================================
B D                   Manatee  =========================================
B D                Guinea pig  =========================================
            Brush-tailed rat  =========================================
                Weddell seal  =========================================
            Cape golden mole  =========================================
B D              Green monkey  =========================================
B D                   Wallaby  =========================================
B D                  Platypus  =========================================
B D                    Turkey  =========================================
  D              Mallard duck  =========================================
B D                Coelacanth  =========================================
B D                    Lizard  =========================================
  D            Painted turtle  =========================================
  D           Green seaturtle  =========================================
B D                   Chicken  =========================================
B D                   Opossum  =========================================
  D  Chinese softshell turtle  =========================================
B D        American alligator  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
B D           Tasmanian devil  =========================================
B D                Budgerigar  =========================================
  D               Rock pigeon  =========================================
          Tibetan ground jay  =========================================
B D               Zebra finch  =========================================
B D       Medium ground finch  =========================================
  D    White-throated sparrow  =========================================
  D       Collared flycatcher  =========================================

Inserts between block 20 and 21 in window
B D                     Pika 357bp

Alignment block 21 of 751 in window, 79217677 - 79217704, 28 bps 
B D                     Human  attagttgtacat-aaaaag-ggcc-----aaaga
B D                     Chimp  attagttgtacgt-aaaaag-ggcc-----aaaga
B D                   Gorilla  attggctgtaagt-aaaaag-ggcc-----aaaga
B D                 Orangutan  attagttgtaagt-gaaaag-ggcc-----aaaga
B D                    Gibbon  attagttttaagt-gcaaag-ggcc-----aaaga
B D                    Rhesus  attagttttaagt-gaaaat-ggcc-----aaaga
B D       Crab-eating macaque  attagttttaagt-gaaaat-ggcc-----aaaga
B D                    Baboon  attagttttaact-gaaaac-ggcc-----aaaga
B D                  Marmoset  attagttttaagt-gaaaag-ggcc-----aaaga
B D           Squirrel monkey  attagttttaagt-gaaaag-ggcc-----aaaga
B D                  Bushbaby  attagtttcaaat-gaaaag-tacc-----a---a
           Chinese tree shrew  catagttttaaat-gaaaag-tgcc-----aaaga
B D                  Squirrel  attaattttattttaaaata-tccca---------
       Lesser Egyptian jerboa  attaatttcaagt--ggaag-gggc----------
                 Prairie vole  gtcaattataagc-aagatg-tgtc----------
B D           Chinese hamster  gttaattttaattaaaaaaa-tgtc----------
               Golden hamster  gttaattataagt-aaaaag-tgtc----------
B D                     Mouse  attaattttcagt--aaaaa-t-------------
B D                       Rat  attaattttcaataaaaaaa-t-------------
B D                    Rabbit  ----atcttaagt-ggaaag-cgccaaaga-----
B D                       Pig  attaattttaagt-gaaaag-tgcc-----aaaga
B D                    Alpaca  aataattatgagt-gaaaag-tgcc-----aaaga
               Bactrian camel  aataattataagt-gaaaag-tgcc-----aaaga
B D                   Dolphin  attaattttaagt-gaaaag-tgcc-----aaaga
                 Killer whale  attaattttaagt-gaaaag-tgcc-----aaaga
             Tibetan antelope  attaattttaagt-gaaaag-tacc-----aaaga
B D                       Cow  attaattttaagt-gaaaag-tacc-----aaaga
B D                     Sheep  attaattttaagt-gaaaag-tacc-----aaaga
                Domestic goat  attaattttaagt-gaaaag-taac-----aaaga
B D                     Horse  attaattttaagt-gaaaag-tgcc-----aaaga
B D          White rhinoceros  actaattttgagt-gaaaag-tgcc-----aaaga
B D                       Cat  actaatgtcaggt-gaaaag-tgcc-----aaaga
B D                       Dog  a-aaatttcaagt-gaaaag-tgac-----aaaga
B D                   Ferret   attaatttcaagt-gaaaag-tgcc-----aaaga
B D                     Panda  attaatttcaagt-gaaaag-tgcc-----aaaca
               Pacific walrus  attaatttcaagt-gaaaag-cacc-----aaaga
             Black flying-fox  attaattttaagt-gaaaag-tacc-----a---a
B D                   Megabat  attaattttaagt-gaaaag-tatc-----a---a
                Big brown bat  attaatttcaact-gaaaag-tacc-----aaaga
         David's myotis (bat)  attaatttcaagt-gaaaag-tacc-----aaaga
B D                  Microbat  attaattttaagt-gaaaag-tacc-----aaaga
B D                  Hedgehog  attaattttaagt-gaaaa--tgtc-----aaaga
B D                     Shrew  aataattttaagt-gaaagattttt-----ggaaa
              Star-nosed mole  attaatttgaagt-aaaaagtgccc-----caaaa
                     Aardvark  attaattgcatga-gaaaag-aacc-----aagga
B D                 Armadillo  gtaaatttcagtt-gaaaca-tacg-----aagga
B D                    Tenrec  ===================================
         Cape elephant shrew  ===================================
B D                      Pika  ===================================
B D                  Elephant  ===================================
B D            Naked mole-rat  ===================================
                  Chinchilla  ===================================
B D                   Manatee  ===================================
B D                Guinea pig  ===================================
            Brush-tailed rat  ===================================
                Weddell seal  ===================================
            Cape golden mole  ===================================
B D              Green monkey  ===================================
B D                   Wallaby  ===================================
B D                  Platypus  ===================================
B D                    Turkey  ===================================
  D              Mallard duck  ===================================
B D                Coelacanth  ===================================
B D                    Lizard  ===================================
  D            Painted turtle  ===================================
  D           Green seaturtle  ===================================
B D                   Chicken  ===================================
B D                   Opossum  ===================================
  D  Chinese softshell turtle  ===================================
B D        American alligator  ===================================
  D          Peregrine falcon  ===================================
  D              Saker falcon  ===================================
B D           Tasmanian devil  ===================================
B D                Budgerigar  ===================================
  D               Rock pigeon  ===================================
          Tibetan ground jay  ===================================
B D               Zebra finch  ===================================
B D       Medium ground finch  ===================================
  D    White-throated sparrow  ===================================
  D       Collared flycatcher  ===================================

Inserts between block 21 and 22 in window
          Chinese tree shrew 538bp
B D                 Squirrel 3bp
B D                   Rabbit 79bp
B D                    Shrew 21bp

Alignment block 22 of 751 in window, 79217705 - 79217713, 9 bps 
B D                     Human  agatcacaa
B D                     Chimp  agatcacaa
B D                   Gorilla  agatcacaa
B D                 Orangutan  agatcgcaa
B D                    Gibbon  agatcacaa
B D                    Rhesus  agatcagca
B D       Crab-eating macaque  agatcagca
B D                    Baboon  agatcagca
B D                  Marmoset  agatcacca
B D           Squirrel monkey  agatcacca
B D                  Bushbaby  agatcatca
B D                  Squirrel  atatcatca
       Lesser Egyptian jerboa  agatcac--
                 Prairie vole  agatcacta
B D           Chinese hamster  agatcactg
               Golden hamster  agatcacta
B D                    Rabbit  aagttacca
B D                       Pig  agatcactg
B D                    Alpaca  agatcacta
               Bactrian camel  agatcacta
B D                   Dolphin  agatcacta
                 Killer whale  agatcacta
             Tibetan antelope  agatcacta
B D                       Cow  agatcacta
B D                     Sheep  agatcacta
                Domestic goat  agatcacta
B D                     Horse  agatcactc
B D          White rhinoceros  agatcacta
B D                       Cat  agagcacta
B D                       Dog  agatcacta
B D                   Ferret   aaatcacta
B D                     Panda  aaatcacta
               Pacific walrus  agatcacca
             Black flying-fox  agatcatta
B D                   Megabat  agatcatta
                Big brown bat  agataacta
         David's myotis (bat)  agataagta
B D                  Microbat  agataacta
B D                  Hedgehog  aaatcacta
B D                     Shrew  aaatcacta
              Star-nosed mole  agatcacta
                     Aardvark  agcccattg
B D                 Armadillo  agatcacta
B D                       Rat  ---------
B D                    Tenrec  =========
         Cape elephant shrew  =========
B D                      Pika  =========
B D                  Elephant  =========
B D                     Mouse  ---------
B D            Naked mole-rat  =========
                  Chinchilla  =========
          Chinese tree shrew  =========
B D                   Manatee  =========
B D                Guinea pig  =========
            Brush-tailed rat  =========
                Weddell seal  =========
            Cape golden mole  =========
B D              Green monkey  =========
B D                   Wallaby  =========
B D                  Platypus  =========
B D                    Turkey  =========
  D              Mallard duck  =========
B D                Coelacanth  =========
B D                    Lizard  =========
  D            Painted turtle  =========
  D           Green seaturtle  =========
B D                   Chicken  =========
B D                   Opossum  =========
  D  Chinese softshell turtle  =========
B D        American alligator  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
B D           Tasmanian devil  =========
B D                Budgerigar  =========
  D               Rock pigeon  =========
          Tibetan ground jay  =========
B D               Zebra finch  =========
B D       Medium ground finch  =========
  D    White-throated sparrow  =========
  D       Collared flycatcher  =========

Alignment block 23 of 751 in window, 79217714 - 79217715, 2 bps 
B D                     Human  ac
B D                     Chimp  ac
B D                   Gorilla  ac
B D                 Orangutan  ac
B D                    Gibbon  ac
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  ac
B D                  Marmoset  ac
B D           Squirrel monkey  ac
B D                  Bushbaby  ag
B D                  Squirrel  ag
                 Prairie vole  ag
B D           Chinese hamster  ag
               Golden hamster  ag
B D                       Pig  ag
B D                    Alpaca  cg
               Bactrian camel  ca
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  ag
B D                   Ferret   ag
B D                     Panda  ag
               Pacific walrus  ag
             Black flying-fox  gg
B D                   Megabat  gg
                Big brown bat  gg
         David's myotis (bat)  gg
B D                  Microbat  gg
B D                  Hedgehog  ag
B D                     Shrew  aa
              Star-nosed mole  ag
                     Aardvark  ag
B D                 Armadillo  ag
B D                       Rat  --
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                      Pika  ==
      Lesser Egyptian jerboa  --
B D                    Rabbit  --
B D                  Elephant  ==
B D                     Mouse  --
B D            Naked mole-rat  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
B D                   Manatee  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
                Weddell seal  ==
            Cape golden mole  ==
B D              Green monkey  ==
B D                   Wallaby  ==
B D                  Platypus  ==
B D                    Turkey  ==
  D              Mallard duck  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Chicken  ==
B D                   Opossum  ==
  D  Chinese softshell turtle  ==
B D        American alligator  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==

Alignment block 24 of 751 in window, 79217716 - 79217753, 38 bps 
B D                     Human  ctat----tcc-cttc-tct-----------------aaatgaaatcatctgtt----------------
B D                     Chimp  ctat----tcc-cttc-tct-----------------aaatgaaatcatctgtt----------------
B D                   Gorilla  ctat----tcc-cttc-tct-----------------aaatgaaatcatctgtt----------------
B D                 Orangutan  ctat----tcc-cttc-tct-----------------aaatgaaattatctatt----------------
B D                    Gibbon  ctat----tcc-cttc-tct-----------------aaatgaaattatctgtt----------------
B D                    Rhesus  ctat----tcc-cttc-tct-----------------aaatgaaagtatctgtt----------------
B D       Crab-eating macaque  ctat----tcc-cttc-tct-----------------aaatgaaagtatctgtt----------------
B D                    Baboon  ctat----tcc-cttc-tct-----------------aaatgaaagtatctgtt----------------
B D                  Marmoset  ctat----tcc-cttc-tct-----------------aaatgaaattatctgtt----------------
B D           Squirrel monkey  ctat----tcc-cttc-tct-----------------aagtgaaattatctgtt----------------
B D                  Bushbaby  ttat----tct-gttt-cct-----------------ccatgaatttatcgatt----------------
           Chinese tree shrew  ctat----tccttttt-tct-----------------aaatgaacttacctgtc----------------
B D                  Squirrel  ctat----tcc-cttc-ttc-----------------taatgatattatttatc----------------
       Lesser Egyptian jerboa  -tat----tcc-cttc-cct-----------------aaatgaaaatatctatc----------------
                 Prairie vole  ctat----ccc-tttt-gat-----------------aaatgaaattatctgtc----------------
B D           Chinese hamster  ctct----ccc-tttc-gat-----------------aaatgagtctatctgtt----------------
               Golden hamster  ccat----cccttttc-act-----------------aaacgaatgtatctgtt----------------
B D                     Mouse  -tat----cct-tttc-tct-----------------aagtggaattatctgtc----------------
B D                       Rat  -tat----ctc-tttc-tca-----------------aagtgaaattatctgtc----------------
B D                    Rabbit  --------tcc-tctg-gtttactgcccaaatgccagcactgggggaatttgccagcactgaacctcacc
B D                      Pika  --ac----cca-tcct-gtt-----------------caataagataatctgtc----------------
B D                       Pig  ctat----tcc-ctcc-ct-------------------aatgaaattatctgtc----------------
B D                    Alpaca  ctat----tcc-ctcc-tct-----------------aaatgaaattatctgtc----------------
               Bactrian camel  caat----tcc-ctcc-tct-----------------aaatgaaattatctgtc----------------
B D                   Dolphin  ctat----tcc-attc-tct-----------------aaatgaaattacctgtc----------------
                 Killer whale  ctat----tcc-attc-tct-----------------aaatgaaattacctgtc----------------
             Tibetan antelope  ctat----tcc-cttc-tct-----------------aaattaaattatctgtc----------------
B D                       Cow  ctat----tcc-cttc-tct-----------------aaatgaaattatctgtc----------------
B D                     Sheep  ctat----tcc-cttc-tct-----------------aaatgaaattatctgtc----------------
                Domestic goat  ctat----tcc-cttc-act-----------------aaatgaaattatttgtc----------------
B D                     Horse  ctct----tcc-cttcttct-----------------aaatgaaattatctgtc----------------
B D          White rhinoceros  ctct----tcc-cttc-tct-----------------aaatgaaattatctgtc----------------
B D                       Cat  ccat----tct-gttc-gct-----------------aaatgaaattatctgtc----------------
B D                       Dog  ccat----tcc-actc-tct----------------------aaatcacctgtc----------------
B D                   Ferret   ccat----tcc-agtc-tct----------------------aaattatctgtc----------------
B D                     Panda  ccat----tcc-attt-tct----------------------aaattatctgtc----------------
               Pacific walrus  ccat----tcc-gttc-tct----------------------aaattgtctgtc----------------
             Black flying-fox  cta-----ttt-cttc-ttt-----------------aaatgcaattatctgtc----------------
B D                   Megabat  cta-----ttt-cttc-ctt-----------------aaatgcaattatctgtc----------------
                Big brown bat  ctat----ttt-cttc-tct-----------------aattgaaattacctgtt----------------
         David's myotis (bat)  ctat----ttt-cttc-tct-----------------aatttaaattacctgtt----------------
B D                  Microbat  ctat----ttt-cttc-tct-----------------aatttaaattacctgtt----------------
B D                  Hedgehog  ctat----tca-tttc-tct-----------------aaatgagactgtctatt----------------
B D                     Shrew  --------tga-cttc-ttc-----------------aaacaaaattatctact----------------
              Star-nosed mole  ctgtgtattcc-cttc-tat-----------------aaatgaaattatctgtc----------------
                     Aardvark  ctat----tct-cct--tct-----------------aattgaagttatctttc----------------
B D                 Armadillo  caaa----gcc-cctc-tct-----------------aaatgaaattatctgtc----------------
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Elephant  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                   Manatee  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
                Weddell seal  ======================================================================
            Cape golden mole  ======================================================================
B D              Green monkey  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
B D                    Turkey  ======================================================================
  D              Mallard duck  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
                 Prairie vole  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
                       Rabbit  aaaactgggagccaagaactcagtacaagtctccccaaaggatggcaggcacccaactacttgagctctc
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                       Alpaca  ----------------------------------------------------------------------
               Bactrian camel  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                     Microbat  ----------------------------------------------------------------------
                     Hedgehog  ----------------------------------------------------------------------
                        Shrew  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
                    Armadillo  ----------------------------------------------------------------------
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                     Elephant  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                      Manatee  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                 Weddell seal  ======================================================================
             Cape golden mole  ======================================================================
                 Green monkey  ======================================================================
                      Wallaby  ======================================================================
                     Platypus  ======================================================================
                       Turkey  ======================================================================
                 Mallard duck  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
              Tasmanian devil  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================

                        Human  -------cattcac
                        Chimp  -------cattcac
                      Gorilla  -------cattcac
                    Orangutan  -------caatcac
                       Gibbon  -------cattcac
                       Rhesus  -------cattcac
          Crab-eating macaque  -------cattcac
                       Baboon  -------cattcac
                     Marmoset  -------cattcag
              Squirrel monkey  -------ggttcag
                     Bushbaby  -------cactcag
           Chinese tree shrew  -------ccttcag
                     Squirrel  -------ccctcag
       Lesser Egyptian jerboa  -------catttag
                 Prairie vole  -------tacttag
              Chinese hamster  -------aacttag
               Golden hamster  -------cacttag
                        Mouse  -------cacttaa
                          Rat  -------cacttac
                       Rabbit  accactgctctcag
                         Pika  -------cactcag
                          Pig  -------cactcag
                       Alpaca  -------cattcag
               Bactrian camel  -------cattcag
                      Dolphin  -------cactcag
                 Killer whale  -------cactcag
             Tibetan antelope  -------cattcag
                          Cow  -------cattcag
                        Sheep  -------cattcag
                Domestic goat  -------cattcag
                        Horse  -------cactcag
             White rhinoceros  -------cactcag
                          Cat  -------cacttag
                          Dog  -------cactcag
                      Ferret   -------tactcag
                        Panda  -------cactcaa
               Pacific walrus  -------cacttag
             Black flying-fox  -------cactcag
                      Megabat  -------cactcag
                Big brown bat  -------caatcag
         David's myotis (bat)  -------caatcac
                     Microbat  -------caatcac
                     Hedgehog  -------cag----
                        Shrew  -------cac----
              Star-nosed mole  -------cac----
                     Aardvark  -------tactcag
                    Armadillo  -------catgcag
                       Tenrec  ==============
          Cape elephant shrew  ==============
                     Elephant  ==============
               Naked mole-rat  ==============
                   Chinchilla  ==============
                      Manatee  ==============
                   Guinea pig  ==============
             Brush-tailed rat  ==============
                 Weddell seal  ==============
             Cape golden mole  ==============
                 Green monkey  ==============
                      Wallaby  ==============
                     Platypus  ==============
                       Turkey  ==============
                 Mallard duck  ==============
                   Coelacanth  ==============
                       Lizard  ==============
               Painted turtle  ==============
              Green seaturtle  ==============
                      Chicken  ==============
                      Opossum  ==============
     Chinese softshell turtle  ==============
           American alligator  ==============
             Peregrine falcon  ==============
                 Saker falcon  ==============
              Tasmanian devil  ==============
                   Budgerigar  ==============
                  Rock pigeon  ==============
           Tibetan ground jay  ==============
                  Zebra finch  ==============
          Medium ground finch  ==============
       White-throated sparrow  ==============
          Collared flycatcher  ==============

Inserts between block 24 and 25 in window
B D                   Rabbit 136bp

Alignment block 25 of 751 in window, 79217754 - 79217794, 41 bps 
B D                     Human  ccaggtcaccaaggcacattgcctcaaggaatttaagttgg
B D                     Chimp  ccaggttaccaaggcacattgcctcaaggaatttaagttgg
B D                   Gorilla  ccaggtcaccaaggcacattgcctcaaggaatttaagttgg
B D                 Orangutan  ccaggtcaccaaggcacatttcctcaaggaatttaagttgg
B D                    Gibbon  acaggtcaccaaggcacattgcctcaaggaatttaagttgg
B D                    Rhesus  ccagat----aaggcacattgcctcaaggaatttaggttgg
B D       Crab-eating macaque  ccagat----aaggcacattgcctcaaggaatttaggttgg
B D                    Baboon  ccagat----aaggcacattgcctcaaggaatttaggttgg
B D                  Marmoset  ccaggtcaccaaggtatattgcctcgaggaatttaggttgg
B D           Squirrel monkey  ccaggtcaccaatgtacattgcctggaggaatttaggttgg
B D                  Bushbaby  ccaggttgctatagtgc-----------tattttaagttgg
           Chinese tree shrew  ccaggtcagaaagctgtaatgtctcaaggactttaagtgag
B D                  Squirrel  ccaggtgacaaaattgcattgtctcaaggaatttaggttgg
       Lesser Egyptian jerboa  gcagatcagaaagatgcattgtctcaaagaatttgggctga
                 Prairie vole  ccagcccacaaaggtgtattgtctcaaggagtttaggttgg
B D           Chinese hamster  ccagaccacaaaggtgtattgtctcaaggagtttagattgg
               Golden hamster  ccagaccacaaaggtatattgtctcaaggagtttaggttgg
B D                     Mouse  ccagaccacaaagg--tattgtctcaaggagtataggctgg
B D                       Rat  ccagaccacaaagg--cattgtctccagg---ataagctgg
B D                    Rabbit  ccagctcacaaaggtgcattgtctcaaggaatttattttgg
B D                      Pika  ccaagtcacaaaggcacattgtcccaaggaattga------
B D                       Pig  ccaggtcacgagggtatattgtctcaaggaacttaagtagg
B D                    Alpaca  ccaggtcacaaatgtgcattgtctcaaggaatttaggttgg
               Bactrian camel  ccaggtcacaaatgtgcattgtctcaaggaatttaggttgg
B D                   Dolphin  ccaggtcacaaaggcacattgtctcaaagaatttaggttgg
                 Killer whale  ccaggtcacaaaggcacattgtctcaaagaatttaggttgg
             Tibetan antelope  ccaggtcacaaaagtg-attacctggaggaatttaggttgg
B D                       Cow  ccaggtcacaaaagtgcattacctgaaggaatttaggttgg
B D                     Sheep  ccaggtcacaaaagtg-attacctgaaggaatttaggctgg
                Domestic goat  ccaggtcataaaagtg-attacctgaaggaatttaggttgg
B D                     Horse  ccagg------------attgtctcaaggaatttaggttcg
B D          White rhinoceros  ccaggtcacaaaagtgcattgcctcaaggaatttaggttgg
B D                       Cat  ccaagtcagaaaggtgca-tgtctcaaaggatttagtttgg
B D                       Dog  ccaggtcacaaaggtact-tgtctcaagggatttagattga
B D                   Ferret   ccagctcacaaaggtgta-tgcctcaagggatttaggttgg
B D                     Panda  ccaggtcacaaaagtgca-tgtctcaagggatttagattag
               Pacific walrus  ccaggtcacaaaggtgca-tgtctcaagggatttaggttgg
             Black flying-fox  ccaggtcacaaaggtacattgtcttaagtgatttaggttga
B D                   Megabat  ccaggtcacaaaggtacattgtcttaagtgatttaggttga
                Big brown bat  acaggccatgaaggtgtacggattcaagtga-tcaagatga
         David's myotis (bat)  acaggcccc-aaagtgtatggatataagtga-tcaagatga
B D                  Microbat  acaggcccc-aaagtgtatggagtcaagtga-tcaagatga
B D                  Hedgehog  cc---------aggcacatagtttc----aatttaaggtag
B D                     Shrew  -caagtagcaaaggcacattatcttgagcaagttaggctag
              Star-nosed mole  acagggcacaaaggtacatcgtctcatagaatttagacagg
                     Aardvark  ccaggtcatgatggtgcaa-gtctcaaggaacttaaattag
B D                 Armadillo  ccccctcatgatggtacagtgtctcaaggaatttacactgg
B D                    Tenrec  =========================================
         Cape elephant shrew  =========================================
B D                  Elephant  =========================================
B D            Naked mole-rat  =========================================
                  Chinchilla  =========================================
B D                   Manatee  =========================================
B D                Guinea pig  =========================================
            Brush-tailed rat  =========================================
                Weddell seal  =========================================
            Cape golden mole  =========================================
B D              Green monkey  =========================================
B D                   Wallaby  =========================================
B D                  Platypus  =========================================
B D                    Turkey  =========================================
  D              Mallard duck  =========================================
B D                Coelacanth  =========================================
B D                    Lizard  =========================================
  D            Painted turtle  =========================================
  D           Green seaturtle  =========================================
B D                   Chicken  =========================================
B D                   Opossum  =========================================
  D  Chinese softshell turtle  =========================================
B D        American alligator  =========================================
  D          Peregrine falcon  =========================================
  D              Saker falcon  =========================================
B D           Tasmanian devil  =========================================
B D                Budgerigar  =========================================
  D               Rock pigeon  =========================================
          Tibetan ground jay  =========================================
B D               Zebra finch  =========================================
B D       Medium ground finch  =========================================
  D    White-throated sparrow  =========================================
  D       Collared flycatcher  =========================================

Inserts between block 25 and 26 in window
B D                Armadillo 5bp

Alignment block 26 of 751 in window, 79217795 - 79217796, 2 bps 
B D                     Human  ag
B D                     Chimp  ag
B D                   Gorilla  ag
B D                 Orangutan  ag
B D                    Gibbon  ag
B D                    Rhesus  ag
B D       Crab-eating macaque  ag
B D                    Baboon  ag
B D                  Marmoset  ag
B D           Squirrel monkey  ag
B D                  Bushbaby  aa
           Chinese tree shrew  ag
B D                  Squirrel  ag
       Lesser Egyptian jerboa  at
                 Prairie vole  ag
B D           Chinese hamster  ag
               Golden hamster  gg
B D                     Mouse  ag
B D                       Rat  ag
B D                    Rabbit  at
B D                       Pig  ag
B D                    Alpaca  at
               Bactrian camel  ag
B D                   Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
B D                       Cow  ag
B D                     Sheep  ag
                Domestic goat  ag
B D                     Horse  ag
B D          White rhinoceros  ag
B D                       Cat  ag
B D                       Dog  ag
B D                   Ferret   tg
B D                     Panda  ag
               Pacific walrus  ag
             Black flying-fox  ag
B D                   Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
B D                  Microbat  ag
B D                  Hedgehog  gg
B D                     Shrew  ag
              Star-nosed mole  ag
B D                    Tenrec  aa
                     Aardvark  ag
B D                 Armadillo  aa
         Cape elephant shrew  ==
B D                      Pika  --
B D                  Elephant  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                   Manatee  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
                Weddell seal  ==
            Cape golden mole  ==
B D              Green monkey  ==
B D                   Wallaby  ==
B D                  Platypus  ==
B D                    Turkey  ==
  D              Mallard duck  ==
B D                Coelacanth  ==
B D                    Lizard  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D                   Chicken  ==
B D                   Opossum  ==
  D  Chinese softshell turtle  ==
B D        American alligator  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
  D       Collared flycatcher  ==

Alignment block 27 of 751 in window, 79217797 - 79217806, 10 bps 
B D                     Human  a--atat------------------------a-tttt
B D                     Chimp  a--atat------------------------a-tttt
B D                   Gorilla  a--atat------------------------a-tttt
B D                 Orangutan  a--atat------------------------a-tttt
B D                    Gibbon  a--atat------------------------a-tttt
B D                    Rhesus  a--atat------------------------a-gttt
B D       Crab-eating macaque  a--atat------------------------a-gttt
B D                    Baboon  a--atat------------------------a-gttt
B D                  Marmoset  a--atat------------------------a-tttt
B D           Squirrel monkey  a--atat------------------------a-tttt
B D                  Bushbaby  a--atat------------------------a-tttg
           Chinese tree shrew  a--atat------------------------a-ttta
B D                  Squirrel  a--acgt------------------------a-ttct
       Lesser Egyptian jerboa  a--atgt------------------------a-tttt
                 Prairie vole  g--atatcttt--------tttgggggatatt-tttt
B D           Chinese hamster  g--atata-----------------------a-tttt
               Golden hamster  g--atat------------------------a-tttt
B D                     Mouse  g--atatataacacaaagtaagaggtgattaa-tttt
B D                       Rat  g------------------aagaggtgattag-tttt
B D                    Rabbit  a--atat------------------------g-tttc
B D                       Pig  g--atcc------------------------a-tatt
B D                    Alpaca  a--acac------------------------a-tttt
               Bactrian camel  a--acac------------------------a-tttt
B D                   Dolphin  a--atac------------------------a-tttt
                 Killer whale  a--gcac------------------------a-tttt
             Tibetan antelope  a--atac------------------------a-tttt
B D                       Cow  a--atac------------------------a-tttt
B D                     Sheep  a--atac------------------------a-tttt
                Domestic goat  a--atac------------------------a-tttt
B D                     Horse  a--acac------------------------a-tttt
B D          White rhinoceros  a--atac------------------------a-tttt
B D                       Cat  a--atac------------------------a-tttt
B D                       Dog  a--atgc------------------------a-ttta
B D                   Ferret   a--atac------------------------a-ttta
B D                     Panda  a--atac------------------------a-ttta
               Pacific walrus  a--atac------------------------a-ttta
             Black flying-fox  a--atat------------------------a-tttt
B D                   Megabat  a--atac------------------------a-tttt
                Big brown bat  a--atac------------------------a-ttgt
         David's myotis (bat)  a--atac------------------------a-ttgt
B D                  Microbat  a--atac------------------------a-ttgt
B D                  Hedgehog  ---atat------------------------a-tttt
B D                     Shrew  aatatat------------------------a-tttt
              Star-nosed mole  catatac------------------------t-tttt
B D                  Elephant  a--agat------------------------attttt
B D                   Manatee  a--aaat------------------------a-tctt
B D                    Tenrec  a--attt------------------------a-tttt
                     Aardvark  a--aaat------------------------aatgtt
B D                 Armadillo  a--aaac------------------------a-tttt
         Cape elephant shrew  =====================================
B D                      Pika  -------------------------------------
B D            Naked mole-rat  =====================================
                  Chinchilla  =====================================
B D                Guinea pig  =====================================
            Brush-tailed rat  =====================================
                Weddell seal  =====================================
            Cape golden mole  =====================================
B D              Green monkey  =====================================
B D                   Wallaby  =====================================
B D                  Platypus  =====================================
B D                    Turkey  =====================================
  D              Mallard duck  =====================================
B D                Coelacanth  =====================================
B D                    Lizard  =====================================
  D            Painted turtle  =====================================
  D           Green seaturtle  =====================================
B D                   Chicken  =====================================
B D                   Opossum  =====================================
  D  Chinese softshell turtle  =====================================
B D        American alligator  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
B D           Tasmanian devil  =====================================
B D                Budgerigar  =====================================
  D               Rock pigeon  =====================================
          Tibetan ground jay  =====================================
B D               Zebra finch  =====================================
B D       Medium ground finch  =====================================
  D    White-throated sparrow  =====================================
  D       Collared flycatcher  =====================================

Inserts between block 27 and 28 in window
B D                      Cow 2bp
                    Aardvark 1bp

Alignment block 28 of 751 in window, 79217807 - 79217818, 12 bps 
B D                     Human  tataaca-gagaa
B D                     Chimp  tataaca-gagaa
B D                   Gorilla  tataaca-gagaa
B D                 Orangutan  tataaca-gagaa
B D                    Gibbon  tataaga-gagaa
B D                    Rhesus  tataaca-gagaa
B D       Crab-eating macaque  tataaca-gagaa
B D                    Baboon  tataaca-gataa
B D                  Marmoset  tataaca-gagaa
B D           Squirrel monkey  tataaca-gagaa
B D                  Bushbaby  aataac-----ca
           Chinese tree shrew  aataaca-caaag
B D                  Squirrel  tatgatg-caaag
       Lesser Egyptian jerboa  tatagca-caaag
                 Prairie vole  tatagca-gagag
B D           Chinese hamster  tattgca-caaca
               Golden hamster  tatagct-caaca
B D                     Mouse  tatagca-caaat
B D                       Rat  tatagca-cagag
B D                    Rabbit  tataat----aca
B D                      Pika  ----------aaa
B D                       Pig  tgtaaca-caaag
B D                    Alpaca  tgtaaca-taaag
               Bactrian camel  tgtaaca-taaag
B D                   Dolphin  tgtgaca-aagag
                 Killer whale  tgtgaca-aagag
             Tibetan antelope  tgtaatg-taaag
B D                       Cow  tgtaatg-taaag
B D                     Sheep  tgtaatg-taaag
                Domestic goat  -----tg-taaag
B D                     Horse  tgtaaca-taaaa
B D          White rhinoceros  tgtaaga-taaag
B D                       Cat  tataaca-taaag
B D                       Dog  tgtaaca-taaag
B D                   Ferret   tgtaaca-taagg
B D                     Panda  tgtaaaa-taaag
               Pacific walrus  cataaca-taaag
             Black flying-fox  tgttagg-taaag
B D                   Megabat  tgttagg-taaag
                Big brown bat  tgtaaca-taaag
         David's myotis (bat)  tgtaaca-taaag
B D                  Microbat  tgtaaca-taaag
B D                  Hedgehog  cataata-tagag
B D                     Shrew  tgtaatg-taaaa
              Star-nosed mole  ca----a-caaag
B D                  Elephant  -----ta-aaaaa
B D                   Manatee  -----ta-aaaaa
             Cape golden mole  --taaaataaaaa
B D                    Tenrec  --tcaaa-aaaga
                     Aardvark  ---tcta-aaaaa
B D                 Armadillo  -ttaata-taaag
         Cape elephant shrew  =============
B D            Naked mole-rat  =============
                  Chinchilla  =============
B D                Guinea pig  =============
            Brush-tailed rat  =============
                Weddell seal  =============
B D              Green monkey  =============
B D                   Wallaby  =============
B D                  Platypus  =============
B D                    Turkey  =============
  D              Mallard duck  =============
B D                Coelacanth  =============
B D                    Lizard  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D                   Chicken  =============
B D                   Opossum  =============
  D  Chinese softshell turtle  =============
B D        American alligator  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
B D           Tasmanian devil  =============
B D                Budgerigar  =============
  D               Rock pigeon  =============
          Tibetan ground jay  =============
B D               Zebra finch  =============
B D       Medium ground finch  =============
  D    White-throated sparrow  =============
  D       Collared flycatcher  =============

Inserts between block 28 and 29 in window
B D                 Elephant 1bp
B D                  Manatee 1bp
            Cape golden mole 1bp
B D                   Tenrec 1bp
                    Aardvark 7006bp

Alignment block 29 of 751 in window, 79217819 - 79217836, 18 bps 
B D                     Human  aataaggtagat--------------------aat-aga
B D                     Chimp  aataaggtagat--------------------aat-aga
B D                   Gorilla  aataaggtagat--------------------aat-aga
B D                 Orangutan  aataaggtagat--------------------aat-aga
B D                    Gibbon  aataaggtagat--------------------aat-aga
B D                    Rhesus  aataaggtagat--------------------aat-aga
B D       Crab-eating macaque  aataaggtagat--------------------aat-aga
B D                    Baboon  aataaggtagat--------------------aat-aga
B D                  Marmoset  aataaggtaaat--------------------aat-aga
B D           Squirrel monkey  aatacggtaaat--------------------aat-aga
B D                  Bushbaby  aataaggagg----------------------cag-aga
           Chinese tree shrew  aataaggtac-t--------------------att-aga
B D                  Squirrel  aaacaggtaatt--------------------aat-agt
       Lesser Egyptian jerboa  aaagaggtaatt--------------------aat-aga
                 Prairie vole  aaagaggt-------------------------------
B D           Chinese hamster  caagaggt-------------------------------
               Golden hamster  aaagaggt-------------------------------
B D                     Mouse  aaagaggcaatt--------------------aat-ata
B D                       Rat  aaagaggtgatt--------------------aat-ata
B D                    Rabbit  aaaaaggtaatt--------------------aat-aga
B D                      Pika  aaaaaagtaatt--------------------aac-ag-
B D                       Pig  aacagagtcatt--------------------aat-aaa
B D                    Alpaca  aataaggtcatt--------------------aataaaa
               Bactrian camel  aataaggtcatt--------------------gataaaa
B D                   Dolphin  aataagatcatt--------------------aat-aaa
                 Killer whale  aataagatcatt--------------------aat-aaa
             Tibetan antelope  aataaggttatt--------------------aataaaa
B D                       Cow  aataagattatt--------------------aat-aaa
B D                     Sheep  aataagattatt--------------------aat-aaa
                Domestic goat  aataagattatt--------------------aat-aaa
B D                     Horse  agcaaggtaatt--------------------aa--taa
B D          White rhinoceros  aataaggtcatt--------------------aat-ttt
B D                       Cat  aatgagataatt--------------------aat-aaa
B D                       Dog  aacaagctaatt--------------------aat-aga
B D                   Ferret   aataagctaatt--------------------aat-aaa
B D                     Panda  aataagctaatt--------------------aat-gaa
               Pacific walrus  aataggctaatt--------------------aag-aaa
             Black flying-fox  aataag-taatt--------------------aat-aaa
B D                   Megabat  aataag-taatt--------------------aat-aaa
                Big brown bat  aacaag-taatttgccctaaccggtttggctcagt-gga
         David's myotis (bat)  aataag-taatt--------------------aat-gaa
B D                  Microbat  aataag-taatt--------------------aat--aa
B D                  Hedgehog  aataagatcatt--------------------aat-aaa
B D                     Shrew  aattaaataatt--------------------act-aaa
              Star-nosed mole  aacagggtaat--------------------------aa
B D                  Elephant  aatagcgtaatc--------------------aat-aga
B D                   Manatee  aataatgtaatc--------------------aat-agg
             Cape golden mole  aataatgtgatc--------------------aat-aga
B D                    Tenrec  aataatgcagtc--------------------aat-aga
                     Aardvark  aataaagtaatt--------------------aac-aga
B D                 Armadillo  aataatgcaatt--------------------agc-aga
         Cape elephant shrew  =======================================
B D            Naked mole-rat  =======================================
                  Chinchilla  =======================================
B D                Guinea pig  =======================================
            Brush-tailed rat  =======================================
                Weddell seal  =======================================
B D              Green monkey  =======================================
B D                   Wallaby  =======================================
B D                  Platypus  =======================================
B D                    Turkey  =======================================
  D              Mallard duck  =======================================
B D                Coelacanth  =======================================
B D                    Lizard  =======================================
  D            Painted turtle  =======================================
  D           Green seaturtle  =======================================
B D                   Chicken  =======================================
B D                   Opossum  =======================================
  D  Chinese softshell turtle  =======================================
B D        American alligator  =======================================
  D          Peregrine falcon  =======================================
  D              Saker falcon  =======================================
B D           Tasmanian devil  =======================================
B D                Budgerigar  =======================================
  D               Rock pigeon  =======================================
          Tibetan ground jay  =======================================
B D               Zebra finch  =======================================
B D       Medium ground finch  =======================================
  D    White-throated sparrow  =======================================
  D       Collared flycatcher  =======================================

Inserts between block 29 and 30 in window
               Big brown bat 171bp

Alignment block 30 of 751 in window, 79217837 - 79217869, 33 bps 
B D                     Human  aata--------------------------------a-aagttc--------------------------
B D                     Chimp  aata--------------------------------a-aagttc--------------------------
B D                   Gorilla  aata--------------------------------a-aagttc--------------------------
B D                 Orangutan  aata--------------------------------a-aagttc--------------------------
B D                    Gibbon  aata--------------------------------a-aagttc--------------------------
B D                    Rhesus  aata--------------------------------a-aagttc--------------------------
B D       Crab-eating macaque  aata--------------------------------a-aagttc--------------------------
B D                    Baboon  aata--------------------------------a-aagttc--------------------------
B D                  Marmoset  aata--------------------------------a-aa-tct--------------------------
B D           Squirrel monkey  aata--------------------------------a-aagtcc--------------------------
B D                  Bushbaby  aata--------------------------------a-aaagac--------------------------
           Chinese tree shrew  aaaa--------------------------------a-aaggtc--------------------------
B D                  Squirrel  aagg--------------------------------aaaa------------------------------
       Lesser Egyptian jerboa  tata--------------------------------aaaaaaac--------------------------
                 Prairie vole  --------------------------------------aaaggc--------------------------
B D           Chinese hamster  --------------------------------------agaggc--------------------------
               Golden hamster  --------------------------------------agaggc--------------------------
B D                     Mouse  aata--------------------------------aaaagggc--------------------------
B D                       Rat  aata--------------------------------aaaaacgc--------------------------
B D                    Rabbit  aa------------------------------------aa------------------------------
B D                      Pika  ---------------------------------------a------------------------------
B D                       Pig  a-----------------------------------a-gaagac--------------------------
B D                    Alpaca  aaaa--------------------------------c-caagat--------------------------
               Bactrian camel  aaaa--------------------------------a-aaaaa---------------------------
B D                   Dolphin  atgt--------------------------------a-aaagac--------------------------
                 Killer whale  atgt--------------------------------a-aaagac--------------------------
             Tibetan antelope  atga--------------------------------a-aaagac--------------------------
B D                       Cow  atga--------------------------------a-aaagac--------------------------
B D                     Sheep  atga--------------------------------a-aaagac--------------------------
                Domestic goat  atga--------------------------------a-aaagac--------------------------
B D                     Horse  gaaa--------------------------------a-aaagat--------------------------
B D          White rhinoceros  tttt--------------------------------a-aaagac--------------------------
B D                       Cat  aaga--------------------------------g-aaagac--------------------------
B D                       Dog  aaga--------------------------------a-aaagat--------------------------
B D                   Ferret   aaga--------------------------------a-aaagac--------------------------
B D                     Panda  aa-a--------------------------------g-actggt--------------------------
               Pacific walrus  aaga--------------------------------a-aaagac--------------------------
             Black flying-fox  -aag--------------------------------a-aaaggc--------------------------
B D                   Megabat  -aag--------------------------------a-aaaggc--------------------------
                Big brown bat  -aataaaatattttttaaaagaataagtaattaataa-aaagac--------------------------
         David's myotis (bat)  ------------------------------------a-aaagac--------------------------
B D                  Microbat  ------------------------------------a-aaagac--------------------------
B D                  Hedgehog  aaca--------------------------------a-aaaggcgtcttccagacaaccatgaagttgat
B D                     Shrew  aaga--------------------------------a-aaatac--------------------------
              Star-nosed mole  aagg--------------------------------a-gaaaac--------------------------
B D                  Elephant  aaga--------------------------------a-aaaggc--------------------------
B D                   Manatee  aaga--------------------------------a-aaaggc--------------------------
             Cape golden mole  aaga--------------------------------c-aaagac--------------------------
B D                    Tenrec  a-------------------------------------aaaggc--------------------------
                     Aardvark  a-aa--------------------------------c-aaaggc--------------------------
B D                 Armadillo  aaga----------------------------------aaaggc--------------------------
         Cape elephant shrew  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
                Weddell seal  ======================================================================
B D              Green monkey  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
B D                    Turkey  ======================================================================
  D              Mallard duck  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  -----------t-----g--attgtgcagataaatatt------aa
                        Chimp  -----------t-----g--attgtgcagataaatatt------aa
                      Gorilla  -----------t-----g--attgtgcagataaatatt------aa
                    Orangutan  -----------t-----g--attgtgcagataaatatg------aa
                       Gibbon  -----------t-----g--attgtgcagacaaatatt------aa
                       Rhesus  -----------t-----g--attgcgcagataaatatt------aa
          Crab-eating macaque  -----------t-----g--attgcgcagataaatatt------aa
                       Baboon  -----------t-----g--attgcgcagataaatatt------aa
                     Marmoset  -----------t-----g--attgtgtggatgaatatt------aa
              Squirrel monkey  -----------t-----g--attgtgcagatgaatatt------aa
                     Bushbaby  -----------t-----t--attgtacagataaacatg------aa
           Chinese tree shrew  -----------t-----g--atgatgcagagaaacatt------ag
                     Squirrel  -----------------c--attggacagattaccatt------aa
       Lesser Egyptian jerboa  -----------t-----g--atggtacaggttagtaat------aa
                 Prairie vole  -----------tctaaag--gttgtgcaggttgacatc-------a
              Chinese hamster  -----------t-----g--gttgagcggggtgaagtt--------
               Golden hamster  -----------t-----g--gctgtgcagggtgatgtt-------a
                        Mouse  -----------t-----g--gttgtacaggttggcatt-------a
                          Rat  -----------t-----g--gtcgtacaggtcgacatt-------a
                       Rabbit  -----------------g--attgcacaaataaacagt------aa
                         Pika  -----------------t--actacacagataaatatg------ta
                          Pig  -----------t-----g--attacctagagaaacact------aa
                       Alpaca  -----------t-----g--tttgtccagataaacatt------aa
               Bactrian camel  -----------------g--attgtccagataaacatt------aa
                      Dolphin  -----------t-----g--gttgtccagataaacatt------aa
                 Killer whale  -----------t-----g--gttgtccagataaacattaatttgaa
             Tibetan antelope  -----------t-----g--gttgttcaaacaaatatg------aa
                          Cow  -----------t-----g--gttgttcaaacaaacatg------aa
                        Sheep  -----------t-----g--gttgttcaaacaaacatg------aa
                Domestic goat  -----------t-----g--gttgttcaaacaaacatg------aa
                        Horse  -----------t-----g--atagttctgataaacact------aa
             White rhinoceros  -----------t-----g--attgtccagataaacatt------aa
                          Cat  -----------t-----g--gttgttcagataaacatt------ag
                          Dog  -----------t-----g--gttgtccagataaacatt------aa
                      Ferret   -----------t-----g--gtcatccagataaacatt------aa
                        Panda  -----------t-----g------tccagataaacatt------aa
               Pacific walrus  -----------t-----g------tccagataaacatt------aa
             Black flying-fox  -----------t-----g--attgtctacataaacatt------ta
                      Megabat  -----------t-----g--attgtccacataaacatt------ta
                Big brown bat  ----------------------tgtccagataaacact------ca
         David's myotis (bat)  ----------------------tgtccagataaacact------ca
                     Microbat  ----------------------tgtccagataaacact------ca
                     Hedgehog  tataaatatttt-----gttattattataaataataat------aa
                        Shrew  -----------t-----g--attgttcaaataaacatt------aa
              Star-nosed mole  -----------t-----g-------tctggagaacact------aa
                     Elephant  -----------t-----g--actgtccagataaacatt------aa
                      Manatee  -----------t-----g--actgtccagataaacatt------aa
             Cape golden mole  -----------t-----g--attttccagataagcatt------aa
                       Tenrec  -----------t-----g--actatctagataaataat------aa
                     Aardvark  -----------t-----g--attgtccag-----tatt------ac
                    Armadillo  -----------t-----g--tttgttcagataaacact------ga
          Cape elephant shrew  ==============================================
               Naked mole-rat  ==============================================
                   Chinchilla  ==============================================
                   Guinea pig  ==============================================
             Brush-tailed rat  ==============================================
                 Weddell seal  ==============================================
                 Green monkey  ==============================================
                      Wallaby  ==============================================
                     Platypus  ==============================================
                       Turkey  ==============================================
                 Mallard duck  ==============================================
                   Coelacanth  ==============================================
                       Lizard  ==============================================
               Painted turtle  ==============================================
              Green seaturtle  ==============================================
                      Chicken  ==============================================
                      Opossum  ==============================================
     Chinese softshell turtle  ==============================================
           American alligator  ==============================================
             Peregrine falcon  ==============================================
                 Saker falcon  ==============================================
              Tasmanian devil  ==============================================
                   Budgerigar  ==============================================
                  Rock pigeon  ==============================================
           Tibetan ground jay  ==============================================
                  Zebra finch  ==============================================
          Medium ground finch  ==============================================
       White-throated sparrow  ==============================================
          Collared flycatcher  ==============================================

Inserts between block 30 and 31 in window
B D                 Hedgehog 177bp

Alignment block 31 of 751 in window, 79217870 - 79217911, 42 bps 
B D                     Human  atttgtaat-------aagga-gacttg-atcttcccaaagggatagtgaa
B D                     Chimp  atttgtaat-------aagga-gacttg-atcttcccaaagggatagtgaa
B D                   Gorilla  atttgtaat-------aagga-gacttg-atcttcccaaagggatagtgaa
B D                 Orangutan  atttgtaat-------aaggg-gacttg-atcttcccaaagggatagtgaa
B D                    Gibbon  atttgtaat-------aaggg-gacttg-atcttcccaaagggatagtgaa
B D                    Rhesus  atttgtacttgatttaaaggg-gacctg-atcttcccaaagggatagtgaa
B D       Crab-eating macaque  atttgtacttgatttaaaggg-gacctg-atcttcccaaagggatagtgaa
B D                    Baboon  atttgtaccttatttaaaggg-gacctg-atcttcccaaagggatagtgaa
B D                  Marmoset  atttgtaat--------aagt-gacttg-atctttccaaagagacagtgaa
B D           Squirrel monkey  atttgtaat--------aagg-gacttg-atcttcccaaagagatagtgaa
B D                  Bushbaby  gttgatcat--------gtag-gatttg-atcttccttaggaggtattgaa
           Chinese tree shrew  gttgataat--------attg-gatttt-ctcttcccaaggaggcact---
B D                  Squirrel  gttgataac--------atga-gatttg-atcttccctgggaggtgtgaa-
       Lesser Egyptian jerboa  attggtgat--------gtgg-gatttg-atattccctatcgaggattgaa
                 Prairie vole  attggtggt--------gtaatcactcc-gtcttctctagcaggtacaaag
B D           Chinese hamster  attggtggt--------gtag-cattca-atcttctctggcaggtacagag
               Golden hamster  attggtggt--------gtag-cagtca-gtcttttctaacaggcacagag
B D                     Mouse  attggtggt--------gtgg-catttg-atcttctccagcaggtaccaag
B D                       Rat  attggtggt--------gtgg-catttg-atcctttccag-aggtaccaag
B D                    Rabbit  attgctaat--------atgg-agtttg-atcttccctcagagggactgtg
B D                      Pika  attgataat--------atgg-ggtttg-atatttccttagagatgttgtg
B D                       Pig  gttgataat--------aaga-gatttg-atcttctgtaggaggatttgaa
B D                    Alpaca  gttgataat--------aaga-gatttg-cttttccgtagaaggagttgag
               Bactrian camel  gttgataat--------aaga-gatttg-ctcttccatagaaggagttgag
B D                   Dolphin  tttgataat--------aaga-gatttg-atcttccataggaggaactgag
                 Killer whale  tttgataat--------aaga-gatttg-atcttccataggaagaactgag
             Tibetan antelope  gttgataat------aaaaga-gattta-atctcct-taggaggaactgag
B D                       Cow  gttgataat------aaaaga-gattta-atgttct-taggaggaactgag
B D                     Sheep  gttgataat------aaaaga-gatttc-atctcct-tatgaggaactgag
                Domestic goat  gttgatgat------aaaaga-gattta-atctcct-taggaggaactgag
B D                     Horse  attaataat--------acgg-gatttg-attttcccgagagggaactgag
B D          White rhinoceros  gttgataat--------atgg-gatgtg-atcttcctgaggaggaactgag
B D                       Cat  gttgataat--------atag-gattct-atcttccctatggagagttgag
B D                       Dog  gttgataat--------atgg-gattca-atcttccctacaaagagttaag
B D                   Ferret   attgataat--------atgg-gattcg-atcttccctacaaagagttggg
B D                     Panda  gttgataat--------acgg-gattcg-atcttccctacaaagagttgag
               Pacific walrus  gttgataat--------atgg-gattca-atcttccctacaaagagttgag
             Black flying-fox  cttgataat--------atga-gatttg-atcttcc-tagaagatattgat
B D                   Megabat  cttgataat--------atga-gatttg-atcttcc-tagaagatattgat
                Big brown bat  gttgataat--------atgg-aatatg-atcttccatagaagatactgag
         David's myotis (bat)  gttcataat--------acag-aatatg-atcttccgtagaaggtattgag
B D                  Microbat  gttcataat--------acac-aatatg-atcttccatagaaggtattgag
B D                  Hedgehog  atattttat--------ttgg-gatttg-atcttccctaagagatattgaa
B D                     Shrew  gtgggtgat--------atgg-cttttg-atc-----tagaaggcactggg
              Star-nosed mole  gttgatcat--------ctag-gatgtg-aacttccttagcagggattgag
B D                  Elephant  gttgataat--------atgg-gattcg-atcttccctagaatgtattgag
B D                   Manatee  gttgataat--------atgg-gattcg-attttccctagaaggtattgag
             Cape golden mole  gttgataat--------atgg-gaattg-ttctttcatagaaggtattgag
B D                    Tenrec  gttgataat--------aagg-aatttgatttttgtctcgaaagtcctaaa
                     Aardvark  cttgataat--------a-gg-gatttg-atcttcactagaaagtattgag
B D                 Armadillo  attgataat--------gtgg-gatttg-atctt--cttggaggtattgaa
         Cape elephant shrew  ===================================================
B D            Naked mole-rat  ===================================================
                  Chinchilla  ===================================================
B D                Guinea pig  ===================================================
            Brush-tailed rat  ===================================================
                Weddell seal  ===================================================
B D              Green monkey  ===================================================
B D                   Wallaby  ===================================================
B D                  Platypus  ===================================================
B D                    Turkey  ===================================================
  D              Mallard duck  ===================================================
B D                Coelacanth  ===================================================
B D                    Lizard  ===================================================
  D            Painted turtle  ===================================================
  D           Green seaturtle  ===================================================
B D                   Chicken  ===================================================
B D                   Opossum  ===================================================
  D  Chinese softshell turtle  ===================================================
B D        American alligator  ===================================================
  D          Peregrine falcon  ===================================================
  D              Saker falcon  ===================================================
B D           Tasmanian devil  ===================================================
B D                Budgerigar  ===================================================
  D               Rock pigeon  ===================================================
          Tibetan ground jay  ===================================================
B D               Zebra finch  ===================================================
B D       Medium ground finch  ===================================================
  D    White-throated sparrow  ===================================================
  D       Collared flycatcher  ===================================================

Inserts between block 31 and 32 in window
B D                 Squirrel 563bp

Alignment block 32 of 751 in window, 79217912 - 79217912, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D                       Rat  g
B D                    Rabbit  a
B D                      Pika  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  g
B D                   Manatee  g
             Cape golden mole  a
B D                    Tenrec  g
                     Aardvark  a
B D                 Armadillo  a
         Cape elephant shrew  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  =
          Chinese tree shrew  -
B D                Guinea pig  =
            Brush-tailed rat  =
                Weddell seal  =
B D              Green monkey  =
B D                   Wallaby  =
B D                  Platypus  =
B D                    Turkey  =
  D              Mallard duck  =
B D                Coelacanth  =
B D                    Lizard  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D                   Chicken  =
B D                   Opossum  =
  D  Chinese softshell turtle  =
B D        American alligator  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D           Tasmanian devil  =
B D                Budgerigar  =
  D               Rock pigeon  =
          Tibetan ground jay  =
B D               Zebra finch  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
  D       Collared flycatcher  =

Alignment block 33 of 751 in window, 79217913 - 79217934, 22 bps 
B D                     Human  taatatc---------------------------------------------------------------
B D                     Chimp  taatgtc---------------------------------------------------------------
B D                   Gorilla  -aatgtc---------------------------------------------------------------
B D                 Orangutan  taatgtc---------------------------------------------------------------
B D                    Gibbon  taatgtc---------------------------------------------------------------
B D                    Rhesus  taatgcc---------------------------------------------------------------
B D       Crab-eating macaque  taatgcc---------------------------------------------------------------
B D                    Baboon  taatgcc---------------------------------------------------------------
B D                  Marmoset  taatctc---------------------------------------------------------------
B D           Squirrel monkey  taatctc---------------------------------------------------------------
B D                  Bushbaby  taatttc---------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
B D                  Squirrel  aaatcct---------------------------------------------------------------
       Lesser Egyptian jerboa  tggtcac---------------------------------------------------------------
                 Prairie vole  caatctt---------------------------------------------------------------
B D           Chinese hamster  caatctt---------------------------------------------------------------
               Golden hamster  caacctt---------------------------------------------------------------
B D                     Mouse  tgttctt---------------------------------------------------------------
B D                       Rat  taatctc---------------------------------------------------------------
B D                    Rabbit  taatctc---------------------------------------------------------------
B D                      Pika  tcatctc---------------------------------------------------------------
B D                       Pig  taatcac---------------------------------------------------------------
B D                    Alpaca  taatcac---------------------------------------------------------------
               Bactrian camel  taatcat---------------------------------------------------------------
B D                   Dolphin  taatcac---------------------------------------------------------------
                 Killer whale  taatcac---------------------------------------------------------------
             Tibetan antelope  taatcac---------------------------------------------------------------
B D                       Cow  taatcac---------------------------------------------------------------
B D                     Sheep  taatcac---------------------------------------------------------------
                Domestic goat  taatcac---------------------------------------------------------------
B D                     Horse  taattgc---------------------------------------------------------------
B D          White rhinoceros  caattgc---------------------------------------------------------------
B D                       Cat  taattgc---------------------------------------------------------------
B D                       Dog  gaattgc---------------------------------------------------------------
B D                   Ferret   taattgc---------------------------------------------------------------
B D                     Panda  taattac---------------------------------------------------------------
               Pacific walrus  taattgc---------------------------------------------------------------
             Black flying-fox  taatcac---------------------------------------------------------------
B D                   Megabat  taatcac---------------------------------------------------------------
                Big brown bat  taatcac---------------------------------------------------------------
         David's myotis (bat)  taatcac---------------------------------------------------------------
B D                  Microbat  taatcac---------------------------------------------------------------
B D                  Hedgehog  taatgacgtgtagagtctgggtggtggcacatccactaaagagctcacattactatatgtgaagacccca
B D                     Shrew  taatcac---------------------------------------------------------------
              Star-nosed mole  tgatcac---------------------------------------------------------------
B D                  Elephant  taatctc---------------------------------------------------------------
B D                   Manatee  taatctc---------------------------------------------------------------
             Cape golden mole  gaatctc---------------------------------------------------------------
B D                    Tenrec  taatttc---------------------------------------------------------------
                     Aardvark  taatctc---------------------------------------------------------------
B D                 Armadillo  taata-c---------------------------------------------------------------
         Cape elephant shrew  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
                Weddell seal  ======================================================================
B D              Green monkey  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
B D                    Turkey  ======================================================================
  D              Mallard duck  ======================================================================
B D                Coelacanth  ======================================================================
B D                    Lizard  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Chicken  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D        American alligator  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D       Collared flycatcher  ======================================================================

                        Human  -----------------------------------------------------------ctttcctt---
                        Chimp  -----------------------------------------------------------ctttcctt---
                      Gorilla  -----------------------------------------------------------ctttcctt---
                    Orangutan  -----------------------------------------------------------ctttcctt---
                       Gibbon  -----------------------------------------------------------ctttcctt---
                       Rhesus  -----------------------------------------------------------ctttcctt---
          Crab-eating macaque  -----------------------------------------------------------ctttcctt---
                       Baboon  -----------------------------------------------------------ctttcctt---
                     Marmoset  -----------------------------------------------------------ctttcctt---
              Squirrel monkey  -----------------------------------------------------------ctttcctt---
                     Bushbaby  -----------------------------------------------------------cttttctt---
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  -----------------------------------------------------------cttttcttccc
       Lesser Egyptian jerboa  -----------------------------------------------------------cttttcct---
                 Prairie vole  -----------------------------------------------------------ctttgctt---
              Chinese hamster  -----------------------------------------------------------ctttgctt---
               Golden hamster  -----------------------------------------------------------ctttgctt---
                        Mouse  -----------------------------------------------------------cttccctt---
                          Rat  -----------------------------------------------------------ctttcttt---
                       Rabbit  -----------------------------------------------------------ccttcctt---
                         Pika  -----------------------------------------------------------tcttcctt---
                          Pig  -----------------------------------------------------------atgtcctt---
                       Alpaca  -----------------------------------------------------------cttacctt---
               Bactrian camel  -----------------------------------------------------------cttttctt---
                      Dolphin  -----------------------------------------------------------cttttctt---
                 Killer whale  -----------------------------------------------------------cttttctt---
             Tibetan antelope  -----------------------------------------------------------cttttgtt---
                          Cow  -----------------------------------------------------------atttcgtt---
                        Sheep  -----------------------------------------------------------cttttgtt---
                Domestic goat  -----------------------------------------------------------ctttcgtt---
                        Horse  -----------------------------------------------------------ctttcctt---
             White rhinoceros  -----------------------------------------------------------ctttcctt---
                          Cat  -----------------------------------------------------------t-----tt---
                          Dog  -----------------------------------------------------------ctttcctt---
                      Ferret   -----------------------------------------------------------ctttcctt---
                        Panda  -----------------------------------------------------------ctttcctt---
               Pacific walrus  -----------------------------------------------------------ttttcctt---
             Black flying-fox  -----------------------------------------------------------ctttcttt---
                      Megabat  -----------------------------------------------------------ctttcttt---
                Big brown bat  -----------------------------------------------------------ctttcctt---
         David's myotis (bat)  -----------------------------------------------------------ctttcctt---
                     Microbat  -----------------------------------------------------------ctttcctt---
                     Hedgehog  gttcaaaccttgtccccatctgcaggagggaagtgatacagacacatctcttcatgtctctcaccct---
                        Shrew  -----------------------------------------------------------cttccctt---
              Star-nosed mole  -----------------------------------------------------------ctgtccct---
                     Elephant  -----------------------------------------------------------ctttcctt---
                      Manatee  -----------------------------------------------------------ctttcctt---
             Cape golden mole  -----------------------------------------------------------ctttcctt---
                       Tenrec  -----------------------------------------------------------ctttcatt---
                     Aardvark  -----------------------------------------------------------cttccctt---
                    Armadillo  -----------------------------------------------------------ctttcttt---
          Cape elephant shrew  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
                 Weddell seal  ======================================================================
                 Green monkey  ======================================================================
                      Wallaby  ======================================================================
                     Platypus  ======================================================================
                       Turkey  ======================================================================
                 Mallard duck  ======================================================================
                   Coelacanth  ======================================================================
                       Lizard  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Chicken  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
           American alligator  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
              Tasmanian devil  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
          Collared flycatcher  ======================================================================

                        Human  -cag-aaaa
                        Chimp  -cag-aaaa
                      Gorilla  -cag-aaaa
                    Orangutan  -cag-aaaa
                       Gibbon  -cag-aaaa
                       Rhesus  -cag-aaaa
          Crab-eating macaque  -cag-aaaa
                       Baboon  -cag-aaaa
                     Marmoset  -cag-aaaa
              Squirrel monkey  -cag-aaaa
                     Bushbaby  -cag-agaa
           Chinese tree shrew  -----aagt
                     Squirrel  ccag-aaga
       Lesser Egyptian jerboa  -ctg-aaaa
                 Prairie vole  -caa-aaga
              Chinese hamster  -caa-aaga
               Golden hamster  -caa-aaga
                        Mouse  -caa-aaga
                          Rat  -caa-aaga
                       Rabbit  -cag-aaaa
                         Pika  -cag-aaaa
                          Pig  -caa-aaaa
                       Alpaca  -cag-aaaa
               Bactrian camel  -cag-aaaa
                      Dolphin  -cagaaaaa
                 Killer whale  -cagaaaaa
             Tibetan antelope  -tac-aaaa
                          Cow  -tag-aaaa
                        Sheep  -tac-aaaa
                Domestic goat  -tac-aaaa
                        Horse  -tag-aaaa
             White rhinoceros  -cag-aaaa
                          Cat  -cag-aaaa
                          Dog  -cag-aaac
                      Ferret   -cag-aaaa
                        Panda  -cag-aaaa
               Pacific walrus  -cag-aaaa
             Black flying-fox  -tag-aaaa
                      Megabat  -tag-aaaa
                Big brown bat  -cag-aaag
         David's myotis (bat)  -cag-aaag
                     Microbat  -cag-aaag
                     Hedgehog  -ctg-ttaa
                        Shrew  -cag-aaaa
              Star-nosed mole  -cag-gaaa
                     Elephant  -caa-aaaa
                      Manatee  -cag-aaaa
             Cape golden mole  -cca-agaa
                       Tenrec  -caa-aaaa
                     Aardvark  -cat-aaaa
                    Armadillo  -cag-aaaa
          Cape elephant shrew  =========
               Naked mole-rat  =========
                   Chinchilla  =========
                   Guinea pig  =========
             Brush-tailed rat  =========
                 Weddell seal  =========
                 Green monkey  =========
                      Wallaby  =========
                     Platypus  =========
                       Turkey  =========
                 Mallard duck  =========
                   Coelacanth  =========
                       Lizard  =========
               Painted turtle  =========
              Green seaturtle  =========
                      Chicken  =========
                      Opossum  =========
     Chinese softshell turtle  =========
           American alligator  =========
             Peregrine falcon  =========
                 Saker falcon  =========
              Tasmanian devil  =========
                   Budgerigar  =========
                  Rock pigeon  =========
           Tibetan ground jay  =========
                  Zebra finch  =========
          Medium ground finch  =========
       White-throated sparrow  =========
          Collared flycatcher  =========

Inserts between block 33 and 34 in window
B D                   Tenrec 106bp

Alignment block 34 of 751 in window, 79217935 - 79217938, 4 bps 
B D                     Human  g--------------------------------------------------------ctt
B D                     Chimp  t--------------------------------------------------------ctt
B D                   Gorilla  g--------------------------------------------------------ctt
B D                 Orangutan  g--------------------------------------------------------ctt
B D                    Gibbon  g--------------------------------------------------------ctt
B D                    Rhesus  g--------------------------------------------------------ctt
B D       Crab-eating macaque  g--------------------------------------------------------ctt
B D                    Baboon  g--------------------------------------------------------ctt
B D                  Marmoset  g--------------------------------------------------------ctt
B D           Squirrel monkey  g--------------------------------------------------------ctt
B D                  Bushbaby  g--------------------------------------------------------ttt
           Chinese tree shrew  g--------------------------------------------------------cgt
B D                  Squirrel  g--------------------------------------------------------ctt
       Lesser Egyptian jerboa  g--------------------------------------------------------tat
                 Prairie vole  g--------------------------------------------------------tgt
B D           Chinese hamster  g--------------------------------------------------------ctt
               Golden hamster  g--------------------------------------------------------ctt
B D                     Mouse  g--------------------------------------------------------ctg
B D                       Rat  g--------------------------------------------------------ctt
B D                    Rabbit  t--------------------------------------------------------ct-
B D                      Pika  t--------------------------------------------------------ct-
B D                       Pig  g--------------------------------------------------------ttt
B D                    Alpaca  g--------------------------------------------------------ctt
               Bactrian camel  g--------------------------------------------------------ctt
B D                   Dolphin  a--------------------------------------------------------att
                 Killer whale  a--------------------------------------------------------att
             Tibetan antelope  a--------------------------------------------------------ctt
B D                       Cow  a--------------------------------------------------------ctt
B D                     Sheep  a--------------------------------------------------------ctt
                Domestic goat  a--------------------------------------------------------ctt
B D                     Horse  g--------------------------------------------------------ctt
B D          White rhinoceros  g--------------------------------------------------------ctc
B D                       Cat  g--------------------------------------------------------ttt
B D                       Dog  g--------------------------------------------------------ctt
B D                   Ferret   t--------------------------------------------------------ctt