Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 243 in window, 104651031 - 104651062, 32 bps 
B D                   Human  tac------------agca-gcgggg------------------------------------------ta
B D                   Chimp  tac------------agca-gcaggg------------------------------------------ta
B D                 Gorilla  tac------------agca-gcgggg------------------------------------------ta
B D               Orangutan  tgc------------agca-gcgggg------------------------------------------ta
B D                  Gibbon  tgc------------agca-gcgggg------------------------------------------tg
B D                  Rhesus  tag------------agca-gtgggg------------------------------------------tg
B D     Crab-eating macaque  tag------------agca-gtgggg------------------------------------------tg
B D                  Baboon  tag------------agca-gtgggg------------------------------------------tg
B D            Green monkey  tag------------agca-gtgagg------------------------------------------tg
B D                Marmoset  tgc------------agca-gcggcg------------------------------------------tg
B D         Squirrel monkey  tgc------------agca-gcgggg------------------------------------------tg
B D                Bushbaby  tgc------------agta-g-aggg------------------------------------------tg
         Chinese tree shrew  cac------------ggca-ctgggg------------------------------------------tt
B D                Squirrel  tgc------------cgcc-atgggg------------------------------------------tg
     Lesser Egyptian jerboa  tgt------------agcc-cagggg------------------------------------------tg
               Prairie vole  tgt------------agca-gttggg------------------------------------------aa
B D         Chinese hamster  tgc------------agca-gttatg------------------------------------------ta
             Golden hamster  agc------------agca-gttatc------------------------------------------ta
B D                   Mouse  tga------------agca-gtgggg------------------------------------------ca
B D                     Rat  tga------------agca-gtaggg------------------------------------------tg
B D          Naked mole-rat  ggc------------agca-gtgggg------------------------------------------ct
B D              Guinea pig  ggc------------aaca-ctgggg------------------------------------------tt
                 Chinchilla  tgc------------agca-gcgggg------------------------------------------ta
           Brush-tailed rat  gac------------agca-gagggg------------------------------------------cc
B D                  Rabbit  ggt------------agca-at-ggg------------------------------------------tg
B D                    Pika  ggt------------aaca-gt-ggg------------------------------------------tg
B D                     Pig  tat------------agtaatggggt------------------------------------------tg
B D                  Alpaca  tgt------------agtt-gagggg------------------------------------------tg
             Bactrian camel  tgt------------agtt-gagggg------------------------------------------tg
B D                 Dolphin  tgt------------agta-ctggag------------------------------------------tg
               Killer whale  tgt------------agta-ctggag------------------------------------------tg
           Tibetan antelope  tgt------------agta--ggggg------------------------------------------tg
B D                     Cow  tgt------------agta--gaggg------------------------------------------tg
B D                   Sheep  tgt------------agta--ggggg------------------------------------------tg
              Domestic goat  tgt------------agta--ggggg------------------------------------------ta
B D                   Horse  tgt------------agca-gtgggg------------------------------------------ta
B D        White rhinoceros  tgt------------gata-gtgggg------------------------------------------tg
B D                     Cat  -gt------------aaca-gcgggg------------------------------------------tg
B D                     Dog  -gt------------aacg-cggggg------------------------------------------tg
B D                 Ferret   -gt------------acca-ccgagg------------------------------------------tg
B D                   Panda  -gt------------gaca-ctgagg------------------------------------------tg
             Pacific walrus  -gt------------aaca-ccgagg------------------------------------------ta
               Weddell seal  -gt------------aaca-ccaagg------------------------------------------tg
           Black flying-fox  tgt------------tgta-gaccgg------------------------------------------tg
B D                 Megabat  tgt------------tgta-gaccgg------------------------------------------tg
       David's myotis (bat)  ggtagagcgtcggcctgcg-gactgaaaggtcccaggttcaattccggtcaagaccatgtaccttggttg
B D                Hedgehog  tgt------------agta-gtgaag------------------------------------------tg
B D                   Shrew  tgc------------aaca-gtgagg------------------------------------------ta
            Star-nosed mole  tac------------agta-gtgggg------------------------------------------tg
B D                Elephant  tgc------------aatg-gtgagg------------------------------------------tg
        Cape elephant shrew  tg-------------atcc-gtggag------------------------------------------tg
B D                 Manatee  tgc------------agtg-gtgagg------------------------------------------ca
           Cape golden mole  tac------------agta-gtgggt------------------------------------------ca
B D                  Tenrec  tgc------------agtg-gtgggc------------------------------------------ca
                   Aardvark  ggc------------acta-gtgggg------------------------------------------tg
B D               Armadillo  tat------------aata-gtggag------------------------------------------tg
B D                 Opossum  tgc------------tgga-cttggg------------------------------------------tt
B D         Tasmanian devil  tgc------------tgga-gttacg------------------------------------------tt
             Big brown bat  ======================================================================
B D                Microbat  ======================================================================
B D      American alligator  ======================================================================
  D         Green seaturtle  ======================================================================

                      Human  agagagcagcc------------accgta
                      Chimp  agagagcagcc------------accgta
                    Gorilla  agagagcagcc------------accgta
                  Orangutan  agagagcagcc------------accgta
                     Gibbon  agggagcagcc------------accgta
                     Rhesus  agggagcagcc------------gcagta
        Crab-eating macaque  agggagcagcc------------gcagta
                     Baboon  agggagcagcc------------gcagta
               Green monkey  agggagcagcc------------acagta
                   Marmoset  agtgagtatct------------tcca-a
            Squirrel monkey  agtgagtatcc------------tcca-c
                   Bushbaby  agggagctgct------------gcctta
         Chinese tree shrew  aaggagcagcc------------accatg
                   Squirrel  aaggagcagcc------------accaca
     Lesser Egyptian jerboa  agggggcaggc------------cccaca
               Prairie vole  agggagcggcc------------actgca
            Chinese hamster  agggagcagct------------accac-
             Golden hamster  agggagcagtc------------actaca
                      Mouse  agggagcagcc------------accaca
                        Rat  agggagcagcc------------accaca
             Naked mole-rat  tgggagcagcc------------accaca
                 Guinea pig  aaggagcagct------------gccaca
                 Chinchilla  agggagcagcc------------accaga
           Brush-tailed rat  agggagcagcc------------accaca
                     Rabbit  ag---------------------------
                       Pika  ag-gagcaggg------------cagtga
                        Pig  aggaagcagcc------------actgtg
                     Alpaca  aggaagctgcc------------actgtg
             Bactrian camel  aggaagctgcc------------actgtg
                    Dolphin  aggcaacagct------------gccgtg
               Killer whale  aggcaacagct------------gccgtg
           Tibetan antelope  gggaatctgct------------gctatg
                        Cow  aggaagcagct------------gctgtg
                      Sheep  gggaagctgct------------gctatg
              Domestic goat  gggaagctgct------------actatg
                      Horse  aggaagcagcc------------acaata
           White rhinoceros  aggaggcagct------------atgctg
                        Cat  acgacgcagcc------------accata
                        Dog  aggacgcagcc------------accatc
                    Ferret   gggacgcagcc------------accgta
                      Panda  agaacacagcc------------accata
             Pacific walrus  agaacgcaagc------------accata
               Weddell seal  aggacgcaacc------------accata
           Black flying-fox  agggcacagcc------------atgca-
                    Megabat  agggcacagcc------------atgca-
       David's myotis (bat)  cgggcacatccccagtaggaggtgtgca-
                   Hedgehog  aggaagcagct------------tccata
                      Shrew  agggtacagcc------------tccata
            Star-nosed mole  agatagtagct------------accaga
                   Elephant  agaaagcagcc------------accgtt
        Cape elephant shrew  aggacgcagcc------------actg--
                    Manatee  a----------------------------
           Cape golden mole  ggaa-gcagcc------------accgtg
                     Tenrec  ggaa----------------------gtg
                   Aardvark  agggagcagcc------------accatg
                  Armadillo  agaatgcagcc------------atcgga
                    Opossum  ggagtgcagcc------------accatc
            Tasmanian devil  ggagtgcagcc------------acaatc
              Big brown bat  =============================
                   Microbat  =============================
         American alligator  =============================
            Green seaturtle  =============================

Inserts between block 1 and 2 in window
      David's myotis (bat) 104bp

Alignment block 2 of 243 in window, 104651063 - 104651289, 227 bps 
B D                   Human  agaat----------------a---------a---atcagactgcataa---------------tgctgc
B D                   Chimp  agaat----------------a---------a---gtcagactgcataa---------------tgctgc
B D                 Gorilla  agaat----------------a---------a---gtcagactgcataa---------------cgctgc
B D               Orangutan  agaat----------------a---------a---gtcagactgcataa---------------cgctgc
B D                  Gibbon  agaat----------------a---------a---gtcagaccgcataa---------------cgctgc
B D                  Rhesus  agaat----------------a---------a---gtgagactgcgtaa---------------cactgc
B D     Crab-eating macaque  agaat----------------a---------a---gtgagactgcgtaa---------------cactgc
B D                  Baboon  agaat----------------a---------a---gtgagactgcgtaa---------------cactgc
B D            Green monkey  agaat----------------a---------a---gtgagactgcgtaa---------------cactgc
B D                Marmoset  agact----------------a---------a---gtcagactgcataa---------------ca-tgc
B D         Squirrel monkey  agaat----------------a---------a---gtcagactgcataa---------------cactgc
B D                Bushbaby  agaat----------------c---------a---gtcagcctgcataa---------------caccgc
         Chinese tree shrew  agaat----------------a---------a---atcagactgcatag---------------cactgc
B D                Squirrel  agaat----------------c---------a---gtcagactacatag---------------cactgc
     Lesser Egyptian jerboa  agaac----------------a---------a---gtcagactgcattt---------------cactgc
               Prairie vole  ggaat----------------a---------a---gtcagcctgcctaa---------------cccagc
B D         Chinese hamster  agaat----------------a---------a---gtcagactgcacaa---------------cccagc
             Golden hamster  agaat----------------a---------a---gtcagactgcacaa---------------cgcagc
B D                   Mouse  aaaat----------------a---------a---gccagactgcatag---------------cccagc
B D                     Rat  aaaat----------------a---------a---gccagattgagtag---------------cccagc
B D          Naked mole-rat  aaaataagtcagccaaaaagaa---------a---gtcagcctgcataa---------------tgcagc
B D              Guinea pig  agcat----------------a---------a---atcagcctgcat-c---------------ctcacc
                 Chinchilla  agaat----------------a---------a---gtcagtctgcat-c---------------cacagc
           Brush-tailed rat  aggat----------------a---------a---gttagcctgcat-c---------------cacatc
B D                  Rabbit  --gct----------------g---------c---acctgc---cattt---------------ttctgc
B D                    Pika  gagct----------------ggtggtaggta---accagc--acattt---------------tgcagc
B D                     Pig  agaat----------------a---------g----tcagactgcata----------------------
B D                  Alpaca  agaat----------------a---------a----tcagactgcgtaa---------------caccac
             Bactrian camel  agaat----------------a---------a----tcagactgcgtaa---------------caccac
B D                 Dolphin  agaat----------------a---------a----ccagactacgtaa---------------cacccc
               Killer whale  agaat----------------a---------a----ccagactatgtaa---------------cacccc
           Tibetan antelope  agaat----------------a---------atcaaccagactatttaa---------------cacccc
B D                     Cow  agaat----------------a---------atcagtcagactatgtaa---------------cacccc
B D                   Sheep  agaat----------------a---------atcaatcaaactatttaa---------------cacccc
              Domestic goat  agaat----------------a---------atcaatcaaactatttaa---------------cacccc
B D                   Horse  agaag----------------a---------a---gtcagactgcgtag---------------cacagc
B D        White rhinoceros  agaat----------------a---------a---gtcagaccgcgttg---------------cgctgc
B D                     Cat  agaat----------------a---------a---gtcagactgcataa---------------caccgc
B D                     Dog  agaat----------------a---------a---gtcagactgcatag---------------cgccac
B D                 Ferret   agaat----------------a---------a---gtcagactgcataa---------------caccac
B D                   Panda  agaat----------------a---------a---gtcagcctgcatga---------------caccac
             Pacific walrus  agaat----------------a---------a---gtcagactgcataa---------------caccac
               Weddell seal  agaat----------------a---------a---gtcagactgcataa---------------caccac
           Black flying-fox  agagt----------------a---------a---gtcacactgcataa---------------cactgc
B D                 Megabat  agagt----------------a---------a---gtcacactgcataa---------------cactgc
       David's myotis (bat)  agaat----------------a---------a---gtcagactgcagaa---------------caccgc
B D                Microbat  agaat----------------a---------a---gtcagactgcagaa---------------caccgc
B D                Hedgehog  agaat----------------a---------a---gtcagactgactaa---------------ctctgc
B D                   Shrew  tgagt----------------a---------a---gtcagtctgcactg---------------caccac
            Star-nosed mole  agaat----------------a---------a---atcaaactgtataa---------------caccac
B D                Elephant  tgact----------------g---------a---gacagactgcagagcgccgcagag-----cgccgt
        Cape elephant shrew  tgagg----------------a---------a---ggcgggctgcagagctcggca--------------
B D                 Manatee  -gagt----------------a---------a---tacagacttcagag----------------gatgc
           Cape golden mole  agagg----------------a---------a---aacagattgcagag---------------cccagt
B D                  Tenrec  agagg----------------a---------a---gccgggctgggggg------agagtgccacctggg
                   Aardvark  agagc----------------a---------a---gacagattgcagag---------------cacccc
B D               Armadillo  agagt----------------a---------a---gacagatttcctaa---------------tgccac
B D                 Opossum  aaaat----------------g---------g---ggccaagtgaataa---------------cacttc
B D         Tasmanian devil  ataat----------------g---------g---agccaagtgaataa---------------cacttc
             Big brown bat  ======================================================================
B D      American alligator  ======================================================================
  D         Green seaturtle  ======================================================================

                      Human  atggg----gtatggaacgagggtggatttgagc---caa-accactgagggaagtttatc---agatct
                      Chimp  atggg----gtatggaacgagggtggatttcagc---caa-accactgagggaagtttatc---agatct
                    Gorilla  atggg----gtacggaacgagggtggatttgagc---caa-accactgagggaagtttatc---agatct
                  Orangutan  atggg----gtacagaacgagggtggatttgagc---caa-gccactgagggaagtttatc---agatcc
                     Gibbon  atggg----gtacagaacgagggtggatttgagc---caa-gccactgagggaagtttatc---agatct
                     Rhesus  atggg----gtacggaacaagggtggatttgagc---caa-gccactgagggaagtttatc---aggtct
        Crab-eating macaque  atggg----gtatggaacaagggtggatttgagc---caa-gccactgagggaagtttatc---aggtct
                     Baboon  atggg----gtacagaacgagggtggatttgagc---caa-gccactgagggaagtttatc---aggtct
               Green monkey  atggg----gtacagaacgagggtgtatttgagc---caa-gccactgagggaagtttatc---aggtct
                   Marmoset  atggg----gtacagaacgagggtggatttgagc---caa-gacactgagggaagtttatc---agatct
            Squirrel monkey  atggg----gtacagaacgagggtggatttaagc---caa-gccactgagggaagtttatc---agatct
                   Bushbaby  agggg----gtacggaacctgga-ggggttgagc---caa-gccaccgaggagagcttatc---agatct
         Chinese tree shrew  atggg----gccctgaacaagggtgagtttgagt---tga-gccactgaggggagttcatc---agatct
                   Squirrel  ggggg----gtgtgcagcaagt--gaatttgagc---caa-gccacccagggaagtttatc---agatct
     Lesser Egyptian jerboa  agggg----gtgtagaatgagt--gaatttgggc---caa-gccaccaagggaagttgatc---agatct
               Prairie vole  aggcg----ttacgggatgagt--gaatttgaga---caa-gccatagaga---gttcatc---agatct
            Chinese hamster  agagg----ttatgggatgagt--gaatttgagg---caa-gccatagagagtggtttatc---agatct
             Golden hamster  agggg----tcatgggatgcgt--gaatttgagg---caa-gccttagggagcagtttatc---agatct
                      Mouse  agggg----ctgtggaatgagt--gaatttggag---caa-gccatagagaggagtt-atc---agatct
                        Rat  agggg----ttgtgagatgagt--gaatttgaag---caa-gccacagagaggagtt-atc---caatct
             Naked mole-rat  aaggg----gtatggaatctga--ga-tttgaat---cag-ggcacaaaaggaagtttatc---acatct
                 Guinea pig  ggggg----ct-caaaacctga--gaatttgagt---cag-ggagcggaaggaggtttatc---agatgt
                 Chinchilla  agggg----atccgggacctga--gactttgagt---caa-ggcgcagaaggaagtttatc---agatgt
           Brush-tailed rat  agggg----gtacagaacctga--gaatttaagt---caa-ggtgcaggaagaagtttatc---aaatgt
                     Rabbit  aggga-----tgcagagcaagggtgagttagagc---cag-gccccaa-ggggagctcagc---agatcc
                       Pika  a-----------------------gagtgtgagc---cag-accccaa--gggagttcatc---agaatc
                        Pig  ---gg----gtgcagaacaagggtgagtttgaag---cag-gccactgagggaaa-----------atct
                     Alpaca  agggg----gtgcagaccaagggtgagtttaaac---taa-gccaccaagggaag-----------atgt
             Bactrian camel  agggg----gtgcagaccaagggtgagtttaaac---taa-gccaccaagggaag-----------atgt
                    Dolphin  acggg----gagtagggcaagggtgagttgaaac---caa-gccactgagggaag-----------atct
               Killer whale  atggg----gagcaggacaagggtgagttgaaac---caa-gcccctgagggaag-----------atct
           Tibetan antelope  gtggg----gtgcggga-gagggtgagtttgagc---caa-gtcagtgagggtag-----------atat
                        Cow  gtggg----gtgcaggaccagggtgaatttgagc---caa-gccagtgagggaag-----------atat
                      Sheep  ttggg----atgctgga-gagggtgagtttgagc---caa-gccagtgagggaag-----------atat
              Domestic goat  gtggg----atgctgga-gagggtgagtttgagc---caa-gccagtgagggaag-----------atat
                      Horse  atggg----gtccagaataagggtgagtttgaac---caa-gcctccgagggaagtc-gtc---agatct
           White rhinoceros  atggg----atacagaacaagggtgggtttgaac---caa-gccactaagggaagta-gtc---agatct
                        Cat  atggg----gtagggaacaagggtgagtttgaac---caa-gccactcagggaagttggtc---agatct
                        Dog  gtggg----gtgcggaacaagggtgagtttgaac---cca-gcccgtcagggaagcttgtc---agatct
                    Ferret   atggg----gtacagaacgagggtgagtttgaac---caa-gccactc-gggaagtctgtc---agatct
                      Panda  atggg----gtccggaac-agggtgagtttgaac---caa-gccactcaggcaagtctgtc---agatct
             Pacific walrus  atggg----gtatggaacaagggtgagtttgaac---caa-gccactcagggaagtctgtc---agatct
               Weddell seal  atggg----gtatggaacaagggtgagtttgaac---caa-gccactcagggaagtctgtc---agatct
           Black flying-fox  atggg----atacggaacaagggcgagtttgaac---caa-gccatggagggaagttggtc---atatct
                    Megabat  atggg----atacggaacaagggcgagtttgaac---caa-gccatggagggaagttggtc---atatct
       David's myotis (bat)  atggg----gtacggaacaaggacgagtttgaaccaacaa-gccatggagggaagtttgtc---agattc
                   Microbat  atggg----gtacggaacaagggcgagtttgaaccaacaa-gccatggagggaagtttgtg---agattc
                   Hedgehog  atgtg----gtacagaacaagagtgagttaaaat---caa-accattgagtggggttcctc---agacct
                      Shrew  atgggttatgaatgaaaccagggtgagcttaaac---cga-gccacaga-gaaggttatgc---tgctct
            Star-nosed mole  atggg----gcatagaccaagggtgaatttgacc---caa-gccactgagggaggtttatc---aggcct
                   Elephant  gtgag----ggatggagtgagggtgaatttgagc---caa-gccctga-gggaaatttatcagaagatct
        Cape elephant shrew  --caa----gcatggcgtgagggtgaagtccagc---cac-tcccccaggggaaacttagcagaaaactc
                    Manatee  gtagg----ggatggagtgagggtgaattagagc---caa-gcccctaagggaaatttatcagaagatct
           Cape golden mole  gtggg----ggacagagtgagggtgaattccagc---caa-gcccctgagggaaatttatcagaagatct
                     Tenrec  gcgag----gg-tggagtaagggtgcatgccggc---caa-gctcctgagggagctttatc---agatct
                   Aardvark  atgag----ggacagtgtgaggatgaattccagc---cag-gccc--aagggaaatttatc---agatct
                  Armadillo  ataga----gtactgaatgaggatgaaattgaac---caa-gctactgagggaaatttatg---agatct
                    Opossum  ctggg----gtgaggattgaaggggaactttggc---caaaggcactaatgaggacctagtatgaaattc
            Tasmanian devil  atggg----gtggatattgaaggggaactttagc---caacagaaataatgaagatctattatgggattc
              Big brown bat  ======================================================================
         American alligator  ======================================================================
            Green seaturtle  ======================================================================

                      Human  tt--gagtaagtagaaaaca----ggc--tgcagttt-aat-gaa--ccacactg-agaagc--------
                      Chimp  tt--gagtaagtagaaaaca----ggc--tgcagttt-aat-gaa--ccacactg-agaagc--------
                    Gorilla  tt--gagtaagtagaaaaca----ggc--tgcagttt-aat-gaa--ccacactg-agaagc--------
                  Orangutan  tt--gaataagtagaaaaca----ggc--tgcagttt-aat-gaa--ccacactg-agaagc--------
                     Gibbon  tt--gaataagtagaaaaca----ggc--tgcagttt-aat-gaa--ccacactg-agaagc--------
                     Rhesus  tt--gaataagtagaaaaca----ggc--tgcagttt-aat-gaa--ccacactg-agaagc--------
        Crab-eating macaque  tt--gaataagtagaaaaca----ggc--tgcagttt-aat-gaa--ccacactg-agaagc--------
                     Baboon  tt--gaataagtagaaaaca----ggc--tgcagttt-aat-gaa--ccacactg-agaagc--------
               Green monkey  tt--gaataagtagaaaaca----ggc--tgcagttt-aat-aaa--ccacactg-agaagc--------
                   Marmoset  tt--gaataagtagaaaaca----ggc--tgcagttt-aat-gaa--ccacaccg-agaagc--------
            Squirrel monkey  tt--gaataagtagaaaaca----ggc--tgcagttt-aat-gaa--ccataccg-agaagc--------
                   Bushbaby  tt--gaatgagtaggaagca----gtc--tacagttt-aat-gaa--gcacaggg-aggacc--------
         Chinese tree shrew  tt--gaagaagtaggaaaca----ggc--tgcagtta-aat-ggg--ccacagtg-aaaagt--------
                   Squirrel  tt--gaataagtaggaacca----ggc--taccgttt-aat-gga--ccacaccg-agaagc--------
     Lesser Egyptian jerboa  tttgaaaa-agtaggaacca----ggc--tgcagttt-aat-gga--ccacacag-agaagc--------
               Prairie vole  tt--gagt-agagcagacca----gga--tgcagttt-aat-gga--ccacactg-agaaaa--------
            Chinese hamster  tt--gaat-agtgggagcca----ggc--tgccgttt-aat-gga--ccacactg-agactc--------
             Golden hamster  at--gaat-agtgggagcca----ggc--tgcggttt-aat-gga--ccacattg-agactc--------
                      Mouse  tt--gaat-agtg-gatgca----ggc--tgcagttt-aat-gga--cc-tgctg-agaagc--------
                        Rat  tt--gaat-cgtg-gagcca----ggc--tgcagttt-aat-gag--cc-tgctg-agaagc--------
             Naked mole-rat  ct--aaataagtaggaagca----ggc--tgctgttt-aat-gga--ccacagtg-agcggc--------
                 Guinea pig  ct--gaataagaaggaacct----ggc--c-cagttt-aat-gac--ccacagtg-agcagc--------
                 Chinchilla  ct--gaataagtagcaaaca----ggc--cgcagtat-aat-gac--ccccagtg-agcggc--------
           Brush-tailed rat  ct--gaatgagcaggaagca----ggc--cacagttt-aat-ggc--ccatagtg-agtggc--------
                     Rabbit  tg--gagtctgtaggagaca----ggc--tgctgt-t-cat-gga--ccccactg-agaagcgatgtgat
                       Pika  ca--gagtcagaaggagaca----ggc--tcccatgc-cgt-gga--ccccaacg-agaagcagtgtgat
                        Pig  tt--gaataagtgggaaaca----gtc--tgcccttt-aat-gga--ccacgctg-agaagc--------
                     Alpaca  tt--gaataagtgagaaaca----ggc--tgcccttt-gat-ggg--ccacactg-agaagc--------
             Bactrian camel  tt--gaataagtgagaaaca----ggc--tgcccttc-gat-ggg--ccacactg-agaagc--------
                    Dolphin  tt--gaatacgtgggaaaca----ggctgtgcccttt-aat-ggg--ccacatgg-aaaagc--------
               Killer whale  tt--gaataagtgggaaaca----ggc--tgcccctt-aat-ggg--ccacatgg-aaaagc--------
           Tibetan antelope  tt----gtaagtggggagaa----ggc--tgcccttt-aat-ggt--ctataagg-agaagc--------
                        Cow  tt--g-gtaagtgggaagaa----ggc--tgcccttt-aat-ggt--ttataagg-agaagc--------
                      Sheep  tt--g-gtaagtggggagaa----ggc--tgcccttt-aat-ggt--ctataagg-agaagc--------
              Domestic goat  tt--g-gtaagtggggagaa----ggc--tgcccttt-aat-ggt--ctataagg-agaagc--------
                      Horse  tt--gactccctggga-aca----ggc--tacagttt-aac-agg--ccacactg-agaaac--------
           White rhinoceros  tt--aa-tatgtggga-aca----ggc--tgcggttc-agt-ggg--ccacactg-agaagc--------
                        Cat  tt--gaatgactgagaaaca----ggc--taccgtttaaat-ggg--ccacactg-agatgc--------
                        Dog  tc--gaacaaatggaagaga----ggc--taccctttcaatgggg--ccacgtgg-agaagc--------
                    Ferret   tt--gaataaatgggaaaga----ggc--tgccctttcaat-ggg--ccaccctg-agaagc--------
                      Panda  tt--gaatacatgggaaaga----ggc--tacccttttcat-ggg--ccaccctg-agaagc--------
             Pacific walrus  tt--gaataaatgggaaaga----ggc--taccctttaaat-ggg--ccaccctg-agaagt--------
               Weddell seal  tt--gaatcaatgggaaaga----ggc--taccctttaaat-ggg--ccaccctg-agaagt--------
           Black flying-fox  tt--gaatgagtggaaaaca----ggg--tgcaattt-cat-ggg--ccacactg-agaagc--------
                    Megabat  tt--gaatgagtggaaaaca----ggg--tgcagttt-cat-ggg--ccacactg-agaagc--------
       David's myotis (bat)  tt--gaatgagtgggaaacg----gac--tgcagttt-aaa-tag--ctgcatgg-agaagc--------
                   Microbat  tt--gaataagtgggaaacg----ggc--tgcagttt-aat-ggg--ccgcat-g-agaagc--------
                   Hedgehog  tt--ggataaatggaaaaga----ggc--tacagtgt-aat-gga--ccacactg-aaataa--------
                      Shrew  tt--gagtaagtggaaaaca----ggc--tgccggtt-aag-gtc--ccacactg-agaggc--------
            Star-nosed mole  tt--gaataagtgtcaaaca----ggc--agcaattt-aat-ggg--ccacattg-agcagc--------
                   Elephant  tt--gaataaataggaaact----ggc--tgcagttt-aat-ggg--ccacactg-agaagt--------
        Cape elephant shrew  cc--caacaaataagaaatcttgaggc--tgcagttt-a--------------tgcagaagg--------
                    Manatee  ct--gaataaataggaaata----ggc--tgcagttt-agt-gag--ctacactg-agaagt--------
           Cape golden mole  tt--gaacaaattggaactg----ggc--tgcagttt-aat-ggg--ccataccg-agaaat--------
                     Tenrec  ct--gagcaaacagaaa--------gc--tgctgttg-aat-gcg--ccaccggg-agcagt--------
                   Aardvark  ct--gaatgaataagaaaca----ggc--tgcagttc-aat-gga--ccacaccg-agaact--------
                  Armadillo  tt--gaataagcaggaaatc----cgc--tgctgttt-cat-gga--ccacaaca-agaagt--------
                    Opossum  tt--aaa-aggtggaaataa----gac--catagttt-aaa-gaaccctatatag-aggggt--------
            Tasmanian devil  at--aaa-agaagaaaataa----gac--catggttt-aaa-gga--ctacatgc-agaagc--------
              Big brown bat  ======================================================================
         American alligator  ======================================================================
            Green seaturtle  ======================================================================

                      Human  --actttccc------------tggtg--------------------------------atgc-------
                      Chimp  --actttccc------------tggtg--------------------------------atgc-------
                    Gorilla  --actttccc------------tggtg--------------------------------atgc-------
                  Orangutan  --actttccc------------tggtg--------------------------------atgc-------
                     Gibbon  --actttccc------------tggtg--------------------------------atgc-------
                     Rhesus  --actttccc------------tggtg--------------------------------atgc-------
        Crab-eating macaque  --actttccc------------tggtg--------------------------------atgc-------
                     Baboon  --actttccc------------tggtg--------------------------------atgc-------
               Green monkey  --actttccc------------tggtg--------------------------------atgc-------
                   Marmoset  --actttccc------------tggtg--------------------------------atgc-------
            Squirrel monkey  --actttccc------------tggtg--------------------------------atgc-------
                   Bushbaby  --actctccc------------tgggg--------------------------------gtgc-------
         Chinese tree shrew  --gctttccc------------tggtgtacactcatgacctaaaataataataataataatac-------
                   Squirrel  --actttccc------------tagca--------------------------------gtac-------
     Lesser Egyptian jerboa  --attttcct------------tggtg--------------------------------atgt-------
               Prairie vole  --acattcta------------tgggg--------------------------------atac-------
            Chinese hamster  --atgctcag------------tactg--------------------------------atat-------
             Golden hamster  --gtgctctg------------tgctg--------------------------------atat-------
                      Mouse  --atgatccg------------tggtg--------------------------------acgt-------
                        Rat  --atggtctg------------tggtg--------------------------------acat-------
             Naked mole-rat  --attttccc------------tggag--------------------------------atgc-------
                 Guinea pig  --accttccc------------tggcg--------------------------------atgc-------
                 Chinchilla  --actttccc------------t---g--------------------------------gcat-------
           Brush-tailed rat  --actttcgt------------gggag--------------------------------gtgc-------
                     Rabbit  gcagtttccc------------tggcg--------------------------------atgc-------
                       Pika  gtagtttccc------------tggtg--------------------------------ataa-------
                        Pig  --actgtccg------------tgaag--------------------------------atgc-------
                     Alpaca  --actgtccc------------cgatg--------------------------------atgt-------
             Bactrian camel  --actgtccc------------cgatg--------------------------------atgc-------
                    Dolphin  --atggtccc------------tggtg--------------------------------atc--------
               Killer whale  --atggtccc------------tggtg--------------------------------atc--------
           Tibetan antelope  --attgtccc------------tggtg--------------------------------atg--------
                        Cow  --atcgtccc------------tggtg--------------------------------atg--------
                      Sheep  --atcgtccc------------tggta--------------------------------atg--------
              Domestic goat  --atcgtccc------------tggtg--------------------------------atg--------
                      Horse  --gctttcct------------tggcg--------------------------------gtgt-------
           White rhinoceros  --tctttccc------------tgggg--------------------------------gtgc-------
                        Cat  --actctccc------------tggtg--------------------------------atgt-------
                        Dog  --gctttccc------------tggtg--------------------------------atgc-------
                    Ferret   --gctttccc------------tggtg--------------------------------atgt-------
                      Panda  --gctttccc------------tggtg--------------------------------atgc-------
             Pacific walrus  --gctttccc------------tggtg--------------------------------atgc-------
               Weddell seal  --gctttccc------------tggtg--------------------------------aggc-------
           Black flying-fox  --actttccc------------tggtg--------------------------------atgc-------
                    Megabat  --actttccc------------tggtg--------------------------------atgc-------
       David's myotis (bat)  --accttccc------------tggcg--------------------------------atgt-------
                   Microbat  --accttccc------------tggca--------------------------------atgt-------
                   Hedgehog  --actt----------------tgatg--------------------------------atgt-------
                      Shrew  --actgtcct------------tggtg--------------------------------atga-------
            Star-nosed mole  --actttcc-------------tagtg--------------------------------atgc-------
                   Elephant  --gctttccc------------tggtg--------------------------------atgc-------
        Cape elephant shrew  --actttccc------------t-gtg--------------------------------atgc-------
                    Manatee  --gctttccc------------tggcg--------------------------------atgc-------
           Cape golden mole  --gcttttct------------tggtg--------------------------------atgc-------
                     Tenrec  --gctttctc------------tgcat--------------------------------atgc-------
                   Aardvark  --gcttttcc------------tggtg--------------------------------atgc-------
                  Armadillo  --gctttccc------------tggtg--------------------------------atgc-------
                    Opossum  --tttttgcctatcaaacagcttggtg--------------------------------atatgcagttt
            Tasmanian devil  --tttttgcctaccaaacaacctagtg--------------------------------acatac-----
              Big brown bat  ======================================================================
         American alligator  ======================================================================
            Green seaturtle  ======================================================================

                      Human  -agtttct----c---ttcc-atgacct-aaaatcatcc-aaacctcctca---agctc-taaaactg--
                      Chimp  -agtttct----c---ttcc-atgacct-aaaaacatcc-aaacctcctca---agctc-taaaactg--
                    Gorilla  -agtttct----c---ttcc-atgacct-aaaaacatcc-aatcctcctca---agctc-taaaactg--
                  Orangutan  -agtttct----c---ttcc-atgacct-aaaaacatcc-aaacctcctca---agctc-taaaactg--
                     Gibbon  -agtttct----c---ttcc-atgacct-aaaaacatcc-aaacctcctca---agctc-taaaactg--
                     Rhesus  -agtttct----c---ttcc-atgacct-aaaaacatcc-aaacctcctca---agctc-taaaactg--
        Crab-eating macaque  -agtttct----c---ttcc-atgacct-aaaaacatcc-aaacctcctca---agctc-taaaactg--
                     Baboon  -agtttct----c---ttcc-atgacct-aaaaacatcc-aaacctcctca---agctc-taaaactg--
               Green monkey  -agtttct----c---ttcc-atgacct-aaaaacatcc-aaacctcctca---agctc-taaaactg--
                   Marmoset  -agtttct----c---tttc-atgacct-aaaaaaatcc-agacctcctca---agatc-taaaactg--
            Squirrel monkey  -agtttct----c---ttcc-atgacct-aaaaaaatcc-aaacctcctcg---agctc-taaaactg--
                   Bushbaby  --tcttct----c---ttcc-ctgaccc-cccaa-atcc-aaacctcctca---ggctc-taacactg--
         Chinese tree shrew  -atttttt----------------aaat-aaaaaaatcc-aaacttcttca---agctt-taaaacta--
                   Squirrel  -agtttct----c---tgcc-atgacctaaaaaa--tcc-aaacctcctca---agctc-taaaactg--
     Lesser Egyptian jerboa  -ggattct----c---ttcc-atgacctcaaaaa--ttc-aaactttctca---aactc-tgaagctg--
               Prairie vole  -gatttct--------ttcc-aaaagct-aaaac--ttc-aagctttcttg---agctc-taaaactg--
            Chinese hamster  -gatttct--------ttcc-aagagtt-aaaat--ttc-agacttcctca---agctc-taaaaccg--
             Golden hamster  -catttct--------ttcc-aagagct-aaaat--ttc-aaatttcctca---agttc-taaaactg--
                      Mouse  -gatttct--------ttcc-atgacct-caaac--ttc-aagcttcatcg---agctc-aaaacctg--
                        Rat  -ggcttcc--------ttcc-aagacct-aagac--ttc-aaacttcgtca---agctc-taaaacgg--
             Naked mole-rat  -agtttct----c---ttcc-atgacct-aaaaa--tcc-aaaccccctta---agctc-taaaactg--
                 Guinea pig  -agttcct----t---ttcc-atgacct-aaaag---cc-aaacctcttct---agctc-tgaaactg--
                 Chinchilla  -agtttct----c---ttct-gtgacct-aaaaa--tcc-aaacctcttca---agctc-cagaactg--
           Brush-tailed rat  -agtttct----c---ttcc-atgacct-aaaaa--tcc-aagcttcttca---aactc-tgaaacta--
                     Rabbit  -catgttt----c---ttcc-acgaccc-agaaa--ctc----cctcccga---agctc-tccaactg--
                       Pika  -catgttt----c---ttcc-atgacct-agcaa--ctccaagcctcttga---agctc-tccaactg--
                        Pig  -gttttct----c---ttcc-atgagct-agaaa--tcc-cagcctcctct---agctc-taaaactg--
                     Alpaca  -ggtttct----c---ttcc-atgtgct-aaaaa--tcc-gagcctcctca---acctc-taaaatgg--
             Bactrian camel  -ggtttct----c---ttcc-atgtgct-aaaaa--tcc-gagcctcctca---acctc-taaaatgg--
                    Dolphin  -----tttttccc---ttcc-atgagct-ag-aa--tcc-aagcctcctca---ggctc-taagactg--
               Killer whale  -----tttttccc---ttcc-atgagct-ag-aa--tcc-aagcctcctca---ggctc-taagactg--
           Tibetan antelope  -----ttt----c---ttcc-ctgagct-agaaa--tcc-aagcttcctca---agctc-tgaaactg--
                        Cow  -----ttt----c---ttcc-ctgagct-agaaa--tcc-aagcctcctca---agctc-tgaaactg--
                      Sheep  -----ttt----c---ttcc-ctgagct-agaaa--tcc-aagcttcctca---agctc-tgaaactg--
              Domestic goat  -----ttt----c---ttcc-ctgagct-agaaa--tcc-aagcttcctca---agctc-tgaaactg--
                      Horse  -gatttcc----c---ttcc-atgagct-aaaaa--tcc-aaacgtgctca---agctc-taaaactg--
           White rhinoceros  -ggtttcc----c---ttcc-gtgagtt-gaaag--tcc-aaacctcctca---ag---------ctg--
                        Cat  -gctttct----c---ttcc-atgagctaaaaaa--t-c-aaacctcctca---agctc-caca-ctg--
                        Dog  -ggtttct----g---ttcc-gtgagtt-aaaac--t-c-aaacctcccca---agctc-taaa-ctg--
                    Ferret   -ggtttct----c---ttcc-gtgagct-aaaaa--t-c-aaacctcctga---agctc-taac-ctg--
                      Panda  -ggtttct----c---ttcc-atgagct-aaaga--t-c-aaacatcctca---agctc-cagc-ctg--
             Pacific walrus  -ggtttct----c---ttcc-atgagct-aaaaa--t-c-aaacttcctca---agctc-taac-ctg--
               Weddell seal  -ggtttct----c---ttcc-atgagct-aaaaa--t-c-aaacctcctca---agctc-taac-ctg--
           Black flying-fox  -gatttct----c---tatc-atgagct-aaaaa--tcc-aaaccttctc-----gctc-taaaactg--
                    Megabat  -gatttct----c---tatc-atgacct-aaaaa--tcc-aaaccttctc-----gctc-taaaactg--
       David's myotis (bat)  -agtttat----c---ttct-gtaagct--aaac--tcc-aaacctcctca---agctc-taaagctg--
                   Microbat  -agtttgt----c---ttct-gtaagct--aaac--tcc-aaacctcctca---agctc-taaagctg--
                   Hedgehog  -gagttct----c---ttcg-ttgagct-aaaaa--tac-aaatctccttt---aactc-taaaatta--
                      Shrew  -ggtttct----c---ttcc-atgagag-aaaca--t-t-acatctcttta---agctc-gaaaactggt
            Star-nosed mole  -agtttc-----c---ttcc-atgtgtt-aaaaa--tcc-aaatctcctta---tgctc-tgaacttg--
                   Elephant  -agtttgt----c---ttcc-atgagct-aaaaa-gccc-aaatctcctca------cc-taaaactg--
        Cape elephant shrew  -tgtttat----c---ttccaaagaact-aaaac-actc-aaacctcctca---agccc-taaaacgg--
                    Manatee  -agtttgt----c---ttcc-gtgagct-aaaaa-accc-agacctcctca---agccc-taaagctg--
           Cape golden mole  -aatttat----c---ttcc-atgagct-aatga-accc-aaacctcctca---agtccgtaaaactg--
                     Tenrec  -agcttgg----c---ttcc-acaagtt-aataa-acac-aaacctcctgg---agcccgcaaaccgg--
                   Aardvark  -agtttgt----c---ttcc-atgagcc-aaaat-accc-aaacctcttca---agccc-taaaactg--
                  Armadillo  -cgtttct----c---ctct-ataagct-aa--a-accc-aaacctcctcc---tgctc-taaaactg--
                    Opossum  tagtttct----cctcctcc-aaaagat-gaaga--ttt-aaaccaactct---ggctc-tcagattg--
            Tasmanian devil  -agtttct----ccatctgc-agatgat-gaaaa--tat-caactaactattagggctc-ttagactg--
              Big brown bat  ======================================================================
         American alligator  ======================================================================
            Green seaturtle  ======================================================================

                      Human  ---------------------------------------------gcagaaat-ttgaacaaaggctt
                      Chimp  ---------------------------------------------gcagaaat-ttgaacaaaggctt
                    Gorilla  ---------------------------------------------gcagaaat-ttgaacaaaggctt
                  Orangutan  ---------------------------------------------gcagaaat-ttgaacaaaggctt
                     Gibbon  ---------------------------------------------gcagaaat-ttgaacaaagcctt
                     Rhesus  ---------------------------------------------gcagaaat-ttgaacaaaggctt
        Crab-eating macaque  ---------------------------------------------gcagaaat-ttgaacaaaggctt
                     Baboon  ---------------------------------------------gcagaaat-ttgaacaaaggctt
               Green monkey  ---------------------------------------------gcagaaat-ttgaacaaaggctt
                   Marmoset  ---------------------------------------------gcagaaat-ttgaaaaaaggctt
            Squirrel monkey  ---------------------------------------------gcagaaat-ttggacaaaggctt
                   Bushbaby  ---------------------------------------------gtagaaat-ttgaacaaagcctt
         Chinese tree shrew  ---------------------------------------------gcagaaat-ttgaacaaaggctt
                   Squirrel  ---------------------------------------------gtagagat-ttgaacaaaggcta
     Lesser Egyptian jerboa  ---------------------------------------------gtaggcat-ctgaacaaaggttt
               Prairie vole  ---------------------------------------------gtagacat-ttaaacaaagattc
            Chinese hamster  ---------------------------------------------ataggcat-ttgtacaaagattg
             Golden hamster  ---------------------------------------------ctagacat-ttgaacgaggattg
                      Mouse  ---------------------------------------------gtagacat-tt-gacaaagattt
                        Rat  ---------------------------------------------gtagacat-ttggacaaaggttt
             Naked mole-rat  ---------------------------------------------gtagaaat-ctgaacaaaggctt
                 Guinea pig  ---------------------------------------------gtagaaat-ctgaacaaaggctt
                 Chinchilla  ---------------------------------------------gtagaaat-ctgaacaaagtctt
           Brush-tailed rat  ---------------------------------------------gtaaaaat-ctgaacaaagtctt
                     Rabbit  ---------------------------------------------gcagacat-tttaacaaa----t
                       Pika  ---------------------------------------------gcagatat-ttgaacaaagattt
                        Pig  ---------------------------------------------gtagaaat-ttgaacaaagcctc
                     Alpaca  ---------------------------------------------gcagaaat-ttgaagaaagcctt
             Bactrian camel  ---------------------------------------------gcagaaat-ttgaataaagcctt
                    Dolphin  ---------------------------------------------gtagaaat-tagaacaaaccctt
               Killer whale  ---------------------------------------------gtagaaat-tagaacaaaccctt
           Tibetan antelope  ---------------------------------------------atataaat-ttgaacaaagcctt
                        Cow  ---------------------------------------------gtataaat-ttgaacaaagcctt
                      Sheep  ---------------------------------------------atataaat-gtgaacaaagcctt
              Domestic goat  ---------------------------------------------atataaat-ttgaacaaagcctt
                      Horse  ---------------------------------------------gtagaaat-ctcaacaaaggctt
           White rhinoceros  ---------------------------------------------gtagaaat-ttgaaaaaaggctt
                        Cat  ---------------------------------------------gtggaaat-gtgaacaaagactc
                        Dog  ---------------------------------------------gtagcaat-tcccactaagactc
                    Ferret   ---------------------------------------------gtagaagt-ttgaacaaaggctg
                      Panda  ---------------------------------------------gtagaaat-ttgagcaaagacca
             Pacific walrus  ---------------------------------------------gtagaaat-ttgaacaaagactg
               Weddell seal  ---------------------------------------------gtagaaat-ttgaacaaagactg
           Black flying-fox  ---------------------------------------------gcagaaat-ttgaactacacctt
                    Megabat  ---------------------------------------------gtagaaat-ttgaactacacctt
       David's myotis (bat)  ---------------------------------------------gcagaaat-ttgaacaaaggctt
                   Microbat  ---------------------------------------------gcagaaat-gtgaacaaaggctt
                   Hedgehog  ---------------------------------------------gtagaaat-ttaaacaaaatctt
                      Shrew  agaatgagagagagagagagagagagaaattaataaatgaaacaagtagaaat-ttgaacaaagcttt
            Star-nosed mole  ---------------------------------------------gcagaaat-ctgaacagagc-tt
                   Elephant  ---------------------------------------------gtaggaat-tgggacaaaggctt
        Cape elephant shrew  ---------------------------------------------gtaggaat-gtggacaaaggctt
                    Manatee  ---------------------------------------------gtagaaat-ttggacaaaggttt
           Cape golden mole  ---------------------------------------------gttgaaat-ttggacaaaggctt
                     Tenrec  -------------------------------------------------------tggacaagggctg
                   Aardvark  ---------------------------------------------ggagaaat-ttggataaaggctt
                  Armadillo  ---------------------------------------------gtagaaat-ttgaacaaaggctt
                    Opossum  ---------------------------------------------gcaagaatgtcacatcaagatct
            Tasmanian devil  ---------------------------------------------acaggtaggtcaaatcaagactt
              Big brown bat  ====================================================================
         American alligator  ====================================================================
            Green seaturtle  ====================================================================

Inserts between block 2 and 3 in window
B D               Elephant 1bp
       Cape elephant shrew 1bp
B D                Manatee 1bp
          Cape golden mole 1bp
B D                 Tenrec 1bp
                  Aardvark 1bp

Alignment block 3 of 243 in window, 104651290 - 104651291, 2 bps 
B D                   Human  ga
B D                   Chimp  ga
B D                 Gorilla  ga
B D               Orangutan  ga
B D                  Gibbon  ga
B D                  Rhesus  ga
B D     Crab-eating macaque  ga
B D                  Baboon  ga
B D            Green monkey  ga
B D                Marmoset  ga
B D         Squirrel monkey  ga
B D                Bushbaby  ga
         Chinese tree shrew  ga
B D                Squirrel  ga
     Lesser Egyptian jerboa  ga
               Prairie vole  ga
B D         Chinese hamster  ga
             Golden hamster  gg
B D                   Mouse  ga
B D                     Rat  ga
B D          Naked mole-rat  ga
B D              Guinea pig  ga
                 Chinchilla  ga
           Brush-tailed rat  ga
B D                  Rabbit  ca
B D                    Pika  ca
B D                     Pig  aa
B D                  Alpaca  ga
             Bactrian camel  ga
B D                 Dolphin  ga
               Killer whale  ga
           Tibetan antelope  ga
B D                     Cow  ga
B D                   Sheep  ga
              Domestic goat  ga
B D                   Horse  ga
B D        White rhinoceros  ga
B D                     Cat  ga
B D                     Dog  ga
B D                 Ferret   tg
B D                   Panda  ga
             Pacific walrus  ga
               Weddell seal  ga
           Black flying-fox  ga
B D                 Megabat  ga
              Big brown bat  ga
       David's myotis (bat)  ga
B D                Microbat  ga
B D                Hedgehog  ga
B D                   Shrew  ga
            Star-nosed mole  ga
B D                Elephant  ga
        Cape elephant shrew  ag
B D                 Manatee  ga
           Cape golden mole  ga
B D                  Tenrec  ta
                   Aardvark  ga
B D               Armadillo  ga
B D                 Opossum  ga
B D         Tasmanian devil  ga
B D      American alligator  ==
  D         Green seaturtle  ==

Alignment block 4 of 243 in window, 104651292 - 104651330, 39 bps 
B D                   Human  ttgtctgga-------ctgct----tattgctac--ta-ttctaaaataaaga
B D                   Chimp  ttgtctgga-------ctgct----tattgctac--ta-ttctaaaataaaga
B D                 Gorilla  ttgtctgga-------ctgct----tattgctac--ta-ttctaaaataaaga
B D               Orangutan  ttgtctgga-------ctgct----tattgctac--ta-ttctaaaataaaga
B D                  Gibbon  ttgtctggg-------ctgct----tattgctac--ta-ttctaaagtaaaga
B D                  Rhesus  ttgtctggg-------ctgct----tattgctac--ta-ttctaaaataaaga
B D     Crab-eating macaque  ttgtctggg-------ctgct----tattgctac--ta-ttctaaaataaaga
B D                  Baboon  ttgtctggg-------ctgct----tattgctac--ta-ttctaaaataaag-
B D            Green monkey  ttgtctggg-------ctgct----tattgctac--ta-ttctaaaataaaga
B D                Marmoset  ttgtctggg-------ctgct----tactgctag--ta-ttctaaaataaaga
B D         Squirrel monkey  ttgtctggg-------ctgct----tactgctag--ta-ttctaaaataaaga
B D                Bushbaby  ttgtctggg-------ctgta----tattgccag--ta-ttctgaaataaaga
         Chinese tree shrew  ttgtctggg-------ctgct----tattgccag--tg-atctgaaatgaaga
B D                Squirrel  ttgtctgta-------ctgct----tattgccag--ta-ttctgaaatgaaga
     Lesser Egyptian jerboa  ttgtgtgga-------ctgct----tgctgccag--tg-ttttgaagtgaaga
               Prairie vole  ttgtctgga-------cggct----tgtggccag--ga-ctttgaaaagat--
B D         Chinese hamster  ttgtctgga-------ctttt----tatggccag--ga-ttttgaaaagatga
             Golden hamster  ctgactgga-------ctgct----gagggccag--ga-ttttgaaaagatga
B D                   Mouse  ttgcctggg-------atgct----ttctgctgg--ga-ttttgagatgaaga
B D                     Rat  ttgcctgga-------atgct----cactgccag--gg-ttttgagatgaaga
B D          Naked mole-rat  ttgtctaga-------actct----tattgccag--ta-ttctgaaatgaaga
B D              Guinea pig  ctgtctgga-------cctct----tattgccag--ta-ttcaaaaatgaaca
                 Chinchilla  ccgtctaga-------cctct----tgttgccag--ta-gtctgaaatgaaga
           Brush-tailed rat  ctgtctaga-------cctct----tattggcag--ta-ttccaaaatgaaga
B D                  Rabbit  ttgtctggg-------ttgca----tattgcttattta-ttctgaaataaaga
B D                    Pika  ctgtccggggtgtccattgct----tattgcttattta-ttattaaataaaga
B D                     Pig  ttgtctggg-------cttct----tattgatat--ta-ttctgaaataaaga
B D                  Alpaca  ttgtctggg-------atcct----tattgccag--ta-ttctgaaataaaga
             Bactrian camel  ttgtctggg-------atcct----tattgccag--ta-ttctgaaataaaga
B D                 Dolphin  ctgtctggg-------ttcca----tattgccat--ta-ttctgaaataaaga
               Killer whale  ctgtctggg-------ttcca----tattgccat--ta-ttctgaaataaaga
           Tibetan antelope  ttgtctgtg-------ctcct----tatggctat--ta-ttctgaaataaaca
B D                     Cow  ttgtctggg-------ctcct----tatggctat--ta-ttctgaaataaaca
B D                   Sheep  ttgtctggg-------ctcct----tatggctat--ta-ttctgaaataaaca
              Domestic goat  ttgtctggg-------ctcct----tatggctat--ta-ttctgaaataaaca
B D                   Horse  tgggctggg-------ctcct----tattgccag--ta-ttttgaaataaagc
B D        White rhinoceros  ttggctggg-------ctcct----tgttgccag--ta-ttctgaaataaaga
B D                     Cat  tggtctagg-------atgct----tattgccgg--tg-tgctgaaataaaga
B D                     Dog  ttgtctggg-------atact----tgttggcag--tg-ttctgaaatagaga
B D                 Ferret   ttgtcgagg-------atact----tattgccgg--ta-ttctgaaatgaaga
B D                   Panda  ttgtctagg-------atact----tactgccag--tg-ttctgaaataaaga
             Pacific walrus  ttgtctagg-------atagt----tattgccag--ca-ttctgaaataaaga
               Weddell seal  ttgtctagg-------atact----tattgccag--ta-ttctgaaataaaga
           Black flying-fox  ttgtctggg-------ctcct----tattgccac--ta-atcagaaataagga
B D                 Megabat  ttgtctggg-------ctcct----tattgccac--ta-ttcagaaataagga
              Big brown bat  tcatctggg-------ctcct----tattgccat--tc-tactgaaataaaga
       David's myotis (bat)  ttatctggg-------ctcct----tattgccat--tc-ttctgaaataaaga
B D                Hedgehog  ttaaccagg-------ctact----tactgtcag--ta-gtctgaaataaaga
B D                   Shrew  ttgcctggg-------ttattggaataaatttgg--tg-ctctgaaataaaga
            Star-nosed mole  tt-tctcgg-------ctatt----tattgtcaa--ta-ttctgaaat-aaga
B D                Elephant  ttgtccggg-------ctact----tattgccag--gacttacaaaataaaac
        Cape elephant shrew  ctgtctggg-------ctgct----tattgtcag--gacatccaaaataaaca
B D                 Manatee  ttgtctggg-------ctact----tattgccca--tacttccaaaatgaaga
           Cape golden mole  ttgtctgga-------ct-ct----tattgccaa--gacttccaaaataaaga
B D                  Tenrec  ctggcgggg-------tc-ct----tcatgccag--gactgtggacatagaga
                   Aardvark  ttgcctggg-------ctatt----tattgccag--gacttccaaactaaggc
B D               Armadillo  ttgtctggg-------ctact----tattgccag--ta-ttctgaaataaaga
B D                 Opossum  tattctttg-------cattc----aggcaataa--tactactggagtaa---
B D         Tasmanian devil  tgttctttg------ccattt----aggtgataa--tacttctggagtga---
B D                Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D      American alligator  =====================================================
  D         Green seaturtle  =====================================================

Inserts between block 4 and 5 in window
B D                    Pig 1bp
B D                  Panda 1bp

Alignment block 5 of 243 in window, 104651331 - 104651336, 6 bps 
B D                   Human  ttt-t-----aa
B D                   Chimp  ttt-t-----aa
B D                 Gorilla  ttt-t-----aa
B D               Orangutan  ttt-t-----aa
B D                  Gibbon  ttt-t-----aa
B D                  Rhesus  ttt-t-----aa
B D     Crab-eating macaque  ttt-t-----aa
B D                  Baboon  ttt-t-----aa
B D            Green monkey  ttt-t-----aa
B D                Marmoset  ttt-t-----aa
B D         Squirrel monkey  ttt-t-----aa
B D                Bushbaby  ttt-t-----aa
         Chinese tree shrew  ttt-t-----aa
B D                Squirrel  ttt-g-----aa
     Lesser Egyptian jerboa  tct-t-----aa
               Prairie vole  -ct-t-----ca
B D         Chinese hamster  tct-t-----ta
             Golden hamster  act-t-----ta
B D                   Mouse  act-t-----ta
B D                     Rat  tct-t-----ta
B D          Naked mole-rat  ttt-t-----aa
B D              Guinea pig  ttt-t-----aa
                 Chinchilla  ttt-t-----ag
           Brush-tailed rat  ttt-t-----aa
B D                  Rabbit  ttt-ttt---ca
B D                    Pika  att-tttccccc
B D                     Pig  ttt-t-----aa
B D                  Alpaca  gtt-t-----aa
             Bactrian camel  ttt-t-----aa
B D                 Dolphin  ttt-t-----aa
               Killer whale  ttt-g-----aa
           Tibetan antelope  ttt-t-----aa
B D                     Cow  ttt-t-----aa
B D                   Sheep  ttt-t-----aa
              Domestic goat  ttt-t-----aa
B D                   Horse  ttt-t-----aa
B D        White rhinoceros  ttt-t-----aa
B D                     Cat  ttt-t-----aa
B D                     Dog  ttt-t-----aa
B D                 Ferret   ttt-t-----aa
B D                   Panda  ttt-t-----aa
             Pacific walrus  ttt-t-----aa
               Weddell seal  ttt-t-----aa
           Black flying-fox  ttttt-----aa
B D                 Megabat  ttttt-----aa
              Big brown bat  ttc-t-----ga
       David's myotis (bat)  ttc---------
B D                Hedgehog  ttt-t-----aa
B D                   Shrew  ttt-a-----aa
            Star-nosed mole  ttt-t-----aa
B D                Elephant  ttc-t-----aa
        Cape elephant shrew  ttt-t-----ta
B D                 Manatee  tta-t-----aa
           Cape golden mole  ttt-g-----ca
B D                  Tenrec  tt----------
                   Aardvark  ttt-t-----aa
B D               Armadillo  tat-g-----aa
B D                 Opossum  ttt-t------a
B D         Tasmanian devil  ttt-t-----aa
B D                Microbat  NNNNNNNNNNNN
B D      American alligator  ============
  D         Green seaturtle  ============

Inserts between block 5 and 6 in window
       Cape elephant shrew 572bp

Alignment block 6 of 243 in window, 104651337 - 104651494, 158 bps 
B D                   Human  -accttaggatag-------ctggccgga---atgcatcgtaagctgtgtgaacccaaggtgctcgaagg
B D                   Chimp  -accttaggatag-------ctggctgga---atgcatcgtaagctgtgtgaacccaaggtgctcgaagg
B D                 Gorilla  -accgtaggatag-------ctggctgga---atgcatcgtaagctgtgggaacccaaggtgctcgaagg
B D               Orangutan  -accataggatag-------ctggctgga---atgcatcgtaagctgtgtgaacccaaggtgctcgaagg
B D                  Gibbon  -accataggatag-------ctggctgga---atgcatcgtaagctgtgtgaacctaaggtgctcgaagg
B D                  Rhesus  -accataggatag-------ctggctaga---atgcatcgtaagctgtgtgaactcaaggtgctcgaagg
B D     Crab-eating macaque  -accataggatag-------ctggctaga---atgcatcgtaagctgtgtgaactcaaggtgctcgaagg
B D                  Baboon  -accataggatag-------ctggctaga---atgcatcgtaagctgtgtgaacccaaggtgctcgaagg
B D            Green monkey  -accataggatag-------ctggctaga---atgcatcgtaagctgtgtgaacccaaggtgctcgaagg
B D                Marmoset  -actaca-gataa-------ct-gcagga---atgtatcttaagctgtgtgatctcaacgtacccaaagg
B D         Squirrel monkey  -actataggataa-------ctggctgga---atgcatcataagctgtgtgaacccaaggtgccctaagg
B D                Bushbaby  -accctaggacag-------ctggctgga---atgcattgtgagctgtgtgaacccaaggtgctccaagg
         Chinese tree shrew  -accacagtatag-------ctggttgga---atgcatggtgagttg-gtgaaccccaggtgctccaagg
B D                Squirrel  -agcctaggataa-------ctggctgga---aggcattgtgagctgtgtgaacccaagatgttcaaagg
     Lesser Egyptian jerboa  -agcacagggcag-------ctgactaga---atgcactgtgagctgtgtgaacccaaggtgctcaaagg
               Prairie vole  -ggaataggacagcggaccgctgatgaga---gtgttctgtg--ctctgtgaaccccaggtgctcaacgg
B D         Chinese hamster  -agagtaaggtagctgatgactgactaga---gtgtactatgaactctgcgaa-cccgggcgctcaaagg
             Golden hamster  -agattaggatagctgacaactgaccaga---gtgcgctgtgaactctgtgaa-cgcaaacgctcaaacc
B D                   Mouse  -agaatagaatag-------ctgccagagctcgctcgctctgatctgtgtgaacccaaggtgctcaaagg
B D                     Rat  -agactagagtag-------ctacctgga---gttcactctgatctgtgtgaacccgaggtgctcaaagg
B D          Naked mole-rat  -agcataggatag-------ctggttggc---atgcactgtgagctgtgtgagcccaaggtattcaaagg
B D              Guinea pig  -agcataggatag-------ttggctggc---gtgcacctcgagctgtgtgagctcaaggtgctcgaaga
                 Chinchilla  -agtataggatac-------cgggttggc---atgcacaccgagctgtgtgagcccaaggtgctcaaaga
           Brush-tailed rat  -ggcatagactag-------ctagctggc---atgcactctcagctgtgtgagcccaaggtgctcaaaga
B D                  Rabbit  -accctgggagat-------ctgtctgga---aggcattgtgagctctgtg-----------ctcaaagg
B D                    Pika  -atcctgacagat-------ctgtccaga---aggccttgtgagct------------------------
B D                     Pig  -gccatagg---------------ctgga---atgcactgagagctgtgggaacccaagg----------
B D                  Alpaca  -gccatagggtat-------ctggctgca---atgcactgagagctgtgggaacccaagg----------
             Bactrian camel  -gccatagagtat-------ctggctgga---atgcactgagagctgtgggaacccaagg----------
B D                 Dolphin  -gccataggttat-------ctggctgga---atgcaccgtgagctatgggaacccaagg----------
               Killer whale  -gccataggttat-------ctggctgga---atgcactgtgagctatgggaacccaagg----------
           Tibetan antelope  -gccataagctat-------ctagctgga---tggcactgtgagctctgggaacccaagg----------
B D                     Cow  -gccataagctat-------ctacctgga---tggcactgtgagctctgggaacccaagg----------
B D                   Sheep  -gccataagctat-------ctagctgga---tggcactgtgagctctgggaacccgagg----------
              Domestic goat  -gccataagctat-------ctagctgga---tgacactgtgagctctgggaacccgggg----------
B D                   Horse  -accgtaggctgg-------ctggctgga---atgcactgtgagctgtgtggacccaaggtgctagaagg
B D        White rhinoceros  -accataggctag-------ctgcctgga---atgca-------ctgtgtgagcccaaggtgctggaagg
B D                     Cat  -acccttggctag-------gaggctgga---aggcaccgtgatctgcatgaacccacggtacaggaaag
B D                     Dog  -agcggaggctag-------gaggctgga---aggccctgggag-ggtgtgaaccctggatgcaggaggg
B D                 Ferret   -accacaggctag-------aaggctgga---aggcagtgtgagctgtgcgaaccgaaggtgcaggaagg
B D                   Panda  -accataggctag-------gaggctgga---acgtagtatgagctgcgtgaacgcaaggtgcgagcagg
             Pacific walrus  -accataggcaag-------gaggccgga---aggcagtgtgagctgtgtgaaccgaaggtgcagtgagg
               Weddell seal  -accataggctag-------gaggccgga---aggcagggtgagctgtgtgaaccgaaggtgcggtgagg
           Black flying-fox  -agcaaagtccag-------ctggccaga---atacaca--gagccgtgtgaacctgaggtgctagaagg
B D                 Megabat  -agcaaagtccag-------ctggccaga---atgcaca--gagccgtgtgaacctgaggtgctggaagg
              Big brown bat  -atcataggctag-------ctggccaga---atgcacc--gagctgtgtgagcccaaggtgcaggaagg
       David's myotis (bat)  ------aggctag-------ctggccaga---atgcacc--gagctgtgtgagcccaaggtgcaggaagg
B D                Hedgehog  -acctcgggccat-------ctggcctaa---atgcactgtgagttttgtcaacctaaggtgctggcgg-
B D                   Shrew  -accacagtctag-------atgactgaa---ctgcactgtgagctgtgtgaacccagggtactgcagg-
            Star-nosed mole  -accatagtttag-------ttgatggga---aagttctgtgacctgcacaaacacaaggtgctgtagg-
B D                Elephant  -accataggat-g-------ttggctaga---atgcactgtgagtcacatgagcccaagt-gctcccagg
        Cape elephant shrew  -accgtaggccaa-------ctggctgga---atctagtttgagtcccatgaacctgagc-actcccagg
B D                 Manatee  -accgtaggatag-------ttggctgga---atgcattgtgagtcacttgagcccaagt-actcccagg
           Cape golden mole  -accacaggagag-------ttggctgga---gtgtagtgtgagtcatgggagccctagt-gcacccagg
B D                  Tenrec  --------------------------------------tgtgagtcgtatgagccccacg-gttcccagg
                   Aardvark  -atgaaaagatag-------ttggctgga---atgcattgtgagtcatgtgagcccaagt-gctcctagg
B D               Armadillo  -accataagagag-------cttactaga---ctgcattgtgagctgtgtaaacccgaggagctcaaagg
B D                 Opossum  aaatat-ggctag-------atataggga---gtaaattataagatgtggagaatcaagatgctaaaggg
B D         Tasmanian devil  aaatat-gactag-------atgtaggga---gtaaattacaagatgtataggaataagatattcaagag
B D                Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D      American alligator  ======================================================================
  D         Green seaturtle  ======================================================================

                      Human  ---attaacga----------------tccctgaggaaata----tgtttgtgcgca-gccctgga-t-c
                      Chimp  ---attaacga----------------tccctgaggaaata----tgtttgtgtgca-gctctgaa-t-c
                    Gorilla  ---attaacga----------------tccctgaggaaata----tgtttgtgcgca-gccctgga-t-c
                  Orangutan  ---attaacga----------------tccctgaggaaata----tgtttgtgtgca-gccctgga-c-c
                     Gibbon  ---attaacga----------------tccctgaggaaata----tgtttgtgtgca-gccctgga-c-c
                     Rhesus  ---attaacga----------------tccctgcggaaata----tgtttgtgtgca-gccctgga-c-c
        Crab-eating macaque  ---attaacga----------------tccctgcggaaata----tgtttgtgtgca-gccctgga-c-c
                     Baboon  ---attaacga----------------tccctgaggaaata----tgtttgtgtgca-gccctgga-c-c
               Green monkey  ---attaacga----------------tccctgaggaaata----tgtttgtgtgca-gccctgga-c-c
                   Marmoset  ---att-ataa----------------tccctcaggaaaca----tgttcgtgtgca-gctctgga-cac
            Squirrel monkey  ---attaacaa----------------tccctcaggaaaca----cgtttgtgttca-gccctggg-c-c
                   Bushbaby  ---attaacag----------------tccctggggaaaca----cgtttgtgtgca-gccctgag-c-c
         Chinese tree shrew  ---attaacaa----------------ccccttggggagca----cgtctatgtgta-gccctgag-c-c
                   Squirrel  ---attaacta----------------tctctggggaaaca----cgactgtgtgca-gcccggtgcc-c
     Lesser Egyptian jerboa  ---attagcaa----------------cccctgaggaaaca----tgtctgcgtgta-gccctgtg-c-c
               Prairie vole  ---attgagaa-------------ccccaccccaggaaaca----agaccatgttc-ggtcctgta-c-c
            Chinese hamster  ---attgacaa--------------cccaccccgggaaaca----tgttca-------gtcatgta-c-c
             Golden hamster  ---atagacaa-------------ccccaccccggaaaaca----tgatcat------gttgag------
                      Mouse  ---attaacaaggc----tccatccctcaccccag-aacca----tgactgtattcagcccccatt-c-c
                        Rat  ---gttaacaaggctccatccatcccccaccccag-aacca----tgactgtattcagcccccatt-c-c
             Naked mole-rat  ---attaagaa----------------tccctggggaaaca----tgtttgtgtga--g------g-c-c
                 Guinea pig  ---atgaacaa----------------tccctggggaaaca----catttgcatga--ggcttgcg-c-c
                 Chinchilla  ---attaacaa----------------tccccagggaaaca----catttgtatga--gggctgcg-c-c
           Brush-tailed rat  ---attaacaa----------------tccctggggaaaca----catttgtatga--ggcctgtg-c-c
                     Rabbit  ---attaacaa----------------cccctggagaaata----cgtctgtgtgca-gccctgag-c-c
                       Pika  -------------------------------tagagctaca----agtctgtgtgca-gccttgag-c-c
                        Pig  ---attaagga----------------t--ctgggaaaaca----tgactggatgga-gccttgag-c-c
                     Alpaca  ---atgaagga----------------tctctgggaaaaca----tgtc--tgtgca-gctctgag-c-c
             Bactrian camel  ---atgaagga----------------tctctgggaaaaca----tgtc--tgtgca-gctctgag-c-c
                    Dolphin  ---attaagaa----------------tctccaggaaaaca----tgtctgtgtgca-gccctgag-c-c
               Killer whale  ---attaagca----------------tctccaggaaaaca----tgtctgtgtgca-gccctgag-c-c
           Tibetan antelope  ---gttaagta----------------tccctgggaaaaca----tgtccgtgtgca-accctgagcc-c
                        Cow  ---gttaggta----------------tctctgggaaaaca----tgtctgtgtgca-accttgag-c-c
                      Sheep  ---gttaagta----------------tccctgggaaaaca----tgtccgtgtgca-accctgagcc-c
              Domestic goat  ---gttaagta----------------tccctgggaaaaca----tgtccgtgtgca-accctgagcc-c
                      Horse  ---atgaagga----------------tctcggggcaaacacatctgtctgtgtgca-gctctgag-c-c
           White rhinoceros  ---attaagga----------------tctctggggaaaca----ggtctgtgtgca-ggcctgag-c-c
                        Cat  ---attgagga----------------tctctggagaagca----tgtc--tgtgca-actccgag-c-c
                        Dog  ---attaa-ga----------------tgcggggagaaacc----cagc--tctgca-gctctga--c-c
                    Ferret   ---attaagga----------------tctctggagaagca----catc--tgtgca-gctccgtg-c-c
                      Panda  ---atgaagga----------------tctgtggagaaaca----tgtc--tgtgca-gctctgag-c-c
             Pacific walrus  ---attaagga----------------tctctggagaaaca----cgtc--tgtgca-gctctgag-c-c
               Weddell seal  ---attaagga----------------tctctggagaaaca----tgtc--tgtgca-gctctgag-c-c
           Black flying-fox  ---agtgggga----------------tctctggggaaaca----cgtttgtgtgtg-gcccagag-c-c
                    Megabat  ---agtgggga----------------tctctggggaaaca----cgtttgtgtgcg-gcccagag-c-c
              Big brown bat  cttaataagga----------------tttctgaggaaaca----cgcctgtgtgca-cccctggg-c-c
       David's myotis (bat)  ctcaataagga----------------tctctggggaaaca----cgcctgtgtgca-gccctgga-c-t
                   Hedgehog  ---actgctga----------------tcttttgggaaatg----tgtcagtgtgta-accctgag-c-c
                      Shrew  ---attaatga----------------gtcca------------------------------tgtg---c
            Star-nosed mole  ---gtaattat----------------ctcca-gggaaact----cgtctatgcaca-gccctatg-c-c
                   Elephant  ---acgaacaa----------------tccctggggaac-a----catctatgtgcc-accccgag-c-c
        Cape elephant shrew  ---attgacag----------------g--------------------------------cctgaa-c-c
                    Manatee  ---attaacaa----------------ttcccagggaac-a----catctgtgtgcc-accctgtg-c-c
           Cape golden mole  ---attaccaa----------------tctccgggaaac-a----cacttgtgagct-gccctgag-c-c
                     Tenrec  ---attcgcag----------------gcctcagggg------------tgta---t-gccctgag-c-c
                   Aardvark  ---attaaca-----------------tccccagggaac-a----catttgtgggcc-atgttgag-c-c
                  Armadillo  ---att--cag----------------tccctggggaacga----ggtttgtatgta-gccctgag-c-c
                    Opossum  ---attaaaac----------------ttccttgggggaaa----tgtc--tatgca-g--------c--
            Tasmanian devil  ---attaaaac----------------tccttaagagaaaa----tggc--tgtgca-a--------c--
                   Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         American alligator  ======================================================================
            Green seaturtle  ======================================================================

                      Human  ctggggccttggcacctgctcc-atggtgcctctgtgcctggcagtggatcaaatg
                      Chimp  ctggggccttggcacctgctcc-atggtgcctctgtgcctggcagtggatcaaatg
                    Gorilla  ctggggccttggcacctgctcc-atggtgcctctgtgcctggcagtggatcaaagg
                  Orangutan  ctggggccttggcacctgctcc-atggcgcctctgtgcctggcagtggatcaaatg
                     Gibbon  ctggggccttcgcacctgctcc-atggtgcctctgtgcctggcagtggatcaaatg
                     Rhesus  ccggggccttggcacctgctcc-atggtgcctctgcgcctgggagtggatcaaatg
        Crab-eating macaque  ccggggccttggcacctgctcc-atggtgcctctgcgcctgggagtggatcaaatg
                     Baboon  ctggggccttggcacctgctcc-atggtgcctctgtgcctggcagtggatcaaatg
               Green monkey  ctggggccttggcacctgctcc-atggtgcctctgcacctggcagtggatcaaatg
                   Marmoset  atgaggacttggcacctgctccaatggtgcctctgagagtagcagaggatcaaatg
            Squirrel monkey  ctgggaccttggcacctgctcc-atggtgcctctgtgcttggcagaggatcaaatg
                   Bushbaby  ctggggctttggcacctgctcc-atgctgcccctggtcctggccgtggatcaagtg
         Chinese tree shrew  ctggggccctggtacccgctct-gcggtgcctctgtgcctggcagtggatcaaatg
                   Squirrel  ccggggccttggcacctgctcc-gtggtgcctctatgcctggcactggatcaaatg
     Lesser Egyptian jerboa  ctggggccttggcac----------ggtgcctctgtatgtggcaggggatcaaatg
               Prairie vole  ctggggccttggcacctgctcc-atgg-accactgggcctggcaagaaatcaaacg
            Chinese hamster  ctggggtcttgccacctgttcc-atggtacctttgggctggacaagaaatcaacc-
             Golden hamster  ccagggtcttgccacctgctcc-atggtacctccgggccgggcaagaaatcagcc-
                      Mouse  caggggcctttgcacctgctcc-atggtacatctgtgcctggcagtgaatcaaatc
                        Rat  caggggcctttgcacctgctcc-atggtacatctgcgcctggcaataaatcaaatc
             Naked mole-rat  ctggggccttggcacctgctcc-atagtgcctctgagcctggcagtagatcaaatg
                 Guinea pig  ctggggccttggcacctgctcc-acagtgcctctaaacctggcagtagatcaaatg
                 Chinchilla  ctggggccttggcacctgctgc-atggtgcctctgagcctggcagtagatcaaatg
           Brush-tailed rat  ctggggccttggcacctgctcc-acagtgcctctgagcctggcagtagatcaaata
                     Rabbit  ctggggccttggcacatgctct-gtggcgcctccacgcttggcaatagatcagatg
                       Pika  ctggagtcttgacacctgctcc-gcagtgcctccaggcctggcagcagatcagagg
                        Pig  ccagggccttggcacctgcccc-aaggtgtctctgcacctggcaggggatcagatg
                     Alpaca  ctagggccttggcacctgttcc-agggtgcc-ccatgcctggcagcagatcagatg
             Bactrian camel  ctagggccttggcacctgctcc-agggtgcc-caacgcctggcagcagatcagatg
                    Dolphin  ctggggcctttccacccactcc-aaggtgcctcctcacctggcagtggctcagttg
               Killer whale  ctggggccttgcca-ccgctcc-aaggtgcctcctcacctggcagtggctcagttg
           Tibetan antelope  ccggggccttggcccctgcttc-caggtgcctctgcgcttggcagctgatcagatg
                        Cow  ccggggccttggcgcctgcttc-caggtgcctctgcgcctggcagctgatcggatg
                      Sheep  ccagggccttggcccctgcttc-caggtgcctctgcacctggcagctgatcagatg
              Domestic goat  ccggggccttggcccctgcttc-caggtgcctctgcgcctggcagctgatcagatg
                      Horse  ccggggccttggcacctgctgc-gtggagcccctgcacctggcagtggatcagatg
           White rhinoceros  ccagggccttggcacctgctct-gaggtgcccctgcacctggcagtggatcagata
                        Cat  ccggggccttggcacctgctcc-aaggtgcctctgtgcctggcagaggatcaaatg
                        Dog  ccagggccttggcacctgcccc-aaggtccctctgtgcctggcagtggatcagccg
                    Ferret   ccagggccttggcaccggctct-aaggtgcctctgcgcctggcagggcatcagatg
                      Panda  ctggggccttggcacctgctcc-aaggtgcttctgcttctggcagcggatcaaatg
             Pacific walrus  ccagggcctcggcccccgctcc-aaggtgcctctgcacctggcagcgcatcagatg
               Weddell seal  ccagggccttggcccctgctcc--aggtgcctctgtgcctggcagcgcatcagatg
           Black flying-fox  ccagggccttggcatctgctct-gaggtgcctctgcgcctggcagcagatcacatg
                    Megabat  ccagggccttggcacctgctcc-gaggtgcctctgcgcctggcagcagatcacatg
              Big brown bat  tcggggccttggcacctgctc------------------------cagatcaaatg
       David's myotis (bat)  tcagggccttggcacttgctc------------------------cagatcaaatg
                   Hedgehog  ccggagccttggcacctgctcc-aaggcgcctctgtg-ttggcagtagatcatata
                      Shrew  ctggggccttggcacctgctcc-aaggtgcctccctgcctggcaggagatcagatg
            Star-nosed mole  ccagggccttggcatctgctcc-aaattgactctgtgcctggcaggggatcagatg
                   Elephant  t-gaggccttggcacctgctcc-gtggagcctctacgcctggcagcggatcagatg
        Cape elephant shrew  t-ggtgccttggcacctgaact-gaagagaccctcagcctggctgctgataagata
                    Manatee  t-ggggccttggcacctgctcc-acggagcctctgcaactgacagcaaatcagatg
           Cape golden mole  t-ggggccttggcacctgctct-gtggagcctctgtacctggcagcagatcaaata
                     Tenrec  t--gagccttggcccctgctct-gtggagtgtgtgctcctggcagcagatcaaatg
                   Aardvark  c-aggcccttggaacctgctct-gtggagcctctgtgtctggcagcagatgaaatg
                  Armadillo  tcggggccttggctcttgctcc-atgccacctctgtgcctggcagcagatcaaatg
                    Opossum  -------------atctactct-gaaatggttgtgcagctggcaacagattataag
            Tasmanian devil  -------------atctactct-gtaatggttttacaatgggcaacagattacaag
                   Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         American alligator  ========================================================
            Green seaturtle  ========================================================

Inserts between block 6 and 7 in window
B D        Tasmanian devil 2857bp

Alignment block 7 of 243 in window, 104651495 - 104651497, 3 bps 
B D                   Human  -ctt
B D                   Chimp  -ctt
B D                 Gorilla  -ctt
B D               Orangutan  -ctt
B D                  Gibbon  -ctt
B D                  Rhesus  -ctt
B D     Crab-eating macaque  -ctt
B D                  Baboon  -ctt
B D            Green monkey  -ctt
B D                Marmoset  -ctt
B D         Squirrel monkey  -ctt
B D                Bushbaby  -ctc
         Chinese tree shrew  -ctc
B D                Squirrel  -ctc
     Lesser Egyptian jerboa  -ctt
               Prairie vole  -cct
B D         Chinese hamster  -ctt
             Golden hamster  -ctt
B D                   Mouse  -ctc
B D                     Rat  -ctc
B D          Naked mole-rat  -ctc
B D              Guinea pig  -ctc
                 Chinchilla  -ttc
           Brush-tailed rat  -ctt
B D                  Rabbit  -ctc
B D                    Pika  -ttt
B D                     Pig  -cca
B D                  Alpaca  -ctt
             Bactrian camel  -ctt
B D                 Dolphin  -ctc
               Killer whale  -ctc
           Tibetan antelope  -ct-
B D                     Cow  -ct-
B D                   Sheep  -ct-
              Domestic goat  -ct-
B D                   Horse  -ctc
B D        White rhinoceros  -ccc
B D                     Cat  -ctc
B D                     Dog  -ttc
B D                 Ferret   -ctt
B D                   Panda  -ctc
             Pacific walrus  -ctc
               Weddell seal  -ctc
           Black flying-fox  -ctt
B D                 Megabat  -ctt
              Big brown bat  -ccc
       David's myotis (bat)  -ccc
B D                Hedgehog  -ctc
B D                   Shrew  -ctc
            Star-nosed mole  -ctc
B D                Elephant  -ctc
        Cape elephant shrew  -cac
B D                 Manatee  -ctc
           Cape golden mole  -ctt
B D                  Tenrec  -ctg
                   Aardvark  -ctc
B D               Armadillo  -ctc
B D                 Opossum  gtt-
B D                Microbat  NNNN
B D      American alligator  ====
B D         Tasmanian devil  ====
  D         Green seaturtle  ====

Inserts between block 7 and 8 in window
B D                Opossum 10663bp

Alignment block 8 of 243 in window, 104651498 - 104651601, 104 bps 
B D                   Human  gccctggcacatgccctcagcatttcagtttgtgaagga-----aag-ggag---gcaggg-tg-cctgt
B D                   Chimp  gccctggcacatgccctcagcatttcagtttgtgaagga-----aag-ggag---gcaggg-tg-cctgt
B D                 Gorilla  gccctggcacatgccctcagcatttcagtttgtgaagga-----aag-ggag---gcaggg-tg-cctgt
B D               Orangutan  gccctggcacatgccctcagcatttcagtttgtgaagga-----aag-gggg---gcaggg-tg-cctgt
B D                  Gibbon  gccctggcacatgccctcagcatttcagtttgtgaagga-----aag-ggag---gcagcg-tg-cctgt
B D                  Rhesus  gccctggcacctgccctcagcatttcagtttgtgaagga-----aag-ggag---gcaggg-tg-cctgt
B D     Crab-eating macaque  gccctggcacctgccctcagcatttcagtttgtgaagga-----aag-ggag---gcaggg-tg-cctgt
B D                  Baboon  gccctggcgcctgccctcagcatttcagtttgtgaagga-----aag-ggag---gcaggg-ta-cctgt
B D            Green monkey  gccctggcacctgccctcagcatttcagtttgtgaagga-----aag-ggag---gcaggg-tg-cctgt
B D                Marmoset  acccttgtacatgccctcagcatatcagtttatgaagga-----aag-ggag---gcaggg-tg-cctgt
B D         Squirrel monkey  accctggcacatgccctcagcatttcagtttgtgaagga-----aag-ggag---gcaggg-tg-cctgt
B D                Bushbaby  accctggcacatccctgcagcactgcggtttgtgaaggg-----aag-gg-g---acaggc-tg-cctct
         Chinese tree shrew  accccggcacatgccctcagcattgtcgtctgtgaggga-----aag-g--a---gctgag-aa-ccttc
B D                Squirrel  accctagcatatgccctcagccttgtagtatgtagacaa-----ggg-aggc-----agtg-ta-cctcc
     Lesser Egyptian jerboa  cccctggcatgcatccttag-cttttagtgtttgaatta-----aag-gggg-----tgagttg-cct-c
               Prairie vole  acattggcacttgcccttgg-cttttagtgtataaaggg-----aag-gggg-----cagg-ta-cct-c
B D         Chinese hamster  accttggcacttgccattgg-tttgcggtgcataaagga-----aag-ggag-----cagg-ta-cct-c
             Golden hamster  accttggc--------------ttacagtgtataagagg-----aag-gggg-----cggg--g-cct-c
B D                   Mouse  atcttggcccttgcccttgg-cttgccgagtacaaagga-----aagtgggg-----tggg-tg-cct-c
B D                     Rat  atcttggcacctgcccttgg-ctgacagagtataaagga-----aattgggg-----tggg-tg-cct-c
B D          Naked mole-rat  accctggcacatgccctcagccttgcagtttgtgaagaa-----aaa-ggag---gcaggg-tg-cctcc
B D              Guinea pig  ttcctggcacctgccctcagcattgcagtttgtgaataa-----aaa-ggag---gcaggg-tg-ccttt
                 Chinchilla  atcctggcacatgctctcagcactgcagtttgtgaagaa-----aaa-ggaa---gcaggg-tg-actct
           Brush-tailed rat  atcctggcacatgc-ctcagcattgcaatttatgaagaa-----aaa-ggag---gcaggg-tg-----c
B D                  Rabbit  accctggcacaggcccgcagcattgcagcttgtggagac-----aaa-gggg---atgggg-tg-ccacc
B D                    Pika  gccctagcacagact------------gctggcagacga-----gag-ggag---acagag-tg-ctgcc
B D                     Pig  tcccttatacatgcccttagcagtgcagtttgtgaagag-----aag-ggag---gcaggg-ta-cctaa
B D                  Alpaca  accctggcacatgccctcagcagtgccatttgtgaagag-----aag-ggag---gcc-gg-ta-cctgc
             Bactrian camel  accctggcacgtgccctcagcagtgccgtttgtgaagag-----aag-ggag---gcc-gg-tg-cctgc
B D                 Dolphin  accccggcacatgccctcagcagtgcagtttgtgaaggg-----aag-gaag---gcaggg-tg-cctgc
               Killer whale  accccggcacatgccctcagcagtgcagtttgtgaaggg-----aag-ggag---gcaggg-tg-cctgc
           Tibetan antelope  -------cacatgccctcagcactgtagtttgtgaaagg-----aag-gcaa---acaggg-cg-cttgc
B D                     Cow  -------cacatgccctcagcagtggagcttgtgaaagg-----aag-ggaa---aagggg-ca-cttgg
B D                   Sheep  -------cacatgccctcagcagtgtagtttgtgaaagg-----aag-gcaa---acgggg-tg-cttgc
              Domestic goat  -------cacatgccctcagcagtgtagtttgtgaaagg-----aag-gcaa---actggg-cg-cttgc
B D                   Horse  gccctggcacatgccctcagcagcccggtttgtgaagag-----aag-ggaa---ccaggg-ag-cctgg
B D        White rhinoceros  accctggcacatgccctcagcagtgcagtttgtgaagac-----aag-ggag---gca----------gc
B D                     Cat  accgtggcacatgccctcagcagtacggcttgcgaagag-----aag-gaaa---gcaggg-cg-cctgt
B D                     Dog  cctgtggcccgtgccctcagctgtacggcctggcaaggg-----agg-ggag---gcc-ac-cg-cctgt
B D                 Ferret   gccgtgacacatgccctcagcagtacagcttgtgaagag-----aag-ggag---gcaggg-ca--ctag
B D                   Panda  accgtggcacatgccctcagcagtacggcttgcgaagag-----aag-ggag---gcaggg-tg-cctgt
             Pacific walrus  actgcggcacatgccctcagcagtatggcttgtgaagag-----aag-ggag---gcaggg-cg-cctgg
               Weddell seal  actgtggcacataccctcagcagtatggcttgtgaagag-----aag-ggag---gcaggg-cg-cctgg
           Black flying-fox  gccctggcacgcgccctgagca-ggcagttgg-gaagag-----aaa-ggag---gcag-g-tg-cttgc
B D                 Megabat  gccctggcacgcgccctgagca-ggcagttgg-gaagag-----aaa-ggag---gcag-g-tg-cttgc
              Big brown bat  accttggcacatgccctcagcagggcagttcgtgaagag-----agg-ggag---gcggcg-tg-tctgt
       David's myotis (bat)  accctggcacatgccctcagtaggggagctggtgaagag-----agg-ggag---gcaggg-tg-tctgt
B D                Hedgehog  accctgacacatgctctcagccatgtgatttgtgaaggg------aa-gttatttgtgggg-tggcctgt
B D                   Shrew  accctggcacatgcgatctgcagtgcagtttgggaagggggaggaag-ggag---gtggga-tg--ctgc
            Star-nosed mole  acccaggaacacgtcctcagctatataatttgtgaagag------aa-gcgg---gtaagg-tg-tctgc
B D                Elephant  ac-ctggcacgtgtcctcagcgttgccgtttgtgaagag-----aag-ggag---gcagag-tg-cctcg
        Cape elephant shrew  cc----aaacctaccctcagcattgctgtttgttaagag-----aag-gaag---gcagag-ca-ccc--
B D                 Manatee  ac-ctggcacgtgacctcagcattgccatttgtgaagag-----aag-agag---gaggag-tg-cctca
           Cape golden mole  accctggcacatgccctcagcattgccatttaggaagac-----agg-ggag---gcggtg-tg-cctcc
B D                  Tenrec  ccccgggcacagccccttggcattggcatttgtattgag-----aag-ggag---gcgatg-t-------
                   Aardvark  accctggcgcatgccctcagtgttg-tgtttgtgaagag-----aat-gaag---gcgggg-tg-cctcc
B D               Armadillo  accctggcacaggccctcagctttgcagcttgaacagag-----aag-ggag---gtgggg-tg-cctgc
B D                Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================

                      Human  ctctgtt---tttcatgcaggcaggactaagttggatacaagagatcc
                      Chimp  ctctgtt---tttcatgcaggcaggactaagttggatacaagagatcc
                    Gorilla  ctctgtt---tttcatgcaggcaggactaagttggatacaagagatcc
                  Orangutan  ctctgtt---tttcatgcaggcaggactaag------acaagagatcc
                     Gibbon  ctctgtt---tttcatgcaggcaggactaagttggatataagagatcc
                     Rhesus  ctctgtt---tttcatgcaggcaggactaagttggatacaagagatcc
        Crab-eating macaque  ctctgtt---tttcatgcaggcaggactaagttggatacaagagatcc
                     Baboon  ctctgtt---tttcatgcaggcaggactaagttggatacaagagatcc
               Green monkey  ctctgtt---tttcatgcaggcaggactaagttggatacaagagatcc
                   Marmoset  ctctgtt---tttcatgcaggcaggattaagttggatacaagagatcc
            Squirrel monkey  ctctatt---tttcatgcaggcaggactaagttggatacaagagatcc
                   Bushbaby  ctttgtt---tttcatgcaggcaggactgagtcagagataagatatct
         Chinese tree shrew  ttttgtc---tttcctgcaggcagcattgagttggatatgagaaatac
                   Squirrel  ctttgtt---tctcatgcaggcaggactgacttggatacaagggatcc
     Lesser Egyptian jerboa  ctttgtt---tt-cacacaggcataaccaagtttcagacgagagatct
               Prairie vole  ctttgtt---ctccatgtaggcatggcagagtttc---tgggagcctc
            Chinese hamster  ctttgtt---ttccatgcaggtgtggcggagtttc---tgagagctct
             Golden hamster  ctttgtt---tttcatgcgggcatggctgag-----------------
                      Mouse  ttttgtt---ttccatgcaggcgtggttgagtttc---tgagagctcc
                        Rat  ctttgtt---ttctgtgcaggcatggctgagtttc---tgagcgcttc
             Naked mole-rat  ctttatt---tttcatgcagccagaaccaagttgg--atacgaggtcc
                 Guinea pig  ctttatt---tttcatgcaggcagaactgagttgg--atataagatcc
                 Chinchilla  ctctgtt---tttcatgcaggcagaactgagttgg--atataaggccc
           Brush-tailed rat  ctctgtt---tttcatgcaaggggatctgagttgg--atacaaggcc-
                     Rabbit  ctgtgtt---tctcatgcaagcaggactag----gatacaggagaccc
                       Pika  cttcgtc---tctcatgcaaacaggactgggtgagatccaagagaaca
                        Pig  ctttgtt---tttcaca---------------tgggtacaagagatcc
                     Alpaca  ctttgct---tttcatgtgggcaaggctgagttggatacaggagatcc
             Bactrian camel  ctttgat---tttcatgtgggcaaggctgagttggatacaggagatcc
                    Dolphin  ctttgtt---tttcatgcaggcagggctgagccggatatgagagatcc
               Killer whale  ctttgtt---tttcatgcaggcagggctgagctggatacgagggatcc
           Tibetan antelope  ctttgtt---ttttattcagactgggctgagctagacacaagaaatcc
                        Cow  ctttgct---ttttattcagactgggctgagctagacacaagaaatcc
                      Sheep  ctttgtt---ttttattcagactgggctgagctagacacaagaaatcc
              Domestic goat  cttt-ta---ttttattcagactgggctgagctagacacaagaaatcc
                      Horse  c--tgtt---tttcatgcaggcaggactgagttgaatacaagagatcc
           White rhinoceros  c--tgtt---ttgcatgctggcagggctgagttggagacatgagatcc
                        Cat  catcgtt---tttcacacagacagggctgaattagatagaagagatcc
                        Dog  ctttgtt---tttcatacaga----gctaggttcgatacaaaagatcc
                    Ferret   ctttgtt---tctc----aga----gctgaattagagacaaaagatcc
                      Panda  ctgtgtt---tctcatacaga----gctgagttagagacaaaagatcc
             Pacific walrus  ctttgtt---tctcatagaga----gctgagttagagacaaaagatcc
               Weddell seal  ccttgtt---tctcatagaga----gctgagttagagacaaaagatcc
           Black flying-fox  cttcgtt---tttcactcaggcagggctgggttaggtatgagagatcc
                    Megabat  cttcgtt---tttcactcaggcagggctgggttgggtacgagagatcc
              Big brown bat  ctttgtt---tttcacacaagcagggctgatttggatacaggaggtcc
       David's myotis (bat)  ctttgtt---tttcatgcaggcagggctgatttggatataggaggccc
                   Hedgehog  ttttcttttgttttacacaggcaaggctgagtcagatatgagagagcc
                      Shrew  ctttgtt---tttcacacaggcaaagctcagttgga--tatgagactg
            Star-nosed mole  ctttgtt---tttcacacaggtaggcttgaggtagat-taaaagtttc
                   Elephant  ctctgct---gttcaggcaggcaggga-gagttgagtacaagacgttc
        Cape elephant shrew  ctttgtt---gttcatacatttagggatgagttagatgcaagagattc
                    Manatee  ctctgct---gttcatgcaggcggggctgagttggatataagagattc
           Cape golden mole  ttctgtt---gttcaggca-acagggctgaattagatataagagattc
                     Tenrec  -----tc---acgtaggc--tcagggctgagttcgatgcgaaagatca
                   Aardvark  ctctgtt---gttcatgcaggcagggctgagttggatacaacagattc
                  Armadillo  ctttgtt---tttcatgcaggaagggctgaggtagatacaagagattc
                   Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         American alligator  ================================================
                    Opossum  ================================================
            Tasmanian devil  ================================================
            Green seaturtle  ================================================

Alignment block 9 of 243 in window, 104651602 - 104651605, 4 bps 
B D                   Human  a-----------------------gca
B D                   Chimp  a-----------------------gca
B D                 Gorilla  a-----------------------gca
B D               Orangutan  a-----------------------gca
B D                  Gibbon  a-----------------------gca
B D                  Rhesus  a-----------------------gca
B D     Crab-eating macaque  a-----------------------gca
B D                  Baboon  a-----------------------gca
B D            Green monkey  a-----------------------gca
B D                Marmoset  a-----------------------gca
B D         Squirrel monkey  a-----------------------gca
B D                Bushbaby  a-----------------------aca
         Chinese tree shrew  a-----------------------atg
B D                Squirrel  c-----------------------aca
     Lesser Egyptian jerboa  a-----------------------gca
               Prairie vole  a-----------------------gca
B D         Chinese hamster  g-----------------------aaa
B D                   Mouse  a-----------------------gca
B D                     Rat  a-----------------------gca
B D          Naked mole-rat  a-----------------------gca
B D              Guinea pig  a-----------------------gca
                 Chinchilla  a-----------------------gca
B D                  Rabbit  c-----------------------aca
B D                    Pika  c-----------------------acg
B D                     Pig  a-----------------------gca
B D                  Alpaca  a-----------------------gca
             Bactrian camel  a-----------------------gca
B D                 Dolphin  a-----------------------gca
               Killer whale  a-----------------------gca
           Tibetan antelope  a-----------------------gca
B D                     Cow  a-----------------------gca
B D                   Sheep  a-----------------------gca
              Domestic goat  a-----------------------gca
B D                   Horse  a-----------------------gca
B D        White rhinoceros  a-----------------------gtg
B D                     Cat  g-----------------------gca
B D                     Dog  acaatgtggggatccttgggtggcgca
B D                 Ferret   a-----------------------gcc
B D                   Panda  a-----------------------gca
             Pacific walrus  a-----------------------gca
               Weddell seal  a-----------------------gca
           Black flying-fox  g-----------------------gaa
B D                 Megabat  g-----------------------gaa
              Big brown bat  a-----------------------gca
       David's myotis (bat)  a-----------------------gca
B D                Microbat  a-----------------------gca
B D                Hedgehog  a-----------------------gat
B D                   Shrew  a-----------------------tct
            Star-nosed mole  a-----------------------gct
B D                Elephant  a-----------------------gca
        Cape elephant shrew  a-----------------------gca
B D                 Manatee  a-----------------------gca
           Cape golden mole  a-----------------------gca
B D                  Tenrec  g-----------------------gca
                   Aardvark  a-----------------------gca
B D               Armadillo  a-----------------------tca
            Golden hamster  ---------------------------
B D      American alligator  ===========================
B D                 Opossum  ===========================
B D         Tasmanian devil  ===========================
  D         Green seaturtle  ===========================
          Brush-tailed rat  ---------------------------

Inserts between block 9 and 10 in window
B D                    Dog 181bp
       Cape elephant shrew 5536bp

Alignment block 10 of 243 in window, 104651606 - 104651617, 12 bps 
B D                   Human  tcataa-ttgt-tt
B D                   Chimp  tcataa-ttgt-tt
B D                 Gorilla  tcataa-ttgt-tt
B D               Orangutan  tcataa-ttgt-tt
B D                  Gibbon  tcataa-ttgt-tt
B D                  Rhesus  tcataa-ttgt-tt
B D     Crab-eating macaque  tcataa-ttgt-tt
B D                  Baboon  tcataa-ttgt-tt
B D            Green monkey  tcataa-ttgt-tt
B D                Marmoset  tcataa-attt-tt
B D         Squirrel monkey  tcataa-tttt-tt
B D                Bushbaby  tcatta-tttt-tt
         Chinese tree shrew  tcatgg-tttt-tt
B D                Squirrel  tcatga-ttat-tt
     Lesser Egyptian jerboa  aca--a-tcgt-tt
               Prairie vole  gtataa-ctat-tt
B D         Chinese hamster  gcatca-ttct-tt
             Golden hamster  ----------t-tt
B D                   Mouse  acataa-ttat-tt
B D                     Rat  acataa-ttat-tt
B D          Naked mole-rat  tcatga-ttat-tt
B D              Guinea pig  tcatga-ttgt-tt
                 Chinchilla  taatga-ttat-tt
           Brush-tailed rat  ---tga-ttat-gt
B D                  Rabbit  tcatgattttt-tt
B D                    Pika  t-gtgattttt-tt
B D                     Pig  tcataa-tttt-tt
B D                  Alpaca  tcgtgt-attt-tt
             Bactrian camel  tcgtgt-attt-tt
B D                 Dolphin  tcgtca-tttt-tt
               Killer whale  tcgtca-tttt-tt
           Tibetan antelope  tcgtga-ttct-tt
B D                     Cow  tcgtga-ttct-tt
B D                   Sheep  tcatga-ttct-tt
              Domestic goat  tcgtga-ttct-tt
B D                   Horse  tcatga-tttt-ct
B D        White rhinoceros  tcgtgc-ttttact
B D                     Cat  tcgtga-ttt-ttt
B D                     Dog  ccacaa-tgtcttt
B D                 Ferret   tcatga-tttcttt
B D                   Panda  tcatgg-tttcttt
             Pacific walrus  ccacga-tttcttt
               Weddell seal  tcatga-tttcttt
           Black flying-fox  ccatga-tttt-tt
B D                 Megabat  ccatga-tttt-tt
              Big brown bat  tcatga-cttt-tt
       David's myotis (bat)  tcatga-cttt-ct
B D                Microbat  tcatga-cttt--t
B D                Hedgehog  tt---t-ttc----
B D                   Shrew  ttttat-ttc----
            Star-nosed mole  tttttt-ttt----
B D                Elephant  tcatga-actt-tt
B D                 Manatee  taatga-tttt-tt
           Cape golden mole  taatga-tttt-ct
B D                  Tenrec  aaatga-tttt-ct
                   Aardvark  taatga-tgtt-tt
B D               Armadillo  tcacgg-tctt-tt
       Cape elephant shrew  ==============
B D      American alligator  ==============
B D                 Opossum  ==============
B D         Tasmanian devil  ==============
  D         Green seaturtle  ==============

Inserts between block 10 and 11 in window
B D               Bushbaby 1bp
        Chinese tree shrew 3bp
B D               Squirrel 1bp
    Lesser Egyptian jerboa 1bp
              Prairie vole 1bp
B D        Chinese hamster 1bp
            Golden hamster 1bp
B D                  Mouse 1bp
B D         Naked mole-rat 1bp
B D             Guinea pig 1bp
                Chinchilla 1bp
          Brush-tailed rat 1bp
B D                 Rabbit 1bp
B D                   Pika 1bp
B D                    Pig 2bp
B D                 Alpaca 1bp
            Bactrian camel 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 148bp
B D                    Cow 148bp
B D                  Sheep 148bp
             Domestic goat 148bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
B D                  Panda 1bp
            Pacific walrus 1bp
              Weddell seal 1bp
          Black flying-fox 1bp
B D                Megabat 1bp
             Big brown bat 1bp
      David's myotis (bat) 1bp
B D               Microbat 1bp
B D               Elephant 1bp
B D                Manatee 1bp
          Cape golden mole 1bp
B D                 Tenrec 6bp
                  Aardvark 1bp
B D              Armadillo 1bp

Alignment block 11 of 243 in window, 104651618 - 104651723, 106 bps 
B D                   Human  ataaaagcatacaatagaagtaga--------------agtg-ac-ttgagccag-gtattc--------
B D                   Chimp  ataaaagtatacaatagaagtaga--------------agtg-ac-ttgagccag-gtattc--------
B D                 Gorilla  ataaaagtatacaataaaagtaga--------------agtg-ac-ttgagccag-gtattc--------
B D               Orangutan  ataaaagtatacaatagaagtaga--------------agtg-ac-ttgagccag-gtattc--------
B D                  Gibbon  ataaaagtatacagtagaagtaga--------------agtg-ac-ttgagccag-gtatac--------
B D                  Rhesus  ataaaagtatacaatagaagtaga--------------agtg-ac-ttgagccag-ctattc--------
B D     Crab-eating macaque  ataaaagtatacaatagaagtaga--------------agtg-ac-ttgagccag-ctattc--------
B D                  Baboon  ataaaagtatacaatagaagtaga--------------agtg-ac-ttgagccag-ctattc--------
B D            Green monkey  ataaaagtatacaatagaagtaga--------------agtg-ac-ttgagccag-ctattc--------
B D                Marmoset  ataaaagtatacaat---agtaga--------------agtg-ac-ttgagccta-gtattc--------
B D         Squirrel monkey  gtaaaagtatacaat---agtaga--------------agtg-ac-ttgagccgt-gtattc--------
B D                Bushbaby  ataaaaatatacaaaagaattaaa--------------agtg-ac-ttgggcggg-gtatat--------
         Chinese tree shrew  atacaagtgtacaaaagaagtaaa--------------agta-gc-ctaagtcag-gtactc--------
B D                Squirrel  acagaagcatacaaaag-aagcaa-------------aaatg-ac-ttgagcctg-gtattt--------
     Lesser Egyptian jerboa  atagaaggacacaaaag-aggaaa-------------gaagg-at-ttgagccag-atgttc--------
               Prairie vole  atagacatatacaaaag-agataa--------------aggg-gt-ttgagccag-gtattc--------
B D         Chinese hamster  ataggtatttatagaag-aggtaa--------------agtg-at-ttgatccag-atattc--------
             Golden hamster  atagacagatacagagg-aggtaa--------------agtg-at-ttgatccag-atattc--------
B D                   Mouse  acaggcatatacagaag-aggtgg--------------actg-ac-ttgagtcag-gtattc--------
B D                     Rat  -------cataca-aac-aggtcg--------------agtg-ac-ttgagccag-gtatcc--------
B D          Naked mole-rat  acaga-------------agtaaa--------------agta-ac-gtaagccag-gtattc--------
B D              Guinea pig  tcaga-------------agtaaa--------------agtg-aa-gtaagccagttttttt--------
                 Chinchilla  ataga-------------agtaaa--------------agtg-ac-ttgagtcag-atattc--------
           Brush-tailed rat  atag--------------agtaaa--------------agtgaac-ttaacctag-gtattc--------
B D                  Rabbit  ataaaagtgtacaacagaagtaaa--------------cgtg-ac-ttgacccgt-gtcttc--------
B D                    Pika  ataaaagtaaccaaatgtagccaa--------------cata-actttgagccat-gctttc--------
B D                     Pig  atagatgtgaaccaaagaaataaa--------------aatg-tc-ttgagccag-atcttc--------
B D                  Alpaca  atagaagggtacgaaaggaataaa--------------agtg-ac-ttgagccag-gtcttc--------
             Bactrian camel  atagaagggtacgaaaggaataaa--------------agtg-ac-ttgagccag-gtcttc--------
B D                 Dolphin  atagaagtgtgtgaaag-----------------------tg-ac-ttcagccag-gtcttc--------
               Killer whale  atagaagtgtatgaaag-----------------------tg-ac-ttcagccag-gtcttc--------
           Tibetan antelope  ataaaggtgtacaaaagaaataaa--------------aatg-at-ttcagccat-gtcctc--------
B D                     Cow  ataaaggtgtacaaaagaaataaa--------------aatt-at-ttcagccag-gtcttc--------
B D                   Sheep  ataaaggtgtacaaaagaaataaa--------------aatt-at-ttcagccgt-gtcctc--------
              Domestic goat  ataaaggtgtacaaaagaaataaa--------------aatg-at-ttcagccat-gtcctc--------
B D                   Horse  agagacatgtgcaaaagaaataaa--------------agtg-ac-tcgagcccg-gtgttc--------
B D        White rhinoceros  agaa--gtgtacaaaagaaataaa--------------agcg-ac-ttgagccag-aagtcc--------
B D                     Cat  atcggagcgtacaaaagaaacaaa--------------agcg-ac-ttgagacag-gtg-----------
B D                     Dog  ataaaggtgtacaaatgaaataca--------------aatg-ac-ttgagccag-gtgttc--------
B D                 Ferret   atagaggagtaccaaagaaataaa--------------attg-ac-ttgagccag-gaattc--------
B D                   Panda  actgaggtgtacaaaagaaagaaa--------------agtg-at-gtgagccgg-atattc--------
             Pacific walrus  atagagatgcgcaaaagaaataaa--------------agtg-ac-ttgacctgg-gaattc--------
               Weddell seal  atagaggtgcgcaaaagaaagaaa--------------agtg-ac-ttgacccgg-gaattc--------
           Black flying-fox  aaagaagtgtacaaaagcaaaaaa--------------agcg-at-ttgagcca---gattc--------
B D                 Megabat  aaagaagtgtacaaaag-aaaaaa--------------agcg-at-ttgagcca---gattc--------
              Big brown bat  atcgacgtgtacaaga--aataaa--------------agtg-ac-ttgagccat-gtactc--------
       David's myotis (bat)  atggatgtgtgcaaga--aataaa--------------agcg-ac-ttgagccat-gtactc--------
B D                Microbat  at-gacgtgtgcaaga--aataag--------------agcg-ac--tgagccat-gtactc--------
B D                Hedgehog  atagagttatgcagaag-----------------------ta-actatg---------------------
B D                   Shrew  acagaaatgtacagaagaaacaga--------------agtg-ac-ttgagcctt-gtattc--------
            Star-nosed mole  acagaaatatataaaagagataaa--------------aatg-actttgagtttg-gtgttc--------
B D                Elephant  atagacaggcacaaaagaagtaaa--------------agcg-at-tc-agatag-gtattctcatagac
B D                 Manatee  atagacatgcacaaaagaagtaga--------------agtg-ac-tt-agccag-gtattctcacagac
           Cape golden mole  atagacatatacaaaaggagtagactatggtacctcggagtg-ac-tt-agcaat-gt------------
B D                  Tenrec  ttagtaaaacacaaaggaagttca--------------agtg-ac-tt-agtcag-gtggtc--------
                   Aardvark  atagaaatgcataaaagatgtaaa--------------agtg-ac-tt-aggcag-gtatcc--------
B D               Armadillo  acagaagtgtacagaggaggttaa--------------agtg-ac-ctaagccag-gtcttc--------
       Cape elephant shrew  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================

                      Human  ----------------------------------t----cacttctgtct---ccaa--gc----ct---
                      Chimp  ----------------------------------t----cacttctgtct---ccaa--gc----ct---
                    Gorilla  ----------------------------------t----cacttctgtct---ccaa--gc----ct---
                  Orangutan  ----------------------------------t----cacttctgcct---ccaa--gc----ct---
                     Gibbon  ----------------------------------t----cactcctgtct---ccaa--gc----ct---
                     Rhesus  ----------------------------------t----cacttctgtct---ccaa--gc----tt---
        Crab-eating macaque  ----------------------------------t----cacttctgtct---ccaa--gc----tt---
                     Baboon  ----------------------------------t----cacttctgtct---ccaa--gt----tt---
               Green monkey  ----------------------------------t----cacttctgtct---ccaa--gc----tt---
                   Marmoset  ----------------------------------t----cacttctgtct---ccaa--gc----tt---
            Squirrel monkey  ----------------------------------t----cacttctgtct---ccaa--gc----ct---
                   Bushbaby  ----------------------------------t----cacttctgtcc---ccga--gg----tt---
         Chinese tree shrew  ----------------------------------t----cacttctgttt---ccaa--gc----tc---
                   Squirrel  ----------------------------------t----cacatctgtct---ctga--gt----aa---
     Lesser Egyptian jerboa  ----------------------------------t----cgtgttggtct---ccaaa-cc----ct---
               Prairie vole  ----------------------------------c----catgtttgtct---ccaa--gt----ct---
            Chinese hamster  ----------------------------------a----catgtttgtct---ccaa--gt----ct---
             Golden hamster  ----------------------------------a----catgtttgtct---ccaa--gc----ct---
                      Mouse  ----------------------------------gttggcatgtttgtct---cccga-gt----ct---
                        Rat  ----------------------------------attcccatgtcc-------------gt----ct---
             Naked mole-rat  -----------------------------------------tgcccgtct---ccaa--gc----ct---
                 Guinea pig  ----------------------------------t----catatctttct---ccaa--ct----ct---
                 Chinchilla  ----------------------------------t----catgtccgtgttacctaa--gc----ct---
           Brush-tailed rat  ----------------------------------t----catgtccatct---ctaa--gc----at---
                     Rabbit  ----------------------------------t----catgcctgtct---cctt--gc----cc---
                       Pika  ----------------------------------c----catgcccgtct---tcatacac----cc---
                        Pig  ----------------------------------t----tcc-----------------------tt---
                     Alpaca  ----------------------------------t----tcc-----------------------tt---
             Bactrian camel  ----------------------------------t----tcc-----------------------tt---
                    Dolphin  ----------------------------------t----tcc-----------------------gt---
               Killer whale  ----------------------------------c----tcc-----------------------gt---
           Tibetan antelope  ----------------------------------t----tcc-----------------------tt---
                        Cow  ----------------------------------t----tcc-----------------------tt---
                      Sheep  ----------------------------------t----tcc-----------------------tt---
              Domestic goat  ----------------------------------t----tcc-----------------------tt---
                      Horse  ----------------------------------c----tcc-tctgtgt---ccaa--gc----gt---
           White rhinoceros  ----------------------------------c----tccttctgtct---ccaa--gc----ctatc
                        Cat  ------------------------------------------ttctgtct---ctaa--gc----ct---
                        Dog  ----------------------------------g----tccttctgtct---ccag--t-----ct---
                    Ferret   ----------------------------------t----tccttctgtct---ccaa--gc----ct---
                      Panda  ----------------------------------t----tccttccg--t---ccaa--gc----ct---
             Pacific walrus  ----------------------------------t----tccttctgtct---ccaa--tggatcct---
               Weddell seal  ----------------------------------t----tccttctgtct---ccaa--gg----ct---
           Black flying-fox  ----------------------------------t----tccttctgtct---ccaa--gc----gc---
                    Megabat  ----------------------------------t----tccttctgtct---ccaa--gc----gc---
              Big brown bat  ----------------------------------t----tccttctgctt---ccaa--gc----cc---
       David's myotis (bat)  ----------------------------------t----tccttctgtct---ccaa--gc----cc---
                   Microbat  ----------------------------------t----tccttccgtct---ccaa--gc----cc---
                   Hedgehog  ----------------------------------t----tccttctgtct---ccaa--at----ct---
                      Shrew  ----------------------------------t----tgcttttg-ct---ctaa--gg----cc---
            Star-nosed mole  ----------------------------------t----tccttctgtct---ccaa--gc----ct---
                   Elephant  taggaagaaaggcctgcagatctacttctgaaaat----tacttttgtct---ccaa--gc----ct---
                    Manatee  taggaagaaaggcctggagatctacttctgaaaat----tacttttgtct---ccaa--gc----ct---
           Cape golden mole  ----------agtc--------------------t----tacttttgcct---ccaa--gc----tt---
                     Tenrec  ----------ggtc--------------------t----cacatttgtcg---ccag--gc----ct---
                   Aardvark  ----------------------------------t----cgcttttgtct---ccat--gc----ct---
                  Armadillo  ----------------------------------t----cacttctctct---ccaa--gc----ca---
        Cape elephant shrew  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================

                      Human  -gcattatagtgat---acatttcta---------------g-tggca-------------c-ttctatg
                      Chimp  -gcattatagtgat---acatttcta---------------g-tggca-------------c-ttctatg
                    Gorilla  -gcattatagtgat---acatttcta---------------g-tggca-------------c-ttctatg
                  Orangutan  -gcgttatagtgat---acatttctg---------------g-tggca-------------c-ttctatg
                     Gibbon  -gcattatagtgat---aaatttcta---------------g-tggca-------------c-ttctatg
                     Rhesus  -gcattacagtgat---aaatttcta---------------g-tggca-------------c-ttctatg
        Crab-eating macaque  -gcattacagtgat---aaatttcta---------------g-tggca-------------c-ttctatg
                     Baboon  -gcattacagtgat---aaatttcta---------------g-tggca-------------c-ttctatg
               Green monkey  -gcattacagtgat---aaatttcta---------------g-tggca-------------c-ttctatg
                   Marmoset  -gcattacagtgag---gcatttcta---------------g-tggta-------------c-gtctgtg
            Squirrel monkey  -gcattacgatgac---acatttcta---------------a-tggca-------------c-ttctgtg
                   Bushbaby  -g--tgacagcgat---atacttctg---------------gcttccc-------------c-ttctgtg
         Chinese tree shrew  -gtgttacaacaat---atatttctg---------------a-tttcac------------c-ttccatg
                   Squirrel  -gtgttacggtgat---aggtttctg---------------a-tttc----------------ttctatg
     Lesser Egyptian jerboa  -gcattatgatggt---gcatgcccc---------------t-ctctg-------------ccacctaca
               Prairie vole  -ctgttataataatgacacatttctg---------------t-ttcca-------------cattctaca
            Chinese hamster  -ctgttccaatgctgatacatctctg---------------g-tttca-------------cattctaca
             Golden hamster  -ctgctataatgataagacatttctg---------------g-tttca-------------cattctaca
                      Mouse  -gtgttataatgat---acatttgtg---------------g-gttca-------------cagtctatc
                        Rat  -gtgctataatgat---acattcctg---------------g-tttca-------------cagtctgtc
             Naked mole-rat  -gtgttacaatgat---aggtttctg---------------g--tcta-------------ccttttatg
                 Guinea pig  -atgttacactgat---agggctctg---------------g--tcta-------------ccttctttg
                 Chinchilla  -gtgttacaatgat---aggcttctg---------------g--tcta-------------ccctctgtc
           Brush-tailed rat  -gtgttccaatgat---aggtttgtg---------------g--tcta-------------ccttctggg
                     Rabbit  -atgttaccctgat---atatttctg---------------g-tttca-------------ctttctctg
                       Pika  -gtgttgctgtgat---gtatttctg---------------a-tttca-------------tcttctctg
                        Pig  -ctgc-acaataat---acatttctg---------------g-tttca-------------ctctctatg
                     Alpaca  -ctcc-gcaatcat---acatttctg---------------g-tttca-------------ctatgtatg
             Bactrian camel  -ctgc-gcaatcat---acatttctg---------------g-ttttg-------------ctatctatg
                    Dolphin  -ctgc-accgtgat---gcgtgttgg---------------g-ttctc-------------ctctgtatg
               Killer whale  -ctgc-accgtgat---gcgttttgg---------------g-ttcta-------------ctctgtatg
           Tibetan antelope  -ctgc-aagatgat---acatttctg---------------g-ttcca-------------ctctctgtg
                        Cow  -ctgt-aagatgat---acatttctg---------------g-ttcca-------------ctctctgtg
                      Sheep  -ctgc-aagatgat---acatttctg---------------g-ttcca-------------ctctctgtg
              Domestic goat  -ctgc-aagatgat---acatttctg---------------g-ttcca-------------ctctctgtg
                      Horse  -gtgt-acaatgat---acatttctg---------------g-tttca-------------gcctctttg
           White rhinoceros  aatgt-acaatgat---acatttctg---------------g-tttca-------------ccctctgtg
                        Cat  -gtgt-acagcgat---acatttctg---------------a-ttcta-------------ccctcggtg
                        Dog  -gtac-acaaagat---acatttctg---------------a--tcca-------------ccttctgtg
                    Ferret   -gtgt-acaagcat---ccattttcg---------------a-ttcca-------------gcctccgtg
                      Panda  -gtgt-acaatgat---ccatttctg---------------a-ctcca-------------tcctcggtg
             Pacific walrus  -gtgt-acaaggat---ccatttctg---------------a-ttcca-------------tcctctgtg
               Weddell seal  -gtgt-tcaaggat---ccatttctg---------------a-ttctg-------------tcctccgtg
           Black flying-fox  -atgt-acggtgaa---acatttctg---------------g-tttca-------------ccctccgag
                    Megabat  -atgt-atggtgaa---acatttctg---------------g-tttca-------------ccctccgag
              Big brown bat  -ggat-ccaaagat---acatttctg---------------g-tctca-------------ccctctttg
       David's myotis (bat)  -gggt-acaaagat---acatttctg---------------g-tctca-------------ccctctttg
                   Microbat  -cgta-caaaagat---acgtttctg---------------g-tctca-------------ccctctttg
                   Hedgehog  -gtgt-acaatgat---gtttgtg-----------------g-ttttg-------------ccctctatg
                      Shrew  -acgc-acagtgat---gcatgtct----------------g-ctcta-------------ccctctatc
            Star-nosed mole  -gtgt-tcaatgat---gcatttcca---------------g-tttct-------------tcctctatg
                   Elephant  -gtgttacacagat---ac-cttgtg---------------g-aatcc-------------ccgtatgta
                    Manatee  -gtgttacaccgat---ac-ctcatg---------------g-catcc-------------tcgtctgta
           Cape golden mole  -gtgttacctggat---ac-cttctgactg-----------g-atccc-------------ccgtctgtg
                     Tenrec  -ggcctacacagat---cc-ctgcagcccatgcagcacagtg-acacctgccatctgggagcagtctctg
                   Aardvark  -gtgttacacagat---tc-tttctg---------------g-ctccc-------------gcaccgata
                  Armadillo  -gtgttaccatgat---ac-attcag---------------g-ttcca-------------ccctcttta
        Cape elephant shrew  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================

                      Human  cctcc
                      Chimp  cctcc
                    Gorilla  cctcc
                  Orangutan  cctcc
                     Gibbon  cctcc
                     Rhesus  cctcc
        Crab-eating macaque  cctcc
                     Baboon  cctcc
               Green monkey  cctcc
                   Marmoset  cctcc
            Squirrel monkey  cctct
                   Bushbaby  cctcc
         Chinese tree shrew  cctcc
                   Squirrel  cctcc
     Lesser Egyptian jerboa  cttcc
               Prairie vole  ctttc
            Chinese hamster  cttcc
             Golden hamster  cttcc
                      Mouse  ct---
                        Rat  cttcc
             Naked mole-rat  cctcc
                 Guinea pig  ccccc
                 Chinchilla  gcccc
           Brush-tailed rat  ccctc
                     Rabbit  cctcc
                       Pika  cctcc
                        Pig  cctct
                     Alpaca  cctcc
             Bactrian camel  cctcc
                    Dolphin  cctcc
               Killer whale  cctcc
           Tibetan antelope  cctct
                        Cow  cctct
                      Sheep  cctct
              Domestic goat  cctct
                      Horse  cctcc
           White rhinoceros  cctcc
                        Cat  cctcc
                        Dog  cttcc
                    Ferret   cagcc
                      Panda  cgtcc
             Pacific walrus  cgtcc
               Weddell seal  cgtcc
           Black flying-fox  cctcc
                    Megabat  cctcc
              Big brown bat  cctcc
       David's myotis (bat)  cctcc
                   Microbat  cctcc
                   Hedgehog  cccag
                      Shrew  cctct
            Star-nosed mole  ccttt
                   Elephant  cctgc
                    Manatee  cctcc
           Cape golden mole  cctcc
                     Tenrec  cctct
                   Aardvark  tctga
                  Armadillo  tgtcc
        Cape elephant shrew  =====
         American alligator  =====
                    Opossum  =====
            Tasmanian devil  =====
            Green seaturtle  =====

Inserts between block 11 and 12 in window
B D                 Tenrec 347bp

Alignment block 12 of 243 in window, 104651724 - 104651821, 98 bps 
B D                   Human  agcttata--ccacttctttgatcttgcccatgaagcacat---cagagcgtgtgc-cctgg-agtcagc
B D                   Chimp  agcttata--ccacttctttgatcttgcccatgaagcacat---cagagcgtgtgc-cctgg-aatcagc
B D                 Gorilla  agcttata--ccacttctttgatcttgcccatgaagcacat---cagagcgtgtgc-cctgg-aatcagc
B D               Orangutan  agcttata--ccacttctttgatcttgcccatgaagcacat---cagagcatgtgc-cctgg-aatcagc
B D                  Gibbon  agcttata--ccactgctttgatcttgcccatgaagcacat---cagagcgtgcgc-cctgg-aatcagc
B D                  Rhesus  agcttata--ccac-gctttgatcttgcccatgaggcacat---gggagtgtgtgc-cctgg-aatcagc
B D     Crab-eating macaque  agcttata--ccac-gctttgatcttgcccatgaggcacat---gggagtgtgtgc-cctgg-aatcagc
B D                  Baboon  agcttata--ccac-gctttgatcttgcccatgaggcacat---gggagcgtgtgc-cctgg-aatcagc
B D            Green monkey  agcttata--ccac-gctttgatcttgcccatgaggcacat---gggagcatgtgc-cctgg-aataagc
B D                Marmoset  agcatatg--ccactgctttggtcttgcccatgaagcacat---cagagcatgtgc-cctgg-aatctgc
B D         Squirrel monkey  agcatatg--ccactgctttggtcttgcccatgaagcacat---cagagcgtgtgc-cctgg-aatctgc
B D                Bushbaby  agcataca--ccactgctctgatcttgcctgagaagcacct---cagaaggtgtgc-tctgg-catcagc
         Chinese tree shrew  ggcaaatc--ccactgttttgatcttagccctgaagcatgtgcacagagcatgtgg-cttag-aatcagt
B D                Squirrel  agcatatg--ccactgctttgatcttgtccttgaagcacat---gggagtatgtgc-tctgg-actcagc
     Lesser Egyptian jerboa  atcctatg--tcactgctttgatctttcccatgaagcacat---ccaag---------------------
               Prairie vole  agtttata--tgatcactttgatcttgcccccggagcacat---gcaagcatacac-tctgg-agt--gc
B D         Chinese hamster  agcttata--tgagcactttgatcttgcc-------cacat---gcaagcaaacct-tccag-agt--at
             Golden hamster  agcttgta--tgatcactttgatcttgcc-------tacat---gcaagctaacat-tccag-agt--at
B D                   Mouse  agcctata--tgatcactatgatcttgcccatgaagcacat---gcaaaagaacat-tctag-agt--ac
B D                     Rat  agcctgtg--tgatcactgccatcttgcctatgaagcacat---acaagtgaacat-tctag-agt--ac
B D          Naked mole-rat  agcacata--ccactgctttgatcttacccatgacacgtat---ctgagcatgggc-tctgg-agtcacc
B D              Guinea pig  agcatat-----actgctttgatcctgcccatgacacatgt---ctaagcatggcg-tatgg-ggacagc
                 Chinchilla  agaatata--ccactgctttgatcctgcccatgacacatat---ctgagcatggac-tatgg-ggtcagc
           Brush-tailed rat  agcataca--ccactgctttgatcctgcccaagacacatac---ctgagcatggac-tatgg-gatcagc
B D                  Rabbit  agcgtgtt--ttagtgctttgatctttcccaggaagaaggt---ctgagcaggcgc-actgg-aatcagc
B D                    Pika  agtgtata--ctaa-----tgatcttgctctggaagccctt---ctggggatgtgc-actgg-aatgaga
B D                     Pig  ggcatata--ccactgctttgatctttctcgtgaagtccat---cagagcatgtgc-tct-g-aatca--
B D                  Alpaca  ggcgtata--ccaccactttgattttgcccatgaagcacat---catagtgtgcacttctgg-attca--
             Bactrian camel  ggcatata--ccaccactttgattttgcccatgaagcacat---catagtatgcacttctgg-attca--
B D                 Dolphin  agcatata--ccaccactttgatcttgcccataaagcacgt---cagagcacgtgc-tctgg-aatca--
               Killer whale  agcatata--ccaccactttgagctcgcccataaagcacgt---cagagcacgtgc-tctgg-aatca--
           Tibetan antelope  ggcatata--gcaccgccttgattttgcctaagaagcacat---cagggcatatgc-tctag-aatca--
B D                     Cow  ggcatata--gcaccaccttgattttgcctaagaagcacat---cagggcatatgt-tctag-aatca--
B D                   Sheep  ggcatata--gcaccaccttgattttgcctaagaagcacat---cagggcatatgc-tctag-aatca--
              Domestic goat  ggcatata--gcaccaccttgattttgcctgagaagcacat---cagggcatatgc-tctag-aatca--
B D                   Horse  agcatccg--ccaccgctttgatcttgcccgtgaagcactt---cagagcatacgc-tctgg-aatcc--
B D        White rhinoceros  agcatact--ccaccgctttgatcttgcccaggaagcacag---cagagcatgcac-tatgg-aatcc--
B D                     Cat  agtgtcca--acaccacttggggcttgcc-------cacat---gtcagcatgcat-tctag-aatca--
B D                     Dog  agcctaca--ccaccgctttgggcccgcccatgaagcgcat---caaagcaggcct-tctag-aatca--
B D                 Ferret   agcccaca--ccaccactgtggtcttgcccacgaagcgcgt---gtcagcgtgcat-tctag-aatca--
B D                   Panda  agcctaca--ccaccattttggtcttgcccacgaagcacat---cgaagcatgtat-tctag-aatca--
             Pacific walrus  agcccaca--ccaccactttggtcttgcctgcaaagcacat---ctaagcatgcat-tctag-aatca--
               Weddell seal  agcccaca--ccaccactttggtcttgcccacgaagcacat---ctaagcatgcat-tctag-aatca--
           Black flying-fox  agcatata--ccaccgcttt-atcttg-ccaggaagcacct---tgggacatgcgc-tccag-aatca--
B D                 Megabat  agcatata--ccaccgcttt-atcttg-ccaggaagcacct---tggaacgtgcgc-tccgg-aatca--
              Big brown bat  agtgtata--ccaccacttt-aacttgcccaagtagcacat---tggagcatgcgc-tctgg-aatca--
       David's myotis (bat)  agggtata--ccaccacgtt-aacttgcccaagtagcacac---tggagcatgcgc-tctgg-aatca--
B D                Microbat  agggtaga--ccaccacgtt-cacttgcccaagtagcacac---tggagcatgcgc-tctgg-aatca--
B D                Hedgehog  gatatatatgccatcattttgatgtttccc---------------acagcatgtgc-tctga-agtca--
B D                   Shrew  gacataca--ccatcacttcagtcttgaccatgaagtacac---tacagcctgtat-tctgg-aatca--
            Star-nosed mole  ggcataca--ctgccgctttgatcttacccattaagaacat---cagagcatgctc-tctgc-a------
B D                Elephant  agcttaca--tcac-actttcatcttgcccatgaagcacat---cagagcatgggc-tctgg-aagc-at
B D                 Manatee  agcgtacg--ccac-actttcatcttgcccgtgaagcacat---cagagcatgggc-tctgg-aatc-at
           Cape golden mole  agtggatg--ccactactttgatcctgctcatgaagcacat---cagcatacatgc-cctggcaact-gt
                   Aardvark  agcatcc---ccgctgctttgatcttgtccttgaagcccat---cagagcatgggc-tctgg-aagcaat
B D               Armadillo  agcacaca--ccacctctttga---tgttcatgaagccgac---cagagcaggacc-tctgg-aatcaga
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================

                      Human  ttctgc----ctgtcattagcagtgagaccttgagaaaa
                      Chimp  ttctgc----ctgtcattagcagtgagaccttgagaaaa
                    Gorilla  ttctgc----ctgtcattagcagtgagatcttgagaaaa
                  Orangutan  ttctgc----ctgtcattagcagtgagaccttgagaaaa
                     Gibbon  ttctac----ctgttgttagcagtgagaccttgagaaaa
                     Rhesus  ttctgt----ctgtcattagcagtgagaccttgagaaaa
        Crab-eating macaque  ttctgt----ctgtcattagcagtgagaccttgagaaaa
                     Baboon  ttctgt----ctgtcattagcagtgagaccttgagaaaa
               Green monkey  ttctgt----ctttcattagcagtgagaccttgagaaaa
                   Marmoset  ttctgc----ctctcattggcagtgagaccttgagaaaa
            Squirrel monkey  ttctgcctctctctcattggcagtgagaccttgagaaaa
                   Bushbaby  ctctgc----ctctcattagcagcgagaccttggggaag
         Chinese tree shrew  ctctgt----ttctcattagcagtgagaacttaggaaag
                   Squirrel  ctctg---------cattagtggtgagactatgggaaaa
     Lesser Egyptian jerboa  --ctct----cataaagtagtgggccc--tgggggaact
               Prairie vole  ccctgt----ccctaactagtggtgat--cttggaaaag
            Chinese hamster  c-ctgt----ccctcgttagtggtgtg--tgtggaaaag
             Golden hamster  ctctgt----ctctcattagtggtgaa--tgtggaaaag
                      Mouse  ctctgg----ccctcattagtggtgag--ctaggaaaag
                        Rat  ctctac----tcctcattagtggtgag--ctaggaaaag
             Naked mole-rat  ctctgc----ctctccttagcagagagtccttgggaaag
                 Guinea pig  ctctgt----ctctccttagcagtgagatattgggaaat
                 Chinchilla  ttct-c----ttcttttaagcagtgagaccctgggaaag
           Brush-tailed rat  ctgtgc----ctcttactagctgtgagaccttgggaaag
                     Rabbit  ctct----------cactagcagcaagaccttgggaaag
                       Pika  ctct----------cactagcagtgagaccttgggaaag
                        Pig  ctctgc----ctcccactaccaataagaccttggtagag
                     Alpaca  ctctgt----ctcccattagcagtgagaccttggaagag
             Bactrian camel  ctctgt----ctcccattagcagtgagaccttgggaaag
                    Dolphin  ctgt------cgcccactagcagtgagaccttggggaag
               Killer whale  ctgt------cacccactagcagtgagaccttgggcaag
           Tibetan antelope  ctctg-----ccctcattagcagtaataccttgaggaag
                        Cow  ctctg-----ccctcgttagcagcgataccttgaggaag
                      Sheep  ctctg-----ccctcattagcagtaataccttgaggaag
              Domestic goat  ctctg-----ccctcattagcagtaataccttgaggaag
                      Horse  tgccgc----ctctccccagcagtgagacctggggagag
           White rhinoceros  ctctgc----ttctcaccagcactgagacctggggaaag
                        Cat  ctgtgg----ctcttactatcagcgagacct-agacgag
                        Dog  ctctgc----ctgtcactagcagtgagacct-gggaaag
                    Ferret   ccctgc----ctctcgctagcagtgagacct-gggaaac
                      Panda  ctcttc----ctctcgctagcagcgagacct-gggaaag
             Pacific walrus  ctctgc----ctctcactggcagtgagacct-gggaaag
               Weddell seal  ctctgc----ctctcactagctgtgagacct-gggaaag
           Black flying-fox  ctctgc----ctctcactatcggtgagaccttgggaaag
                    Megabat  ctctgc----ctctcactatcagtgagaccttgggaaag
              Big brown bat  c-ctgc----ctctcactagcagtgagacctgagggaag
       David's myotis (bat)  c-ctgc----ctctcactagcagtgaggccttggggaag
                   Microbat  c-ctgc----ctctcactagcagtgaggccttggggaag
                   Hedgehog  tg--at----ccttc-------------cattgtgaaag
                      Shrew  caagat----ctctctttagcagttcaaccttggggaag
            Star-nosed mole  ----aa----ctctcatgagcaatgaggtcttgggaaag
                   Elephant  ctctgcct--ctctcactagcagcaggacctttggaaag
                    Manatee  ctatgc----ctctcactagcagcaggaccttgggaaag
           Cape golden mole  ctctgc----ttctccctggcagtgggaccttaggaaag
                   Aardvark  ctctgc----ctctcactagcactggggccttgggaaag
                  Armadillo  ctccac----ctctcactagcagtgggaccttgagaaag
                     Tenrec  =======================================
        Cape elephant shrew  =======================================
         American alligator  =======================================
                    Opossum  =======================================
            Tasmanian devil  =======================================
            Green seaturtle  =======================================

Inserts between block 12 and 13 in window
          Cape golden mole 168bp

Alignment block 13 of 243 in window, 104651822 - 104651823, 2 bps 
B D                   Human  c------t
B D                   Chimp  c------t
B D                 Gorilla  c------t
B D               Orangutan  c------t
B D                  Gibbon  c------t
B D                  Rhesus  t------t
B D     Crab-eating macaque  t------t
B D                  Baboon  t------t
B D            Green monkey  t------t
B D                Marmoset  t------t
B D         Squirrel monkey  t------t
B D                Bushbaby  t------t
         Chinese tree shrew  t------t
B D                Squirrel  t------g
     Lesser Egyptian jerboa  t------g
               Prairie vole  t------a
B D         Chinese hamster  g------g
             Golden hamster  g------g
B D                   Mouse  t------g
B D                     Rat  c------a
B D          Naked mole-rat  t------t
B D              Guinea pig  t------t
                 Chinchilla  t------t
           Brush-tailed rat  t------t
B D                  Rabbit  t------t
B D                    Pika  t------t
B D                     Pig  g-------
B D                  Alpaca  g------t
             Bactrian camel  a------t
B D                 Dolphin  g------t
               Killer whale  g------t
           Tibetan antelope  gtattaat
B D                     Cow  gtattaat
B D                   Sheep  gtattagt
              Domestic goat  gtattaat
B D                   Horse  g------g
B D        White rhinoceros  g------t
B D                     Cat  g------t
B D                     Dog  g------c
B D                 Ferret   g------g
B D                   Panda  g------g
             Pacific walrus  g------g
               Weddell seal  g------g
           Black flying-fox  g------c
B D                 Megabat  g------c
              Big brown bat  g------t
       David's myotis (bat)  g------t
B D                Microbat  g------t
B D                Hedgehog  g------t
B D                   Shrew  g------t
            Star-nosed mole  g------t
B D                Elephant  -------t
B D                 Manatee  -------t
                   Aardvark  -------t
B D               Armadillo  ------ct
B D                  Tenrec  ========
       Cape elephant shrew  ========
B D      American alligator  ========
          Cape golden mole  ========
B D                 Opossum  ========
B D         Tasmanian devil  ========
  D         Green seaturtle  ========

Inserts between block 13 and 14 in window
B D               Elephant 1bp
B D                Manatee 1bp
                  Aardvark 1bp

Alignment block 14 of 243 in window, 104651824 - 104651834, 11 bps 
B D                   Human  ag----t---------aatctgt--c
B D                   Chimp  ag----t---------aacctgt--c
B D                 Gorilla  ag----t---------aacctgt--c
B D               Orangutan  ag----t---------aacctgt--c
B D                  Gibbon  ag----t---------aacctgt--c
B D                  Rhesus  ag----t---------aacctgt--c
B D     Crab-eating macaque  ag----t---------aacctgt--c
B D                  Baboon  ag----t---------aacctgt--c
B D            Green monkey  ag----t---------aacctgt--c
B D                Marmoset  ag----t---------aacctat--c
B D         Squirrel monkey  ag----t---------aacctat--c
B D                Bushbaby  ag----t---------aa-ctct--c
         Chinese tree shrew  ag----t---------aacctct--c
B D                Squirrel  ag----t---------agccttt---
     Lesser Egyptian jerboa  ag----t---------aacatct--c
               Prairie vole  at----c---------atcccat--c
B D         Chinese hamster  aa----c---------atcccat--c
             Golden hamster  aa----c---------atcccat--c
B D                   Mouse  ag----t---------atcccat--c
B D                     Rat  ag----c---------atcccgt--c
B D          Naked mole-rat  ag----t---------agtctcc--c
B D              Guinea pig  ag----t---------agtttct---
                 Chinchilla  ag----t---------agtctct--c
           Brush-tailed rat  ag----t---------ggtctct--c
B D                  Rabbit  ag----a---------aacctct--c
B D                    Pika  gc----a---------aacccct--c
B D                     Pig  ------t---------aaggtct--c
B D                  Alpaca  ag----t---------aacctct--c
             Bactrian camel  ag----t---------aacctct--c
B D                 Dolphin  ag----t---------aacctct--c
               Killer whale  ag----t---------aacctct--c
           Tibetan antelope  ag----t---------aacgtct--c
B D                     Cow  ag----t---------aacatct--c
B D                   Sheep  ag----t---------aacgtct--c
              Domestic goat  ag----t---------aacgtct--c
B D                   Horse  ag----c---------aatctct--t
B D        White rhinoceros  ag----c---------aacctct--c
B D                     Cat  gg----t---------aacctct--c
B D                     Dog  agtcgct---------aacctct--c
B D                 Ferret   ag----t---------cacctcg--c
B D                   Panda  ag----t---------aacctct--c
             Pacific walrus  ag----t---------aacctct--c
               Weddell seal  ag----t---------aacctct--c
           Black flying-fox  ag----c---------caccttt--c
B D                 Megabat  ag----c---------caccttt--c
              Big brown bat  cg--------------caactct--c
       David's myotis (bat)  cg--------------caactct--c
B D                Microbat  cg--------------caactct--c
B D                Hedgehog  ga----t---------gaacactctc
B D                   Shrew  gg----t---------aactccg-tc
            Star-nosed mole  ag----t---------aacca----c
B D                Elephant  ag----t---------aacctct--g
B D                 Manatee  ag----t---------aacctc----
           Cape golden mole  ag----tctccattgaaatctgt--c
B D                  Tenrec  ag----t---------aacctct--c
                   Aardvark  ag----t---------aacctct--g
B D               Armadillo  ag----t---------aacctct--a
       Cape elephant shrew  ==========================
B D      American alligator  ==========================
B D                 Opossum  ==========================
B D         Tasmanian devil  ==========================
  D         Green seaturtle  ==========================

Inserts between block 14 and 15 in window
          Cape golden mole 118bp

Alignment block 15 of 243 in window, 104651835 - 104651858, 24 bps 
B D                   Human  tgagcctcagtttcctgac----ttgta
B D                   Chimp  tgagcctcagtttcctgac----ttgta
B D                 Gorilla  tgagcctcagtttcctgac----ttgta
B D               Orangutan  tgagcctcagttttctgac----ttgta
B D                  Gibbon  ttagcctcagtttcctgac----tttta
B D                  Rhesus  tgagcctcggtttcctgag----tcata
B D     Crab-eating macaque  tgagcctcggtttcctgag----tcata
B D                  Baboon  tgagcctcggtttcctgac----tcata
B D            Green monkey  tgtgcctcggtttcctgac----tcata
B D                Marmoset  tgagcctcagttacctggc----ttata
B D         Squirrel monkey  tgagcctcagttacctggc----ttata
B D                Bushbaby  tgagtttcagttgactggt----ttatc
         Chinese tree shrew  tgacgcttgatttgcttat----ttcga
B D                Squirrel  -----ctcaatttactgat----ttaca
     Lesser Egyptian jerboa  tgagtctcaatttattgat----ttata
               Prairie vole  tgagcctgaatttgttgat----ttata
B D         Chinese hamster  tgagcctccatttgttgat----ttata
             Golden hamster  tgagcctccatttgttgat----ttata
B D                   Mouse  ggagcctcgagttgttgat----ttata
B D                     Rat  tgagcctcgagttgttgat----ttata
B D          Naked mole-rat  agagcctcaatttacttactaatttgt-
B D              Guinea pig  -gagcctcaatttcctgac----ttgta
                 Chinchilla  agagcctcaatttactgac----ttgta
           Brush-tailed rat  agagcctcaatttaccaac----ttgta
B D                  Rabbit  ttaacctcaatttactgac----ttgaa
B D                    Pika  ttgacctcaggtgactgat----ttgaa
B D                     Pig  tctgatcctgtttcccgat----ttgta
B D                  Alpaca  tgaacctcagtttcctgat----ttgta
             Bactrian camel  tgaacctcagtttcctgat----ttgta
B D                 Dolphin  tgagccttagtttcctgat----atgtg
               Killer whale  tgagccttagtttcctgat----atgtg
           Tibetan antelope  --agcctcagtttcctgat----ctatg
B D                     Cow  --agcctcagtttcctgat----ctatg
B D                   Sheep  --agcctcagtttcctgat----ctatg
              Domestic goat  --agcctcagtttcctgat----ctatg
B D                   Horse  tgaacctcgatttcctggt----tttcg
B D        White rhinoceros  tgaacctcaatttcctgat----ttgta
B D                     Cat  tgagcctccatttcccaat----ttgta
B D                     Dog  tgagcctccatttccggat----ttgta
B D                 Ferret   tgagcctcagtttcctgtt----ttgta
B D                   Panda  cgagcctcagtttcctgat----ttgta
             Pacific walrus  cgagcctcagtttcctgat----ttgta
               Weddell seal  ccagcctcagtttcctgat----ttgta
           Black flying-fox  agaccctcaatttcctgat----ttgta
B D                 Megabat  agaccctcaatttcctgat----ttgta
              Big brown bat  tggctgtcaatttcctgat----ttgta
       David's myotis (bat)  tggctttcaatttcctgat----ttgta
B D                Microbat  tggctttcagtttcccgat----ttgta
B D                Hedgehog  agaacctccatttcctgtt----ttata
B D                   Shrew  tgagtcacagtgtcctgat----taatt
            Star-nosed mole  tgagtctcagtttcctgat----ttgta
B D                Elephant  ----ttgttgttagctgcc----ctcga
B D                 Manatee  -----tgttgttagttgcc----cttga
           Cape golden mole  tgagcctcagttttctaat----ctgta
B D                  Tenrec  tgagcctcaatttcctgat----ctaat
                   Aardvark  ----ttgttgttagttgcc----ctcga
B D               Armadillo  tgaggctcattttcctgat----ttgta
       Cape elephant shrew  ============================
B D      American alligator  ============================
B D                 Opossum  ============================
B D         Tasmanian devil  ============================
  D         Green seaturtle  ============================

Inserts between block 15 and 16 in window
B D               Elephant 35bp
B D                Manatee 323bp
          Cape golden mole 3bp
B D                 Tenrec 3bp
                  Aardvark 34bp

Alignment block 16 of 243 in window, 104651859 - 104651893, 35 bps 
B D                   Human  aa--at-------ggtgataatttcaggctca-----caggc------------------tattgtg
B D                   Chimp  aa--at-------ggtgataatttcaggctca-----caggc------------------tattgtg
B D                 Gorilla  aa--at-------ggtgataatttcaggctca-----caggc------------------tattgtg
B D               Orangutan  aa--at-------ggtgataatttcaggctta-----caggc------------------tattgtg
B D                  Gibbon  aa--at-------ggtgataatttcaggctca-----caggc------------------tattgtg
B D                  Rhesus  aa--at-------ggtgataatttcaggctcg-----caggc------------------tattgtg
B D     Crab-eating macaque  aa--at-------ggtgataatttcaggctcg-----caggc------------------tattgtg
B D                  Baboon  aa--at-------ggtgataatttcaggctca-----caggc------------------tattgtg
B D            Green monkey  aa--at-------ggtgataatttcaggctca-----caggc------------------tattgtg
B D                Marmoset  aa--at-------ggtgatcatttcaggctct-----caggc------------------tattgtg
B D         Squirrel monkey  aa--at-------ggtgatcatttcaggctca-----caggc------------------tattgtg
B D                Bushbaby  ag--gt-------ggtgatcattacagac--------------------------------------
         Chinese tree shrew  aa--at-------gaggacaacttcatgtgca-----caggt------------------tgttgtg
B D                Squirrel  aa--at-------gttcataattccaaacccc-----caaat------------------tgttatg
     Lesser Egyptian jerboa  aa--at-------agtcataattccagaccca-----caggt------------------tgttggg
               Prairie vole  aa--at-------gg---------caaacaca-----ggagt------------------tgttgtg
B D         Chinese hamster  aa--at-------gg---------tagactct-----ggagc------------------tgttgtg
             Golden hamster  aa--at-------gg---------tagagtct-----ggagc------------------tgttgtg
B D                   Mouse  ag--at-------ggttcttattctagactca-----aaagt------------------tgttgtg
B D                     Rat  ag--at-------ggctcttattctagcctcg-----gaagt------------------tgttgtg
B D          Naked mole-rat  aa--at-------agtcacaattccagacaca-----a--gt------------------tgttata
B D              Guinea pig  aa--at-------agtcacaattccaaacttg---------t------------------tgttgtg
                 Chinchilla  aa--at-------agttacaattccagactca-----c---a------------------aattctg
           Brush-tailed rat  aa--at-------agttgcaattccag--------------t------------------agttgtg
B D                  Rabbit  aa--gt-------ggttaca-----------------------------------------------
B D                    Pika  ag--gt-------atcgacaattccagtctca-----tggat------------------tgttgag
B D                     Pig  aatggtgcctcacagttatcgttt--gactca-----caggt------------------ggttgtg
B D                  Alpaca  aata---------aatggtgg------actca-----caggt------------------ggttgtg
             Bactrian camel  aata---------aatggtgg------actca-----caggt------------------ggttgtg
B D                 Dolphin  aatggt-------gatcatagtct--gactca-----taggt------------------agttgtg
               Killer whale  aatggt-------gatcatagtct--gactca-----taggt------------------agttgtg
           Tibetan antelope  aatggt-------gattatag----------------------------------------gttatg
B D                     Cow  aatgtt-------gataacag----------------------------------------gttgtg
B D                   Sheep  aatggt-------gattatag----------------------------------------attatg
              Domestic goat  agtggt-------gattgtag----------------------------------------gttatg
B D                   Horse  agtggt-------gatagtaattccagactca-----caggt------------------gatcgtg
B D        White rhinoceros  gatggt-------gataataattccagactca-----caggt------------------ggttgta
B D                     Cat  aatggt-------gacaatacctccaggctca-----caggt------------------agttgtg
B D                     Dog  aatggt-------gataaaaattctagtctca-----cacgt------------------agtggtg
B D                 Ferret   aaaggt-------gatgataattccagtctca-----caggc------------------agttgtg
B D                   Panda  aatagt-------gataataattccagtgtca-----cagg--------------------------
             Pacific walrus  aaaggt-------gataataactccagtctca-----caggc------------------agttgtg
               Weddell seal  aaaggt-------gataataattgcagtctca-----caggc------------------agttgtg
           Black flying-fox  aatggt-------gctaataattccagacata-----caggt------------------gttcgtg
B D                 Megabat  aatggt-------gctaataattccagacata-----caggt------------------gttcatg
              Big brown bat  aatggt-------gatgataagtccaatctca-----caggt------------------ggttgtg
       David's myotis (bat)  aatgat-------gatgacaattccagtctca-----taggt------------------ggttgtg
B D                Microbat  aatggt-------gatgacaattccagtctca-----caggt------------------ggttgtg
B D                Hedgehog  aacaat-------ggtattagtcccagactca-----ttgat------------------tcttgtg
B D                   Shrew  gggggt-------gtttatgagtacagatgtg-----caggt------------------gtttgtg
            Star-nosed mole  acaagt-------ggtactga-tctagactca-----gaag---------------------ctatt
B D                Elephant  --gact-------gttgctatgtttgggctcatcttccagctctatatcagacaacgttctgttgcg
B D                 Manatee  --aaat-------ggtgataattccagactca-----caggt------------------tgttgtg
           Cape golden mole  --cagc-------aataataaccccaaacttg-----caggt------------------t---gtg
B D                  Tenrec  --ggac-------aatgataattccagactca-----caggt------------------tatcgtg
                   Aardvark  --aagt-------gttgttctgtttgggctcatctcccagctctgtgtcggacgatgttctattaca
B D               Armadillo  --aaat-------agcaatcattcttgactaa-----caggt------------------tat-gtg
       Cape elephant shrew  ===================================================================
B D      American alligator  ===================================================================
B D                 Opossum  ===================================================================
B D         Tasmanian devil  ===================================================================
  D         Green seaturtle  ===================================================================

Alignment block 17 of 243 in window, 104651894 - 104651909, 16 bps 
B D                   Human  a-----------------ggat--t--a-------aa-t-gacatc
B D                   Chimp  a-----------------ggat--t--a-------aa-t-gacatc
B D                 Gorilla  a-----------------ggat--t--a-------aa-t-gacatc
B D               Orangutan  a-----------------ggat--t--a-------aa-t-gacatc
B D                  Gibbon  a-----------------ggat--t--a-------aa-t-gacatc
B D                  Rhesus  a-----------------ggat--t--a-------aa-t-gatatc
B D     Crab-eating macaque  a-----------------ggat--t--a-------aa-t-gatatc
B D                  Baboon  a-----------------ggat--t--a-------aa-t-gatatt
B D            Green monkey  a-----------------ggat--t--a-------aa-t-gatatc
B D                Marmoset  a-----------------ggat--t--a-------aa-t-gatatt
B D                Bushbaby  --------------------------------------------tc
         Chinese tree shrew  a-----------------gggt--t--c-------aa-c-gat---
B D                Squirrel  a-----------------ggat--t-ta-------aa-t-gatatc
     Lesser Egyptian jerboa  a-----------------ggac--t----------gagt-agtatc
               Prairie vole  a-----------------ggatgat----------ga-cagacatt
B D         Chinese hamster  g-----------------gcat--t----------ga-t-gacatt
             Golden hamster  a-----------------gtat--t----------gg-t-gacatt
B D                   Mouse  a-----------------ggat--t----------aa-t-gatatc
B D                     Rat  a-----------------ggac--t----------ga-t-gatgtt
B D          Naked mole-rat  a-----------------gaat--t--a-------aa-t-gatgtc
B D              Guinea pig  a-----------------ggat--t--a-------aa-t-gacatg
                 Chinchilla  a-----------------ggat--t--a-------aa-t-cactt-
           Brush-tailed rat  a-----------------gaac--------------a-t-cactt-
B D                    Pika  a-----------------gaaa--t-ca-------gc-t-gacatc
B D                     Pig  a-----------------ggat--t--a-------aa-t-gacatc
B D                  Alpaca  a-----------------ggat--t--a-------ga-t-gacgtc
             Bactrian camel  a-----------------ggat--t--a-------ga-t-gacgtc
B D                 Dolphin  a-----------------ggat--t--a-------aa-t-gccatc
               Killer whale  a-----------------ggat--t--a-------aa-t-gccatc
           Tibetan antelope  a-----------------ggat--t--a-------ag-t-gacatt
B D                     Cow  a-----------------ggat--t--a-------aa-t-gacatc
B D                   Sheep  a-----------------ggat--t--a-------aa-t-gacatc
              Domestic goat  a-----------------ggat--t--a-------aa-t-gacatc
B D                   Horse  t-----------------gggt--t--a-------ag-t-gacatc
B D        White rhinoceros  a-----------------ggat--t--a-------aa-t-gacatc
B D                     Cat  a-----------------ggat--t--a-------ca-t-gacatc
B D                     Dog  a-----------------aggt--t--a-------aa-c-gacatc
B D                 Ferret   a-----------------gggt--t--a-------aa-t-gacatc
B D                   Panda  ------------------------t--a-------aa-t-gacacc
             Pacific walrus  a-----------------gggt--t--a-------aa-t-gacatc
               Weddell seal  a-----------------gggt--t--a-------aa-t-gacatc
           Black flying-fox  a-----------------ggat--t--t-------ag-t-gatatc
B D                 Megabat  a-----------------ggat--t--t-------ag-t-gatatc
              Big brown bat  a-----------------ggat--t--t-------ag-t-gatatc
       David's myotis (bat)  a-----------------ggat--t--t-------ag-t-gatatc
B D                Microbat  a-----------------ggat--t--t-------ag-t-gatatc
B D                Hedgehog  t-----------------g---------------------gacatc
B D                   Shrew  a-----------------aggt--t--a-------aa-t-gatctc
            Star-nosed mole  a-----------------ggat--t--a-------aa-t-gatatc
B D                Elephant  atccataaggttttcattggct--a--attttcagaa-g-tagatt
B D                 Manatee  a-----------------ggat--a--a-------aa-g-gagatc
           Cape golden mole  a-----------------ggat--atca-------aa-t-gagatc
B D                  Tenrec  a-----------------ggat--a--a-------aa-t-gagatc
                   Aardvark  atccagaaagttttcttcggct--a--attttcagga-g-tcaatc
B D               Armadillo  a-----------------agag--c----------aa-t-gaaatc
B D                  Rabbit  ----------------------------------------------
       Cape elephant shrew  ==============================================
B D      American alligator  ==============================================
B D                 Opossum  ==============================================
B D         Tasmanian devil  ==============================================
  D         Green seaturtle  ==============================================
B D         Squirrel monkey  ----------------------------------------------

Inserts between block 17 and 18 in window
                  Aardvark 145bp

Alignment block 18 of 243 in window, 104651910 - 104651935, 26 bps 
B D                   Human  ac-------------------------atatgtgggg--------------------------tg-cc--
B D                   Chimp  ac-------------------------atatgtgggg--------------------------tg-cc--
B D                 Gorilla  ac-------------------------atatgtgggg--------------------------ag-cc--
B D               Orangutan  ac-------------------------atatgtggag--------------------------tg-cc--
B D                  Gibbon  ac-------------------------atatatgggg--------------------------tg-cc--
B D                  Rhesus  cc-------------------------atatgcaggg--------------------------tg-cc--
B D     Crab-eating macaque  cc-------------------------atatgcaggg--------------------------tg-cc--
B D                  Baboon  cc-------------------------atatgcaggg--------------------------tg-cc--
B D            Green monkey  cc-------------------------atatgcaggg--------------------------tg-cc--
B D                Marmoset  ac-------------------------atatgtgggg--------------------------tg-cc--
B D                Bushbaby  ac-------------------------atgggtaggg--------------------------tg-tc--
         Chinese tree shrew  ----------------------------------ggt--------------------------gg-cc--
B D                Squirrel  ac-------------------------ctatgtgggg--------------------------tg-tt--
     Lesser Egyptian jerboa  ac----------------------------tgagagc--------------------------ta-ta--
               Prairie vole  ac----------------------attatatgtaaaa--------------------------ta-ta--
B D         Chinese hamster  ac-------------------------atatgtgatg--------------------------ta-aa--
             Golden hamster  ac-------------------------atatgtgaca--------------------------ta-ta--
B D                   Mouse  at-------------------------atatgtaaag--------------------------ta-ca--
B D                     Rat  ac-------------------------atatgtcaag--------------------------ca-ca--
B D          Naked mole-rat  ac---------------------------ttatgaag--------------------------tg-tc--
B D              Guinea pig  ac---------------------------atgtgagg--------------------------gg-tc--
                 Chinchilla  -----------------------------atgtgagg--------------------------tg-tt--
           Brush-tailed rat  -----------------------------atgtgagg--------------------------tg-tg--
B D                  Rabbit  --------------------------------taagg--------------------------ca-tc--
B D                    Pika  at-------------------------ctatgtaaag--------------------------ca-tc--
B D                     Pig  ac-------------------------ctatgtggag--------------------------tg-tc--
B D                  Alpaca  ac-------------------------ccatgtcaag--------------------------tg-tc--
             Bactrian camel  ac-------------------------ccatgtcaag--------------------------tg-tc--
B D                 Dolphin  gc-------------------------ctatgtggac--------------------------tg-tc--
               Killer whale  ac-------------------------ctatgtggac--------------------------tg-tc--
           Tibetan antelope  ac-------------------------ctaggtgagg--------------------------tg-tc--
B D                     Cow  ac-------------------------ctaggtgagg--------------------------tg-tc--
B D                   Sheep  ac-------------------------ctaggtgagg--------------------------tg-tc--
              Domestic goat  ac-------------------------ctaggtgagg--------------------------tg-tc--
B D                   Horse  gc-------------------------atatctgggg--------------------------tg-tc--
B D        White rhinoceros  ac-------------------------atatctgggg--------------------------tg-tt--
B D                     Cat  ac-------------------------atatatgggg--------------------------tg-tc--
B D                     Dog  ac-------------------------atacgtgggg--------------------------cg-tc--
B D                 Ferret   at-------------------------atgtgtgggg--------------------------tg-tc--
B D                   Panda  ac-------------------------atatgtgggg--------------------------tg-tc--
             Pacific walrus  ac-------------------------atgtgtgggg--------------------------tg-tc--
               Weddell seal  ac-------------------------atgtgtgggg--------------------------tg-tc--
           Black flying-fox  ac-------------------------atatgtgtgg--------------------------tg-tc--
B D                 Megabat  ac-------------------------atctgtgcgg--------------------------tg-tc--
              Big brown bat  ac-------------------------ctccgtgggt--------------------------tg-tc--
       David's myotis (bat)  ac-------------------------ctacgtgggt--------------------------tgttc--
B D                Microbat  ac-------------------------ctacataggt--------------------------tg-tc--
B D                Hedgehog  ac-------------------------aagtatggaa--------------------------ca-ct--
B D                   Shrew  ac-------------------------a--tctagga--------------------------gg-tg--
            Star-nosed mole  at-------------------------aagtgtacag--------------------------aa-tc--
B D                Elephant  gccgggtctttcttcctagtctgtcttaga-ctggaagcatcactgaaacc------------tg-tcc-
B D                 Manatee  ac-------------------------ata-atggag--------------------------tg-tc--
           Cape golden mole  aa-------------------------ata-atggag--------------------------gc-tt--
B D                  Tenrec  ac-------------------------cta-atgaag--------------------------tg-tc--
                   Aardvark  ac-------------------------aga-tgggtggtggcaataacctctatgagcttcaatt-tcct
B D               Armadillo  ------------------------atggac-gcggag--------------------------tg-tc--
       Cape elephant shrew  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D         Squirrel monkey  ----------------------------------------------------------------------

                      Human  ----------------------------------------------------------------------
                      Chimp  ----------------------------------------------------------------------
                    Gorilla  ----------------------------------------------------------------------
                  Orangutan  ----------------------------------------------------------------------
                     Gibbon  ----------------------------------------------------------------------
                     Rhesus  ----------------------------------------------------------------------
        Crab-eating macaque  ----------------------------------------------------------------------
                     Baboon  ----------------------------------------------------------------------
               Green monkey  ----------------------------------------------------------------------
                   Marmoset  ----------------------------------------------------------------------
                   Bushbaby  ----------------------------------------------------------------------
         Chinese tree shrew  ----------------------------------------------------------------------
                   Squirrel  ----------------------------------------------------------------------
     Lesser Egyptian jerboa  ----------------------------------------------------------------------
               Prairie vole  ----------------------------------------------------------------------
            Chinese hamster  ----------------------------------------------------------------------
             Golden hamster  ----------------------------------------------------------------------
                      Mouse  ----------------------------------------------------------------------
                        Rat  ----------------------------------------------------------------------
             Naked mole-rat  ----------------------------------------------------------------------
                 Guinea pig  ----------------------------------------------------------------------
                 Chinchilla  ----------------------------------------------------------------------
           Brush-tailed rat  ----------------------------------------------------------------------
                     Rabbit  ----------------------------------------------------------------------
                       Pika  ----------------------------------------------------------------------
                        Pig  ----------------------------------------------------------------------
                     Alpaca  ----------------------------------------------------------------------
             Bactrian camel  ----------------------------------------------------------------------
                    Dolphin  ----------------------------------------------------------------------
               Killer whale  ----------------------------------------------------------------------
           Tibetan antelope  ----------------------------------------------------------------------
                        Cow  ----------------------------------------------------------------------
                      Sheep  ----------------------------------------------------------------------
              Domestic goat  ----------------------------------------------------------------------
                      Horse  ----------------------------------------------------------------------
           White rhinoceros  ----------------------------------------------------------------------
                        Cat  ----------------------------------------------------------------------
                        Dog  ----------------------------------------------------------------------
                    Ferret   ----------------------------------------------------------------------
                      Panda  ----------------------------------------------------------------------
             Pacific walrus  ----------------------------------------------------------------------
               Weddell seal  ----------------------------------------------------------------------
           Black flying-fox  ----------------------------------------------------------------------
                    Megabat  ----------------------------------------------------------------------
              Big brown bat  ----------------------------------------------------------------------
       David's myotis (bat)  ----------------------------------------------------------------------
                   Microbat  ----------------------------------------------------------------------
                   Hedgehog  ----------------------------------------------------------------------
                      Shrew  ----------------------------------------------------------------------
            Star-nosed mole  ----------------------------------------------------------------------
                   Elephant  ------------------------------cctataggtgaccttgctggt------atttgaaatacca
                    Manatee  ----------------------------------------------------------------------
           Cape golden mole  ----------------------------------------------------------------------
                     Tenrec  ----------------------------------------------------------------------
                   Aardvark  gatctgtaaaatagcaatactaattccagactcataggttgtggtgaggataaaatgagatcatatattg
                  Armadillo  ----------------------------------------------------------------------
        Cape elephant shrew  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
            Squirrel monkey  ----------------------------------------------------------------------

                      Human  -tagcatggtt
                      Chimp  -tagcatggtt
                    Gorilla  -tagcatggtt
                  Orangutan  -tagcatggtt
                     Gibbon  -taacatggtt
                     Rhesus  -tagcatggtt
        Crab-eating macaque  -tagcatggtt
                     Baboon  -tagcatggtt
               Green monkey  -tagcatggtt
                   Marmoset  -tagcatggtt
                   Bushbaby  -cagcacagtt
         Chinese tree shrew  -taacatggct
                   Squirrel  -ttgcatgttt
     Lesser Egyptian jerboa  -taacatggcc
               Prairie vole  -gagcatggta
            Chinese hamster  -gaacacagga
             Golden hamster  -gaactctgga
                      Mouse  -gagcatggta
                        Rat  -caacacggta
             Naked mole-rat  -tagcataact
                 Guinea pig  -tagcataact
                 Chinchilla  -tagcataacc
           Brush-tailed rat  -aagcatattt
                     Rabbit  -tagtagggta
                       Pika  -caggagggta
                        Pig  -tagcatggtt
                     Alpaca  -tagtgtggtt
             Bactrian camel  -tagtgtggtt
                    Dolphin  -tagcatggtt
               Killer whale  -tagcatggtt
           Tibetan antelope  -tagca---tt
                        Cow  -tagca---tt
                      Sheep  -tagca---tt
              Domestic goat  -tagca---tt
                      Horse  -tagtgtggtt
           White rhinoceros  -tagcatggtt
                        Cat  -tcacatggtt
                        Dog  -ttgtgtggtt
                    Ferret   -tcgtgtggtt
                      Panda  -ttgtgtggat
             Pacific walrus  -tcgcatggtt
               Weddell seal  -tcgcatggtt
           Black flying-fox  -cacgatggtt
                    Megabat  -cacgatggtt
              Big brown bat  -tagcatggtt
       David's myotis (bat)  -tagcatggtt
                   Microbat  -tagcatggtt
                   Hedgehog  -tagcatggct
                      Shrew  -ttggatggct
            Star-nosed mole  -tagcatggtt
                   Elephant  gtggcatagtt
                    Manatee  -tagcatggtt
           Cape golden mole  -tagcctggtt
                     Tenrec  -tagaatgatt
                   Aardvark  attacatggat
                  Armadillo  -tagtatggtt
        Cape elephant shrew  ===========
         American alligator  ===========
                    Opossum  ===========
            Tasmanian devil  ===========
            Green seaturtle  ===========
            Squirrel monkey  -----------

Inserts between block 18 and 19 in window
B D               Elephant 175bp

Alignment block 19 of 243 in window, 104651936 - 104651973, 38 bps 
B D                   Human  t-tctga-cc-cataat--atatgctcgataaa-tgttagtaac
B D                   Chimp  t-tctga-cc-cataat--atatgctcgataaa-tgttagtaac
B D                 Gorilla  t-tctga-cc-cataat--atatgctcgataaa-tgttagtaac
B D               Orangutan  t-tctga-cc-cataat--atatgctcgataaa-tgttagtaac
B D                  Gibbon  t-tctga-cc-cataat--atatgctcgataaa-tgttagtaac
B D                  Rhesus  t-cctga-cc-cataat--atatgctctataaa-tgttagtaac
B D     Crab-eating macaque  t-cctga-cc-cataat--atatgctctataaa-tgttagtaac
B D                  Baboon  t-cctga-tc-cataat--atatgctctataaa-tgttagtaac
B D            Green monkey  t-cctga-cc-cataat--atatgctctataaa-tgttagtaac
B D                Marmoset  t-tctga-cc-cataat--ttatgctcgataaa-tgttagtaac
B D                Bushbaby  t-tctga-tc-cataat--agatgttcaataaa-tgttagttac
         Chinese tree shrew  t-actga-tc-cataat--aggtg-tctataaa-tgttagttac
B D                Squirrel  t-cctga-t--tatacaacagatgatcaataaa-tgttagtcac
     Lesser Egyptian jerboa  t-cttgg-c--c-catagtacatgctcaataaaatattaattat
               Prairie vole  a--------------------agggtcaattta--gttgg----
B D         Chinese hamster  g---------------------gggtcaataga--gttgg----
             Golden hamster  g--------------------agggtcagtaga--gttgg----
B D                   Mouse  t------------------agagcatcagtgga-tgctgg----
B D                     Rat  g------------------agagagtcaatggg-tgacag----
B D          Naked mole-rat  t-tctga-t--cacagt--agatggtcaataaa-tattatttac
B D              Guinea pig  t-tctga-t--cataac--aaacagtcaataaa-tattatttat
                 Chinchilla  t-tctga-t--catg----taatggtcaataaa-tattatttat
           Brush-tailed rat  c-catca-t--aata-----gatggccaataaa-tattatttat
B D                  Rabbit  t-tctga-ct-catgag--agatgctcaataaa-tgtcagtcgc
B D                    Pika  t-tctga-ca-catgag--aggtgcttaataaa-cgttagtcat
B D                     Pig  ttcctga-cc-catgat--agactcgcaataaa-ggtcagccac
B D                  Alpaca  tttctga-cc-cataat--agatgctccgtaaa-tgtcagctac
             Bactrian camel  tttctga-cc-cttaat--agatgctccgtaaa-tgtcagctac
B D                 Dolphin  tctctga-cc-cataat--agatgctcagtaaa-tgtcagctac
               Killer whale  tctctga-cc-cataat--agatgctcagtaaa-tgtcagctac
           Tibetan antelope  tctctga-cc-caaaac--agatgttcaataaa-tatcagctac
B D                     Cow  tctctga-cc-caaaac--agacgttcagtaaa-tgtcagctac
B D                   Sheep  tctctga-cc-caaaac--agatgttcaataaa-tgtcagctac
              Domestic goat  tctctga-cc-caaaac--agatgttcaataaa-tgtcagctac
B D                   Horse  t-tctga-cc-agcaag--agatgctcagtaaa-----agtt-c
B D        White rhinoceros  t-tctga-cc-catgat--ggatgctcagtgaa-tgtgagttac
B D                     Cat  t-tctga-cc-catagt--aggtgttcagtaaa-tgctagttac
B D                     Dog  t-tgtga-cc-catagt--agaagctccgtggt-tggtagttac
B D                 Ferret   t-tctga-tg-catagt--agatgctcagtaaa-tggtagttac
B D                   Panda  t-t-tga-cc-catagt--agatgctcagtaac-tggtagttac
             Pacific walrus  t-tctga-ca-catagg--agatgctcagtaaa-tggtagttac
               Weddell seal  t-tctga-ca-catagg--agatgctcagtaaa-tggtagttac
           Black flying-fox  t-tctga-cc-caaaat--agatgcttggtaaa-tgtcagttac
B D                 Megabat  t-tctga-cc-caaaat--agatgcttggtaaa-tgtcagttac
              Big brown bat  t-tctga-t-----aat--agatactcagtaaa-ggttagttat
       David's myotis (bat)  t-tctga-t-----aat--agatactcagtaaa-tgttagttat
B D                Microbat  t-tctga-t-----aat--agatactcagtaaa-tgttagttat
B D                Hedgehog  t-tctaa-ca-cattat--aggtgcttaatcag-tgttagtcac
B D                   Shrew  g-tctga-cc-catgaa--atgtattcagtaaa-ttttagttat
            Star-nosed mole  t-tctgaccc-cattac--agatgctcagtaaa-catgagcttc
B D                Elephant  t-tctga-cc-cataat--agatgctcaataaa-tgttagtaac
B D                 Manatee  t-tctga-cc-cgtaat--agatgctcaataaa-tgttagtcgc
           Cape golden mole  t-tcaga-tt-cataat--agaagtccaataaa-tgttaattac
B D                  Tenrec  t-tctga-ttccaaaat--agatgttcaagaaa-catacatggc
                   Aardvark  t-tctga-cc-aataat--agatgctca-----------gttac
B D               Armadillo  t-tctaa-cc-cataat--aggtgctcaataca-agttagttac
       Cape elephant shrew  ============================================
B D      American alligator  ============================================
B D                 Opossum  ============================================
B D         Tasmanian devil  ============================================
  D         Green seaturtle  ============================================
B D         Squirrel monkey  --------------------------------------------

Inserts between block 19 and 20 in window
B D                    Pig 406bp

Alignment block 20 of 243 in window, 104651974 - 104651975, 2 bps 
B D                   Human  ct
B D                   Chimp  ct
B D                 Gorilla  ct
B D               Orangutan  tt
B D                  Gibbon  ct
B D                  Rhesus  ct
B D     Crab-eating macaque  ct
B D                  Baboon  ct
B D            Green monkey  ct
B D                Marmoset  ct
B D                Bushbaby  ct
         Chinese tree shrew  a-
B D                Squirrel  ct
     Lesser Egyptian jerboa  ct
               Prairie vole  -t
B D         Chinese hamster  -t
             Golden hamster  -t
B D                   Mouse  -c
B D                     Rat  -c
B D          Naked mole-rat  ct
B D              Guinea pig  ct
                 Chinchilla  ct
           Brush-tailed rat  ct
B D                  Rabbit  ct
B D                    Pika  ct
B D                     Pig  ct
B D                  Alpaca  ct
             Bactrian camel  ct
B D                 Dolphin  ct
               Killer whale  ct
           Tibetan antelope  ct
B D                     Cow  ct
B D                   Sheep  ct
              Domestic goat  ct
B D                   Horse  at
B D        White rhinoceros  tt
B D                     Cat  ct
B D                     Dog  cg
B D                 Ferret   ct
B D                   Panda  ct
             Pacific walrus  ct
               Weddell seal  ct
           Black flying-fox  ct
B D                 Megabat  ct
              Big brown bat  ct
       David's myotis (bat)  ct
B D                Microbat  ct
B D                Hedgehog  tt
B D                   Shrew  ct
            Star-nosed mole  ct
B D                Elephant  ct
B D                 Manatee  ct
           Cape golden mole  ct
B D                  Tenrec  ct
                   Aardvark  ct
B D               Armadillo  ct
       Cape elephant shrew  ==
B D      American alligator  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==
  D         Green seaturtle  ==
B D         Squirrel monkey  --

Inserts between block 20 and 21 in window
B D                  Shrew 724bp

Alignment block 21 of 243 in window, 104651976 - 104652023, 48 bps 
B D                   Human  tatctacgtccccc-at--------atgatcc--acaggcttttgtgataagatg-g-aga
B D                   Chimp  tatctacgtccccc-at--------atgatcc--acaggcttttgtgataagatg-g-aga
B D                 Gorilla  tatctacgtccccc-at--------atgatcc--acaggcttttgtgataagatg-g-aga
B D               Orangutan  tatctatgtccccc-at--------atgatcc--acaggcttttgtgataaggtg-a-aga
B D                  Gibbon  tatctacgtccccc-at--------atgatcc--acaggcttttgtgataagatg-g-aga
B D                  Rhesus  tatctatgtcccct-at--------atgatcc--acaggcttttgtgataagatg-g-aga
B D     Crab-eating macaque  tatctatgtcccct-at--------atgatcc--acaggcttttgtgataagatg-g-aga
B D                  Baboon  tatctatgtcccct-at--------atgatcc--acaggcttttgtgataagatg-g-aga
B D            Green monkey  tatctatgtcccct-at--------atgatct--acaggcttttgtgataagatg-g-aga
B D                Marmoset  tatctacatgcccc-at--------atgaacc--agaggtttttgtgataagatg-g-aga
B D                Bushbaby  cgtttgtggctcct-ct--------atgatcc--agaggtttttgtgataagatatg-aga
         Chinese tree shrew  catttacatccccc-at--------atgatcc--agagatttttgtgataagaga-t-a--
B D                Squirrel  tacttatgcccccctag--------agaatcc--agagg-ttttgtgatgaagtg-c-aca
     Lesser Egyptian jerboa  tatctatatcaccc-at--------aagatcc--agagggatgt---gtgaaaaa-g-aga
               Prairie vole  tatccatattcacc-at--------aagattt--aggggattttattataaaata-t-ggg
B D         Chinese hamster  tatctatgttctcc-at--------aagatct--agggggttttatagtatgata-t-gaa
             Golden hamster  tgtctatattccca-gt--------aagattt--agggcattttatagtaagata-t-g-g
B D                   Mouse  tatctatattcacccat--------aagactt--acaagttttt---gtaagata-t-gga
B D                     Rat  tatccatattctccaat--------aagatac--agggcttttt---ataagata-t-ggg
B D          Naked mole-rat  tatctatgttcccc-at--------aggatcc--agagatttctgtgataagatg-t-gag
B D              Guinea pig  tatctacattcccc-at--------aggatcc--agagatttttgtgacaagatg-t-ggg
                 Chinchilla  tatcgatattcccc-at--------aggatcc--agaggtttttgtgatgagatg-t-ggg
           Brush-tailed rat  tatctaaattcccc-at--------tggatcc--agaaatttttgtgataagatg-t-ggg
B D                  Rabbit  tatctgtgtcccc--gt--------gggatcc--caaggattgtgtaacgggaca-a-aga
B D                    Pika  tatccatgttcct--at--------gcaatcc--tgaggattctgtaacaagaca-c-agg
B D                     Pig  tatccatgtccctt-gg--------ataatgg--agagg-ttttgtgataagatg-t-gag
B D                  Alpaca  tatctatgtcccccggg--------gtggtgg--agaga-ttttgtgataagatg-t-ggg
             Bactrian camel  tatctatgtcccccggg--------gtggtgg--agaga-ttttgtgataagacg-t-ggg
B D                 Dolphin  tgtctatgtccgcc-aa--------atgatgg--agaag-ttttgtgataagttg-g-gga
               Killer whale  tgtctatgtccgcc-aa--------atgatgg--agaag-ttttgtgataagttg-g-gga
           Tibetan antelope  tatctatatgatct-ag--------atgatgg--agagg-ttttgtgataagatg-t-ggg
B D                     Cow  tatctatatcaccc-ag--------atgatgg--ggagg-ttttgtgataagatg-t-ggg
B D                   Sheep  tatctatatcatcc-ag--------atgatgg--agagg-ttttgtgataagatg-t-ggg
              Domestic goat  tctctatatcatcc-ag--------atgatgg--agagg-ttttgtgataagatg-t-ggg
B D                   Horse  tatcgatgtctgcc-at--------gtgatgc--agagg-ttttgtgataagatg-t-ggg
B D        White rhinoceros  tatttatgtctgcc-at--------gtgatat--agagg-ttctgtgataaagtg-t-ggg
B D                     Cat  tctctatgtttgcc-at--------atgatgt--agagg-tttggtgataagatt-tggga
B D                     Dog  catctgtgtctgcc-ct--------atgcggt--agagg-ttttgtgatgcgacg-t-gga
B D                 Ferret   cctctgggtccacc-gt--------atggtgt--agagg-ttttgcagtacaata-t-gga
B D                   Panda  cctctatgtccacc-gt--------acggtgg--agaag-ttttgcgatacgatg-t-gga
             Pacific walrus  cctctatgtccagt-gt--------atggtgt--agagg-ttttgtgatacaatg-t-gga
               Weddell seal  cctctatgtccagc-gt--------atggtgt--agagg-ttttgtgatacgatg-t-gga
           Black flying-fox  tgtctatgtccccc-at--------aatatgt--agagg-ttttgtgataagatg-t-ggg
B D                 Megabat  tgtctatgtccccc-ac--------aagatgt--agagg-ttttgtgataagatg-t-ggg
              Big brown bat  tctcgatgtcctcc-at--------aggatgt--agtgg-ttttgaggtaaaatg-t-gag
       David's myotis (bat)  tctctatgtcctcc-at--------aggatgt--agggg-ttttgagataagatg-t-gag
B D                Microbat  tctctatgtcctcc-at--------aggatat--agggg-ttttgagataagatg-t-gag
B D                Hedgehog  catctgtgtccaca-at--------atacaatgcaggga-ctttgtgataagatg-t-gga
            Star-nosed mole  catctttgtttacc-tt--------atagag---agaag-ctttataagaagata-t-atg
B D                Elephant  tatctttgtccccc-at--------ataatgc--agaggtgttcatgacaagatg-t-ggg
B D                 Manatee  tacctttgtccccc-at--------gtaatcc--agaggtgttcatgataagatg-t-ggg
           Cape golden mole  tttctttgtccttc-ac--------ctgatcc--agagatgttcatg-----atg-c-ag-
B D                  Tenrec  tatctttgcccgcc-ccgccccctgatgatcc--aagggtgttcatg--taaatg-t-ggg
                   Aardvark  tatatttgtccccc-----------atgat-c--agagatgttcatgatgagatg-t----
B D               Armadillo  tatcaatgtccctc-ct--------gtgattt--aggagag--------------------
B D                   Shrew  =============================================================
       Cape elephant shrew  =============================================================
B D      American alligator  =============================================================
B D                 Opossum  =============================================================
B D         Tasmanian devil  =============================================================
  D         Green seaturtle  =============================================================
B D         Squirrel monkey  -------------------------------------------------------------

Inserts between block 21 and 22 in window
             Big brown bat 1bp
      David's myotis (bat) 106bp
B D               Microbat 1bp

Alignment block 22 of 243 in window, 104652024 - 104652043, 20 bps 
B D                   Human  c-------c------aggaggaggag-----------aga---gg--ca
B D                   Chimp  c-------c------aggaggaggag-----------aga---gg--ca
B D                 Gorilla  c-------c------aggaggaggag-----------aga---gg--cg
B D               Orangutan  c-------c------aggaggaggag-----------aga---gg--tg
B D                  Gibbon  c-------c------aggaggaggag-----------aga---gg--tg
B D                  Rhesus  c-------c------agaaggaggag-----------aga---gg--tg
B D     Crab-eating macaque  c-------c------agaaggaggag-----------aga---gg--tg
B D                  Baboon  c-------c------aggaggaggag-----------aga---gg--tg
B D            Green monkey  c-------c------aggaggaggag-----------aga---cg--tg
B D                Marmoset  t-------g------aggacgaggaa-----------aga---gg--tg
B D                Bushbaby  -----------------gaggaggag-----------agc---gg--ca
         Chinese tree shrew  ------------------aggagaag-----------aga---gg--tg
B D                Squirrel  aatcatctg------aggagggagag---------acagg---tg----
     Lesser Egyptian jerboa  g-------a------gaaagagagag-----------agg---ta----
               Prairie vole  a-------g------aggagggatagtttgagcttttaag---tg----
B D         Chinese hamster  a-------g------aggagggacag--tgagtttttaag---tg----
             Golden hamster  a-------g------aggagggacag--tgagtttttaag---tg----
B D                   Mouse  g-------g------aagagggaaaatctgcatgtctaag---cg----
B D                     Rat  a-------g------aaga-gaaaaatctgcatttttaag---tg----
B D          Naked mole-rat  a-------g------aggaaggagag-----------ggg---ac----
B D              Guinea pig  a-------g------aggaaagagag-----------a-----------
                 Chinchilla  a-------g------aggaaggagag-----------agg---gg----
           Brush-tailed rat  a-------t------aggaaggaaag-----------aag---gc----
B D                  Rabbit  g-------g------aggaggaggag-----------agc---ggtg--
B D                    Pika  c-------c------aggaggaagag-----------agc---agtg--
B D                     Pig  -------aa------aagagcaggag-----------aga---ga--tg
B D                  Alpaca  -------aa------aggagcaggag-----------aga---gg--t-
             Bactrian camel  -------aa------aggagcaggag-----------aga---gg--ta
B D                 Dolphin  -------aa------aggagcagcag-----------aga---gg--ta
               Killer whale  -------aa------aggagcagcag-----------aga---gg--ta
           Tibetan antelope  -------aa------aggagcagaaa-----------aga---gg--tg
B D                     Cow  -------aa------aggagcagaag-----------aga---gg--tg
B D                   Sheep  -------aa------aggagcagaag-----------aga---gg--tg
              Domestic goat  -------aa------aggatcagaag-----------aga---gg--tg
B D                   Horse  -------aa------aggagca--ag-----------aga---gg--tg
B D        White rhinoceros  -------aa------aggagcaggag-----------aga---gg--tg
B D                     Cat  -------aa------ggttgctggag-----------aga---ga----
B D                     Dog  -------aa------gggagcaggag-----------aga---ag--gc
B D                 Ferret   -------aa------gggagcaggag-----------gga---gg--gc
B D                   Panda  -------aa------gggagcaggag-----------aga---gg--gc
             Pacific walrus  -------aa------gggagcaggag-----------aga---gg--gc
               Weddell seal  -------aa------ggaagcaggag-----------aga---gg--gc
           Black flying-fox  -------aa------aggagcaagag-----------aaa---gg--cg
B D                 Megabat  -------aa------aggagcaagag-----------aaa---gg--cg
              Big brown bat  ---------------aggagcaggag-----------aga---gg--ag
       David's myotis (bat)  ---------ccagtaggaggtgtgca-----------gga---gg--cg
B D                Microbat  ---------------aggagcgggag-----------aga---gg--tg
B D                Hedgehog  -------aa------aggagcaggat-----------aga---gg--tg
            Star-nosed mole  -------ag------aggtgcaggaa-----------aca---ga--gg
B D                Elephant  ------------tgaggaggagagag-----------agg---tg----
B D                 Manatee  ------------acaggaggagaaag-----------aggtattg----
           Cape golden mole  ---------------agatgtgaaag-----------agg---ca----
B D                  Tenrec  ------------agaggaggaaagag-----------agc---gg----
                   Aardvark  ---------------ggaagacaaag-----------agg---tg----
B D               Armadillo  ---------------caagacgagag-----------agg---tg----
B D                   Shrew  =================================================
       Cape elephant shrew  =================================================
B D      American alligator  =================================================
B D                 Opossum  =================================================
B D         Tasmanian devil  =================================================
  D         Green seaturtle  =================================================
B D         Squirrel monkey  -------------------------------------------------

Inserts between block 22 and 23 in window
    Lesser Egyptian jerboa 2038bp

Alignment block 23 of 243 in window, 104652044 - 104652047, 4 bps 
B D                   Human  tctg
B D                   Chimp  tctg
B D                 Gorilla  tctg
B D               Orangutan  tctg
B D                  Gibbon  tctg
B D                  Rhesus  tctg
B D     Crab-eating macaque  tctg
B D                  Baboon  tctg
B D            Green monkey  tctg
B D                Marmoset  tagg
B D                Bushbaby  tct-
         Chinese tree shrew  cctg
B D                Squirrel  tctg
               Prairie vole  tctg
B D         Chinese hamster  tctg
             Golden hamster  t-tg
B D                   Mouse  tctg
B D                     Rat  tcta
B D          Naked mole-rat  cctg
                 Chinchilla  tctg
           Brush-tailed rat  tctg
B D                  Rabbit  tctg
B D                    Pika  tctg
B D                     Pig  tctg
B D                  Alpaca  tctg
             Bactrian camel  tctg
B D                 Dolphin  tctg
               Killer whale  tctg
           Tibetan antelope  tctg
B D                     Cow  tctg
B D                   Sheep  tctg
              Domestic goat  tctg
B D                   Horse  tctg
B D        White rhinoceros  tctg
B D                     Cat  ---g
B D                     Dog  tctg
B D                 Ferret   tctg
B D                   Panda  tctg
             Pacific walrus  tctg
               Weddell seal  tctg
           Black flying-fox  tctg
B D                 Megabat  tctg
              Big brown bat  tctg
       David's myotis (bat)  gctg
B D                Microbat  tctc
B D                Hedgehog  tctg
            Star-nosed mole  tctg
B D                Elephant  tcta
B D                 Manatee  tcta
           Cape golden mole  cctg
B D                  Tenrec  tctg
                   Aardvark  ttta
B D               Armadillo  tctg
B D                   Shrew  ====
       Cape elephant shrew  ====
    Lesser Egyptian jerboa  ====
B D      American alligator  ====
B D                 Opossum  ====
B D         Tasmanian devil  ====
  D         Green seaturtle  ====
B D              Guinea pig  ----
B D         Squirrel monkey  ----

Alignment block 24 of 243 in window, 104652048 - 104652048, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D            Green monkey  a
B D                Marmoset  a
B D                Bushbaby  a
         Chinese tree shrew  g
B D                Squirrel  a
               Prairie vole  a
B D         Chinese hamster  a
             Golden hamster  g
B D                   Mouse  a
B D                     Rat  a
B D          Naked mole-rat  a
                 Chinchilla  a
           Brush-tailed rat  a
B D                  Rabbit  g
B D                    Pika  g
B D                     Pig  a
B D                  Alpaca  a
             Bactrian camel  a
B D                 Dolphin  a
               Killer whale  a
           Tibetan antelope  a
B D                     Cow  a
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  a
B D        White rhinoceros  a
B D                     Cat  a
B D                     Dog  a
B D                 Ferret   a
B D                   Panda  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  c
B D                 Megabat  c
              Big brown bat  t
       David's myotis (bat)  a
B D                Microbat  t
B D                Hedgehog  a
            Star-nosed mole  a
B D                Elephant  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  a
                   Aardvark  a
B D               Armadillo  a
B D                   Shrew  =
       Cape elephant shrew  =
    Lesser Egyptian jerboa  =
B D      American alligator  =
B D                 Opossum  =
B D         Tasmanian devil  =
  D         Green seaturtle  =
B D              Guinea pig  -
B D         Squirrel monkey  -
B D                  Baboon  =

Inserts between block 24 and 25 in window
      David's myotis (bat) 128bp
B D               Microbat 2bp

Alignment block 25 of 243 in window, 104652049 - 104652054, 6 bps 
B D                   Human  gt-ttgc
B D                   Chimp  gt-ttgc
B D                 Gorilla  gt-ttgc
B D               Orangutan  gt-ttgc
B D                  Gibbon  gt-ttgc
B D                  Rhesus  gt-ttgc
B D     Crab-eating macaque  gt-ttgc
B D            Green monkey  gt-ttgc
B D                Marmoset  gt-ttgc
B D                Bushbaby  ct-ttcc
         Chinese tree shrew  at-ttct
B D                Squirrel  gt-gtcc
               Prairie vole  at-atca
B D         Chinese hamster  at-atgt
             Golden hamster  at-atct
B D                   Mouse  gt-gtgt
B D                     Rat  at-gtct
B D          Naked mole-rat  gt-gtct
B D              Guinea pig  ---gtct
                 Chinchilla  gt-attt
           Brush-tailed rat  gtaatct
B D                  Rabbit  gc-acct
B D                    Pika  gt-atct
B D                     Pig  at-ttct
B D                  Alpaca  gt-tcct
             Bactrian camel  gt-tcct
B D                 Dolphin  gt-ttct
               Killer whale  gt-ttct
           Tibetan antelope  at-ttct
B D                     Cow  gt-ttct
B D                   Sheep  at-ttct
              Domestic goat  at-ttct
B D                   Horse  ct-tgct
B D        White rhinoceros  gt-ttct
B D                     Cat  gt-tcct
B D                     Dog  gt-ttct
B D                 Ferret   gt-ttct
B D                   Panda  gt-ctcg
             Pacific walrus  gt-ttct
               Weddell seal  gt-ttct
           Black flying-fox  at-ttct
B D                 Megabat  at-ttct
              Big brown bat  gt-ttct
       David's myotis (bat)  gt-ttgt
B D                Microbat  gt-ttgt
B D                Hedgehog  gt-ctct
            Star-nosed mole  gt-ctct
B D                Elephant  gt-ttct
B D                 Manatee  gt-ttcg
           Cape golden mole  gt-tgca
B D                  Tenrec  gt-ttct
                   Aardvark  gt-ttct
B D               Armadillo  gt-ttct
B D                   Shrew  =======
       Cape elephant shrew  =======
    Lesser Egyptian jerboa  =======
B D      American alligator  =======
B D                 Opossum  =======
B D         Tasmanian devil  =======
  D         Green seaturtle  =======
B D         Squirrel monkey  -------
B D                  Baboon  =======

Alignment block 26 of 243 in window, 104652055 - 104652057, 3 bps 
B D                   Human  aag
B D                   Chimp  aag
B D                 Gorilla  aag
B D               Orangutan  aag
B D                  Gibbon  aaa
B D                  Rhesus  aag
B D     Crab-eating macaque  aag
B D            Green monkey  aag
B D                Marmoset  aag
B D                Bushbaby  gag
         Chinese tree shrew  aag
B D                Squirrel  aag
               Prairie vole  cgg
B D         Chinese hamster  aag
             Golden hamster  aag
B D                   Mouse  aag
B D                     Rat  aag
B D          Naked mole-rat  aag
B D              Guinea pig  aag
                 Chinchilla  aag
           Brush-tailed rat  aat
B D                  Rabbit  gag
B D                    Pika  gag
B D                     Pig  aat
B D                  Alpaca  aag
             Bactrian camel  aag
B D                 Dolphin  aag
               Killer whale  aag
           Tibetan antelope  aag
B D                     Cow  aag
B D                   Sheep  aag
              Domestic goat  aag
B D                   Horse  aag
B D        White rhinoceros  aag
B D                     Cat  aag
B D                     Dog  aag
B D                 Ferret   aag
B D                   Panda  aag
             Pacific walrus  aag
               Weddell seal  aag
           Black flying-fox  aac
B D                 Megabat  aac
              Big brown bat  aag
       David's myotis (bat)  aag
B D                Microbat  aag
B D                Hedgehog  gag
B D                   Shrew  aag
            Star-nosed mole  aag
B D                Elephant  aag
B D                 Manatee  aag
           Cape golden mole  atg
B D                  Tenrec  aag
                   Aardvark  aag
B D               Armadillo  aag
       Cape elephant shrew  ===
    Lesser Egyptian jerboa  ===
B D      American alligator  ===
B D                 Opossum  ===
B D         Tasmanian devil  ===
  D         Green seaturtle  ===
B D         Squirrel monkey  ---
B D                  Baboon  ===

Alignment block 27 of 243 in window, 104652058 - 104652089, 32 bps 
B D                   Human  cttggcaactaggt-gaa-tggagatg------------c---ttttaa
B D                   Chimp  cttggcaactaggt-gaa-tggagatg------------c---ttttaa
B D                 Gorilla  cttggcaactgggt-gaa-tggagatg------------c---ttttaa
B D               Orangutan  cttggcaactaggt-gaa-tggagatg------------c---ttttaa
B D                  Gibbon  cttggcaactaggt-gaa-tggagatg------------c---ttttaa
B D                  Rhesus  cttggcaactaggt-gaa-tggagata------------c---ttttaa
B D     Crab-eating macaque  cttggcaactaggt-gaa-tggagata------------c---ttttaa
B D                  Baboon  cttggcaactaggt-gaa-tggagata------------c---ttttaa
B D            Green monkey  cttggcaactaggt-gaa-tggagata------------c---ttttaa
B D                Marmoset  cttggtaactaggt-gaattggagacg------------c---ttttaa
B D                Bushbaby  cttggcaactgggt-taa-cggagat-----------------------
         Chinese tree shrew  tttggcaactaggt-aat-aagagagg------------c---tttcag
B D                Squirrel  cttggccactaggt-taa-tggagatg------------c---tttcaa
               Prairie vole  attggctactagtt-taa-tgagat-g------------t---tctcag
B D         Chinese hamster  gttgactacaagct-taa-taggggtg------------c---tcccag
             Golden hamster  gttggcgactagct-tca-tagagg-g------------c---tctcag
B D                   Mouse  a-tgactactagct-tac-tagagg------------------------
B D                     Rat  a-tgacttctagct-taa-taaagg------------------------
B D          Naked mole-rat  cttggccattgggt-taa-tagagatg------------c---ttttca
B D              Guinea pig  cttggtcgttgggt-taa-cagagatg------------c---ttttca
                 Chinchilla  cgtggtcattgggt-tca-tagaggta------------c---ttttca
           Brush-tailed rat  cttggccattgggt-cag-tagagata------------c---ttttca
B D                  Rabbit  c-tgccaactcagt---g-gagatgct----------------------
B D                    Pika  c-tcccaactaagt-cag-tagatgtggaacagttgttgt---ttttaa
B D                     Pig  cttggcaactaggt-aaa-tggagttg------------c---ttttaa
B D                  Alpaca  cttagcaactaggt-aaa-tggagtgg------------c---tttcaa
             Bactrian camel  cttagcaactaggt-aaa-tggagtgg------------c---tttcaa
B D                 Dolphin  ctcgtcaactaggt-aaa-tggagttg------------c---ttttaa
               Killer whale  ctcggcaactaggt-aaa-tggagttg------------c---ttttaa
           Tibetan antelope  cttgacagctaggt-aaa-ttgagtta------------c---ttttaa
B D                     Cow  cttgacaactaggt-aaa-tggagtta------------c---ttttaa
B D                   Sheep  cttgacaactaggt-aaa-tggagtta------------c---ttttaa
              Domestic goat  cttgacaactaggt-aaa-tggagtga------------c---ttttaa
B D                   Horse  cttggcatctaggt-gga-tggagttg------------c---ttttaa
B D        White rhinoceros  cttggcaaccaggt-aaa-tggagttg------------c---ttttaa
B D                     Cat  cttggcaactaggt-tcc-gggagttg------------c---ttttaa
B D                     Dog  gttggtgagtaggt-tcc-aggggctg------------c---ttttaa
B D                 Ferret   gttgctagttaggt-tct-gggagttg------------t---ttttaa
B D                   Panda  gttggtaattaggt-tct-gggagttg------------c---ttttaa
             Pacific walrus  gttggtaattaggt-tct-gggagttg------------c---ttttaa
               Weddell seal  gttggtaattaggt-tct-gggagttg------------c---ttttaa
           Black flying-fox  cttggcaactaggc-ata-tagagttg------------c---ttttaa
B D                 Megabat  cttggcaactaggt-ata-tagagttg------------c---ttttaa
              Big brown bat  cttggcagctagcc-aaa-tggagttg------------c----tttaa
       David's myotis (bat)  ctctgcaactaggc-aaa-tggagttg------------c----tttaa
B D                Microbat  cttggcaactaggc-aaa-tggagttg------------c----tttaa
B D                Hedgehog  cttggcagttatat-taa-tgaagctg------------c---ttttaa
B D                   Shrew  ttttgtaactatatctca-tggtgatt------------caattttttt
            Star-nosed mole  gctagcaactagat-taa-tgaagatg------------c---tcttaa
B D                Elephant  tttgacaactaggt-taa-gagag-ag------------c---ttttaa
B D                 Manatee  gtggacaactaggt-taa-gagagaag------------c---ttctaa
           Cape golden mole  cttgacagctagat-gaa-tagagaaa------------c---ttctga
B D                  Tenrec  ctggacaacgaggt-tgg-tcacggaa------------c---ttttag
                   Aardvark  ctggacaactaggt-tag-tagagaag------------c---tttgaa
B D               Armadillo  tttggcaacttggt-taa-tggagatg------------c---ttttag
       Cape elephant shrew  =================================================
    Lesser Egyptian jerboa  =================================================
B D      American alligator  =================================================
B D                 Opossum  =================================================
B D         Tasmanian devil  =================================================
  D         Green seaturtle  =================================================
B D         Squirrel monkey  -------------------------------------------------

Inserts between block 27 and 28 in window
B D                   Pika 408bp

Alignment block 28 of 243 in window, 104652090 - 104652103, 14 bps 
B D                   Human  ctgagaa--gggaagt
B D                   Chimp  ctgagaa--gggaagt
B D                 Gorilla  ctgagaa--gggaagt
B D               Orangutan  ctgagaa--gggaaat
B D                  Gibbon  ctgagaa--gggaaat
B D                  Rhesus  ctgagaa--gggaaat
B D     Crab-eating macaque  ctgagaa--gggaaat
B D                  Baboon  ctgagaa--gggaaat
B D            Green monkey  ctgagaa--gggaaat
B D                Marmoset  ctgatga--gggaaat
B D                Bushbaby  -----aa--gggatgt
         Chinese tree shrew  ttgagaa--ggaaaat
B D                Squirrel  tgaagaa--gggagag
               Prairie vole  ctgatga--gagaagt
B D         Chinese hamster  ctaagaa--gggacgt
             Golden hamster  ctgagag-------gt
B D                   Mouse  -----aa--ggaacat
B D                     Rat  -----aa--ggaggat
B D          Naked mole-rat  ctgagaa--gggaaat
B D              Guinea pig  ctgagaa--gggaaat
                 Chinchilla  ccaagaa--ggaaaat
           Brush-tailed rat  ctgagaa--gggaact
B D                  Rabbit  ctgagaa--ggaacac
B D                     Pig  ctgagaa--aggaaat
B D                  Alpaca  ctgagaa--aggaaat
             Bactrian camel  ctgagaa--aggaaat
B D                 Dolphin  ctgagaa--aggaaat
               Killer whale  ctgagaa--aggaaat
           Tibetan antelope  ctgagaa--aggaaat
B D                     Cow  ctgagaa--aggaaat
B D                   Sheep  ctgagaa--aggaaat
              Domestic goat  ctgagaa--aggaaat
B D                   Horse  ctgagga--agggagt
B D        White rhinoceros  ctgagaa--agcaaat
B D                     Cat  ctgagaa--aggaaat
B D                     Dog  ctcagaa--g-gaaat
B D                 Ferret   cgaagaa--a-gaagt
B D                   Panda  ctaagaa--aggaaat
             Pacific walrus  ctcagaa--aggaaat
               Weddell seal  ctcagaa--aggaaat
           Black flying-fox  ctgagaa--aggaaat
B D                 Megabat  ctgagaa--aggaaat
              Big brown bat  cggagaa--aagaaat
       David's myotis (bat)  ctgagaa--aaggaat
B D                Microbat  c--agaa--aaggaat
B D                Hedgehog  ctggaaaaagggaaat
B D                   Shrew  aagaaaa---ggacat
            Star-nosed mole  atgaaaa-------at
B D                Elephant  ctgag-a--aagcaat
B D                 Manatee  ctgag-a--aaggaat
           Cape golden mole  ctaagca--aggtaat
B D                  Tenrec  ccaagaa--aagaaat
                   Aardvark  ctgagaa--aggaaat
B D               Armadillo  ctgaaaa--aggaaat
B D                    Pika  ================
       Cape elephant shrew  ================
    Lesser Egyptian jerboa  ================
B D      American alligator  ================
B D                 Opossum  ================
B D         Tasmanian devil  ================
  D         Green seaturtle  ================
B D         Squirrel monkey  ----------------

Inserts between block 28 and 29 in window
B D                    Cat 1126bp

Alignment block 29 of 243 in window, 104652104 - 104652126, 23 bps 
B D                   Human  acaa---aagg---aggaggaggctt-ggg
B D                   Chimp  acaa---gagg---aggaggaggctt-ggg
B D                 Gorilla  acaa---gagg---aggaggaggctt-ggg
B D               Orangutan  acaa---gagg---aggaggaggctt-ggg
B D                  Gibbon  acaa---gagg---aggaggaggcttgggg
B D                  Rhesus  acaa---gagg---aggaggcagctt-cgg
B D     Crab-eating macaque  acaa---gagg---aggaggcagctt-cgg
B D                  Baboon  acaa---gagg---aagcggcggctt-cgg
B D            Green monkey  acaa---gagg---aggaggtggctt-cgg
B D                Marmoset  acaa---gagg---aggaggaggctt-gag
B D                Bushbaby  ataa---gagg---agggagagggtt-cag
         Chinese tree shrew  acaa---gagg---aagagaagtttg-ggg
B D                Squirrel  gcaa---gagg---agtagac---tg-tgg
               Prairie vole  acaa---ga-g---atgaggt---tt-ggg
B D         Chinese hamster  acaa---gagg---atgagat---at-gga
             Golden hamster  acag---aagg---atgagat---ct-gga
B D                   Mouse  tcaa---tagg---gaaaaaa-gact-ggg
B D                     Rat  tcaa---tagg---gaaaaaaggact-ggg
B D          Naked mole-rat  acaa---gaga---aggagat---tt-gtg
B D              Guinea pig  acca---gagg---aggagat---ct-gtg
                 Chinchilla  acaa---gagg---aggagat---tt-gtg
           Brush-tailed rat  gcaa---gagg---agcagat---tt-gtg
B D                  Rabbit  acag---gaggagcaggagac---cc-agg
B D                     Pig  ataa---aagg---aggaggaagtct-ag-
B D                  Alpaca  ggaa---gtgg---aggaagaagtct-gg-
             Bactrian camel  ggaa---gcag---aggaagaagtct-gg-
B D                 Dolphin  gtaa---gagg---agtaggaagttt-g--
               Killer whale  gtaa---gagg---agtaggaagttt-g--
           Tibetan antelope  gtaacaggagg---aagaggaagtct-gg-
B D                     Cow  gtaagaagagg---aggaggaagtct-gg-
B D                   Sheep  gtaacaggagg---aagaggaagtct-gg-
              Domestic goat  gtaacaggagg---aagaggaagtct-gg-
B D                   Horse  g-ag---gcca---aggaggaagggtggg-
B D        White rhinoceros  gtaa---gagg---aggaggaagtgt-gg-
B D                     Dog  gtag---cagg---agcactaagtat-gg-
B D                 Ferret   gtag---cagg---aggaacaaggag-gg-
B D                   Panda  gtag---cggg---aggaacaggtac-gg-
             Pacific walrus  gtag---cagg---aggaacaagtat-gg-
               Weddell seal  gtag---cagg---aggaacaagtat-gg-
           Black flying-fox  ataa---gagg---aggaagaactgtgga-
B D                 Megabat  ataa---gagg---aggaagaactgtgga-
              Big brown bat  ataagaggagg---aggaggaagtatggg-
       David's myotis (bat)  ataa---gagg---aggaggaagtatggg-
B D                Microbat  ataa---gagg---aggaagaagtatggg-
B D                Hedgehog  atga---gagg---aggagaaatacg-at-
B D                   Shrew  gtaa---taac---aggaaaaatatg-ga-
            Star-nosed mole  gtaa---gagg---aagaagaataag-aa-
B D                Elephant  acag---gaag---aggaggaggctt-ggg
B D                 Manatee  acag---gaag---aggaggcggttt-ggg
           Cape golden mole  acag---gacc---agcaggcagttt-agg
B D                  Tenrec  tcag---gcac---aggaggaggttt-ggg
                   Aardvark  acag---gaac---agcaggaggttt-agg
B D               Armadillo  acta---g------aggaagaggttt-ggg
B D                    Pika  ==============================
       Cape elephant shrew  ==============================
    Lesser Egyptian jerboa  ==============================
B D                     Cat  ==============================
B D      American alligator  ==============================
B D                 Opossum  ==============================
B D         Tasmanian devil  ==============================
  D         Green seaturtle  ==============================
B D         Squirrel monkey  ------------------------------

Inserts between block 29 and 30 in window
B D                  Mouse 3bp
B D                    Rat 721bp

Alignment block 30 of 243 in window, 104652127 - 104652139, 13 bps 
B D                   Human  g-acaagat---ggt----gt
B D                   Chimp  g-acaagat---ggt----gt
B D                 Gorilla  g-acaagat---ggt----gt
B D               Orangutan  g-acaagat---ggc----gt
B D                  Gibbon  g-acaagat---tgt----gt
B D                  Rhesus  g-acaagat---ggt----gt
B D     Crab-eating macaque  g-acaagat---ggt----gt
B D                  Baboon  g-acaagat---ggt----gt
B D            Green monkey  g-acaagat---ggt----gt
B D                Marmoset  g-acaagat---gat----gt
B D                Bushbaby  acacaagac---t-------t
         Chinese tree shrew  g-acaagat---ggt----at
B D                Squirrel  g-acaagag---ggtat----
               Prairie vole  g-atatggg---tgt------
B D         Chinese hamster  g-atacaag---gat------
             Golden hamster  g-acagaga---cat------
B D                   Mouse  g-aaattgg---tgt------
B D          Naked mole-rat  g-gcaagag---gct--at--
B D              Guinea pig  g-gcaagag---gct--at--
                 Chinchilla  g-gcaagag---ggt--at--
           Brush-tailed rat  g-gcaggat---gct--at--
B D                  Rabbit  g-acaagag---gat------
B D                     Pig  g-acaagat---gt-------
B D                  Alpaca  g-acgagat---gt-------
             Bactrian camel  g-acgagat---gt-------
           Tibetan antelope  g--tgagat---gt-------
B D                     Cow  g--tgagat---gt-------
B D                   Sheep  g--tgagat---gt-------
              Domestic goat  g--tgagat---gt-------
B D                   Horse  g-accaggt---gt-------
B D        White rhinoceros  g-atgagct---gt-------
B D                     Dog  g-gtgagat---gc-------
B D                 Ferret   g-gtgagat---gt-------
B D                   Panda  g-gtgagat---gt-------
             Pacific walrus  g-gtgaggt---gt-------
               Weddell seal  g-gtgagat---gt-------
           Black flying-fox  g-atgagat---gt-------
B D                 Megabat  g-atgagac---gt-------
              Big brown bat  g-gtgagat---gt-------
       David's myotis (bat)  g-gtgggat---gt-------
B D                Microbat  g-gtgggat---gt-------
B D                Hedgehog  g-a---gcc---aa-------
B D                   Shrew  g-actggat---g--------
            Star-nosed mole  g-acaagat---at-------
B D                Elephant  g-atgacat---gt-------
B D                 Manatee  g-atgagat---gt-------
           Cape golden mole  g-at--------cg-------
B D                  Tenrec  g-atgagatgaaag-------
                   Aardvark  g-atgaaatgatgt-------
B D               Armadillo  g-gggagatggtgc-------
B D                    Pika  =====================
       Cape elephant shrew  =====================
B D                     Rat  =====================
    Lesser Egyptian jerboa  =====================
              Killer whale  ---------------------
B D                     Cat  =====================
B D      American alligator  =====================
B D                 Opossum  =====================
B D         Tasmanian devil  =====================
  D         Green seaturtle  =====================
B D                 Dolphin  ---------------------
B D         Squirrel monkey  ---------------------

Inserts between block 30 and 31 in window
B D                  Mouse 747bp
B D                 Rabbit 2bp

Alignment block 31 of 243 in window, 104652140 - 104652156, 17 bps 
B D                   Human  ttggtttggcacag--ac------t
B D                   Chimp  ttggtttggcacag--ac------t
B D                 Gorilla  ttggtttggcgcag--ac------t
B D               Orangutan  ttggtttggcacag--ac------t
B D                  Gibbon  ttggtttggaacag--ac------t
B D                  Rhesus  ttagtttggcacag--ac------t
B D     Crab-eating macaque  ttagtttggcacag--ac------t
B D                  Baboon  ttagtttggcacag--ac------t
B D            Green monkey  ttagtttggcacag--ac------t
B D                Marmoset  ttggtttggcacag--actgagatt
B D                Bushbaby  ctggtttggcacat--ag------c
         Chinese tree shrew  ttgatttggcacat--tt-------
B D                Squirrel  ttggtttggcacat---c------t
               Prairie vole  ttggttcgatgcac--ag------c
B D         Chinese hamster  a----ttgaaacac--ac------t
             Golden hamster  ctggttcgaaacac--ac------t
B D          Naked mole-rat  ttggtttggcatat--gc------t
B D              Guinea pig  ttgatttggcatat--tc------t
                 Chinchilla  ttggtctggcatat--gc------t
           Brush-tailed rat  ttggcttggcatat--gc------t
B D                  Rabbit  ttagctcggcacat--gc------t
B D                     Pig  tt--------------gc------t
B D                  Alpaca  ttggtttgacacat--gc------t
             Bactrian camel  ttggtttgacacat--gc------t
           Tibetan antelope  ttcgtttgacacatc-ac------t
B D                     Cow  ttagtttgacacatc-ac------t
B D                   Sheep  ttcgtttgacacatc-ac------t
              Domestic goat  ttcgtttgacacatc-ac------t
B D                   Horse  ttggttcggcgcac--gc------t
B D        White rhinoceros  ctggtttggcatat--gc------t
B D                     Dog  gtggtttgacacat--gc------t
B D                 Ferret   ttgggttgatacac--ac------t
B D                   Panda  ttgggttgacacgt--gc------t
             Pacific walrus  ttggattgacacat--gc------t
               Weddell seal  ttggattgacacat--gc------t
           Black flying-fox  ttggtttggcacat--gc------t
B D                 Megabat  ttggtttggcacat--gc------t
              Big brown bat  ttggtttggcacat--tc------a
       David's myotis (bat)  ttggtttggcacat--gc-------
B D                Microbat  ttggtttggcacat--gc-------
B D                Hedgehog  ttggttttacacacatgc------t
B D                   Shrew  ----------------gt------t
            Star-nosed mole  ttgacttggcacac--ga------t
B D                Elephant  ttagtttggcatat--gc------t
B D                 Manatee  gtagtttgacacat--gc------t
           Cape golden mole  ttagtttgacacat--gg------t
B D                  Tenrec  ttagttcaacacat--ag------t
                   Aardvark  ttagtttgacacat--gc------t
B D               Armadillo  ttagtttggtacat--gc------t
B D                    Pika  =========================
       Cape elephant shrew  =========================
B D                     Rat  =========================
B D                   Mouse  =========================
    Lesser Egyptian jerboa  =========================
              Killer whale  -------------------------
B D                     Cat  =========================
B D      American alligator  =========================
B D                 Opossum  =========================
B D         Tasmanian devil  =========================
  D         Green seaturtle  =========================
B D                 Dolphin  -------------------------
B D         Squirrel monkey  -------------------------

Inserts between block 31 and 32 in window
          Cape golden mole 160bp
B D                 Tenrec 329bp
B D              Armadillo 1bp

Alignment block 32 of 243 in window, 104652157 - 104652227, 71 bps 
B D                   Human  gagact---g--agaag--------atgggatgtcc--acagacactca-aaa---agctgacttga---
B D                   Chimp  gagact---g--ggagg--------atgggatgtcc--acagacactca-aaa---agctgacttga---
B D                 Gorilla  gagact---g--agagg--------atgggatgtcc--acagacactca-aaa---agctgacttga---
B D               Orangutan  gagact---g--agagg--------atgggatgtcc--acagacactca-aaa---agctgacttga---
B D                  Gibbon  gagact---g--agagg--------atgggatgtcc--acagacactca-aaa---agctgacttga---
B D                  Rhesus  gagatt---a--agagg--------atgggatgtcc--acagacactta-aaa---agctgacttga---
B D     Crab-eating macaque  gagatt---a--agagg--------atgggatgtcc--acagacactta-aaa---agctgacttga---
B D                  Baboon  gagatt---a--agagg--------atgggatgtcc--acagacactta-aaa---agctgacttga---
B D            Green monkey  gagatt---a--agagg--------atgggatgtcc--acagacactta-aaa---agctgacttga---
B D                Marmoset  gagatt---g--agagg--------atgggatgtcc--acagacactca-aaa---agctgacttga---
B D                Bushbaby  gagttt---g--aga--------------gatgtcc--agagacacctg-gag---agttgaactga---
         Chinese tree shrew  ---------------------------gaggtgtcc--agagatacctg-aaa---agtcgaactgg---
B D                Squirrel  gaatct---g--agagg--------atgagaagtcc--agagccacttg-aaa---cattgagttgg---
               Prairie vole  aacttt---g--acaga--------acaagatgttc--a----catact-taa---aaatgaattgg---
B D         Chinese hamster  aagttt---g--acaga--------acaaggtgttc--a----tatctt-gaa---aactgaattgagcc
             Golden hamster  aagtct---g--acaga--------acaaaatgttc--a----catctt-gaa---aactgaattga---
B D          Naked mole-rat  gagtat---g--agagg--------acaagatgtccagaga--cacttg-aaa---aggtgactcga---
B D              Guinea pig  ttgtat---g--agggg--------acaagatatcc--aga--cacttg-aac---agggactttga---
                 Chinchilla  gagtat---g--agagg--------acaagatatcc--aga--cacttg-aaa---aggtaaatgaa---
           Brush-tailed rat  gagtat---g--aaagg--------acaaaatatac--aga--ctctt---aa---agggaaattaa---
B D                  Rabbit  gagttt---gtcagagg--------acaagacgtcc--agagaaacttg-aaa---atctggattga---
B D                     Pig  gaattt-------gatg--------a-aagctgtcc--agagacacttg-aaa---agatgagtcaa---
B D                  Alpaca  gagtttaaaa--ggagg--------aggagatgtcc--agagactcttg-aaa---aaatgcattga---
             Bactrian camel  gagtttaaaa--ggagg--------aggagatgtcc--agagactcttgaaaa---aaatgcattga---
B D                 Dolphin  ------------agagg--------aaaagatgtcc--agagacacttg-aaa---agatgaataga---
               Killer whale  ------------agagg--------aaaagatgtcc--agagacacttg-aaa---agatgaataga---
           Tibetan antelope  gagatt---a--agagg--------aggaaatgttc--agagacacgtg-aaa---agatgaatcaa---
B D                     Cow  gagatt---a--agagg--------aggaaatgtcc--agagacacttg-aaa---agatgaatcaa---
B D                   Sheep  gagatt---a--agagg--------aggaaatgttc--agagacacatg-aaa---agatgaatcaa---
              Domestic goat  gagatt---a--agagg--------aggaaatgttc--agagacacatg-aaa---agatgaatcaa---
B D                   Horse  gagttt---g--agagg--------aggagtgtgc---agagatgcttg-aaa---agatgcattga---
B D        White rhinoceros  gagttt---g--agagg--------aggagtgtcc---agagacacttg-aaa---aggtgaattga---
B D                     Dog  gagttt---g--agagg--------aggagaggtct--agagaaacttg-gaa---agatgaactgg---
B D                 Ferret   gatttt---g--a---g--------aggagatgtt---ggaggcactgg-gag---agatgaacaag---
B D                   Panda  gacttt---g--a---g--------aggagatgtt---ggagactctgg-gag---agatgaactgg---
             Pacific walrus  gacttt---g--agagg--------aggagatgtc---agagaagctgg-gaa---agatgaactgg---
               Weddell seal  gacttt---g--a---g--------aggagatgtc---agagaccctgg-gaa---ggatgaactag---
           Black flying-fox  gagtct---g--acaga--------aggagatgttc--agagatatttg-aga---agat-----ga---
B D                 Megabat  gagtct---g--acaga--------aggagatgttc--agagatatttg-aaa---agat-----ga---
              Big brown bat  gagttt---t--a---g--------aggagatgtcc--agaga---ctc-aaa---agat-----at---
       David's myotis (bat)  -agttt---g--a---g--------aggagatgtcc--agaga---ctc-aaa---agtt-----ag---
B D                Microbat  -agttt---g--a---g--------aggagatgtcc--agaga---ctc-aaa---agat-----ag---
B D                Hedgehog  aaggct---g--agagg--------aagagatgtca--aga-atacttg-aaa---agatgaattag---
B D                   Shrew  tggtct---g--agaaa--------aagagatgtct--agcgatagatg-aaa---aaatgaattga---
            Star-nosed mole  gggctt---g--agaag--------aagagatgtcc--tgagacacttg-caa---agatgaattga---
B D                Elephant  aagttt---g--agagg--------aggagctgtcc--agagacatttg-aaa---agatgaattga---
B D                 Manatee  aagttt---g--agagg--------aggcactgtcc--agagacacttg-aaa---agatgagtggg---
           Cape golden mole  ggattt---g--agaaa--------aggagctgtct--agagatacttg-aga---agatgaattga---
                   Aardvark  aggttt---g--agaga--------aggagcttcct--agagacacttg-aaa---aaaggaattga---
B D               Armadillo  agattg---g--aggagcagctgtccggagctgtcc--agagacacttg-aaaaacaagtgaattgg---
B D                    Pika  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                     Cat  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D         Squirrel monkey  ----------------------------------------------------------------------

                      Human  -----------------------------------caacc-tggggcagtggg------------cagtg
                      Chimp  -----------------------------------caacc-tggggcagtggg------------cagtg
                    Gorilla  -----------------------------------caacc-tggggcagtggg------------cagtg
                  Orangutan  -----------------------------------caacc-tggggcagtggg------------cagtg
                     Gibbon  -----------------------------------caacc-tggggcactgtg------------cagtg
                     Rhesus  -----------------------------------caacc-tggggcagtggg------------cagtg
        Crab-eating macaque  -----------------------------------caacc-tggggcagtggg------------cagtg
                     Baboon  -----------------------------------caacc-tggggcagtggg------------cagtg
               Green monkey  -----------------------------------caacc-tggggcagtggg------------cagtg
                   Marmoset  -----------------------------------caacc-tggggcagttgg------------cagtg
                   Bushbaby  -----------------------------------taacc-tggggcagtagg-------------ggtc
         Chinese tree shrew  -----------------------------------caacc-tggggcagtagg------------tggta
                   Squirrel  -----------------------------------taacc-tgaggctgtaga------------tggtg
               Prairie vole  -----------------------------------tgcca-taaagatatagg------------caatg
            Chinese hamster  gggcattggtggtgcacgcctttaatcccagtactcggga-ggaagaggcagg------------cggat
             Golden hamster  ----------------------------------------------------------------------
             Naked mole-rat  ------------------------------------tccc-tggggtgttggg------------tggtg
                 Guinea pig  ------------------------------------tcct-tggggtagtggg------------tgatg
                 Chinchilla  ------------------------------------tccc-tgggattgcggg------------tgatg
           Brush-tailed rat  ------------------------------------tccc-tggggtagtggg------------tgatg
                     Rabbit  -----------------------------------tcccc-cagggcagcaga------------tggtg
                        Pig  -----------------------------------tatcc-tgggacagtaga------------tggtg
                     Alpaca  -----------------------------------tatcc-tgggacagtaga------------ttgtg
             Bactrian camel  -----------------------------------tatcc-tgggacagtaga------------ttgtg
                    Dolphin  -----------------------------------tatcc-agggacagtaga------------tggta
               Killer whale  -----------------------------------tatcc-agggacagtaga------------tggta
           Tibetan antelope  -----------------------------------tatcc-tgggacagtaga------------tgatg
                        Cow  -----------------------------------tatcc-tgggacagtaga------------tgatg
                      Sheep  -----------------------------------tatcc-tgggacagtaga------------tgatg
              Domestic goat  -----------------------------------tatcc-tgggacagtaga------------tgatg
                      Horse  -----------------------------------tatcc-tgggaccaacga------------tggtg
           White rhinoceros  -----------------------------------tatcc-tgggacaataga------------tggtg
                        Dog  -----------------------------------tagcc-t-ggacagtggg------------tggtg
                    Ferret   -----------------------------------aagcc-tgggacaatagt------------cggtg
                      Panda  -----------------------------------tagcc-tgggacagtaga------------tggtg
             Pacific walrus  -----------------------------------tagcc-tgggacagcggc------------tggtg
               Weddell seal  -----------------------------------tagcc-tgggacagtggc------------tggtg
           Black flying-fox  -----------------------------------taacc-taggacagtaga------------tggtt
                    Megabat  -----------------------------------taacc-tgggacagtaga------------tggtt
              Big brown bat  -----------------------------------taaccttgggacaa-aga------------tagtg
       David's myotis (bat)  -----------------------------------taaccttgggacagtaga------------ttgtg
                   Microbat  -----------------------------------taaccttgggacagtaga------------ttgtg
                   Hedgehog  -----------------------------------tattc-cagaactgtaag------------tggta
                      Shrew  -----------------------------------taatc-ttgggcagtagg------------tggtg
            Star-nosed mole  -----------------------------------tatct-tgggacagtaga------------tggtg
                   Elephant  -----------------------------------taact-gaagacagtagg-----------------
                    Manatee  -----------------------------------taacg-taagacagtagg-----------------
           Cape golden mole  -----------------------------------caacc-tagggcagtagg-----------------
                   Aardvark  -----------------------------------taacc-taggacagtagc-----------------
                  Armadillo  -----------------------------------tagcc-taagat--tagggttaggtgatgt-----
                       Pika  ======================================================================
                     Tenrec  ======================================================================
        Cape elephant shrew  ======================================================================
                        Rat  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                        Cat  ======================================================================
         American alligator  ======================================================================
                    Opossum  ======================================================================
            Tasmanian devil  ======================================================================
            Green seaturtle  ======================================================================
            Squirrel monkey  ----------------------------------------------------------------------

                      Human  t
                      Chimp  t
                    Gorilla  t
                  Orangutan  t
                     Gibbon  t
                     Rhesus  t
        Crab-eating macaque  t
                     Baboon  t
               Green monkey  t
                   Marmoset  t
                   Bushbaby  t
         Chinese tree shrew  t
                   Squirrel  t
               Prairie vole  t
            Chinese hamster  c
             Golden hamster  -
             Naked mole-rat  t
                 Guinea pig  t
                 Chinchilla  t
           Brush-tailed rat  t
                     Rabbit  t
                        Pig  t
                     Alpaca  t
             Bactrian camel  t
                    Dolphin  t
               Killer whale  t
           Tibetan antelope  t
                        Cow  t
                      Sheep  t
              Domestic goat  t
                      Horse  t
           White rhinoceros  t
                        Dog  t
                    Ferret   t
                      Panda  t
             Pacific walrus  t
               Weddell seal  t
           Black flying-fox  t
                    Megabat  t
              Big brown bat  c
       David's myotis (bat)  c
                   Microbat  c
                   Hedgehog  g
                      Shrew  t
            Star-nosed mole  t
                   Elephant  -
                    Manatee  -
           Cape golden mole  -
                   Aardvark  -
                  Armadillo  -
                       Pika  =
                     Tenrec  =
        Cape elephant shrew  =
                        Rat  =
                      Mouse  =
     Lesser Egyptian jerboa  =
                        Cat  =
         American alligator  =
                    Opossum  =
            Tasmanian devil  =
            Green seaturtle  =
            Squirrel monkey  -

Inserts between block 32 and 33 in window
B D                Ferret  232bp

Alignment block 33 of 243 in window, 104652228 - 104652241, 14 bps 
B D                   Human  taa------ttg--aagc------ca--tg
B D                   Chimp  taa------ttg--aagc------ca--tg
B D                 Gorilla  taa------ttg--aagc------ca--tg
B D               Orangutan  taa------ttg--aagc------ca--tg
B D                  Gibbon  taa------ttg--aagc------ca--tg
B D                  Rhesus  tga------tcg--aagc------ca--tg
B D     Crab-eating macaque  tga------ttg--aagc------ca--tg
B D                  Baboon  tga------ttg--aagc------ca--tg
B D            Green monkey  tga------ttg--aagc------ca--tg
B D                Marmoset  tga------ctg--aagc------ca--tc
B D                Bushbaby  tga------ttg--aagc------cc--tt
         Chinese tree shrew  tgg------ttg--aagc------ct--ct
B D                Squirrel  tgg------ttg--aggc------ca--tc
               Prairie vole  tgc------ttg--aaac------ca--tt
B D         Chinese hamster  tctgtgagtttg--agac------cagcct
             Golden hamster  ---------ctg--aaac------ca--tt
B D          Naked mole-rat  tgg------ttg--accc------cg--ta
B D              Guinea pig  tgg------ttg--agcc------ca--ct
                 Chinchilla  tgg------ttg--accc------ca--ct
           Brush-tailed rat  tgg------gtg--actc------ta--ct
B D                  Rabbit  tgg------cag--aagc------ca--tt
B D                     Pig  ttg------ttg--aagt------ca--tt
B D                  Alpaca  cgg------ttg--aagccattaaca--tt
             Bactrian camel  cag------ttg--aagc------ca--tt
B D                 Dolphin  tgg------ttgtgaagc------ca--tt
               Killer whale  tgg------ttgtgaagc------ca--tt
           Tibetan antelope  tgg------ttgtattgc------ca--tt
B D                     Cow  tgg------ttgtatagc------ca--tt
B D                   Sheep  tgg------ttgtatagc------ca--tt
              Domestic goat  tgg------ttgtatagc------ca--tt
B D                   Horse  cgg-------tg--aagc------ca--tc
B D        White rhinoceros  tgg------ttg--aagc------ta--tt
B D                     Dog  cgg------gtg--aaag------ca--tt
B D                 Ferret   ctt------tgg--aaaa------ca--aa
B D                   Panda  cgg------atg--aatg------ca--ca
             Pacific walrus  cgg------gtg--aaag------ca--cg
               Weddell seal  c-a------gtg--aaag------ca--cg
           Black flying-fox  tgg------ttg--aagc------ca--tt
B D                 Megabat  tgg------ttg--aagt------ca--tt
              Big brown bat  cgg------ttg--aagc------ca--tt
       David's myotis (bat)  tgg------ttg--aagc------ca--tt
B D                Microbat  tgg------ttg--aagc------ca--tg
B D                Hedgehog  tag------ctg--aagc------ag--tt
B D                   Shrew  --a------ttg--aagc------ca--ca
            Star-nosed mole  tag------ttg--aagt------ca--tt
B D                Elephant  tgg------ttg--aagc------ca--tt
B D                 Manatee  tgg------ttg--aagc------ca--tt
           Cape golden mole  tgg------ttg--aaac------ta--tt
                   Aardvark  taa------tgg--aaag------cg--tt
B D               Armadillo  tgg------ttg--aagc------ca--tt
B D                    Pika  ==============================
B D                  Tenrec  ==============================
       Cape elephant shrew  ==============================
B D                     Rat  ==============================
B D                   Mouse  ==============================
    Lesser Egyptian jerboa  ==============================
B D                     Cat  ==============================
B D      American alligator  ==============================
B D                 Opossum  ==============================
B D         Tasmanian devil  ==============================
  D         Green seaturtle  ==============================
B D         Squirrel monkey  ------------------------------

Inserts between block 33 and 34 in window
B D                Ferret  6bp
B D                  Panda 7bp
            Pacific walrus 459bp
              Weddell seal 449bp

Alignment block 34 of 243 in window, 104652242 - 104652243, 2 bps 
B D                   Human  aa
B D                   Chimp  aa
B D                 Gorilla  aa
B D               Orangutan  aa
B D                  Gibbon  aa
B D                  Rhesus  aa
B D     Crab-eating macaque  aa
B D                  Baboon  ag
B D            Green monkey  aa
B D                Marmoset  aa
B D                Bushbaby  ga
         Chinese tree shrew  ta
B D                Squirrel  ag
               Prairie vole  gg
B D         Chinese hamster  gg
             Golden hamster  gg
B D          Naked mole-rat  a-
B D              Guinea pig  a-
                 Chinchilla  ag
           Brush-tailed rat  ag
B D                  Rabbit  ca
B D                     Pig  aa
B D                  Alpaca  aa
             Bactrian camel  aa
B D                 Dolphin  aa
               Killer whale  aa
           Tibetan antelope  aa
B D                     Cow  aa
B D                   Sheep  aa
              Domestic goat  aa
B D                   Horse  aa
B D        White rhinoceros  aa
B D                     Dog  aa
B D                 Ferret   aa
B D                   Panda  aa
             Pacific walrus  aa
               Weddell seal  aa
           Black flying-fox  -a
B D                 Megabat  aa
              Big brown bat  aa
       David's myotis (bat)  ac
B D                Microbat  aa
B D                Hedgehog  aa
B D                   Shrew  ca
            Star-nosed mole  aa
B D                Elephant  ga
B D                 Manatee  ga
           Cape golden mole  ga
                   Aardvark  ga
B D               Armadillo  aa
B D                    Pika  ==
B D                  Tenrec  ==
       Cape elephant shrew  ==
B D                     Rat  ==
B D                   Mouse  ==
    Lesser Egyptian jerboa  ==
B D                     Cat  ==
B D      American alligator  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==
  D         Green seaturtle  ==
B D         Squirrel monkey  --

Inserts between block 34 and 35 in window
B D                    Dog 206bp

Alignment block 35 of 243 in window, 104652244 - 104652256, 13 bps 
B D                   Human  tgagg-----gtgtgta---------g
B D                   Chimp  tgagg-----gtgtgta---------g
B D                 Gorilla  tgagg-----gtgtgta---------g
B D               Orangutan  tgagg-----gtgtgta---------c
B D                  Gibbon  tgagg-----gtgttta---------g
B D                  Rhesus  tgagg-----gtgtgta---------g
B D     Crab-eating macaque  tgagg-----gtgtgta---------g
B D                  Baboon  tgagg-----gtgtgta---------g
B D            Green monkey  tgagg-----gtgtgta---------g
B D                Marmoset  tgagg-----gtgtgta---------g
B D                Bushbaby  ggagg-----gtgtgta---------a
         Chinese tree shrew  tgagg-----gtctata---------g
B D                Squirrel  tgagg-----gtgtgga---------g
               Prairie vole  taagg-----gtgtgga---------g
B D         Chinese hamster  tctcc-----agagcga---------g
             Golden hamster  taagg-----atagggg---------g
B D          Naked mole-rat  tgatg-----gtgtgaa---------a
B D              Guinea pig  tcagg-----atggggt---------a
                 Chinchilla  tgagg-----gtatgaa---------a
           Brush-tailed rat  taaga-----gtgtgaa---------a
B D                  Rabbit  tgagc-----atgtggg---------a
B D                     Pig  tgaga-----gagtgta---------g
B D                  Alpaca  caaggcg---gggggtgtatgtgtgtg
             Bactrian camel  caaggggtgtgtgtgtgtgtgtgtgtg
B D                 Dolphin  caagg-----gtgtaca---------g
               Killer whale  caagg-----gtgtaca---------g
           Tibetan antelope  caagg-----gtgagta---------g
B D                     Cow  caagg-----gtgagta---------g
B D                   Sheep  caagg-----gtgagta---------g
              Domestic goat  caagg-----gtgagta---------g
B D                   Horse  caaca-----gtgtata---------g
B D        White rhinoceros  caacg-----gtgtata---------g
B D                     Dog  caagg-----gcatgta---------g
B D                 Ferret   taaga-----gtatgta---------a
B D                   Panda  cgagg-----gtatgca---------g
             Pacific walrus  caagg-----gtatgta---------g
               Weddell seal  caagg-----gtatgta---------g
           Black flying-fox  caagg-----gtctgag---------g
B D                 Megabat  caagg-----gtctgag---------g
              Big brown bat  caagg-----gtgtggt---------g
       David's myotis (bat)  caagg-----gtgtggt---------g
B D                Microbat  caagg-----gtgtggt---------g
B D                Hedgehog  tgatt-----ctgtgta---------g
B D                   Shrew  agagg-----atgtaga---------a
            Star-nosed mole  tgaca-----gtgt-------------
B D                Elephant  agaag-----ttgtata---------g
B D                 Manatee  a-agg-----ttgtatc---------g
           Cape golden mole  agagg-----atggata---------a
                   Aardvark  agagg-----ttgtctagatactt--g
B D               Armadillo  agaaa-----gtatgta---------a
B D                    Pika  ===========================
B D                  Tenrec  ===========================
       Cape elephant shrew  ===========================
B D                     Rat  ===========================
B D                   Mouse  ===========================
    Lesser Egyptian jerboa  ===========================
B D                     Cat  ===========================
B D      American alligator  ===========================
B D                 Opossum  ===========================
B D         Tasmanian devil  ===========================
  D         Green seaturtle  ===========================
B D         Squirrel monkey  ---------------------------

Inserts between block 35 and 36 in window
B D                  Panda 420bp

Alignment block 36 of 243 in window, 104652257 - 104652274, 18 bps 
B D                   Human  agtat-g----g-agaaagg-----------gcca
B D                   Chimp  agtgt-g----g-agaaagg-----------gcca
B D                 Gorilla  agtgt-g----g-agaaagg-----------gcca
B D               Orangutan  agtgt-g----g-agaaagg-----------gcca
B D                  Gibbon  agtgt-g----g-agaaagg-----------gcca
B D                  Rhesus  actgt-g----g-agaaagg-----------gcca
B D     Crab-eating macaque  actgt-g----g-agaaagg-----------gcca
B D                  Baboon  actgt-g----g-agaaaga-----------gcca
B D            Green monkey  actgt-g----g-agaaagg-----------gcca
B D                Marmoset  agggt-g----g-agaaagg-----------gcct
B D                Bushbaby  tatat-g----g-agaaagg-----------gcca
         Chinese tree shrew  agtgt-g----g-agaaaaa-----------gcaa
B D                Squirrel  agggt-g----g-agaaggaggcatgggaaagcag
               Prairie vole  catgt-g----g-aaaggg------------gctc
B D         Chinese hamster  tgcca-g----g-ataggc------------tcca
             Golden hamster  cacgt-g----g-aaaagg------------gctc
B D          Naked mole-rat  agtat-a----g-agaaag------------gaaa
B D              Guinea pig  agtag-a----g-aaaaca------------gggt
                 Chinchilla  agtat-g----g-agaaag------------ggct
           Brush-tailed rat  agtgt-g----g-agaaaa------------gact
B D                  Rabbit  -------------------------------g---
B D                     Pig  cctgc-a----g-agaacag-----------gtaa
B D                  Alpaca  tgtgt-g----g-agaaagg-----------gcca
             Bactrian camel  tgtgt-g----g-agaaagg-----------gcca
B D                 Dolphin  catgt-g----g-agaaagg-----------gtta
               Killer whale  catgt-g----g-agaaagg-----------gtta
           Tibetan antelope  catgt-g----g-agaaaag-----------gtta
B D                     Cow  catgt-g----g-agaaaag-----------gtta
B D                   Sheep  catgt-g----g-agaaaag-----------gtta
              Domestic goat  catgt-g----g-agaaaag-----------atta
B D                   Horse  agtgt-g----g-taacagg-----------gcca
B D        White rhinoceros  agtga-g----g-agaaagg-----------gcca
B D                     Dog  actat-g----a-agaaaag-----------gcca
B D                 Ferret   actat-g----g-agaaagg-----------gcca
             Pacific walrus  actat-g----g-acaaa-g-----------gcca
               Weddell seal  actat-g----g-agaaagg-----------gcca
           Black flying-fox  agtac-a----g-aggaagg-----------gccg
B D                 Megabat  agtac-a----g-aggaagg-----------gcca
              Big brown bat  cgtag-a--gtgtggacacg-----------gcca
       David's myotis (bat)  catag-a--gtg-ggacatg-----------gcca
B D                Microbat  cgtag-agtgtg-ggacacg-----------gcca
B D                Hedgehog  tgtgt-c----a-agaaagg-----------gcca
B D                   Shrew  agtgtag----g-aaaaatg-----------gcta
            Star-nosed mole  ------g----g-agaaagg-----------gcca
B D                Elephant  agtgc-a----c-agacagg-----------gcca
B D                 Manatee  agtgc-a----t-ggacaag-----------ggca
           Cape golden mole  agtgc-a----t-ggacagg-----------gtcc
                   Aardvark  aaagc-a----t-tggcagg-----------gcca
B D               Armadillo  a--gc-a----c-ggggaaa-----------ggcc
B D                    Pika  ===================================
B D                  Tenrec  ===================================
       Cape elephant shrew  ===================================
B D                   Panda  ===================================
B D                     Rat  ===================================
B D                   Mouse  ===================================
    Lesser Egyptian jerboa  ===================================
B D                     Cat  ===================================
B D      American alligator  ===================================
B D                 Opossum  ===================================
B D         Tasmanian devil  ===================================
  D         Green seaturtle  ===================================
B D         Squirrel monkey  -----------------------------------

Inserts between block 36 and 37 in window
B D                    Pig 91bp

Alignment block 37 of 243 in window, 104652275 - 104652324, 50 bps 
B D                   Human  agg-aaa-----agccccaggg-gacaccagcattgaagggc--------cag----tgg----gg----
B D                   Chimp  agg-aaa-----agccccaggg-gacaccagcattgaaaggc--------cag----tgg----gg----
B D                 Gorilla  agg-aaa-----agccccaggg-gacaccagcattgaagggc--------cag----tgg----gg----
B D               Orangutan  agg-aaa-----agccccaggg-gacaccagcattgaagggc--------cag----tgg----gg----
B D                  Gibbon  agg-aaa-----agcctcaggg-gacaccagcattgaagggc--------cac----tgg----gg----
B D                  Rhesus  agg-aaa-----agccccaggg-gacaccagcattgaagggt--------cag----tgg----gg---a
B D     Crab-eating macaque  agg-aaa-----agccccaggg-gacaccagcattgaagggt--------cag----tgg----gg---a
B D                  Baboon  agg-aaa-----agccccaggg-tacaccagcattgaagggt--------cag----tgg----gg---g
B D            Green monkey  agg-aaa-----agccccaggg-gacaccagcattgaagggt--------cag----tgg----gg---g
B D                Marmoset  agg-aaa-----ggccccaggg-gacaccagcattgaagggc--------caggggctgg----gggtgg
B D                Bushbaby  agg-gaa-----agctcctggg-tgcaccaatatcgaagagc--------aga----ctg----ga----
         Chinese tree shrew  atg-aaa-----atccccagag-agcaccaatattgaagggt--------aga----ggg----aa----
B D                Squirrel  aac-cca---------gcagac-agcacccaggttgaagggtg-------gat----tgg----ag----
               Prairie vole  agc-ata------gtcccaagc-agcaccaatgttggaaggg--------gta----tgt----ag----
B D         Chinese hamster  aag-cta--------cacagag-aaaccctgtcttgaaaaaatccaaaaaaaa----aaa----ag----
             Golden hamster  agg-cta------gccacaagc-agcaccaatgttg--------------aaa----ggc----ag----
B D          Naked mole-rat  agg-aaa-----agccccaggc-aacaccagctttgaagggt--------aga----tgg-----g----
B D              Guinea pig  agg-aaa-----agccc-aggt-aacaccagcattgcaggct--------aga----tgt-----g----
                 Chinchilla  agg-aaa-----agccctaggc-aacaccagcatcaaagggt--------tga----tgg-----g----
           Brush-tailed rat  agg-aaa-----agccctaggc-aacaccaccatccaaggat--------aga----tgg-----g----
B D                  Rabbit  -------------ttcccaggg-agcactaaca-agaaaggt--------aga----tggcagtgg----
B D                     Pig  aag-gaa-----agccctggag-agcaccaacattgaagggt--------ata----ttg----ga----
B D                  Alpaca  agg-aaa-----agtcctgggg-agcgcccacactgaagggt--------agg----ttg----ga----
             Bactrian camel  agg-aaa-----agtcctgggg-agcgcccacactgaagggt--------agg----ttg----ga----
B D                 Dolphin  agg-aaa-----agccctgggg-attgcctacattgaagggt--------aga----ttg----ga----
               Killer whale  agg-aaa-----agccctgggg-attgccaacattgaagggt--------aga----ttg----ga----
           Tibetan antelope  aggaaaa-----agccctagag-attgctaaaactgaagggt--------aga----ttg----ga----
B D                     Cow  aggaaaa-----agccctagag-attgctaacactgaaggat--------aga----ttg----ga----
B D                   Sheep  agg-aaa-----agccctagag-attgctaacactgaagggt--------aga----ttg----ga----
              Domestic goat  aggaaaa-----agccctagag-attgctaacactgaagggt--------aga----ttg----ga----
B D                   Horse  agg-aaa-----agccccaggg-aacaccaacgttgacgggt--------aga----ttg----ga----
B D        White rhinoceros  agg-aaa-----agccccaggg-agcaccaacgttgaagggt--------aga----ttg----ga----
B D                     Dog  agg-aaa----gagctccaggg-agcaccaacattgaaaggt--------gga----gtg----ga----
B D                 Ferret   agg-aaa----gagccccaggg-agcaccaacattgaaaggt--------gga-----tg----ga----
             Pacific walrus  agg-aat----gagccccaggg-agcatcaacattgaagggt--------gga----ttg----ga----
               Weddell seal  agg-agt----gagccccaggg-agcatcaacattgaagggt--------gga----ttg----ga----
           Black flying-fox  tgg-aaa-----ggccccgggg-agcgccaaagtcgaagggt--------agg----ttg----ga----
B D                 Megabat  tgg-aaa-----ggccctgggg-agtgccaatgtcgaagggt--------agg----ttg----ga----
              Big brown bat  agg-aaa-----gaccccgggg-agcaccaacatcgaa-ggt--------gga----ttg----ga----
       David's myotis (bat)  agg-aaa-----gaccccaggg-agcaccaacattgaa-ggt--------gga----ttg----ga----
B D                Microbat  agg-aaa-----gaccccaggg-agcaccaacattgaa-ggt--------gga----ttg----ga----
B D                Hedgehog  agg-aaaa---aaatcccaggg-agcaccaactctgaagagt--------agg----tta----ga----
B D                   Shrew  aag-aaa----atatccagggg-agaaccagctttgaagatt--------gca----tgg----ga----
            Star-nosed mole  agg-aaaagctatatcaagtg------ccaacactgaagttt--------aga----ttg----ga----
B D                Elephant  agg-aga-----agcttcaggg-agtaccaactctgaacaga--------agg----ttg----ga----
B D                 Manatee  agg-aga-----agcttcaggg-agtgccagcattgaaaggt--------aag----ttg----ga----
           Cape golden mole  agg-aga-----agaatcaggatagaacc---------------------tag----tga----ga----
                   Aardvark  ttg-aga-----agcttcag---agtgccaaagttgaagggc--------aga----ttg----ca----
B D               Armadillo  agg-aaa-----agcctcaggg-agcaccagtactgaggg----------aca----ccg----ga----
B D                    Pika  ======================================================================
B D                  Tenrec  ======================================================================
       Cape elephant shrew  ======================================================================
B D                   Panda  ======================================================================
B D                     Rat  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                     Cat  ======================================================================
B D      American alligator  ======================================================================
B D                 Opossum  ======================================================================
B D         Tasmanian devil  ======================================================================
  D         Green seaturtle  ======================================================================
B D         Squirrel monkey  ----------------------------------------------------------------------

                      Human  gaaaa----gt
                      Chimp  gaaaa----gt
                    Gorilla  gaaaa----gt
                  Orangutan  aaaaa----gt
                     Gibbon  gaaaa----gt
                     Rhesus  gaaaa----ct
        Crab-eating macaque  gaaaa----ct
                     Baboon  gaaaa----ct
               Green monkey  gaaaa----ct
                   Marmoset  gagaa----gc
                   Bushbaby  gaaaa----gt
         Chinese tree shrew  gaaaa----gg
                   Squirrel  gaaag------
               Prairie vole  aaaag------
            Chinese hamster  aaaag------
             Golden hamster  aaaag------
             Naked mole-rat  aaaag------
                 Guinea pig  aaaag------
                 Chinchilla  aaaag------
           Brush-tailed rat  gaaag------
                     Rabbit  gaaaa------
                        Pig  gaaaa----ga
                     Alpaca  gaaaa----ga
             Bactrian camel  gaaca----ga
                    Dolphin  gaata----ga
               Killer whale  gaata----ga
           Tibetan antelope  gaaca----ga
                        Cow  gaaca----ga
                      Sheep  gaaca----ga
              Domestic goat  gaaca----ga
                      Horse  gaaaa----ga
           White rhinoceros  gaaga----ga
                        Dog  gaaaa----g-
                    Ferret   gaaaa----g-
             Pacific walrus  gaaaa----g-
               Weddell seal  gaaaa----g-
           Black flying-fox  ggaaa------
                    Megabat  ggaaa------
              Big brown bat  ggaaa----g-
       David's myotis (bat)  ggaaa----g-
                   Microbat  ggaaa----g-
                   Hedgehog  ggaaa----ga
                      Shrew  gg--a----gt
            Star-nosed mole  ga---------
                   Elephant  gaaaa------
                    Manatee  gaaaa------
           Cape golden mole  gcaaagt----
                   Aardvark  ggaaa------
                  Armadillo  gcaaa--ga--
                       Pika  ===========
                     Tenrec  ===========
        Cape elephant shrew  ===========
                      Panda  ===========
                        Rat  ===========
                      Mouse  ===========
     Lesser Egyptian jerboa  ===========
                        Cat  ===========
         American alligator  ===========
                    Opossum  ===========
            Tasmanian devil  ===========
            Green seaturtle  ===========
            Squirrel monkey  -----------

Inserts between block 37 and 38 in window
          Cape golden mole 179bp

Alignment block 38 of 243 in window, 104652325 - 104652367, 43 bps 
B D                   Human  gaag-caaattagttggag-aagtaggagcagaactagctgatgg
B D                   Chimp  gaag-caaattagttggag-aagtaggagcagaactagctgatgg
B D                 Gorilla  gaag-caaattagttggag-aagtaggagcagaactagctgatgg
B D               Orangutan  gaag-caaattagttggag-aagtaggagcagaactagctgatgg
B D                  Gibbon  gaag-caaattagtcggag-aagtaggagcaaaactagctgatgg
B D                  Rhesus  gaag-caaattagttgggg-aagtaggaacagaactagctgacgg
B D     Crab-eating macaque  gaag-caaattagttgggg-aagtaggaacagaactagctgacgg
B D                  Baboon  gaag-caaattagttgggg-aagtaggaacagaactagctgacgg
B D            Green monkey  gaag-caaattagttgggg-aagtaggaacagaactagctgacgg
B D                Marmoset  aaag-taaattagttggagaaagtaggaacagaactagctgacag
B D                Bushbaby  agct-caaactagtcagag-aagcacaagcagaactagatgac--
         Chinese tree shrew  gaat-caaac-agttggag-aagtagaaggagatgcagcttgcag
B D                Squirrel  agag-caaattcctcagag-agagaggagtcaaaccagctgacgg
               Prairie vole  aaaaccaaatt-atcagag-aataaggtataaacccagatgatga
B D         Chinese hamster  aaaa-gaaaaa-gaaaaag-aaaactaaattgactgaaactattg
             Golden hamster  agaa-caaatt-atcacag-aagcaggcataaacccagacaatgg
B D          Naked mole-rat  agag-caaattaagcagag-agataggagtaactctagccagttc
B D              Guinea pig  agag-aaaattaaccagag-aggtaggagtggcactagccagta-
                 Chinchilla  ---------------agaa-aggtaggagtgacattagccagtgc
           Brush-tailed rat  aaag-caagttaagcagga-aggtaggagtgatg-cagccagtgt
B D                  Rabbit  ggca-cgagct-------g-gagaaggattgggaccaggtggtgg
B D                     Pig  g--c-cagaagagttggca-aagtaggaatggaacaagctgatgg
B D                  Alpaca  gagc-aagcttagttggca-aaataggagcagaaacagatgctgg
             Bactrian camel  gaac-aaacttagtcggca-aagtaggagcagaaccagatgctgg
B D                 Dolphin  g--------------agcg-aaataggaacagaaccagatgatgg
               Killer whale  g--------------ggcg-aaataggaacagaaccagatgatgg
           Tibetan antelope  aagc-cagattagttagca-aagtaggaatggaaccagctgatgg
B D                     Cow  aagc-cagattagttagca-aagtaggaatggaaacagctgatgg
B D                   Sheep  aagc-cagattagttagca-aagtaggaatggaaccagctgatgg
              Domestic goat  aagc-cagattagttagca-aagtaggaatggaaccagctgatgg
B D                   Horse  gagc-cagattaggcagag-aagcaggagtagaaccagctgacgg
B D        White rhinoceros  gagc-cag-ttagtcagag-aagtgggagtggggccagctgacag
B D                     Dog  ------agataagtcagag-aagtaggagcggaaacagctgctga
B D                 Ferret   -agc-cagattagtcagag-aaataggaggggaaccagcccctga
             Pacific walrus  -agc-cagattagtcagag-aagtaggagtggaagctgctggtga
               Weddell seal  -agc-cagattagttagag-aagtaggagtggaaccagctgctga
           Black flying-fox  -----cagaaaagtcagag-gag------tggaaccagctgaca-
B D                 Megabat  -----cagaaaagtcagag-gag------tagaaccagctgaca-
              Big brown bat  ---c-cagatacgtcagag-aag---gggtagaatcagctgatgg
       David's myotis (bat)  ---c-cagattcgtcagag-aag---gactagaaccatttgatgg
B D                Microbat  ---c-tagattcgtcagag-aag---gactagaaccatttgatgg
B D                Hedgehog  gagt-cacacttgtcagag-aagtagtaga---agcttctgacag
B D                   Shrew  gagc-cacattggtgacag-aagttggagt-------------gt
            Star-nosed mole  -----cacattagtcagag-aaataggagtcgaaacagcagtgtt
B D                Elephant  gagc-catcttagac-----aagttggggtagaaccaggtgagag
B D                 Manatee  gaac-cacattagtcaaag-aagtaggggtagaaccaggtgagag
                   Aardvark  gatc-catattagag-----aagtaagggca-aaccaagtgagag
B D               Armadillo  gagc-cagattagtc--ag-aggtcggagtacaaccaggtaagag
B D                    Pika  =============================================
B D                  Tenrec  =============================================
       Cape elephant shrew  =============================================
B D                   Panda  =============================================
B D                     Rat  =============================================
B D                   Mouse  =============================================
    Lesser Egyptian jerboa  =============================================
B D                     Cat  =============================================
B D      American alligator  =============================================
          Cape golden mole  =============================================
B D                 Opossum  =============================================
B D         Tasmanian devil  =============================================
  D         Green seaturtle  =============================================
B D         Squirrel monkey  ---------------------------------------------

Inserts between block 38 and 39 in window
B D        Chinese hamster 4bp
B D                    Pig 15bp

Alignment block 39 of 243 in window, 104652368 - 104652369, 2 bps 
B D                   Human  ca
B D                   Chimp  ca
B D                 Gorilla  ca
B D               Orangutan  ca
B D                  Gibbon  ca
B D                  Rhesus  ca
B D     Crab-eating macaque  ca
B D                  Baboon  ca
B D            Green monkey  ca
B D                Marmoset  ca
B D                Bushbaby  ta
         Chinese tree shrew  ca
B D                Squirrel  ca
B D         Chinese hamster  gg
B D          Naked mole-rat  ca
B D              Guinea pig  ca
                 Chinchilla  ca
           Brush-tailed rat  ca
B D                  Rabbit  tg
B D                     Pig  tc
B D                  Alpaca  ca
             Bactrian camel  ca
B D                 Dolphin  ca
               Killer whale  ca
           Tibetan antelope  ca
B D                     Cow  ca
B D                   Sheep  ca
              Domestic goat  ca
B D                   Horse  ca
B D        White rhinoceros  ca
B D                     Dog  ca
B D                 Ferret   cc
             Pacific walrus  ca
               Weddell seal  ca
              Big brown bat  cg
       David's myotis (bat)  ca
B D                Microbat  ca
B D                Hedgehog  ca
B D                   Shrew  cc
            Star-nosed mole  ct
B D                Elephant  ca
B D                 Manatee  cc
                   Aardvark  ca
B D               Armadillo  aa
B D                    Pika  ==
B D                  Tenrec  ==
       Cape elephant shrew  ==
B D                   Panda  ==
            Golden hamster  --
              Prairie vole  --
B D                     Rat  ==
B D                   Mouse  ==
    Lesser Egyptian jerboa  ==
          Black flying-fox  --
B D                     Cat  ==
B D      American alligator  ==
          Cape golden mole  ==
B D                 Opossum  ==
B D         Tasmanian devil  ==
  D         Green seaturtle  ==
B D                 Megabat  --
B D         Squirrel monkey  --

Alignment block 40 of 243 in window, 104652370 - 104652370, 1 bps 
B D                   Human  g
B D                   Chimp  g
B D                 Gorilla  g
B D               Orangutan  g
B D                  Gibbon  g
B D                  Rhesus  g
B D     Crab-eating macaque  g
B D                  Baboon  g
B D            Green monkey  g
B D                Marmoset  g
B D                Bushbaby  g
         Chinese tree shrew  g
B D                Squirrel  c
B D         Chinese hamster  g
B D          Naked mole-rat  g
B D              Guinea pig  g
                 Chinchilla  g
           Brush-tailed rat  g
B D                  Rabbit  g
B D                     Pig  t
B D                  Alpaca  g
             Bactrian camel  g
B D                 Dolphin  g
               Killer whale  g
           Tibetan antelope  a
B D                     Cow  t
B D                   Sheep  a
              Domestic goat  a
B D                   Horse  g
B D        White rhinoceros  g
B D                     Dog  g
B D                 Ferret   g
             Pacific walrus  g
              Big brown bat  g
       David's myotis (bat)  g
B D                Microbat  g
B D                Hedgehog  g
B D                   Shrew  a
            Star-nosed mole  g
B D                Elephant  g
B D                 Manatee  g
                   Aardvark  g
B D               Armadillo  g
B D                    Pika  =
B D                  Tenrec  =
       Cape elephant shrew  =
B D