Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 710 in window, 88353717 - 88353930, 214 bps 
B D                     Human  accatcctggctaacatggtgaaaccccatctctact-aaaaaaatacaa--------------------
B D                     Chimp  accatcctggctaacatggtgaaaccccgtctctactaaaaaaaatacaa--------------------
B D                   Gorilla  accaccctggctaacacggtgaaaccccgtctctact-aaaaaaatacaa--------------------
B D                    Gibbon  accatcctggctaacacggtgaaaccccgtctctact-aaaaaaatacaa--------------------
B D       Crab-eating macaque  accatcctggctaacacggtgaaaccccgtctctact-aaaaaaatacaaagaaattagttgggcgtggt
B D                    Baboon  accatcctggctaacatggtgaaatcccgtctctact-aaaaaaatacaaagaaattagttgggcgtggt
B D              Green monkey  accatcctggctaacacggtgaaaccccgtctctact-aaaaaaatacaaagaaattagttgggcatggt
             Star-nosed mole  ======================================================================
              Golden hamster  ======================================================================
B D                  Hedgehog  ======================================================================
B D                       Rat  ======================================================================
B D                     Shrew  ======================================================================
B D                     Mouse  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                  Squirrel  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
            Black flying-fox  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
B D           Squirrel monkey  ======================================================================
          Chinese tree shrew  ======================================================================
B D                    Rabbit  ======================================================================
              Pacific walrus  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                       Dog  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                 Armadillo  ======================================================================
B D                       Cat  ======================================================================
                    Aardvark  ----------------------------------------------------------------------
B D                  Elephant  ======================================================================
B D                     Horse  ======================================================================
                Weddell seal  ======================================================================
B D          White rhinoceros  ======================================================================
B D                   Manatee  ----------------------------------------------------------------------
                Killer whale  ======================================================================
B D                   Dolphin  ======================================================================
B D                  Marmoset  ======================================================================
B D                    Rhesus  ======================================================================
B D                 Orangutan  ======================================================================
            Cape golden mole  ======================================================================
B D                  Bushbaby  ======================================================================

                        Human  -agaaattagcggggcatggtagcgggcgcctgtagtcccagctactcgggaggctgggacaggagactg
                        Chimp  -agaaattagcggggcatggtagcgggcgcctgtggtcccagctactcaggaggctgggacaggagactg
                      Gorilla  -agaaattagcagggcatggtagcgggcgcctgtagtcccagctactcgggaggctggggcaggagactg
                       Gibbon  -agaaattagcggggcatggtggcgggtgcctgtagtcctagctactcgggaggctggggcaggagactg
          Crab-eating macaque  gagaaattagttgggcatggtggcgggcgcctgtagtcccagctactcgggaggctgaggcaggagaatg
                       Baboon  gagaaattagttgggcgtggtggcgggcacctgtagtcccagctactcgggaggctgaggcaggagaatg
                 Green monkey  gagaaattagttgggcatggt---gggcgcctatagtcccagctactcgggaggttgaggcaggagaatg
              Star-nosed mole  ======================================================================
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                          Rat  ======================================================================
                        Shrew  ======================================================================
                        Mouse  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ======================================================================
       White-throated sparrow  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
             Black flying-fox  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
              Squirrel monkey  ======================================================================
           Chinese tree shrew  ======================================================================
                       Rabbit  ======================================================================
               Pacific walrus  ======================================================================
                         Pika  ======================================================================
                      Ferret   ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                          Dog  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                          Cat  ======================================================================
                     Aardvark  ----------------------------------------------------------------------
                     Elephant  ======================================================================
                        Horse  ======================================================================
                 Weddell seal  ======================================================================
             White rhinoceros  ======================================================================
                      Manatee  ----------------------------------------------------------------------
                 Killer whale  ======================================================================
                      Dolphin  ======================================================================
                     Marmoset  ======================================================================
                       Rhesus  ======================================================================
                    Orangutan  ======================================================================
             Cape golden mole  ======================================================================
                     Bushbaby  ======================================================================

                        Human  gagtgaacccgggaggtggagcttgcagtgagccgagatcatgccactgcactccagcctgggcaacaga
                        Chimp  gagtgaacccgggaggcggagcttgcagtgagccgagatcatgccactgcactccagcctgggcaacaga
                      Gorilla  gagtgaacccaggaggcggagcttgcagtgagacgagatcatgccactgcactccagcctgggcaacaga
                       Gibbon  gagtgaacccaggaggcggagcttgcagtgagccaagattgtgccactgcactccagcctgggcaacaga
          Crab-eating macaque  gcgtgaacctgggaggtggagcttgcagtgagcctagattgcgcccctgaactccagcctgggcaacaga
                       Baboon  gcgtgaacctgggtggtggagcttgcagtgagcctagattgcgcccctgaactccagcctgggcgacaga
                 Green monkey  gcgtgaacctgggaggtggagcttgcagtgagcctagattgcgcccctgaactccagcctgggcaacaga
              Star-nosed mole  ======================================================================
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                          Rat  ======================================================================
                        Shrew  ======================================================================
                        Mouse  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ======================================================================
       White-throated sparrow  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
             Black flying-fox  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
              Squirrel monkey  ======================================================================
           Chinese tree shrew  ======================================================================
                       Rabbit  ======================================================================
               Pacific walrus  ======================================================================
                         Pika  ======================================================================
                      Ferret   ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                          Dog  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                          Cat  ======================================================================
                     Aardvark  ----------------------------------------------------------------------
                     Elephant  ======================================================================
                        Horse  ======================================================================
                 Weddell seal  ======================================================================
             White rhinoceros  ======================================================================
                      Manatee  ----------------------------------------------------------------------
                 Killer whale  ======================================================================
                      Dolphin  ======================================================================
                     Marmoset  ======================================================================
                       Rhesus  ======================================================================
                    Orangutan  ======================================================================
             Cape golden mole  ======================================================================
                     Bushbaby  ======================================================================

                        Human  gcgagactccatatc------aaaaacaaaag
                        Chimp  gcgagactccatatc------aaaaacaaaag
                      Gorilla  gcgagactccatatc------aaaaacaaaag
                       Gibbon  gcgagactccatctc-aaaaaaaaaaaaaaag
          Crab-eating macaque  gcgagactccatatcaaaaaaaaaaaaagaaa
                       Baboon  gcaagactccatatc------aaaaaaagaaa
                 Green monkey  gcgagactccgtatc-----aaaaaaaagaaa
              Star-nosed mole  ================================
               Golden hamster  ================================
                     Hedgehog  ================================
                          Rat  ================================
                        Shrew  ================================
                        Mouse  ================================
             Peregrine falcon  ================================
                 Saker falcon  ================================
                       Parrot  ================================
                   Budgerigar  ================================
                  Rock pigeon  ================================
                 Mallard duck  ================================
     Chinese softshell turtle  ================================
                      Chicken  ================================
          Medium ground finch  ================================
                       Turkey  ================================
               Painted turtle  ================================
                  Zebra finch  ================================
          Collared flycatcher  ================================
           American alligator  ================================
           Tibetan ground jay  ================================
                Scarlet macaw  ================================
       White-throated sparrow  ================================
                   Guinea pig  ================================
             Brush-tailed rat  ================================
               Naked mole-rat  ================================
                   Chinchilla  ================================
                     Squirrel  ================================
                 Prairie vole  ================================
              Chinese hamster  ================================
                        Panda  ================================
                Domestic goat  ================================
                        Sheep  ================================
                      Wallaby  ================================
              Tasmanian devil  ================================
                     Platypus  ================================
              Green seaturtle  ================================
                          Cow  ================================
             Tibetan antelope  ================================
                     Microbat  ================================
         David's myotis (bat)  ================================
                Big brown bat  ================================
             Black flying-fox  ================================
                      Megabat  ================================
                          Pig  ================================
              Squirrel monkey  ================================
           Chinese tree shrew  ================================
                       Rabbit  ================================
               Pacific walrus  ================================
                         Pika  ================================
                      Ferret   ================================
               Bactrian camel  ================================
                       Alpaca  ================================
                          Dog  ================================
       Lesser Egyptian jerboa  ================================
                       Tenrec  ================================
                    Armadillo  ================================
                          Cat  ================================
                     Aardvark  --------------------------------
                     Elephant  ================================
                        Horse  ================================
                 Weddell seal  ================================
             White rhinoceros  ================================
                      Manatee  --------------------------------
                 Killer whale  ================================
                      Dolphin  ================================
                     Marmoset  ================================
                       Rhesus  ================================
                    Orangutan  ================================
             Cape golden mole  ================================
                     Bushbaby  ================================

Alignment block 2 of 710 in window, 88353931 - 88354127, 197 bps 
B D                     Human  aagcagcacac-aaggggccgggcacagtgactcactggctcacgcctataatcccagcactttgggagg
B D                     Chimp  aagcagcacac-aaggggccgggcacagtgactcactggctcacgcctataatcccagcactctgggagg
B D                   Gorilla  aagcagcacac-aaggggccgggcacagtggctcactggctcacgcctataatcccagcactttgggagg
B D                    Gibbon  aagaagcacacaaaggggccgggcacggtggctcactggctcacgcctataatcccagcactttgggagg
B D       Crab-eating macaque  aaaaagcacac-aaggggctgggtgcggtgcctcactggctcatgcctataatcccagctttttgggagg
B D                    Baboon  aaaaagc-cac-aaggggctgggcgcggtgcctcactggctcatgcctataatcccagctctttgggagg
B D              Green monkey  aaaaagcacac-aaggggctgggtgtggtgcctcactggttcatgcctataatcccagctttttgggagg
B D                  Marmoset  aagaaacacac-a--gggccaggcgcagtgactcac--------acctgtaatcccagcactttgggagg
B D           Squirrel monkey  aagaaatacac-a--gggctgggcgcagtggctcac--------acctgtaatcccagctctttgggagg
             Star-nosed mole  ======================================================================
              Golden hamster  ======================================================================
B D                  Hedgehog  ======================================================================
B D                       Rat  ======================================================================
B D                     Shrew  ======================================================================
B D                     Mouse  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
B D                Budgerigar  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
  D             Scarlet macaw  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                Guinea pig  ======================================================================
            Brush-tailed rat  ======================================================================
B D            Naked mole-rat  ======================================================================
                  Chinchilla  ======================================================================
B D                  Squirrel  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D           Green seaturtle  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
            Black flying-fox  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
          Chinese tree shrew  ======================================================================
B D                    Rabbit  ======================================================================
              Pacific walrus  ======================================================================
B D                      Pika  ======================================================================
B D                   Ferret   ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
B D                       Dog  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                    Tenrec  ======================================================================
B D                 Armadillo  ======================================================================
B D                       Cat  ======================================================================
                    Aardvark  ----------------------------------------------------------------------
B D                  Elephant  ======================================================================
B D                     Horse  ======================================================================
                Weddell seal  ======================================================================
B D          White rhinoceros  ======================================================================
B D                   Manatee  ----------------------------------------------------------------------
                Killer whale  ======================================================================
B D                   Dolphin  ======================================================================
B D                    Rhesus  ======================================================================
B D                 Orangutan  ======================================================================
            Cape golden mole  ======================================================================
B D                  Bushbaby  ======================================================================

                        Human  ctgaggcaggcggatcatctgaggtcaggagttcaagacaagcctgaccaacatggagaaaccccgtgcc
                        Chimp  ctgaggcaggcggatcatctgaggtcaggagtttgagacaagcctgaccaacatggagaaaccccgtgcc
                      Gorilla  ctgaggcaggcggatcatctgaggtcaggagttcgagacaagcctgaccaacatggagaaaccccgtgcc
                       Gibbon  ctgaggcaggcagatcatctgaggtcaggagttcgagacaagcctgaccaacatg--agaaccccgtgcc
          Crab-eating macaque  ccgaggcaggtggatcacctgaggtcaggagttcgagaccagcctgaccaacatggagaaaccacgtgtc
                       Baboon  ccgaggcaggtggatcacctgaggtcaggagttcaagaccagcctgaccaacatggagaaaccccgtgtc
                 Green monkey  ccgaggcaggcggatcacctgaggtcaggagttcgagaccagcctgaccaacatggagaaaccccgtgtc
                     Marmoset  ccgaggcaggtggatcacctaagatggggagatcgagaccagcctaaccaacgtggagaaaccctgtctc
              Squirrel monkey  ccgaggcaggtggatcacctaaggtggggagattgagaccagcctaaccaacatggagaaaccctgtctc
              Star-nosed mole  ======================================================================
               Golden hamster  ======================================================================
                     Hedgehog  ======================================================================
                          Rat  ======================================================================
                        Shrew  ======================================================================
                        Mouse  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
                   Budgerigar  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                Scarlet macaw  ======================================================================
       White-throated sparrow  ======================================================================
                   Guinea pig  ======================================================================
             Brush-tailed rat  ======================================================================
               Naked mole-rat  ======================================================================
                   Chinchilla  ======================================================================
                     Squirrel  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
              Green seaturtle  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
             Black flying-fox  ======================================================================
                      Megabat  ======================================================================
                          Pig  ======================================================================
           Chinese tree shrew  ======================================================================
                       Rabbit  ======================================================================
               Pacific walrus  ======================================================================
                         Pika  ======================================================================
                      Ferret   ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                          Dog  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                       Tenrec  ======================================================================
                    Armadillo  ======================================================================
                          Cat  ======================================================================
                     Aardvark  ----------------------------------------------------------------------
                     Elephant  ======================================================================
                        Horse  ======================================================================
                 Weddell seal  ======================================================================
             White rhinoceros  ======================================================================
                      Manatee  ----------------------------------------------------------------------
                 Killer whale  ======================================================================
                      Dolphin  ======================================================================
                       Rhesus  ======================================================================
                    Orangutan  ======================================================================
             Cape golden mole  ======================================================================
                     Bushbaby  ======================================================================

                        Human  tactaaaaatacaaaattagccgagcatggtggcacatgcctgtaatcccagctactt
                        Chimp  tactaaaaatacaaaattagccgagcatggtggcacatgcctgtaatcccagctactt
                      Gorilla  tactaaaaatacaaaattagccgagcatggtggcacatgcctgtaatcccagctactc
                       Gibbon  tactaaaaatacaaaattagccgagtatggtggcacatgcctgtaatcccagctactc
          Crab-eating macaque  tactaaaaatacaacattagccgagcatggtggcacatgcctgtaatcccagctactc
                       Baboon  tactaaaaatacaacattagctgagcatggtggcacatgcctgtaatcccagctactc
                 Green monkey  tactaaaaat---acattagccgagcacggtggcacatgcctgtaatcccagctactc
                     Marmoset  taccaaaaatacaaaattagccaggcatggtggcgcatgcctataatcccagctactc
              Squirrel monkey  taccaaaaatacaaaattagccaggcatggtggcacatgcctataatcccagctactc
              Star-nosed mole  ==========================================================
               Golden hamster  ==========================================================
                     Hedgehog  ==========================================================
                          Rat  ==========================================================
                        Shrew  ==========================================================
                        Mouse  ==========================================================
             Peregrine falcon  ==========================================================
                 Saker falcon  ==========================================================
                       Parrot  ==========================================================
                   Budgerigar  ==========================================================
                  Rock pigeon  ==========================================================
                 Mallard duck  ==========================================================
     Chinese softshell turtle  ==========================================================
                      Chicken  ==========================================================
          Medium ground finch  ==========================================================
                       Turkey  ==========================================================
               Painted turtle  ==========================================================
                  Zebra finch  ==========================================================
          Collared flycatcher  ==========================================================
           American alligator  ==========================================================
           Tibetan ground jay  ==========================================================
                Scarlet macaw  ==========================================================
       White-throated sparrow  ==========================================================
                   Guinea pig  ==========================================================
             Brush-tailed rat  ==========================================================
               Naked mole-rat  ==========================================================
                   Chinchilla  ==========================================================
                     Squirrel  ==========================================================
                 Prairie vole  ==========================================================
              Chinese hamster  ==========================================================
                        Panda  ==========================================================
                Domestic goat  ==========================================================
                        Sheep  ==========================================================
                      Wallaby  ==========================================================
              Tasmanian devil  ==========================================================
                     Platypus  ==========================================================
              Green seaturtle  ==========================================================
                          Cow  ==========================================================
             Tibetan antelope  ==========================================================
                     Microbat  ==========================================================
         David's myotis (bat)  ==========================================================
                Big brown bat  ==========================================================
             Black flying-fox  ==========================================================
                      Megabat  ==========================================================
                          Pig  ==========================================================
           Chinese tree shrew  ==========================================================
                       Rabbit  ==========================================================
               Pacific walrus  ==========================================================
                         Pika  ==========================================================
                      Ferret   ==========================================================
               Bactrian camel  ==========================================================
                       Alpaca  ==========================================================
                          Dog  ==========================================================
       Lesser Egyptian jerboa  ==========================================================
                       Tenrec  ==========================================================
                    Armadillo  ==========================================================
                          Cat  ==========================================================
                     Aardvark  ----------------------------------------------------------
                     Elephant  ==========================================================
                        Horse  ==========================================================
                 Weddell seal  ==========================================================
             White rhinoceros  ==========================================================
                      Manatee  ----------------------------------------------------------
                 Killer whale  ==========================================================
                      Dolphin  ==========================================================
                       Rhesus  ==========================================================
                    Orangutan  ==========================================================
             Cape golden mole  ==========================================================
                     Bushbaby  ==========================================================

Alignment block 3 of 710 in window, 88354128 - 88354167, 40 bps 
B D                     Human  gggaggctgaggtaggagaatcgctggaacctgggaggcg
B D                     Chimp  gggaggctgaggtaggagaatcgctggaacctgggaggca
B D                   Gorilla  gggaggctgaggtaggagaatcgctggaacctgggaggcg
B D                 Orangutan  gggaggctgaggtaggagaatcgctggaacctgggaggcg
B D                    Gibbon  gggaggctgagttaggagaatcgctggaacctgggaggca
B D       Crab-eating macaque  gggaggctgaggcaggagaatcactagaacccagcaggcg
B D                    Baboon  gggaggctgaggcaggagaatcactagaagccaggaggtg
B D              Green monkey  gggaggctgaggcaggat-atcactagaacccaggaggcg
B D                  Marmoset  gggaggctgaggcaggagaatcgcttgaacctgggaggca
B D           Squirrel monkey  gggaggctgaggcaggagaatcacatgaacctgggaggca
             Star-nosed mole  ========================================
              Golden hamster  ========================================
B D                  Hedgehog  ========================================
B D                       Rat  ========================================
B D                     Shrew  ========================================
B D                     Mouse  ========================================
  D          Peregrine falcon  ========================================
  D              Saker falcon  ========================================
  D                    Parrot  ========================================
B D                Budgerigar  ========================================
  D               Rock pigeon  ========================================
  D              Mallard duck  ========================================
  D  Chinese softshell turtle  ========================================
B D                   Chicken  ========================================
B D       Medium ground finch  ========================================
B D                    Turkey  ========================================
  D            Painted turtle  ========================================
B D               Zebra finch  ========================================
  D       Collared flycatcher  ========================================
B D        American alligator  ========================================
          Tibetan ground jay  ========================================
  D             Scarlet macaw  ========================================
  D    White-throated sparrow  ========================================
B D                Guinea pig  ========================================
            Brush-tailed rat  ========================================
B D            Naked mole-rat  ========================================
                  Chinchilla  ========================================
B D                  Squirrel  ========================================
                Prairie vole  ========================================
B D           Chinese hamster  ========================================
B D                     Panda  ========================================
               Domestic goat  ========================================
B D                     Sheep  ========================================
B D                   Wallaby  ========================================
B D           Tasmanian devil  ========================================
B D                  Platypus  ========================================
  D           Green seaturtle  ========================================
B D                       Cow  ========================================
            Tibetan antelope  ========================================
B D                  Microbat  ========================================
        David's myotis (bat)  ========================================
               Big brown bat  ========================================
            Black flying-fox  ========================================
B D                   Megabat  ========================================
B D                       Pig  ========================================
          Chinese tree shrew  ========================================
B D                    Rabbit  ========================================
              Pacific walrus  ========================================
B D                      Pika  ========================================
B D                   Ferret   ========================================
              Bactrian camel  ========================================
B D                    Alpaca  ========================================
B D                       Dog  ========================================
      Lesser Egyptian jerboa  ========================================
B D                    Tenrec  ========================================
B D                 Armadillo  ========================================
B D                       Cat  ========================================
                    Aardvark  ----------------------------------------
B D                  Elephant  ========================================
B D                     Horse  ========================================
                Weddell seal  ========================================
B D          White rhinoceros  ========================================
B D                   Manatee  ----------------------------------------
                Killer whale  ========================================
B D                   Dolphin  ========================================
B D                    Rhesus  ========================================
            Cape golden mole  ========================================
B D                  Bushbaby  ========================================

Alignment block 4 of 710 in window, 88354168 - 88354198, 31 bps 
B D                     Human  gaggttgcagtgagcccagatggtgccattg
B D                     Chimp  gaggttgcagtgagcccagatggtgccattg
B D                 Orangutan  gaggttgcagtgagcccagatggtgccattg
B D                    Gibbon  gaggttgcagtgagcccagatggtgccattg
B D       Crab-eating macaque  gaggttgcagtgagcccagatggtgccattg
B D                    Baboon  gaggttgcagtgagcccagatggtaccattg
B D              Green monkey  gagattgcagtgagcccagatggtgccattg
B D                  Marmoset  gaggttgcagtgagccaagatcatgccatta
B D           Squirrel monkey  gaggttacagtgagccaagatcatgccatta
             Star-nosed mole  ===============================
              Golden hamster  ===============================
B D                  Hedgehog  ===============================
B D                       Rat  ===============================
B D                     Shrew  ===============================
B D                     Mouse  ===============================
  D          Peregrine falcon  ===============================
  D              Saker falcon  ===============================
  D                    Parrot  ===============================
B D                Budgerigar  ===============================
  D               Rock pigeon  ===============================
  D              Mallard duck  ===============================
  D  Chinese softshell turtle  ===============================
B D                   Chicken  ===============================
B D       Medium ground finch  ===============================
B D                    Turkey  ===============================
  D            Painted turtle  ===============================
B D               Zebra finch  ===============================
  D       Collared flycatcher  ===============================
B D        American alligator  ===============================
          Tibetan ground jay  ===============================
  D             Scarlet macaw  ===============================
  D    White-throated sparrow  ===============================
B D                Guinea pig  ===============================
            Brush-tailed rat  ===============================
B D            Naked mole-rat  ===============================
                  Chinchilla  ===============================
B D                  Squirrel  ===============================
                Prairie vole  ===============================
B D           Chinese hamster  ===============================
B D                     Panda  ===============================
               Domestic goat  ===============================
B D                     Sheep  ===============================
B D                   Wallaby  ===============================
B D           Tasmanian devil  ===============================
B D                  Platypus  ===============================
  D           Green seaturtle  ===============================
B D                       Cow  ===============================
            Tibetan antelope  ===============================
B D                  Microbat  ===============================
        David's myotis (bat)  ===============================
               Big brown bat  ===============================
            Black flying-fox  ===============================
B D                   Megabat  ===============================
B D                       Pig  ===============================
          Chinese tree shrew  ===============================
B D                    Rabbit  ===============================
              Pacific walrus  ===============================
B D                      Pika  ===============================
B D                   Ferret   ===============================
              Bactrian camel  ===============================
B D                    Alpaca  ===============================
B D                       Dog  ===============================
      Lesser Egyptian jerboa  ===============================
B D                    Tenrec  ===============================
B D                 Armadillo  ===============================
B D                       Cat  ===============================
                    Aardvark  -------------------------------
B D                  Elephant  ===============================
B D                     Horse  ===============================
                Weddell seal  ===============================
B D          White rhinoceros  ===============================
B D                   Manatee  -------------------------------
                Killer whale  ===============================
B D                   Dolphin  ===============================
B D                    Rhesus  ===============================
            Cape golden mole  ===============================
B D                  Bushbaby  ===============================
B D                   Gorilla  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 5 of 710 in window, 88354199 - 88354212, 14 bps 
B D                     Human  cactccagcctggg
B D                     Chimp  cactccagcctggg
B D                   Gorilla  cactccagcctggg
B D                 Orangutan  cactccagcctggg
B D                    Gibbon  cactccagcctggg
B D       Crab-eating macaque  tactccagcctgtg
B D                    Baboon  cactccagcctgtg
B D              Green monkey  cattccagcctgtg
B D                  Marmoset  cactccagtctggg
B D           Squirrel monkey  cactccagcctggg
             Star-nosed mole  ==============
              Golden hamster  ==============
B D                  Hedgehog  ==============
B D                       Rat  ==============
B D                     Shrew  ==============
B D                     Mouse  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D                    Parrot  ==============
B D                Budgerigar  ==============
  D               Rock pigeon  ==============
  D              Mallard duck  ==============
  D  Chinese softshell turtle  ==============
B D                   Chicken  ==============
B D       Medium ground finch  ==============
B D                    Turkey  ==============
  D            Painted turtle  ==============
B D               Zebra finch  ==============
  D       Collared flycatcher  ==============
B D        American alligator  ==============
          Tibetan ground jay  ==============
  D             Scarlet macaw  ==============
  D    White-throated sparrow  ==============
B D                Guinea pig  ==============
            Brush-tailed rat  ==============
B D            Naked mole-rat  ==============
                  Chinchilla  ==============
B D                  Squirrel  ==============
                Prairie vole  ==============
B D           Chinese hamster  ==============
B D                     Panda  ==============
               Domestic goat  ==============
B D                     Sheep  ==============
B D                   Wallaby  ==============
B D           Tasmanian devil  ==============
B D                  Platypus  ==============
  D           Green seaturtle  ==============
B D                       Cow  ==============
            Tibetan antelope  ==============
B D                  Microbat  ==============
        David's myotis (bat)  ==============
               Big brown bat  ==============
            Black flying-fox  ==============
B D                   Megabat  ==============
B D                       Pig  ==============
          Chinese tree shrew  ==============
B D                    Rabbit  ==============
              Pacific walrus  ==============
B D                      Pika  ==============
B D                   Ferret   ==============
              Bactrian camel  ==============
B D                    Alpaca  ==============
B D                       Dog  ==============
      Lesser Egyptian jerboa  ==============
B D                    Tenrec  ==============
B D                 Armadillo  ==============
B D                       Cat  ==============
                    Aardvark  --------------
B D                  Elephant  ==============
B D                     Horse  ==============
                Weddell seal  ==============
B D          White rhinoceros  ==============
B D                   Manatee  --------------
                Killer whale  ==============
B D                   Dolphin  ==============
B D                    Rhesus  ==============
            Cape golden mole  ==============
B D                  Bushbaby  ==============

Alignment block 6 of 710 in window, 88354213 - 88354231, 19 bps 
B D                     Human  caacaagagcgaaacc-cca
B D                     Chimp  caacaagagcgaaacc-cca
B D                   Gorilla  caacaagagcgaaacc-cct
B D                 Orangutan  caacaagagtgaaact-cca
B D                    Gibbon  caacaagagtgaaact-cca
B D       Crab-eating macaque  caacaagagcgaaact-cca
B D                    Baboon  caacaagagcaaaact-cca
B D              Green monkey  caacaagagcgatactccca
B D                  Marmoset  caacaagagctagact-ctg
B D           Squirrel monkey  ccacaagagctagact-cca
             Tibetan antelope  caacaaaaacaaaca-----
B D                       Cow  caacaacaac----------
B D                     Sheep  caacaaaaacaaaca-----
                Domestic goat  caacaaaaacaaaca-----
             Star-nosed mole  ====================
              Golden hamster  ====================
B D                  Hedgehog  ====================
B D                       Rat  ====================
B D                     Shrew  ====================
B D                     Mouse  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
  D                    Parrot  ====================
B D                Budgerigar  ====================
  D               Rock pigeon  ====================
  D              Mallard duck  ====================
  D  Chinese softshell turtle  ====================
B D                   Chicken  ====================
B D       Medium ground finch  ====================
B D                    Turkey  ====================
  D            Painted turtle  ====================
B D               Zebra finch  ====================
  D       Collared flycatcher  ====================
B D        American alligator  ====================
          Tibetan ground jay  ====================
  D             Scarlet macaw  ====================
  D    White-throated sparrow  ====================
B D                Guinea pig  ====================
            Brush-tailed rat  ====================
B D            Naked mole-rat  ====================
                  Chinchilla  ====================
B D                  Squirrel  ====================
                Prairie vole  ====================
B D           Chinese hamster  ====================
B D                     Panda  ====================
B D                   Wallaby  ====================
B D           Tasmanian devil  ====================
B D                  Platypus  ====================
  D           Green seaturtle  ====================
B D                  Microbat  ====================
        David's myotis (bat)  ====================
               Big brown bat  ====================
            Black flying-fox  ====================
B D                   Megabat  ====================
B D                       Pig  ====================
          Chinese tree shrew  ====================
B D                    Rabbit  ====================
              Pacific walrus  ====================
B D                      Pika  ====================
B D                   Ferret   ====================
              Bactrian camel  ====================
B D                    Alpaca  ====================
B D                       Dog  ====================
      Lesser Egyptian jerboa  ====================
B D                    Tenrec  ====================
B D                 Armadillo  ====================
B D                       Cat  ====================
                    Aardvark  --------------------
B D                  Elephant  ====================
B D                     Horse  ====================
                Weddell seal  ====================
B D          White rhinoceros  ====================
B D                   Manatee  --------------------
                Killer whale  ====================
B D                   Dolphin  ====================
B D                    Rhesus  ====================
            Cape golden mole  ====================
B D                  Bushbaby  ====================

Inserts between block 6 and 7 in window
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp

Alignment block 7 of 710 in window, 88354232 - 88354232, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  c
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D          White rhinoceros  t
             Star-nosed mole  =
              Golden hamster  =
B D                  Hedgehog  =
B D                       Rat  =
B D                     Shrew  =
B D                     Mouse  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D              Mallard duck  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
  D            Painted turtle  =
B D               Zebra finch  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
  D             Scarlet macaw  =
  D    White-throated sparrow  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  =
                Prairie vole  =
B D           Chinese hamster  =
B D                     Panda  =
               Domestic goat  =
B D                     Sheep  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                  Platypus  =
  D           Green seaturtle  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Microbat  =
        David's myotis (bat)  =
               Big brown bat  =
            Black flying-fox  =
B D                   Megabat  =
B D                       Pig  =
          Chinese tree shrew  =
B D                    Rabbit  =
              Pacific walrus  =
B D                      Pika  =
B D                   Ferret   =
              Bactrian camel  =
B D                    Alpaca  =
B D                       Dog  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
B D                 Armadillo  =
B D                       Cat  =
                    Aardvark  -
B D                  Elephant  =
B D                     Horse  =
                Weddell seal  =
B D                   Manatee  -
                Killer whale  =
B D                   Dolphin  =
B D                    Rhesus  =
            Cape golden mole  =
B D                  Bushbaby  =

Alignment block 8 of 710 in window, 88354233 - 88354255, 23 bps 
B D                     Human  -----------------ct-gaaaagaaaa------aaaaaaaa------tgc
B D                     Chimp  -----------------ct-gaaaag-aaa------aaaaaaaa------tgc
B D                   Gorilla  -----------------ct-gaaaag--aa------aaaaaaaa------tgc
B D                 Orangutan  -----------------ct-gaaaaa-----------taaaaaa------agc
B D                    Gibbon  -----------------ct-gaaaaa------------aaaaaa------tgc
B D       Crab-eating macaque  -----------------ct-aaaaaaaaaa------gaaaaaaacaaaattgc
B D                    Baboon  -----------------ctaaaaaaaaaaa------gaaaaaaacaaaattgc
B D              Green monkey  -----------------ct-aaaaaaaaaa------gaaaaaaacaaaattgc
B D                  Marmoset  -----------------ct-caaaaaagaa-----------------------
B D           Squirrel monkey  -----------------ct-caaaaaaaaaaaaattaaaaaaaaaaaaaatgc
B D                    Alpaca  -----------------ct-gagaagatgg-----------------------
B D                   Dolphin  --------------cttag-aagaagatgg-----------------------
                 Killer whale  --------------cttag-aagaagatgg-----------------------
             Tibetan antelope  -----aagaaaa--caaca-aaaaagatgg-----------------------
B D                       Cow  -----aagaaaa--caata-aaaaagatgg-----------------------
B D                     Sheep  -----aagaaaa--caaca-aaaaagatgg-----------------------
                Domestic goat  -----aagaaaa--caaca-aaaaagatgg-----------------------
B D          White rhinoceros  cttataagaagattcccat-gagaagacag-----------------------
             Star-nosed mole  =====================================================
              Golden hamster  =====================================================
B D                  Hedgehog  =====================================================
B D                       Rat  =====================================================
B D                     Shrew  =====================================================
B D                     Mouse  =====================================================
  D          Peregrine falcon  =====================================================
  D              Saker falcon  =====================================================
  D                    Parrot  =====================================================
B D                Budgerigar  =====================================================
  D               Rock pigeon  =====================================================
  D              Mallard duck  =====================================================
  D  Chinese softshell turtle  =====================================================
B D                   Chicken  =====================================================
B D       Medium ground finch  =====================================================
B D                    Turkey  =====================================================
  D            Painted turtle  =====================================================
B D               Zebra finch  =====================================================
  D       Collared flycatcher  =====================================================
B D        American alligator  =====================================================
          Tibetan ground jay  =====================================================
  D             Scarlet macaw  =====================================================
  D    White-throated sparrow  =====================================================
B D                Guinea pig  =====================================================
            Brush-tailed rat  =====================================================
B D            Naked mole-rat  =====================================================
                  Chinchilla  =====================================================
B D                  Squirrel  =====================================================
                Prairie vole  =====================================================
B D           Chinese hamster  =====================================================
B D                     Panda  =====================================================
B D                   Wallaby  =====================================================
B D           Tasmanian devil  =====================================================
B D                  Platypus  =====================================================
  D           Green seaturtle  =====================================================
B D                  Microbat  =====================================================
        David's myotis (bat)  =====================================================
               Big brown bat  =====================================================
            Black flying-fox  =====================================================
B D                   Megabat  =====================================================
B D                       Pig  =====================================================
          Chinese tree shrew  =====================================================
B D                    Rabbit  =====================================================
              Pacific walrus  =====================================================
B D                      Pika  =====================================================
B D                   Ferret   =====================================================
              Bactrian camel  =====================================================
B D                       Dog  =====================================================
      Lesser Egyptian jerboa  =====================================================
B D                    Tenrec  =====================================================
B D                 Armadillo  =====================================================
B D                       Cat  =====================================================
                    Aardvark  -----------------------------------------------------
B D                  Elephant  =====================================================
B D                     Horse  =====================================================
                Weddell seal  =====================================================
B D                   Manatee  -----------------------------------------------------
B D                    Rhesus  =====================================================
            Cape golden mole  =====================================================
B D                  Bushbaby  =====================================================

Inserts between block 8 and 9 in window
B D                   Alpaca 16bp
B D                  Dolphin 12bp
                Killer whale 12bp
            Tibetan antelope 14bp
B D                      Cow 14bp
B D                    Sheep 14bp
               Domestic goat 14bp
B D         White rhinoceros 2bp

Alignment block 9 of 710 in window, 88354256 - 88354258, 3 bps 
B D                     Human  aca
B D                     Chimp  aca
B D                   Gorilla  aca
B D                 Orangutan  aca
B D                    Gibbon  aca
B D       Crab-eating macaque  gcg
B D                    Baboon  gcg
B D              Green monkey  gcg
B D                  Marmoset  -ta
B D           Squirrel monkey  gta
           Chinese tree shrew  aca
B D                    Alpaca  aca
               Bactrian camel  aca
             Tibetan antelope  acg
B D                       Cow  aca
B D                     Sheep  aca
                Domestic goat  acg
B D                     Horse  aca
B D          White rhinoceros  aca
B D                       Dog  acc
B D                     Panda  acc
             Black flying-fox  aca
B D                   Megabat  aca
B D                     Shrew  aca
             Star-nosed mole  ===
              Golden hamster  ===
B D                  Hedgehog  ===
B D                       Rat  ===
B D                     Mouse  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
  D              Mallard duck  ===
  D  Chinese softshell turtle  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
  D             Scarlet macaw  ===
  D    White-throated sparrow  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
B D                  Squirrel  ===
                Prairie vole  ===
B D           Chinese hamster  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D                  Platypus  ===
  D           Green seaturtle  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
               Big brown bat  ===
B D                       Pig  ===
B D                    Rabbit  ===
              Pacific walrus  ===
B D                      Pika  ===
B D                   Ferret   ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                 Armadillo  ===
B D                       Cat  ===
                    Aardvark  ---
B D                  Elephant  ===
                Weddell seal  ===
B D                   Manatee  ---
                Killer whale  ===
B D                   Dolphin  ===
B D                    Rhesus  ===
            Cape golden mole  ===
B D                  Bushbaby  ===

Alignment block 10 of 710 in window, 88354259 - 88354260, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ca
           Chinese tree shrew  ca
B D                    Alpaca  ca
               Bactrian camel  ca
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  ta
B D                       Cow  ta
B D                     Sheep  ta
                Domestic goat  ta
B D                     Horse  ca
B D          White rhinoceros  ca
B D                       Dog  ca
B D                     Panda  ca
               Pacific walrus  ca
                 Weddell seal  ca
             Black flying-fox  -a
B D                   Megabat  -a
B D                     Shrew  -a
             Star-nosed mole  ==
              Golden hamster  ==
B D                  Hedgehog  ==
B D                       Rat  ==
B D                     Mouse  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
  D              Mallard duck  ==
  D  Chinese softshell turtle  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                    Turkey  ==
  D            Painted turtle  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
B D        American alligator  ==
          Tibetan ground jay  ==
  D             Scarlet macaw  ==
  D    White-throated sparrow  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                  Squirrel  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D                  Platypus  ==
  D           Green seaturtle  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
               Big brown bat  ==
B D                       Pig  ==
B D                    Rabbit  ==
B D                      Pika  ==
B D                   Ferret   ==
      Lesser Egyptian jerboa  ==
B D                    Tenrec  ==
B D                 Armadillo  ==
B D                       Cat  ==
                    Aardvark  --
B D                  Elephant  ==
B D                   Manatee  --
B D                    Rhesus  ==
            Cape golden mole  ==
B D                  Bushbaby  ==

Inserts between block 10 and 11 in window
            Black flying-fox 1bp
B D                  Megabat 1bp
B D                    Shrew 1bp

Alignment block 11 of 710 in window, 88354261 - 88354263, 3 bps 
B D                     Human  agg
B D                     Chimp  agg
B D                   Gorilla  agg
B D                 Orangutan  agg
B D                    Gibbon  agg
B D       Crab-eating macaque  agg
B D                    Baboon  agg
B D              Green monkey  agg
B D                  Marmoset  ggg
B D           Squirrel monkey  gag
           Chinese tree shrew  ggg
B D                    Alpaca  agg
               Bactrian camel  agg
B D                   Dolphin  agg
                 Killer whale  agg
             Tibetan antelope  ggg
B D                       Cow  ggg
B D                     Sheep  ggg
                Domestic goat  ggg
B D                     Horse  agg
B D          White rhinoceros  atg
B D                       Dog  agg
B D                     Panda  aag
               Pacific walrus  agg
                 Weddell seal  agg
             Black flying-fox  agg
B D                   Megabat  agg
                Big brown bat  agg
         David's myotis (bat)  agg
B D                  Microbat  agg
B D                     Shrew  agg
             Star-nosed mole  ===
              Golden hamster  ===
B D                  Hedgehog  ===
B D                       Rat  ===
B D                     Mouse  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
  D              Mallard duck  ===
  D  Chinese softshell turtle  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
  D             Scarlet macaw  ===
  D    White-throated sparrow  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
B D                  Squirrel  ===
                Prairie vole  ===
B D           Chinese hamster  ===
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D                  Platypus  ===
  D           Green seaturtle  ===
B D                       Pig  ===
B D                    Rabbit  ===
B D                      Pika  ===
B D                   Ferret   ===
      Lesser Egyptian jerboa  ===
B D                    Tenrec  ===
B D                 Armadillo  ===
B D                       Cat  ===
                    Aardvark  ---
B D                  Elephant  ===
B D                   Manatee  ---
B D                    Rhesus  ===
            Cape golden mole  ===
B D                  Bushbaby  ===

Alignment block 12 of 710 in window, 88354264 - 88354276, 13 bps 
B D                     Human  agaagccatgtgt
B D                     Chimp  agaagccatgtgt
B D                   Gorilla  agaagccacgtgt
B D                 Orangutan  agaagccgtgtgt
B D                    Gibbon  agaagccatgtgt
B D       Crab-eating macaque  agaagtcatgtga
B D                    Baboon  agaggtcatgtga
B D              Green monkey  agaagtcatgtga
B D                  Marmoset  agaagccatgtga
B D           Squirrel monkey  agaagccatgtga
           Chinese tree shrew  caatatcacatga
B D                    Alpaca  agatgccctgtga
               Bactrian camel  agatgccttgtga
B D                   Dolphin  agatgccttgtga
                 Killer whale  agatgcctagtga
             Tibetan antelope  agatgccttgtaa
B D                       Cow  agatgccttgtga
B D                     Sheep  agatgccttgtaa
                Domestic goat  agatgccttgtaa
B D                     Horse  agatgcctcgtga
B D          White rhinoceros  acatgccttgtga
B D                       Cat  agatgccttgtga
B D                       Dog  agatgccttgt--
B D                     Panda  agatgcctagcga
               Pacific walrus  agacgcctcgtga
                 Weddell seal  agacgcctcgtga
             Black flying-fox  agatgccttgtga
B D                   Megabat  agatgccttgtga
                Big brown bat  agatgcc-tgtga
         David's myotis (bat)  agatgcc-tgtga
B D                  Microbat  agatgcc-tgtga
B D                     Shrew  ------atcataa
             Star-nosed mole  =============
              Golden hamster  =============
B D                  Hedgehog  =============
B D                       Rat  =============
B D                     Mouse  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D                    Parrot  =============
B D                Budgerigar  =============
  D               Rock pigeon  =============
  D              Mallard duck  =============
  D  Chinese softshell turtle  =============
B D                   Chicken  =============
B D       Medium ground finch  =============
B D                    Turkey  =============
  D            Painted turtle  =============
B D               Zebra finch  =============
  D       Collared flycatcher  =============
B D        American alligator  =============
          Tibetan ground jay  =============
  D             Scarlet macaw  =============
  D    White-throated sparrow  =============
B D                Guinea pig  =============
            Brush-tailed rat  =============
B D            Naked mole-rat  =============
                  Chinchilla  =============
B D                  Squirrel  =============
                Prairie vole  =============
B D           Chinese hamster  =============
B D                   Wallaby  =============
B D           Tasmanian devil  =============
B D                  Platypus  =============
  D           Green seaturtle  =============
B D                       Pig  =============
B D                    Rabbit  =============
B D                      Pika  =============
B D                   Ferret   =============
      Lesser Egyptian jerboa  =============
B D                    Tenrec  =============
B D                 Armadillo  =============
                    Aardvark  -------------
B D                  Elephant  =============
B D                   Manatee  -------------
B D                    Rhesus  =============
            Cape golden mole  =============
B D                  Bushbaby  =============

Inserts between block 12 and 13 in window
B D                    Shrew 2bp

Alignment block 13 of 710 in window, 88354277 - 88354300, 24 bps 
B D                     Human  agatggaagcacaga--------ttggaatga
B D                     Chimp  agatggaagcacaga--------ttggaatga
B D                   Gorilla  agatggaagcacaga--------ttggaatga
B D                 Orangutan  agatggaagcacaga--------ttggaatga
B D                    Gibbon  agatggaagcacaga--------tttgaatga
B D       Crab-eating macaque  agatggaagcacaga--------ttggaatgt
B D                    Baboon  agatggaagcacaga--------ttggaatgt
B D              Green monkey  agatggaagcacaga--------ttggaatgt
B D                  Marmoset  agatggaagcacagatgcacaggttggaataa
B D           Squirrel monkey  agatggaagcacagatgcacagcttggaataa
           Chinese tree shrew  agaccaacgaagaga--------ttggagtga
B D                    Alpaca  agacagaggccgggg--------ttggagtga
               Bactrian camel  agacagaggcagggg--------ttggagtga
B D                   Dolphin  agacaggggcagagg--------tgggagtga
                 Killer whale  agacaggggcagagg--------tgggaggga
             Tibetan antelope  aggcagagggagagg--------tgggagtaa
B D                       Cow  agacagacgcagagg--------tgggaggga
B D                     Sheep  agacagcgggagagg--------tgggagtga
                Domestic goat  agacagcgggagatg--------tgggagtga
B D                     Horse  agacagaggcagaga--------ttggagtgc
B D          White rhinoceros  agacagaggcagaga--------ctggagtga
B D                       Cat  agacagaggcagaga--------ttggagcga
B D                       Dog  -----------gaga--------ttgaagtga
B D                     Panda  ggac--aggcagaga--------tcagagtga
               Pacific walrus  ggacagaggcagaga--------ttggagtgg
                 Weddell seal  ggacagaggcagaga--------ttggagtgg
             Black flying-fox  aga-agaggcaagga--------ttggagtaa
B D                   Megabat  agacagaggcaacga--------ttggagtaa
                Big brown bat  agacaggggcaggga--------ttggagtga
         David's myotis (bat)  agacgggggccgggg--------ttgaattga
B D                  Microbat  agacgggggccggga--------ttggagtga
B D                     Shrew  ------agacagaga--------catgaatga
              Star-nosed mole  agactgaggtagaga--------ccagggtgg
              Golden hamster  ================================
B D                  Hedgehog  ================================
B D                       Rat  ================================
B D                     Mouse  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
  D                    Parrot  ================================
B D                Budgerigar  ================================
  D               Rock pigeon  ================================
  D              Mallard duck  ================================
  D  Chinese softshell turtle  ================================
B D                   Chicken  ================================
B D       Medium ground finch  ================================
B D                    Turkey  ================================
  D            Painted turtle  ================================
B D               Zebra finch  ================================
  D       Collared flycatcher  ================================
B D        American alligator  ================================
          Tibetan ground jay  ================================
  D             Scarlet macaw  ================================
  D    White-throated sparrow  ================================
B D                Guinea pig  ================================
            Brush-tailed rat  ================================
B D            Naked mole-rat  ================================
                  Chinchilla  ================================
B D                  Squirrel  ================================
                Prairie vole  ================================
B D           Chinese hamster  ================================
B D                   Wallaby  ================================
B D           Tasmanian devil  ================================
B D                  Platypus  ================================
  D           Green seaturtle  ================================
B D                       Pig  ================================
B D                    Rabbit  ================================
B D                      Pika  ================================
B D                   Ferret   ================================
      Lesser Egyptian jerboa  ================================
B D                    Tenrec  ================================
B D                 Armadillo  ================================
                    Aardvark  --------------------------------
B D                  Elephant  ================================
B D                   Manatee  --------------------------------
B D                    Rhesus  ================================
            Cape golden mole  ================================
B D                  Bushbaby  ================================

Alignment block 14 of 710 in window, 88354301 - 88354333, 33 bps 
B D                     Human  tgcac-ct-acaagccaaggaatgccaagg-gctgc
B D                     Chimp  tgcac-ct-acaagccaaggaatgccaagg-gctgc
B D                   Gorilla  tgcac-ct-acaagccaaggaatgccaaag-gctgc
B D                 Orangutan  tgcac-ct-acaagccaaggaatgccaagg-gctgc
B D                    Gibbon  tgcac-ct-acaagccaaggaatgccaagg-gctgc
B D                    Rhesus  tgcac-ct-acaagccaaggaatgccaagg-gctgc
B D       Crab-eating macaque  cgcac-ct-acaagccaaggaatgccaagg-gctgc
B D                    Baboon  cgcac-ct-acaagccaaggaatgccaagg-gctgc
B D              Green monkey  cacac-ct-acaagccaaggaatgccaagg-gctgc
B D                  Marmoset  catac-ct-ataagctgaggattgccaagg-gctgc
B D           Squirrel monkey  cacac-ct-acaagccgaggattgccaagatgctgc
           Chinese tree shrew  tgcat-tt-g-aagtcaaggattgc-----------
B D                    Alpaca  tgtgt-ct-ttatgccgagga------------tgc
               Bactrian camel  tgcat-ct-ttatgccgagga------------tgc
B D                   Dolphin  tacag-ct-acaagacaaaggatgccaagg-attgc
                 Killer whale  gacat-ct-acaagccaaaggatgccaagg-attgc
             Tibetan antelope  tgcat-ct-gtaaactgacggaccacgaga-atcgc
B D                       Cow  tacat-ct-gtaaactgatggactacaaga-attgc
B D                     Sheep  tgcat-ct-gtaaactgacggaccaggaga-atcgc
                Domestic goat  tgcat-ct-gtaaactgatggacc------------
B D                     Horse  tacgt-t--ataagccaagggatgccgagg-attgc
B D          White rhinoceros  tacgt-t--ataaaccaagggatgccaagg-attgc
B D                       Cat  cacat-ctaataaaccaagggatgccaagg-atggc
B D                       Dog  tatat-ctaatggaccaagggacaccaaga-acagc
B D                     Panda  tacat--taatgagccagggggtgcccggg-atggc
               Pacific walrus  tacat-ctaatgagccaggggacgcccagg-aaggc
                 Weddell seal  tacat-ctaatgagccaggggacgcccagg-acggc
             Black flying-fox  ----t-ct-ataagcctgggaataccaagg-attgc
B D                   Megabat  ----t-ct-ataagcctaggaatac-----------
                Big brown bat  cacgt-ct-atga-tcaagggatgccgagc-attgc
         David's myotis (bat)  cacgc-ct-atga-tcaagggatgcagagc-attgc
B D                  Microbat  cacgt-ct-atga-tcaagggatgccgagc-attgc
B D                     Shrew  gataagtt-gatggccaagggacgccaagg-gttgc
              Star-nosed mole  aacaa-ct-actagctgagaggtgccaaag-actgc
              Golden hamster  ====================================
B D                  Hedgehog  ====================================
B D                       Rat  ====================================
B D                     Mouse  ====================================
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
  D                    Parrot  ====================================
B D                Budgerigar  ====================================
  D               Rock pigeon  ====================================
  D              Mallard duck  ====================================
  D  Chinese softshell turtle  ====================================
B D                   Chicken  ====================================
B D       Medium ground finch  ====================================
B D                    Turkey  ====================================
  D            Painted turtle  ====================================
B D               Zebra finch  ====================================
  D       Collared flycatcher  ====================================
B D        American alligator  ====================================
          Tibetan ground jay  ====================================
  D             Scarlet macaw  ====================================
  D    White-throated sparrow  ====================================
B D                Guinea pig  ====================================
            Brush-tailed rat  ====================================
B D            Naked mole-rat  ====================================
                  Chinchilla  ====================================
B D                  Squirrel  ====================================
                Prairie vole  ====================================
B D           Chinese hamster  ====================================
B D                   Wallaby  ====================================
B D           Tasmanian devil  ====================================
B D                  Platypus  ====================================
  D           Green seaturtle  ====================================
B D                       Pig  ====================================
B D                    Rabbit  ====================================
B D                      Pika  ====================================
B D                   Ferret   ====================================
      Lesser Egyptian jerboa  ====================================
B D                    Tenrec  ====================================
B D                 Armadillo  ====================================
                    Aardvark  ------------------------------------
B D                  Elephant  ====================================
B D                   Manatee  ------------------------------------
            Cape golden mole  ====================================
B D                  Bushbaby  ====================================

Alignment block 15 of 710 in window, 88354334 - 88354350, 17 bps 
B D                     Human  cagcaacacca-gtagct
B D                     Chimp  cagcaacacca-gtagct
B D                   Gorilla  cagcaacacca-gtagct
B D                 Orangutan  cagcaacacca-gtagct
B D                    Gibbon  cagcagcaccaggtagct
B D                    Rhesus  cagcaacacca-gtagct
B D       Crab-eating macaque  cagcaacacca-gtagct
B D                    Baboon  cagcaacacca-gtagct
B D              Green monkey  cagcaacacca-gtagct
B D                  Marmoset  cagcagcacca-gtagct
B D           Squirrel monkey  cagcaacacta-gaagct
B D                  Bushbaby  cagcagcatca-gtggcc
           Chinese tree shrew  cagcaacaccg-gaagct
B D                    Alpaca  cgccaacacca-gaagct
               Bactrian camel  cggcaacacca-gaagct
B D                   Dolphin  cgacaatatta-gaagct
                 Killer whale  cgacaatatta-gaagct
             Tibetan antelope  tggcaacatct-gaagcc
B D                       Cow  tggcaacatct-gaagcc
B D                     Sheep  tggcaacatct-gaagcc
                Domestic goat  -----acatct-gaagcc
B D                     Horse  tggcaacacga-gacgct
B D          White rhinoceros  tggcaacatca-gaagct
B D                       Cat  cagcaacacca-gaagct
B D                       Dog  tggcaacacca-gaagat
B D                     Panda  tggcaacacca-gaagct
               Pacific walrus  tggcaacacca-gaagct
                 Weddell seal  tggcaacacca-gaagct
             Black flying-fox  cggcaacacca-gaagct
B D                   Megabat  ---caacacca-gaagct
                Big brown bat  cagcaactcca-gaagct
         David's myotis (bat)  cagcaactcca-gaagct
B D                  Microbat  cagcaactcca-gaagct
B D                     Shrew  tggcaacatga-gagagc
              Star-nosed mole  tgataatgc-a-gaaagt
              Golden hamster  ==================
B D                  Hedgehog  ==================
B D                       Rat  ==================
B D                     Mouse  ==================
  D          Peregrine falcon  ==================
  D              Saker falcon  ==================
  D                    Parrot  ==================
B D                Budgerigar  ==================
  D               Rock pigeon  ==================
  D              Mallard duck  ==================
  D  Chinese softshell turtle  ==================
B D                   Chicken  ==================
B D       Medium ground finch  ==================
B D                    Turkey  ==================
  D            Painted turtle  ==================
B D               Zebra finch  ==================
  D       Collared flycatcher  ==================
B D        American alligator  ==================
          Tibetan ground jay  ==================
  D             Scarlet macaw  ==================
  D    White-throated sparrow  ==================
B D                Guinea pig  ==================
            Brush-tailed rat  ==================
B D            Naked mole-rat  ==================
                  Chinchilla  ==================
B D                  Squirrel  ==================
                Prairie vole  ==================
B D           Chinese hamster  ==================
B D                   Wallaby  ==================
B D           Tasmanian devil  ==================
B D                  Platypus  ==================
  D           Green seaturtle  ==================
B D                       Pig  ==================
B D                    Rabbit  ==================
B D                      Pika  ==================
B D                   Ferret   ==================
      Lesser Egyptian jerboa  ==================
B D                    Tenrec  ==================
B D                 Armadillo  ==================
                    Aardvark  ------------------
B D                  Elephant  ==================
B D                   Manatee  ------------------
            Cape golden mole  ==================

Alignment block 16 of 710 in window, 88354351 - 88354380, 30 bps 
B D                     Human  a---ggaaagggccatggaa--caga-ttctccctg
B D                     Chimp  a---ggaaagggccatggaa--caga-ttctccctg
B D                   Gorilla  a---ggaaagggccatggaa--caga-ttctccctg
B D                 Orangutan  a---ggaaagggccatggaa--caga-ttctccctg
B D                    Gibbon  a---ggaaagggccatgggaactagatttctccctg
B D                    Rhesus  a---ggagagggccatggaa--caga-ttctcccgg
B D       Crab-eating macaque  a---ggagagggccatggaa--caga-ttctcccgg
B D                    Baboon  a---ggagagggccatggaa--caga-ttctcccgg
B D              Green monkey  a---ggagagggccatggaa--caga-ttctcccgg
B D                  Marmoset  a---ggagagggccacggaa--caga-ttctccctg
B D           Squirrel monkey  a---ggagagggccacagag--caga-ttctccctg
B D                  Bushbaby  a---ggagatagcc-tggga--caga-ttcaccctc
           Chinese tree shrew  t---ggagagaggcctggaa-----a-atccctctc
B D                       Pig  a---agagaagggcatgaga--caga-acctacctc
B D                    Alpaca  a---agagagcaccgaggga--cgg-----------
               Bactrian camel  a---agagagcaccgaggga--cag-----------
B D                   Dolphin  a---agggaaggatatggga--caga-gactccctc
                 Killer whale  a---agagaaggatatggga--caga-gactccctc
             Tibetan antelope  a---agatgaggacatagga--taga-gtctccctc
B D                       Cow  g---agatgaggacatagga--t--a-gtctccctc
B D                     Sheep  a---agatgaggacatagga--taga-gtctccctc
                Domestic goat  a---agatgaggacatagga--taga-gtctccctc
B D                     Horse  aggaggggaaaggcagggga--caag-gcctccctg
B D          White rhinoceros  aggaggagagatgtatggga--cagg-ttcttcctc
B D                       Cat  a---ggagaaagccatgtgg--cagg-ttctccttc
B D                       Dog  a------gagaggtatgtga--cagg-ttct-catc
B D                     Panda  a----gagaaaggcgtggga--cagg-ttctccatc
               Pacific walrus  a---ggagaaaggcatgtga--cagg-ttctccatc
                 Weddell seal  a---ggagaaaggcatgtga--cagg-ttctccatc
             Black flying-fox  a---ggggagaggcatggga--cagg-ttctccctc
B D                   Megabat  a---ggggagacgcatggga--cagg-ttctccctc
                Big brown bat  -----gggagaggcctggga--cagc-ttctccc--
         David's myotis (bat)  -----ggaagaggcctggga--cagg-ttctccg--
B D                  Microbat  -----gggagaggcctggga--cagg-ttctccc--
B D                     Shrew  ---agagtaaagacgtggac--cagg-ccctccctt
              Star-nosed mole  ---aggagggaaatagagg---cagg-ttctctctc
              Golden hamster  ====================================
B D                  Hedgehog  ====================================
B D                       Rat  ====================================
B D                     Mouse  ====================================
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
  D                    Parrot  ====================================
B D                Budgerigar  ====================================
  D               Rock pigeon  ====================================
  D              Mallard duck  ====================================
  D  Chinese softshell turtle  ====================================
B D                   Chicken  ====================================
B D       Medium ground finch  ====================================
B D                    Turkey  ====================================
  D            Painted turtle  ====================================
B D               Zebra finch  ====================================
  D       Collared flycatcher  ====================================
B D        American alligator  ====================================
          Tibetan ground jay  ====================================
  D             Scarlet macaw  ====================================
  D    White-throated sparrow  ====================================
B D                Guinea pig  ====================================
            Brush-tailed rat  ====================================
B D            Naked mole-rat  ====================================
                  Chinchilla  ====================================
B D                  Squirrel  ====================================
                Prairie vole  ====================================
B D           Chinese hamster  ====================================
B D                   Wallaby  ====================================
B D           Tasmanian devil  ====================================
B D                  Platypus  ====================================
  D           Green seaturtle  ====================================
B D                    Rabbit  ====================================
B D                      Pika  ====================================
B D                   Ferret   ====================================
      Lesser Egyptian jerboa  ====================================
B D                    Tenrec  ====================================
B D                 Armadillo  ====================================
                    Aardvark  ------------------------------------
B D                  Elephant  ====================================
B D                   Manatee  ------------------------------------
            Cape golden mole  ====================================

Alignment block 17 of 710 in window, 88354381 - 88354388, 8 bps 
B D                     Human  ggagccct
B D                     Chimp  ggagccct
B D                   Gorilla  ggagccct
B D                 Orangutan  ggagccct
B D                    Gibbon  ggagccct
B D                    Rhesus  ggagccct
B D       Crab-eating macaque  ggagccct
B D                    Baboon  ggagccct
B D              Green monkey  ggagccct
B D                  Marmoset  ggagcctt
B D           Squirrel monkey  ggagccct
B D                  Bushbaby  aga-----
           Chinese tree shrew  agagtcct
B D                  Squirrel  ggagccct
B D                       Pig  agagactt
B D                   Dolphin  a-gaccct
                 Killer whale  a-gaccct
             Tibetan antelope  attgctct
B D                       Cow  attgctct
B D                     Sheep  attgctct
                Domestic goat  attgctct
B D                     Horse  agagccct
B D          White rhinoceros  agagccct
B D                       Cat  agagtcct
B D                       Dog  agagccct
B D                     Panda  agagcccc
               Pacific walrus  agagccct
                 Weddell seal  agagccct
             Black flying-fox  cgagttgt
B D                   Megabat  agagttgt
                Big brown bat  -------t
         David's myotis (bat)  -------t
B D                  Microbat  -------t
B D                     Shrew  agagcctt
              Star-nosed mole  a-agccct
              Golden hamster  ========
B D                  Hedgehog  ========
B D                       Rat  ========
B D                     Mouse  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
B D                Budgerigar  ========
  D               Rock pigeon  ========
  D              Mallard duck  ========
  D  Chinese softshell turtle  ========
B D                   Chicken  ========
B D       Medium ground finch  ========
B D                    Turkey  ========
  D            Painted turtle  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========
B D        American alligator  ========
          Tibetan ground jay  ========
  D             Scarlet macaw  ========
  D    White-throated sparrow  ========
B D                Guinea pig  ========
            Brush-tailed rat  ========
B D            Naked mole-rat  ========
                  Chinchilla  ========
                Prairie vole  ========
B D           Chinese hamster  ========
B D                   Wallaby  ========
B D           Tasmanian devil  ========
B D                  Platypus  ========
  D           Green seaturtle  ========
B D                    Rabbit  ========
B D                      Pika  ========
B D                   Ferret   ========
              Bactrian camel  --------
B D                    Alpaca  --------
      Lesser Egyptian jerboa  ========
B D                    Tenrec  ========
B D                 Armadillo  ========
                    Aardvark  --------
B D                  Elephant  ========
B D                   Manatee  --------
            Cape golden mole  ========

Alignment block 18 of 710 in window, 88354389 - 88354440, 52 bps 
B D                     Human  ccgaaggagccaaccctgcc----aac-ac-cttgattctggactttgaacctcc-aa------a
B D                     Chimp  ctgaaggagccaaccctgcc----aac-ac-cttgattctggacttcgaacctcc-aa------a
B D                   Gorilla  ctgaaggagccaaccctgcc----aac-ac-cttgattctggacttcgaacctcc-aa------a
B D                 Orangutan  ccgaaggaaccaaccctgcc----aac-ac-cttgattctggacttcaaacctcc-aa------a
B D                    Gibbon  acaaaggaaccaaccctgct----aac-ac-cttgattctggacttcaaacctccaaa------a
B D                    Rhesus  ccgaaggaaccaaccctgcc----aac-ac-ctggattctggacttctaacctcc-aa------a
B D       Crab-eating macaque  ccgaaggaaccaaccctgcc----aac-ac-ctggattctggacttctaacctcc-aa------a
B D                    Baboon  ccgaaggaaccaaccctgtc----aac-ac-ctggattctggacttctaacctcc-aa------a
B D              Green monkey  ccgaaggaaccaaccctgcc----aac-ac-ctggattctggacttctaacctcc-aa------a
B D                  Marmoset  ccaaaggcaccaaccctgcc----agc-ac-cttgattctggacttctaacctcc-ag------a
B D           Squirrel monkey  ccaaaggcaccaacccggcc----agc-ac-cttgattctggacttctaacctcc-ag------a
B D                  Bushbaby  --------accaactctact----gac-ac-cttgactctggacttctaacctcc-ag------a
           Chinese tree shrew  c-agagaagccaactctgcc----aac-ac-agtgactctggacttccgacctcc-ag------a
B D                  Squirrel  cagtagga--caactctgcc----agc-ac-ct-gaccttggacagcccagctcc-ag------a
B D                       Pig  cagaaagaacgaaccctgcc----aac-aa-cttgattttggacttataacctcc-agacttgta
B D                    Alpaca  --ggaggaacccgccctgcc----aac-aa-cctgactggggccttgtaacctcc-aggcttgtg
               Bactrian camel  --ggaggaacccaccctgcc----aac-aa-cctgactggggccttgtaacctcc-aggcttgtg
B D                   Dolphin  ccgaaagaac----cctgcc----aac-aa-cttaattctgaacttgtaaccccc-ggacttgta
                 Killer whale  ccgaaagaac----cctgcc----aac-aa-cttaattctgaacttgtaaccccc-ggacttgta
             Tibetan antelope  caggaagaaccaaacctgcc----aac-aa-ctttatttgcaactcaaacccccc-agacatgta
B D                       Cow  caggaagaaccaaacctgcc----agc-aa-ctttatttcggactcaaaccccct-agacttgta
B D                     Sheep  caggaagaaccaaacctgcc----aac-aa-ctttatttgcgactcaaacccctc-agacttgta
                Domestic goat  caggaagaaccaaacctgcc----atc-aa-ctttatttgctactcaaacccccc-agacttgta
B D                     Horse  cagagggagccaaccctgcc----aacag--cttggttttggacttctaacctcc-ag------a
B D          White rhinoceros  cagaaggagccaaccctgcc----aatag--cttgattttggacttccaacctcc-ag------a
B D                       Cat  -cgaaggaaccagccctgtc----atccatccttgatgtgggacttctgacctcc-ag------a
B D                       Dog  tcaaaggaatcgaccctgcc----aaccat-ctagatgttggacttcccacctcc-ag------a
B D                   Ferret   ccgaaggaaccaaccctgct----aaccat-ctagatgttggacttcttacctcc-ag------a
B D                     Panda  tcgaaggaaccaaccctgct----caccat-ctagatgttggacttctcacctct-gg------a
               Pacific walrus  ccaaaggaaccaaccctgcc----aaccgt-ctagatgttggacttctcacctcc-ag------a
                 Weddell seal  ccaaaggaaccaaccctgcc----aacagt-ctagatgttggacttctcacctcc-ag------a
             Black flying-fox  cagagagaactaaccttgcc----aat-gt-cttaatcgtggacttctaa---cc-ag------a
B D                   Megabat  cagagagaactaaccttgcc----aac-gt-cttaatcgtggacttctaa---cc-ag------a
                Big brown bat  cagagagaaccaaccctgcc----aat-at-ctcagctgtggattcctaacctcc-ag------a
         David's myotis (bat)  cagaaagaaccaaccctgccaataaat-at-tgcagctgtggattcctaacctcc-gg------a
B D                  Microbat  cagaaagaaccaaccctgccaataaat-at-ttcagctgtggattcctaacctcc-gg------a
B D                     Shrew  cagaaggaagcaacgctacc----agc-ac-cttgacttagaactcctaacttcc-ag------a
              Star-nosed mole  tagga------caccctgct----ggc-tc-cttgactt-ggacttctgactccc-ag------a
              Golden hamster  =================================================================
B D                  Hedgehog  =================================================================
B D                       Rat  =================================================================
B D                     Mouse  =================================================================
  D          Peregrine falcon  =================================================================
  D              Saker falcon  =================================================================
  D                    Parrot  =================================================================
B D                Budgerigar  =================================================================
  D               Rock pigeon  =================================================================
  D              Mallard duck  =================================================================
  D  Chinese softshell turtle  =================================================================
B D                   Chicken  =================================================================
B D       Medium ground finch  =================================================================
B D                    Turkey  =================================================================
  D            Painted turtle  =================================================================
B D               Zebra finch  =================================================================
  D       Collared flycatcher  =================================================================
B D        American alligator  =================================================================
          Tibetan ground jay  =================================================================
  D             Scarlet macaw  =================================================================
  D    White-throated sparrow  =================================================================
B D                Guinea pig  =================================================================
            Brush-tailed rat  =================================================================
B D            Naked mole-rat  =================================================================
                  Chinchilla  =================================================================
                Prairie vole  =================================================================
B D           Chinese hamster  =================================================================
B D                   Wallaby  =================================================================
B D           Tasmanian devil  =================================================================
B D                  Platypus  =================================================================
  D           Green seaturtle  =================================================================
B D                    Rabbit  =================================================================
B D                      Pika  =================================================================
      Lesser Egyptian jerboa  =================================================================
B D                    Tenrec  =================================================================
B D                 Armadillo  =================================================================
                    Aardvark  -----------------------------------------------------------------
B D                  Elephant  =================================================================
B D                   Manatee  -----------------------------------------------------------------
            Cape golden mole  =================================================================

Alignment block 19 of 710 in window, 88354441 - 88354453, 13 bps 
B D                     Human  actgtgtgagaag
B D                     Chimp  actgtgtgagaag
B D                   Gorilla  actgtgtgagaag
B D                 Orangutan  actgtgtgagaag
B D                    Gibbon  actgtgtgagaag
B D                    Rhesus  actgggtgagatg
B D       Crab-eating macaque  actgggtgagatg
B D                    Baboon  actgggtgagacg
B D              Green monkey  actgagtgagaag
B D                  Marmoset  gctgtgtgaggag
B D           Squirrel monkey  gctgtgtgagaag
B D                  Bushbaby  attatgtgagaag
           Chinese tree shrew  actgtacgagaag
B D                  Squirrel  gctgggtgagaag
B D                       Rat  actgtgctaaaa-
B D                       Pig  actacgtgagaag
B D                    Alpaca  actgtgtgagaag
               Bactrian camel  actgtgtgagaag
B D                   Dolphin  actgtgtgggaag
                 Killer whale  actgtgtgggaag
             Tibetan antelope  agtatgtgagaag
B D                       Cow  agtatgtgagaag
B D                     Sheep  agtatgtgagaag
                Domestic goat  agtatgtgagaag
B D                     Horse  actgtgggagagg
B D          White rhinoceros  actgtgtgagaag
B D                       Cat  actgtatgagaag
B D                       Dog  actctttgagaag
B D                   Ferret   actgtatgagaag
B D                     Panda  actgtgtgagaag
               Pacific walrus  actgtgtgagaag
                 Weddell seal  actgtgtgagaag
             Black flying-fox  actgtgtgagaag
B D                   Megabat  actgtgtgagaag
                Big brown bat  aggacatgagaac
         David's myotis (bat)  acgacgtgagaac
B D                  Microbat  acgacgtgagaac
B D                     Shrew  acagttcaagaag
              Star-nosed mole  actatgtgggaag
              Golden hamster  =============
B D                  Hedgehog  =============
B D                     Mouse  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D                    Parrot  =============
B D                Budgerigar  =============
  D               Rock pigeon  =============
  D              Mallard duck  =============
  D  Chinese softshell turtle  =============
B D                   Chicken  =============
B D       Medium ground finch  =============
B D                    Turkey  =============
  D            Painted turtle  =============
B D               Zebra finch  =============
  D       Collared flycatcher  =============
B D        American alligator  =============
          Tibetan ground jay  =============
  D             Scarlet macaw  =============
  D    White-throated sparrow  =============
B D                Guinea pig  =============
            Brush-tailed rat  =============
B D            Naked mole-rat  =============
                  Chinchilla  =============
                Prairie vole  =============
B D           Chinese hamster  =============
B D                   Wallaby  =============
B D           Tasmanian devil  =============
B D                  Platypus  =============
  D           Green seaturtle  =============
B D                    Rabbit  =============
B D                      Pika  =============
      Lesser Egyptian jerboa  =============
B D                    Tenrec  =============
B D                 Armadillo  =============
                    Aardvark  -------------
B D                  Elephant  =============
B D                   Manatee  -------------
            Cape golden mole  =============

Alignment block 20 of 710 in window, 88354454 - 88354458, 5 bps 
B D                     Human  aactt
B D                     Chimp  aactt
B D                   Gorilla  aactt
B D                 Orangutan  aactt
B D                    Gibbon  aactt
B D                    Rhesus  aactt
B D       Crab-eating macaque  aactt
B D                    Baboon  aactt
B D              Green monkey  aactt
B D                  Marmoset  aa-tt
B D           Squirrel monkey  ag-tt
B D                  Bushbaby  aaatt
           Chinese tree shrew  agatt
B D                  Squirrel  cagct
B D                     Mouse  aaatt
B D                       Rat  ---tt
B D                       Pig  acatt
B D                    Alpaca  acgtt
               Bactrian camel  acgtt
B D                   Dolphin  acatt
                 Killer whale  acatt
             Tibetan antelope  acatt
B D                       Cow  acatt
B D                     Sheep  acatt
                Domestic goat  atatt
B D                     Horse  acact
B D          White rhinoceros  acctt
B D                       Cat  acatt
B D                       Dog  acatt
B D                   Ferret   acaat
B D                     Panda  acatt
               Pacific walrus  ccatt
                 Weddell seal  acatt
             Black flying-fox  acatt
B D                   Megabat  acatt
                Big brown bat  acggt
         David's myotis (bat)  acagt
B D                  Microbat  acagt
B D                     Shrew  acatt
              Star-nosed mole  ccatt
              Golden hamster  =====
B D                  Hedgehog  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
B D                Budgerigar  =====
  D               Rock pigeon  =====
  D              Mallard duck  =====
  D  Chinese softshell turtle  =====
B D                   Chicken  =====
B D       Medium ground finch  =====
B D                    Turkey  =====
  D            Painted turtle  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====
B D        American alligator  =====
          Tibetan ground jay  =====
  D             Scarlet macaw  =====
  D    White-throated sparrow  =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
                Prairie vole  =====
B D           Chinese hamster  =====
B D                   Wallaby  =====
B D           Tasmanian devil  =====
B D                  Platypus  =====
  D           Green seaturtle  =====
B D                    Rabbit  =====
B D                      Pika  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
B D                 Armadillo  =====
                    Aardvark  -----
B D                  Elephant  =====
B D                   Manatee  -----
            Cape golden mole  =====

Alignment block 21 of 710 in window, 88354459 - 88354505, 47 bps 
B D                     Human  tctc-ct--gttttaagtcctccaatttgtggtac--tttgctgcagcaacc
B D                     Chimp  tctc-ct--gttttaagtcctccaatttgtggtac--tttgctgcagcaacc
B D                   Gorilla  tctc-ct--gtttgaagtcctccaatctgtggtac--tttgctgcagcaacc
B D                 Orangutan  tctc-ct--gttttaagtcctccagtttgtggtac--tttgctgcaacaacc
B D                    Gibbon  tctc-tt--gttttaagtcctccagtttgtggcac-ttttgctgcagcaacc
B D                    Rhesus  tctc-ct--gttttaagtcctccggtttgtggtac--tttgctgtggcaacc
B D       Crab-eating macaque  tctc-ct--gttttaagtcctccggtttgtggtac--tttgctgtggcaacc
B D                    Baboon  tctc-ct--gttttaagtcctccggtttgtggtac--tttgctgtggcaa-c
B D              Green monkey  tctc-ct--gttttaagtcctctggtttgtggtac--tttgctgtggcaacc
B D                  Marmoset  tctc-ct--cttttaaatcttctagtttgtggtatattttgctgaggcaatt
B D           Squirrel monkey  tctt-ct--cttttaaa---tctagtttgtggtgtattttgctgaggcaatt
B D                  Bushbaby  tctc-ct--gttttaagcctcctagt-tgtaacac--tttgttatagtagcc
           Chinese tree shrew  tctc-cttcatttaaagccactcagtttgt-gcgt--tttgttatggcagtc
B D                  Squirrel  -----tc--tcttccagccacccagggtggggtgc--actgtcatgtggccc
B D           Chinese hamster  tttc-cc--tttttaagccacttcttttgtggtac---ttgttctgggatca
B D                     Mouse  ttcc-tt--cttttaagccacttaatgggtgatgc--tttattctgggatca
B D                       Rat  cccc-tt--cttttaagccacttagtgagtgatac--tttattctgggatcc
B D                       Pig  tcta-tt--gtttgaaatcagctagtttgtggtac--ttca-----acaacc
B D                    Alpaca  tctg-ct--gctttcagtcacctggctggtggcac--ttcatttcgacagcc
               Bactrian camel  tctg-ct--gctttcagtcacctggtgggtggtac--ttcatttcgacagcc
B D                   Dolphin  tccg-tt--gtttgaagtcacccagtttgtggtac--ttcatttagacaacg
                 Killer whale  tccg-tt--gtttgaagtcacccagtgtgtggtac--ttcatttagacaacg
             Tibetan antelope  tctg-tt--gtttaatatcacccagtttgtggtac--ttcattttgac----
B D                       Cow  tctg-tt--gttttatatcacccagtttgtggtac--ttcattttgac----
B D                     Sheep  tctg-tt--gtttaatatcacccagtttgtggtac--ttcattttgac----
                Domestic goat  tctg-tt--gtttaatatcacccagtttgtggtac--ttcattttgac----
B D                     Horse  gctg-tt---gtttaagtcacccagtgtgtggcac--tgtgttacggcagcc
B D          White rhinoceros  tctg-tt--cttttaagttgcccagtttgtggtac--tttgttacggcagcc
B D                       Cat  tctg-tt--gttttaagtcacccggtttgtggtac--tttgttacagcagcc
B D                       Dog  tctg-tt--gttttaaggtactgagtttgtggtat--gttgttatggcagcc
B D                   Ferret   tctg-tt--gttttaagtcatccaggctgtgggac--gttgttatagcagcc
B D                     Panda  tcgg-tt--gttttaagtcacccagtttgtggtac--gttgttatggcagcc
               Pacific walrus  tctg-tt--gttttaagtcacccagtttgtgggac--attgttatggcagcc
                 Weddell seal  tctg-tt--gttttaagtcacccagtttgtgggat--gttgttttggcagcc
             Black flying-fox  -ctg-tt--ggtttaaaccacccagttgatggtac---ctgttacagcagcc
B D                   Megabat  -ctg-tt--ggtttaaaccacccagttgatggtac---ctgttacagcagcc
                Big brown bat  -ctg-tt--gttttacgccactcagtctgtggtac------ttacagcagcc
         David's myotis (bat)  -ctgttt--tttttatgccacccagtctgtggtac------ttacagcagcc
B D                  Microbat  -ctg-tt--gttttatgccacccagtctgtggtac------ttacagcagcc
B D                     Shrew  -ctg-ac--att-----tcaagcgttttgtggcaa--gttgttacagcacct
              Star-nosed mole  -ttg-gt--ttt----ggcagccagtttgtggtac--tttgttaaggaatcc
              Golden hamster  ====================================================
B D                  Hedgehog  ====================================================
  D          Peregrine falcon  ====================================================
  D              Saker falcon  ====================================================
  D                    Parrot  ====================================================
B D                Budgerigar  ====================================================
  D               Rock pigeon  ====================================================
  D              Mallard duck  ====================================================
  D  Chinese softshell turtle  ====================================================
B D                   Chicken  ====================================================
B D       Medium ground finch  ====================================================
B D                    Turkey  ====================================================
  D            Painted turtle  ====================================================
B D               Zebra finch  ====================================================
  D       Collared flycatcher  ====================================================
B D        American alligator  ====================================================
          Tibetan ground jay  ====================================================
  D             Scarlet macaw  ====================================================
  D    White-throated sparrow  ====================================================
B D                Guinea pig  ====================================================
            Brush-tailed rat  ====================================================
B D            Naked mole-rat  ====================================================
                  Chinchilla  ====================================================
                Prairie vole  ====================================================
B D                   Wallaby  ====================================================
B D           Tasmanian devil  ====================================================
B D                  Platypus  ====================================================
  D           Green seaturtle  ====================================================
B D                    Rabbit  ====================================================
B D                      Pika  ====================================================
      Lesser Egyptian jerboa  ====================================================
B D                    Tenrec  ====================================================
B D                 Armadillo  ====================================================
                    Aardvark  ----------------------------------------------------
B D                  Elephant  ====================================================
B D                   Manatee  ----------------------------------------------------
            Cape golden mole  ====================================================

Alignment block 22 of 710 in window, 88354506 - 88354512, 7 bps 
B D                     Human  c-tgggaa
B D                     Chimp  c-tgggaa
B D                   Gorilla  c-tgggaa
B D                 Orangutan  c-tgggaa
B D                    Gibbon  cttgggaa
B D                    Rhesus  c-tgggaa
B D       Crab-eating macaque  c-tgggaa
B D                    Baboon  c-tgggaa
B D              Green monkey  c-tgggaa
B D                  Marmoset  c-tgggaa
B D           Squirrel monkey  t-tgggaa
B D                  Bushbaby  c-taggaa
           Chinese tree shrew  c-cagaaa
B D                  Squirrel  t-ta--ca
B D           Chinese hamster  g-taggca
B D                     Mouse  a-taggaa
B D                       Rat  a-taggaa
B D                       Pig  c-taggaa
B D                    Alpaca  c-tgggaa
               Bactrian camel  c-tgggaa
B D                   Dolphin  c-taggaa
                 Killer whale  c-taggaa
             Tibetan antelope  ---aggct
B D                       Cow  ---aggct
B D                     Sheep  ---aggct
                Domestic goat  ---aggct
B D                     Horse  c-taggaa
B D          White rhinoceros  a-taggaa
B D                       Cat  c-tagaga
B D                       Dog  c-tagg--
B D                   Ferret   c-taggaa
B D                     Panda  c-tagg--
               Pacific walrus  c-tagg--
                 Weddell seal  c-taggaa
             Black flying-fox  g-tgggaa
B D                   Megabat  g-tgggaa
                Big brown bat  t-taggaa
         David's myotis (bat)  t-taggaa
B D                  Microbat  t-taggaa
B D                  Hedgehog  c-taataa
B D                     Shrew  c-taagaa
              Star-nosed mole  t-taagaa
              Golden hamster  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
  D                    Parrot  ========
B D                Budgerigar  ========
  D               Rock pigeon  ========
  D              Mallard duck  ========
  D  Chinese softshell turtle  ========
B D                   Chicken  ========
B D       Medium ground finch  ========
B D                    Turkey  ========
  D            Painted turtle  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========
B D        American alligator  ========
          Tibetan ground jay  ========
  D             Scarlet macaw  ========
  D    White-throated sparrow  ========
B D                Guinea pig  ========
            Brush-tailed rat  ========
B D            Naked mole-rat  ========
                  Chinchilla  ========
                Prairie vole  ========
B D                   Wallaby  ========
B D           Tasmanian devil  ========
B D                  Platypus  ========
  D           Green seaturtle  ========
B D                    Rabbit  ========
B D                      Pika  ========
      Lesser Egyptian jerboa  ========
B D                    Tenrec  ========
B D                 Armadillo  ========
                    Aardvark  --------
B D                  Elephant  ========
B D                   Manatee  --------
            Cape golden mole  ========

Alignment block 23 of 710 in window, 88354513 - 88354517, 5 bps 
B D                     Human  accaa
B D                     Chimp  accaa
B D                   Gorilla  accaa
B D                 Orangutan  accaa
B D                    Gibbon  accaa
B D                    Rhesus  accaa
B D       Crab-eating macaque  accaa
B D                    Baboon  accaa
B D              Green monkey  accaa
B D                  Marmoset  accaa
B D           Squirrel monkey  accaa
B D                  Bushbaby  accaa
           Chinese tree shrew  actaa
B D                  Squirrel  c----
B D           Chinese hamster  a----
B D                     Mouse  a----
B D                       Rat  a----
B D                       Pig  actaa
B D                    Alpaca  accaa
               Bactrian camel  accaa
B D                   Dolphin  actaa
                 Killer whale  actaa
             Tibetan antelope  actaa
B D                       Cow  actaa
B D                     Sheep  actaa
                Domestic goat  actaa
B D                     Horse  atgaa
B D          White rhinoceros  actaa
B D                       Cat  actaa
B D                       Dog  --aaa
B D                   Ferret   acaaa
B D                     Panda  --aaa
               Pacific walrus  --aaa
                 Weddell seal  acaaa
             Black flying-fox  actaa
B D                   Megabat  actaa
                Big brown bat  attaa
         David's myotis (bat)  attaa
B D                  Microbat  attaa
B D                  Hedgehog  attaa
B D                     Shrew  acaaa
              Star-nosed mole  atgaa
B D                 Armadillo  acaga
              Golden hamster  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D                    Parrot  =====
B D                Budgerigar  =====
  D               Rock pigeon  =====
  D              Mallard duck  =====
  D  Chinese softshell turtle  =====
B D                   Chicken  =====
B D       Medium ground finch  =====
B D                    Turkey  =====
  D            Painted turtle  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====
B D        American alligator  =====
          Tibetan ground jay  =====
  D             Scarlet macaw  =====
  D    White-throated sparrow  =====
B D                Guinea pig  =====
            Brush-tailed rat  =====
B D            Naked mole-rat  =====
                  Chinchilla  =====
                Prairie vole  =====
B D                   Wallaby  =====
B D           Tasmanian devil  =====
B D                  Platypus  =====
  D           Green seaturtle  =====
B D                    Rabbit  =====
B D                      Pika  =====
      Lesser Egyptian jerboa  =====
B D                    Tenrec  =====
                    Aardvark  -----
B D                  Elephant  =====
B D                   Manatee  -----
            Cape golden mole  =====

Inserts between block 23 and 24 in window
B D                      Pig 135bp

Alignment block 24 of 710 in window, 88354518 - 88354518, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                       Pig  c
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  c
                 Killer whale  c
             Tibetan antelope  c
B D                       Cow  c
B D                     Sheep  c
                Domestic goat  c
B D                     Horse  c
B D          White rhinoceros  c
B D                       Cat  c
B D                       Dog  c
B D                   Ferret   c
B D                     Panda  c
               Pacific walrus  c
                 Weddell seal  c
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  c
         David's myotis (bat)  c
B D                  Microbat  c
B D                  Hedgehog  t
B D                     Shrew  c
              Star-nosed mole  c
B D                 Armadillo  t
              Golden hamster  =
B D                       Rat  -
B D                     Mouse  -
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D              Mallard duck  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
  D            Painted turtle  =
B D               Zebra finch  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
  D             Scarlet macaw  =
  D    White-throated sparrow  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  -
                Prairie vole  =
B D           Chinese hamster  -
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                  Platypus  =
  D           Green seaturtle  =
B D                    Rabbit  =
B D                      Pika  =
      Lesser Egyptian jerboa  =
B D                    Tenrec  =
                    Aardvark  -
B D                  Elephant  =
B D                   Manatee  -
            Cape golden mole  =

Alignment block 25 of 710 in window, 88354519 - 88354520, 2 bps 
B D                     Human  gc
B D                     Chimp  gc
B D                   Gorilla  gc
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                    Rhesus  gc
B D       Crab-eating macaque  gc
B D                    Baboon  gc
B D              Green monkey  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gc
B D                  Bushbaby  ac
           Chinese tree shrew  at
B D                       Pig  gt
B D                    Alpaca  gt
               Bactrian camel  gt
B D                   Dolphin  ac
                 Killer whale  at
             Tibetan antelope  ac
B D                       Cow  at
B D                     Sheep  ac
                Domestic goat  ac
B D                     Horse  ac
B D          White rhinoceros  ac
B D                       Cat  aa
B D                       Dog  aa
B D                   Ferret   aa
B D                     Panda  aa
               Pacific walrus  ag
                 Weddell seal  ag
             Black flying-fox  at
B D                   Megabat  at
                Big brown bat  ac
         David's myotis (bat)  ac
B D                  Microbat  ac
B D                  Hedgehog  ta
B D                     Shrew  ac
              Star-nosed mole  ac
B D                    Tenrec  gc
              Golden hamster  ==
B D                       Rat  --
B D                     Mouse  --
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
  D              Mallard duck  ==
  D  Chinese softshell turtle  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                    Turkey  ==
  D            Painted turtle  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
B D        American alligator  ==
          Tibetan ground jay  ==
  D             Scarlet macaw  ==
  D    White-throated sparrow  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                  Squirrel  --
                Prairie vole  ==
B D           Chinese hamster  --
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D                  Platypus  ==
  D           Green seaturtle  ==
B D                    Rabbit  ==
B D                      Pika  ==
      Lesser Egyptian jerboa  ==
B D                 Armadillo  --
                    Aardvark  --
B D                  Elephant  ==
B D                   Manatee  --
            Cape golden mole  ==

Alignment block 26 of 710 in window, 88354521 - 88354523, 3 bps 
B D                     Human  att
B D                     Chimp  att
B D                   Gorilla  att
B D                 Orangutan  att
B D                    Gibbon  att
B D                    Rhesus  att
B D       Crab-eating macaque  att
B D                    Baboon  att
B D              Green monkey  att
B D                  Marmoset  att
B D           Squirrel monkey  att
B D                  Bushbaby  aat
           Chinese tree shrew  aca
B D                    Rabbit  ata
B D                       Pig  gct
B D                    Alpaca  acc
               Bactrian camel  acc
B D                   Dolphin  act
                 Killer whale  act
             Tibetan antelope  ggt
B D                       Cow  ggt
B D                     Sheep  ggt
                Domestic goat  ggt
B D                     Horse  acc
B D          White rhinoceros  acc
B D                       Cat  act
B D                       Dog  act
B D                   Ferret   act
B D                     Panda  act
               Pacific walrus  act
                 Weddell seal  act
             Black flying-fox  atc
B D                   Megabat  acc
                Big brown bat  acc
         David's myotis (bat)  acc
B D                  Microbat  acc
B D                  Hedgehog  att
B D                     Shrew  atc
              Star-nosed mole  acc
B D                    Tenrec  acc
B D                 Armadillo  att
              Golden hamster  ===
B D                       Rat  ---
B D                     Mouse  ---
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
B D                Budgerigar  ===
  D               Rock pigeon  ===
  D              Mallard duck  ===
  D  Chinese softshell turtle  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
  D             Scarlet macaw  ===
  D    White-throated sparrow  ===
B D                Guinea pig  ===
            Brush-tailed rat  ===
B D            Naked mole-rat  ===
                  Chinchilla  ===
B D                  Squirrel  ---
                Prairie vole  ===
B D           Chinese hamster  ---
B D                   Wallaby  ===
B D           Tasmanian devil  ===
B D                  Platypus  ===
  D           Green seaturtle  ===
B D                      Pika  ===
      Lesser Egyptian jerboa  ===
                    Aardvark  ---
B D                  Elephant  ===
B D                   Manatee  ---
            Cape golden mole  ===

Inserts between block 26 and 27 in window
B D                Armadillo 2bp

Alignment block 27 of 710 in window, 88354524 - 88354529, 6 bps 
B D                     Human  ct--------------------------------------------ct-a---a
B D                     Chimp  ct--------------------------------------------ct-a---a
B D                   Gorilla  ct--------------------------------------------ct-a---a
B D                 Orangutan  ct--------------------------------------------ctaa---a
B D                    Gibbon  ct--------------------------------------------ct-a---a
B D                    Rhesus  ct--------------------------------------------ct-a---a
B D       Crab-eating macaque  ct--------------------------------------------ct-a---a
B D                    Baboon  ct--------------------------------------------ct-a---a
B D              Green monkey  ct--------------------------------------------ct-a---a
B D                  Marmoset  ct--------------------------------------------ct-a---a
B D           Squirrel monkey  ct--------------------------------------------ct-a---a
B D                  Bushbaby  ct--------------------------------------------ct-a---a
           Chinese tree shrew  cc--------------------------------------------tt-g---a
B D                  Squirrel  cc--------------------------------------------tt-t---g
B D           Chinese hamster  ct--------------------------------------------ct-a---a
B D                     Mouse  tt--------------------------------------------ct-a---a
B D                       Rat  ct--------------------------------------------ct-a---a
B D                    Rabbit  ct--------------------------------------------ct-a---a
B D                       Pig  gtaggcgcaaccaaaaaaaaaaaattaatgtaattaaattaaataaat-a---g
B D                    Alpaca  gt--------------------------------------------ct-t---c
               Bactrian camel  gt--------------------------------------------ct-t---c
B D                   Dolphin  tt--------------------------------------------ct-a---a
                 Killer whale  tt--------------------------------------------ct-a---a
             Tibetan antelope  gt--------------------------------------------ct-a---a
B D                       Cow  gt--------------------------------------------ct-a---a
B D                     Sheep  gt--------------------------------------------ct-a---a
                Domestic goat  gt--------------------------------------------ct-a---a
B D                     Horse  ct--------------------------------------------ct------
B D          White rhinoceros  ct--------------------------------------------ct-a---a
B D                       Cat  ct-----------------------------------------------a---a
B D                       Dog  ct--------------------------------------------ct-a---a
B D                   Ferret   ct--------------------------------------------cc-a---a
B D                     Panda  ct--------------------------------------------ct-a---a
               Pacific walrus  ct--------------------------------------------ct-a---a
                 Weddell seal  ct--------------------------------------------ct-a---a
             Black flying-fox  ct--------------------------------------------ct-a---a
B D                   Megabat  ct--------------------------------------------ct-a---a
                Big brown bat  cg--------------------------------------------cc-----a
         David's myotis (bat)  cg--------------------------------------------ct-----a
B D                  Microbat  cg--------------------------------------------ct-----a
B D                  Hedgehog  aa--------------------------------------------ct-aatta
B D                     Shrew  tt--------------------------------------------ct-a---a
              Star-nosed mole  ct--------------------------------------------ct-a---c
B D                  Elephant  ct--------------------------------------------ct-a---g
B D                   Manatee  ct--------------------------------------------ct-a---a
B D                    Tenrec  tt--------------------------------------------ct-a---a
                     Aardvark  ct--------------------------------------------ct-a---a
B D                 Armadillo  gt--------------------------------------------ct-t---a
              Golden hamster  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
  D                    Parrot  ======================================================
B D                Budgerigar  ======================================================
  D               Rock pigeon  ======================================================
  D              Mallard duck  ======================================================
  D  Chinese softshell turtle  ======================================================
B D                   Chicken  ======================================================
B D       Medium ground finch  ======================================================
B D                    Turkey  ======================================================
  D            Painted turtle  ======================================================
B D               Zebra finch  ======================================================
  D       Collared flycatcher  ======================================================
B D        American alligator  ======================================================
          Tibetan ground jay  ======================================================
  D             Scarlet macaw  ======================================================
  D    White-throated sparrow  ======================================================
B D                Guinea pig  ======================================================
            Brush-tailed rat  ======================================================
B D            Naked mole-rat  ======================================================
                  Chinchilla  ======================================================
                Prairie vole  ======================================================
B D                   Wallaby  ======================================================
B D           Tasmanian devil  ======================================================
B D                  Platypus  ======================================================
  D           Green seaturtle  ======================================================
B D                      Pika  ======================================================
      Lesser Egyptian jerboa  ======================================================
            Cape golden mole  ======================================================

Alignment block 28 of 710 in window, 88354530 - 88354564, 35 bps 
B D                     Human  a--aaaaga---gaaat----acag----ttcatgcattattt-gagtg
B D                     Chimp  a--aaaaga---gaaat----acag----ttcatgcattattt-gagtg
B D                   Gorilla  a--aaaaga---gaaat----acag----ttcatgcattattt-gagtg
B D                 Orangutan  a--aaaaga---gaaat----acag----atcatgcattattt-gagtg
B D                    Gibbon  aacaagaga---gaaat----acag----atcatgcattattt-gagtg
B D                    Rhesus  a-caaaaga---gaaat----acgg----ttcatgcattattt-gagtg
B D       Crab-eating macaque  a-caaaaga---gaaat----acgg----ttcatgcattattt-gagtg
B D                    Baboon  a-caaaaaa---gaaat----acgg----ttcatgcattatta-gagtg
B D              Green monkey  a-caaaaga---gaaat----acgg----ttcgtgcattattt-gagtg
B D                  Marmoset  c-aaaagga---gaaat----atgg----ttcatgcattattt-gagtg
B D           Squirrel monkey  c-gaaaaga---gaaat----acgg----ttcatgcattattt-gagtg
B D                  Bushbaby  a--agggga---gagat----actg----ttcagccattattt-gaagg
           Chinese tree shrew  a--aggagg---gaaat-------g----ttctgacattattt-gagtg
B D                  Squirrel  g--aaaggg---ggact----gttg----ttcaggcatcattg-ccatg
B D           Chinese hamster  a--ga-gga---gaaat----cctg----gtcaggcattattt-gagta
B D                     Mouse  a--gaggga---gaaat----cctg----gccaggcattattt-gaata
B D                       Rat  a--gaggga---gaaatagtgcctg----gccaggcactattt-gaata
B D                    Rabbit  a--agggga---aaaat----gata----ttctggcattattt-gggtg
B D                       Pig  a--aagggt---gaaat----acta----ttcaggcatttttt-gagtg
B D                    Alpaca  a--aaggga---gacat----atta----ttcatgcactattt-gagtg
               Bactrian camel  a--aaggga---gacat----atta----ttcaggcactattt-gagtg
B D                   Dolphin  a--aaggga---gaaat----gtca----ttcagacgtt-----gagtg
                 Killer whale  a--aaggga---gaaat----gtca----ttcaggcgtt-----gagtg
             Tibetan antelope  a--gaggga---gaaat----acta----ttcaggtgttattt-gagtg
B D                       Cow  a--gaggga---gaaat----acta----ttcaggtgttactt-gagtg
B D                     Sheep  a--gaggga---gaaat----acta----ttcaggtgttatttaaagtg
                Domestic goat  a--gaggga---gaaac----acta----ttcaggtgttatttaaagtg
B D                     Horse  a--aaagga---ggcgt----agta----ctcaggttttagtt-gagtg
B D          White rhinoceros  a--aaagaa---gatat----atta----ttcaggtattagcg-gagtg
B D                       Cat  c--aagagt---gaact----atta----ttcagtcatca-ct-gaatg
B D                       Dog  a--aaggga---gaaat----atta----ttcaggcatca-tc-gaata
B D                   Ferret   a--aagaga---gaaat----atta----ttcaggcatca-tc-gaacg
B D                     Panda  a--aaggga---gaaat----atta----ttcgggcatca-tc-gaatg
               Pacific walrus  a--aaggga---gaaat----atta----ttcaggtatca-tg-gaatg
                 Weddell seal  a--aaggga---gaaat----atta----ttcaggcatca-tc-gaatg
             Black flying-fox  a--aagggc---gaaat----attg----ttcaggcattattt-gagtg
B D                   Megabat  a--aagggc---gaaat----attg----ttcaggcattattt-gagtg
                Big brown bat  a--cagcaa---gaaat----attg----ttcaggcattattt-gag--
         David's myotis (bat)  a--gagcaa---gaaat----attg----ttcaggcgttattt-gagtg
B D                  Microbat  a--gagcaa---gaaat----attg----ttcaggcattattt-gagtg
B D                  Hedgehog  a--ttaaaaatggagac----atta----tttaggcatcattt-cagtt
B D                     Shrew  a--caaaaaat-aagac----atg-----tttaggcgttattt-ga---
              Star-nosed mole  a--aaagaa------gc----att-----atcaggcactgttt-gaatg
B D                  Elephant  a--aagggg---gaaat----gttg----ttcaggcattatat-gagtg
B D                   Manatee  a--aaggga---gaaat----gttg----ttcaggcattgtat-gagtg
             Cape golden mole  a--aaggga---gaagt----gttg----tgcaggcattattt-gagtg
B D                    Tenrec  ---aaagag---gaaat----ggcgttcttacattaattatct-gggtg
                     Aardvark  a--gaggga---gaaat----atca----tttaggcattattt-gtgtg
B D                 Armadillo  a--aaaaga---caaat----aatg----tttaggcattattt-tagca
              Golden hamster  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
  D                    Parrot  =================================================
B D                Budgerigar  =================================================
  D               Rock pigeon  =================================================
  D              Mallard duck  =================================================
  D  Chinese softshell turtle  =================================================
B D                   Chicken  =================================================
B D       Medium ground finch  =================================================
B D                    Turkey  =================================================
  D            Painted turtle  =================================================
B D               Zebra finch  =================================================
  D       Collared flycatcher  =================================================
B D        American alligator  =================================================
          Tibetan ground jay  =================================================
  D             Scarlet macaw  =================================================
  D    White-throated sparrow  =================================================
B D                Guinea pig  =================================================
            Brush-tailed rat  =================================================
B D            Naked mole-rat  =================================================
                  Chinchilla  =================================================
                Prairie vole  =================================================
B D                   Wallaby  =================================================
B D           Tasmanian devil  =================================================
B D                  Platypus  =================================================
  D           Green seaturtle  =================================================
B D                      Pika  =================================================
      Lesser Egyptian jerboa  =================================================

Inserts between block 28 and 29 in window
B D          Chinese hamster 1bp

Alignment block 29 of 710 in window, 88354565 - 88354586, 22 bps 
B D                     Human  ag------ttctttt--------aa-----------agtc--t-actaac
B D                     Chimp  ag------ttctttt--------aa-----------agtc--t-actaac
B D                   Gorilla  ag------ttctttt--------aa-----------agtc--t-actaac
B D                 Orangutan  ag------ttctttt--------aa-----------agtc--t-actaac
B D                    Gibbon  ag------ttctttt--------aa-----------agtc--t-actaac
B D                    Rhesus  ag------ttctttt--------aa-----------aatc--t-actcac
B D       Crab-eating macaque  ag------ttctttt--------aa-----------aatc--t-actcac
B D                    Baboon  ag------ttctttt--------aa-----------aatc--t-actcac
B D              Green monkey  ag------ttctttt--------aa-----------aatc--t-actaac
B D                  Marmoset  ag------ttctttt--------aa-----------agtc--t-actaac
B D           Squirrel monkey  ag------ttctttt--------aa-----------agtc--t-actaac
B D                  Bushbaby  ag------ttctttc--------aa-----------agcc--c-actaac
           Chinese tree shrew  ag------gtctttc--------aa-----------agtc--t-ggtaat
B D                  Squirrel  gg------ttctttc--------aa-----------agtc--c-aacagc
                 Prairie vole  -a------gtgctct--------taatgactggaccatct--g-tccagt
B D           Chinese hamster  -a------gtcctcc--------ta-----------agtt--t-accaac
B D                     Mouse  aa------tttctcc--------aa-----------agtt--t-actaac
B D                       Rat  aa------tgtctcc--------aa-----------agtt--t-actaac
B D                    Rabbit  gt------ttttttc--------ca-----------agtc--t-aataac
B D                       Pig  ca------ttcttgc--------aa-----------atc---t-actaac
B D                    Alpaca  ag------ttctcca--------aa-----------agtc--t-gctaac
               Bactrian camel  ag------ttctccc--------aa-----------agtc--t-gctaac
B D                   Dolphin  ag------ttctccc--------aa-----------agtc--t-actaac
                 Killer whale  ag------ttctctc--------aa-----------agtc--t-actaac
             Tibetan antelope  ag------ttcttcc--------aa-----------ggt---t-gctaac
B D                       Cow  ag------ttcttcc--------aa-----------ggt---t-gctaac
B D                     Sheep  ag------ttcttcc--------aa-----------ggt---t-gctaac
                Domestic goat  ag------ttcttcc--------aa-----------ggt---t-gctaac
B D                     Horse  ac------ttttttc--------aa-----------agtc--t-actggc
B D          White rhinoceros  ag------ttctttc--------aa-----------agtc--t-actaac
B D                       Cat  ag------ttgtttc--------aa-----------agtt--t-gctgac
B D                       Dog  ag------ttctttc--------aa-----------agtc--t-gctaac
B D                   Ferret   ag------ttctttc--------aa-----------agtc--t-gctaac
B D                     Panda  ag------ttctttc--------aa-----------agtc--t-gctaac
               Pacific walrus  ag------ttctttc--------ca-----------agtc--g-gctaac
                 Weddell seal  ag------ttctttc--------ca-----------agtc--t-gctaac
             Black flying-fox  ag------ttctttc--------aa-----------tgtc--t-acagac
B D                   Megabat  ag------ttctttc--------aa-----------tgtc--t-acagac
                Big brown bat  ------------------------a-----------agtc--t-actaac
         David's myotis (bat)  ag------ttcttcc--------aa-----------agcc--t-actaac
B D                  Microbat  ag------ttctttc--------aa-----------agtc--t-actaac
B D                  Hedgehog  aa------ttacttc--------aa-----------agtctat-actaaa
B D                     Shrew  ---------ggtttttttcccccaa-----------cccc--t-actagc
              Star-nosed mole  ag------cggttgg--------aa-----------agtc--t-actaac
B D                  Elephant  ag------ttctttc--------aa-----------agtc--tgggtagc
B D                   Manatee  ag------ttctttc--------aa-----------agtc--t-agtaac
             Cape golden mole  ag------ttctttc--------aa-----------agac--t-agcaac
B D                    Tenrec  aggtttctgtttttc--------aa-----------agtc--t-agtaag
                     Aardvark  ag------ttttttc--------aa-----------agtc--ttagagat
B D                 Armadillo  ag------ttctttc--------aa-----------agtc--c--actac
              Golden hamster  ==================================================
  D          Peregrine falcon  ==================================================
  D              Saker falcon  ==================================================
  D                    Parrot  ==================================================
B D                Budgerigar  ==================================================
  D               Rock pigeon  ==================================================
  D              Mallard duck  ==================================================
  D  Chinese softshell turtle  ==================================================
B D                   Chicken  ==================================================
B D       Medium ground finch  ==================================================
B D                    Turkey  ==================================================
  D            Painted turtle  ==================================================
B D               Zebra finch  ==================================================
  D       Collared flycatcher  ==================================================
B D        American alligator  ==================================================
          Tibetan ground jay  ==================================================
  D             Scarlet macaw  ==================================================
  D    White-throated sparrow  ==================================================
B D                Guinea pig  ==================================================
            Brush-tailed rat  ==================================================
B D            Naked mole-rat  ==================================================
                  Chinchilla  ==================================================
B D                   Wallaby  ==================================================
B D           Tasmanian devil  ==================================================
B D                  Platypus  ==================================================
  D           Green seaturtle  ==================================================
B D                      Pika  ==================================================
      Lesser Egyptian jerboa  ==================================================

Inserts between block 29 and 30 in window
B D                 Squirrel 671bp

Alignment block 30 of 710 in window, 88354587 - 88354588, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  ca
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
B D                  Marmoset  ca
B D           Squirrel monkey  ca
B D                  Bushbaby  ca
           Chinese tree shrew  ca
                 Prairie vole  cc
B D           Chinese hamster  ca
B D                     Mouse  ca
B D                       Rat  ca
B D                    Rabbit  ta
B D                       Pig  ca
B D                    Alpaca  ca
               Bactrian camel  ca
B D                   Dolphin  ca
                 Killer whale  ca
             Tibetan antelope  ca
B D                       Cow  ca
B D                     Sheep  ca
                Domestic goat  ca
B D                     Horse  ca
B D          White rhinoceros  ca
B D                       Cat  ca
B D                       Dog  ca
B D                   Ferret   ca
B D                     Panda  ca
               Pacific walrus  ca
                 Weddell seal  ca
             Black flying-fox  ca
B D                   Megabat  ca
                Big brown bat  ta
         David's myotis (bat)  ca
B D                  Microbat  ca
B D                  Hedgehog  tg
B D                     Shrew  ca
              Star-nosed mole  ca
B D                  Elephant  ca
B D                   Manatee  ca
             Cape golden mole  ca
B D                    Tenrec  ca
                     Aardvark  ca
B D                 Armadillo  ta
              Golden hamster  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
  D              Mallard duck  ==
  D  Chinese softshell turtle  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                    Turkey  ==
  D            Painted turtle  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
B D        American alligator  ==
          Tibetan ground jay  ==
  D             Scarlet macaw  ==
  D    White-throated sparrow  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                  Squirrel  ==
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D                  Platypus  ==
  D           Green seaturtle  ==
B D                      Pika  ==
      Lesser Egyptian jerboa  ==

Inserts between block 30 and 31 in window
          Chinese tree shrew 294bp

Alignment block 31 of 710 in window, 88354589 - 88354605, 17 bps 
B D                     Human  ccaagtaaatgatattt
B D                     Chimp  ccaagtaaatgatattt
B D                   Gorilla  ccaagtaaatgatattt
B D                 Orangutan  ccaagtaaatgatattt
B D                    Gibbon  ccaagtaaatgatattt
B D                    Rhesus  ccaagtaaattatattt
B D       Crab-eating macaque  ccaagtaaattatattt
B D                    Baboon  ccaagtaaatgatattt
B D              Green monkey  ccaagtaaatgatattt
B D                  Marmoset  ccaagtaattgatattt
B D           Squirrel monkey  ccaagtaaatgatattt
B D                  Bushbaby  acaaataaatgatattt
           Chinese tree shrew  ccaggtaaatgatttct
                 Prairie vole  ccaaggatatgatattt
B D           Chinese hamster  acatgtatatgattctt
B D                     Mouse  gcatgtatatgatcctt
B D                       Rat  atatgtctatgattctt
B D                    Rabbit  acaggaaagtgattttt
B D                       Pig  aaaagtatatgattttt
B D                    Alpaca  acaagtctatgattttt
               Bactrian camel  acaagtctatgattttt
B D                   Dolphin  acaagtatgtgattttt
                 Killer whale  acaagtatgtgattttt
             Tibetan antelope  acaagtatatgaccttt
B D                       Cow  acaagtatatgaacttt
B D                     Sheep  acaagtatatgaccttt
                Domestic goat  acaagtatatgaccttt
B D                     Horse  acaagtatatgattttt
B D          White rhinoceros  acaagtatatgattttt
B D                       Cat  acaagtctatcattttt
B D                       Dog  acaagtctatcattctt
B D                   Ferret   acaagtctttcattttt
B D                     Panda  acaagtccttcgttttt
               Pacific walrus  acaaggctttcgttttt
                 Weddell seal  acaagtctttcgttttt
             Black flying-fox  gcgaatacatgattttg
B D                   Megabat  gcgaatacatgattttg
                Big brown bat  acaaat--atgattctt
         David's myotis (bat)  acaaat--atgattttt
B D                  Microbat  aggaat--atgattttt
B D                  Hedgehog  acatggatattattttt
B D                     Shrew  acctgtgtataattttt
              Star-nosed mole  gcatgtatatgatttgc
B D                  Elephant  acaagtaactgatcttt
B D                   Manatee  acaagtaaatgattttt
             Cape golden mole  acaagtgaacgattttt
B D                    Tenrec  ccaagtcaatgattttt
                     Aardvark  acaactaaattattttt
B D                 Armadillo  acaggtaaattacattc
              Golden hamster  =================
  D          Peregrine falcon  =================
  D              Saker falcon  =================
  D                    Parrot  =================
B D                Budgerigar  =================
  D               Rock pigeon  =================
  D              Mallard duck  =================
  D  Chinese softshell turtle  =================
B D                   Chicken  =================
B D       Medium ground finch  =================
B D                    Turkey  =================
  D            Painted turtle  =================
B D               Zebra finch  =================
  D       Collared flycatcher  =================
B D        American alligator  =================
          Tibetan ground jay  =================
  D             Scarlet macaw  =================
  D    White-throated sparrow  =================
B D                Guinea pig  =================
            Brush-tailed rat  =================
B D            Naked mole-rat  =================
                  Chinchilla  =================
B D                  Squirrel  =================
B D                   Wallaby  =================
B D           Tasmanian devil  =================
B D                  Platypus  =================
  D           Green seaturtle  =================
B D                      Pika  =================
      Lesser Egyptian jerboa  =================

Inserts between block 31 and 32 in window
B D                   Rabbit 924bp

Alignment block 32 of 710 in window, 88354606 - 88354607, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D                  Marmoset  aa
B D           Squirrel monkey  aa
B D                  Bushbaby  aa
           Chinese tree shrew  ga
                 Prairie vole  aa
B D           Chinese hamster  aa
B D                     Mouse  aa
B D                       Rat  aa
B D                       Pig  ca
B D                    Alpaca  aa
               Bactrian camel  aa
B D                   Dolphin  ct
                 Killer whale  ct
             Tibetan antelope  ca
B D                       Cow  ca
B D                     Sheep  ca
                Domestic goat  ca
B D                     Horse  aa
B D          White rhinoceros  aa
B D                       Cat  aa
B D                       Dog  aa
B D                   Ferret   aa
B D                     Panda  aa
               Pacific walrus  aa
                 Weddell seal  aa
             Black flying-fox  aa
B D                   Megabat  aa
                Big brown bat  aa
         David's myotis (bat)  aa
B D                  Microbat  aa
B D                  Hedgehog  aa
B D                     Shrew  aa
              Star-nosed mole  aa
B D                  Elephant  aa
B D                   Manatee  aa
             Cape golden mole  aa
B D                    Tenrec  ca
                     Aardvark  aa
B D                 Armadillo  ta
              Golden hamster  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
B D                Budgerigar  ==
  D               Rock pigeon  ==
  D              Mallard duck  ==
  D  Chinese softshell turtle  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                    Turkey  ==
  D            Painted turtle  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
B D        American alligator  ==
          Tibetan ground jay  ==
  D             Scarlet macaw  ==
  D    White-throated sparrow  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                  Squirrel  ==
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D                  Platypus  ==
  D           Green seaturtle  ==
B D                    Rabbit  ==
B D                      Pika  ==
      Lesser Egyptian jerboa  ==

Inserts between block 32 and 33 in window
B D                    Mouse 947bp
B D                      Rat 1560bp

Alignment block 33 of 710 in window, 88354608 - 88354611, 4 bps 
B D                     Human  tgga
B D                     Chimp  tgga
B D                   Gorilla  cgga
B D                 Orangutan  tgga
B D                    Gibbon  tgga
B D                    Rhesus  tgga
B D       Crab-eating macaque  tgga
B D                    Baboon  tgga
B D              Green monkey  tgga
B D                  Marmoset  tgga
B D           Squirrel monkey  tgga
B D                  Bushbaby  tgga
           Chinese tree shrew  tgga
                 Prairie vole  -agg
B D           Chinese hamster  -gaa
B D                       Pig  tgga
B D                    Alpaca  tggg
               Bactrian camel  tgga
B D                   Dolphin  tgga
                 Killer whale  tgga
             Tibetan antelope  tgga
B D                       Cow  tgga
B D                     Sheep  tgga
                Domestic goat  tgga
B D                     Horse  tgga
B D          White rhinoceros  tgga
B D                       Cat  tgga
B D                       Dog  tgga
B D                   Ferret   tgga
B D                     Panda  tgga
               Pacific walrus  tgga
                 Weddell seal  tgga
             Black flying-fox  taga
B D                   Megabat  taga
                Big brown bat  tgga
         David's myotis (bat)  tgga
B D                  Microbat  tgga
B D                  Hedgehog  tgga
B D                     Shrew  tggt
              Star-nosed mole  ggga
B D                  Elephant  tgga
B D                   Manatee  tgga
             Cape golden mole  tgga
B D                    Tenrec  tgga
                     Aardvark  taga
B D                 Armadillo  tggt
              Golden hamster  ====
B D                       Rat  ====
B D                     Mouse  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
  D              Mallard duck  ====
  D  Chinese softshell turtle  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                    Turkey  ====
  D            Painted turtle  ====
B D               Zebra finch  ====
  D       Collared flycatcher  ====
B D        American alligator  ====
          Tibetan ground jay  ====
  D             Scarlet macaw  ====
  D    White-throated sparrow  ====
B D                Guinea pig  ====
            Brush-tailed rat  ====
B D            Naked mole-rat  ====
                  Chinchilla  ====
B D                  Squirrel  ====
B D                   Wallaby  ====
B D           Tasmanian devil  ====
B D                  Platypus  ====
  D           Green seaturtle  ====
B D                    Rabbit  ====
B D                      Pika  ====
      Lesser Egyptian jerboa  ====

Inserts between block 33 and 34 in window
                Prairie vole 1bp
B D          Chinese hamster 1bp

Alignment block 34 of 710 in window, 88354612 - 88354612, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
       Lesser Egyptian jerboa  g
                 Prairie vole  a
B D           Chinese hamster  a
B D                       Pig  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  a
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  g
              Star-nosed mole  g
B D                  Elephant  g
B D                   Manatee  a
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  g
              Golden hamster  =
B D                       Rat  =
B D                     Mouse  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
B D                Budgerigar  =
  D               Rock pigeon  =
  D              Mallard duck  =
  D  Chinese softshell turtle  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Turkey  =
  D            Painted turtle  =
B D               Zebra finch  =
  D       Collared flycatcher  =
B D        American alligator  =
          Tibetan ground jay  =
  D             Scarlet macaw  =
  D    White-throated sparrow  =
B D                Guinea pig  =
            Brush-tailed rat  =
B D            Naked mole-rat  =
                  Chinchilla  =
B D                  Squirrel  =
B D                   Wallaby  =
B D           Tasmanian devil  =
B D                  Platypus  =
  D           Green seaturtle  =
B D                    Rabbit  =
B D                      Pika  =

Alignment block 35 of 710 in window, 88354613 - 88354616, 4 bps 
B D                     Human  tcat
B D                     Chimp  tcat
B D                   Gorilla  tcat
B D                 Orangutan  tcat
B D                    Gibbon  tcat
B D                    Rhesus  tcat
B D       Crab-eating macaque  tcat
B D                    Baboon  tcat
B D              Green monkey  tcat
B D                  Marmoset  tcat
B D           Squirrel monkey  tcat
B D                  Bushbaby  ttgt
           Chinese tree shrew  ttgc
       Lesser Egyptian jerboa  ctat
                 Prairie vole  tcat
B D           Chinese hamster  ttat
B D                      Pika  tccc
B D                       Pig  tcgt
B D                    Alpaca  ttgt
               Bactrian camel  ttgt
B D                   Dolphin  ttgt
                 Killer whale  ttgt
             Tibetan antelope  ttgt
B D                       Cow  ttgt
B D                     Sheep  ttgt
                Domestic goat  ttgt
B D                     Horse  ttgt
B D          White rhinoceros  ttgt
B D                       Cat  tcct
B D                       Dog  tcgt
B D                   Ferret   tcgt
B D                     Panda  tcgc
               Pacific walrus  tcgt
                 Weddell seal  tcgt
             Black flying-fox  tcgt
B D                   Megabat  tcgt
                Big brown bat  ccat
         David's myotis (bat)  tcat
B D                  Microbat  tcat
B D                  Hedgehog  ctgt
B D                     Shrew  ctgt
              Star-nosed mole  ccat
B D                  Elephant  ttgt
B D                   Manatee  ttgt
             Cape golden mole  ttgt
B D                    Tenrec  ttgt
                     Aardvark  ttgt
B D                 Armadillo  tcat
              Golden hamster  ====
B D                       Rat  ====
B D                     Mouse  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
  D                    Parrot  ====
B D                Budgerigar  ====
  D               Rock pigeon  ====
  D              Mallard duck  ====
  D  Chinese softshell turtle  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                    Turkey  ====
  D            Painted turtle  ====
B D               Zebra finch  ====
  D       Collared flycatcher  ====
B D        American alligator  ====
          Tibetan ground jay  ====
  D             Scarlet macaw  ====
  D    White-throated sparrow  ====
B D                Guinea pig  ====
            Brush-tailed rat  ====
B D            Naked mole-rat  ====
                  Chinchilla  ====
B D                  Squirrel  ====
B D                   Wallaby  ====
B D           Tasmanian devil  ====
B D                  Platypus  ====
  D           Green seaturtle  ====
B D                    Rabbit  ====

Alignment block 36 of 710 in window, 88354617 - 88354618, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                 Orangutan  tc
B D                    Gibbon  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
B D              Green monkey  tc
B D                  Marmoset  tc
B D           Squirrel monkey  tc
B D                  Bushbaby  tc
           Chinese tree shrew  tc
       Lesser Egyptian jerboa  ct
                 Prairie vole  tc
B D           Chinese hamster  tt
B D                    Rabbit  tc
B D                      Pika  tc
B D                       Pig  tc
B D                    Alpaca  tc
               Bactrian camel  tc
B D                   Dolphin  tc
                 Killer whale  tc
             Tibetan antelope  tc
B D                       Cow  tt
B D                     Sheep  tc
                Domestic goat  tc
B D                     Horse  tc
B D          White rhinoceros  tt
B D                       Cat  tc
B D                       Dog  tc
B D                   Ferret   tc
B D                     Panda  tc
               Pacific walrus  tc
                 Weddell seal  tc
             Black flying-fox  tc
B D                   Megabat  tc
                Big brown bat  ta
         David's myotis (bat)  ta
B D                  Microbat  ta
B D                  Hedgehog  tc
B D                     Shrew  tc
              Star-nosed mole  tc
B D                  Elephant  tt