Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 429 in window, 43444509 - 43444565, 57 bps 
B D                     Human  agctttggccattttggta------ggcttttaatccaatctg-ccatc-taa--c--------------
B D                     Chimp  aactttggccattttggta------ggcttttaatccaatctg-ccatc-taa--c--------------
B D                   Gorilla  agctttggccattttggta------ggcttttaatccaatctg-ccatc-taa--c--------------
B D                 Orangutan  agctttggccattttggta------ggcttttaatccaacctg-ccatc-taa--c--------------
B D                    Gibbon  agctttggccattttggta------ggcttttaatccaacctg-ccatc-taa--c--------------
B D                    Rhesus  gactttggccattttggta------ggctttgaatccaacctg-acatc-taa--c--------------
B D       Crab-eating macaque  gactttggccattttggta------ggctttgaatccaacctg-acatc-taa--c--------------
B D                    Baboon  gactttggccattttggta------ggctttgaatccaacctg-acatc-taa--c--------------
B D              Green monkey  gactttggccattttggta------ggctttgaatccaacctg-acatc-taa--c--------------
B D                  Marmoset  agcttcggccattttggtt------ggctttcaatcgaacctg-tcatc-taa--c--------------
B D           Squirrel monkey  agcttcagccattttggct------ggctttcattctaacctg-ccatc-taa--t--------------
B D                  Bushbaby  agctttggccattacagta------cactttgaatccaccctg-ccatc-taa--c--------------
           Chinese tree shrew  a------gcgatgctgaca------ggc-------ccagcctg-ccatcttaa--c--------------
B D                  Squirrel  acacttggccattttgtta------gacaatggatccagaata-cagtc-taa--t--------------
       Lesser Egyptian jerboa  agttttgaccccttggt------------------ccaggctg-ccatc-taa--c--------------
B D           Chinese hamster  agctcaggccacttggt-a------tactctgaatccagccca-acatt-taa--c--------------
               Golden hamster  agctcaggccactaggt-a------taatctg-acccagtcca-atatt-taa--c--------------
B D                       Rat  agtttaggccacttggt-g------tactctgaatccaggcca-atggt-taa--c--------------
B D            Naked mole-rat  ccctctgcccatgtgggta------ggttttaaatacagcctg-ccatc-tga--c--------------
B D                Guinea pig  cccactgccagtgtggaca------ggctatgaacacagcctg-tcaac-tca--c--------------
                   Chinchilla  cctcctgcccatgtggata------ggctttgaatacagcctg-ccacc-taa--c--------------
             Brush-tailed rat  ccctctgcctatgtgggta------ggctttgaatacagcctg-ccatt-taa--c--------------
B D                    Rabbit  ---tttggccatttttgta------ggctttgaatctagacta-ccatg-aaa--a--------------
B D                      Pika  ---tttggccatttttgaa------atctttgaacctaga----------aaa--a--------------
B D                       Pig  agctttggtcactgtggta------gtctgtgaccccaccctg-ccatc-taa--c--------------
B D                    Alpaca  agctttggtcattgtagtg------gtctaggaatccaccctgtccctt-taa--c--------------
               Bactrian camel  agctttggtcattgtagtg------gtctaggaatccaccctgcccctc-taa--c--------------
B D                   Dolphin  agctttggtcattttggta------gtctgtgaatccaccctg-ccatc-taa--c--------------
                 Killer whale  agctttggtcattttggta------gtctgtgaatccaccctg-ccatc-taa--c--------------
             Tibetan antelope  acctttggtcattttggta------gtctatgaactctccctg-ccatc-taa--c--------------
B D                       Cow  acctttggtcatttcggta------gtctatgaactctccctg-ccatc-taa--c--------------
B D                     Sheep  acctttggtcattttggta------gtctatgaactctccctg-ccatc-taa--c--------------
                Domestic goat  acctttggtcattttggta------gtctatgaactctccctg-ccatc-taa--c--------------
B D                     Horse  atcttttgccattttggta------gtctttgaagtcagcctg-ccatc-caa--c--------------
B D          White rhinoceros  agcttttgccattttggta------ggctttgaatccagcctg-ccatc-cca--c--------------
B D                       Cat  agctttcgctgttttggcg------ggctttgaatcccccctg-ccatc-taa--c--------------
B D                       Dog  tgctttcatcattttgacc------gtctttgaatcctgcctg-ccatc-taa--a--------------
B D                   Ferret   agcttccattgttttgact------gtctttgaatcccacctg-ccatc-cacaac--------------
B D                     Panda  agctttcatcatttggacc------gtctttgaatcccacctg-ccatc-taa--c--------------
               Pacific walrus  agctttca------------------tctttgaatcccacctg-ccatc-tac--c--------------
                 Weddell seal  agctttca------------------tctttgaatcccacctg-ccatc-tac--c--------------
             Black flying-fox  agcttttaccattttggta------gtctctgaatccagcctg-ccacc-taa--cacatcggaatctaa
B D                   Megabat  agcttttaccattttggta------gtctctgaatccagcctg-ccacc-taa--cacatcggaatctaa
                Big brown bat  agctttcaccattttggta------gtctttgaatccagccta-ccacc-taa--cacattttaatctaa
         David's myotis (bat)  agctttcaccattttggta------gtctttgaatccagcctg-ccacc-taa--cacatttgaatctag
B D                  Microbat  agctttcaccattttggta------gtctttgaatccagcctg-ccacc--aa--cacatttgaatctaa
              Star-nosed mole  agccttgaccatt-tggta------gtcttagaatccagccta-tcacc-taa--c--------------
B D                  Elephant  aactttggccattttggcagattgtggcttggaattcagcctg-ccatc-taa--c--------------
          Cape elephant shrew  aactctggccattttggtggagtgtggctttaaatccagcctg-ccat--taa--c--------------
B D                   Manatee  aaatttggccattttggtagattgtggcttggaatccagcctg-ccatc-taa--c--------------
B D                    Tenrec  aacttggaccattctgatagagggtggctt-----------------tc-tag--c--------------
                     Aardvark  aattctggccattttggtagcatgtggctttgaatccagcctg-tcatc-taa--c--------------
B D                     Mouse  ======================================================================
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
B D                 Armadillo  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ---a-gcct-----------------ag-aaaa
                        Chimp  ---a-gcct-----------------ag-aaaa
                      Gorilla  ---a-gcct-----------------ag-aaaa
                    Orangutan  ---a-gcct-----------------ag-aaaa
                       Gibbon  ---a-gcct-----------------ag-aaaa
                       Rhesus  ---a-gcct-----------------ag-aaaa
          Crab-eating macaque  ---a-gcct-----------------ag-aaaa
                       Baboon  ---a-gcct-----------------ag-aaaa
                 Green monkey  ---a-gcct-----------------ag-aaaa
                     Marmoset  ---a-gtct-----------------ag-aaaa
              Squirrel monkey  ---a-gcct-----------------agaaaaa
                     Bushbaby  ---a-gcct-----------------ag-aaaa
           Chinese tree shrew  ---a-gcct-----------------ag-agaa
                     Squirrel  ---a-gtct-----------------aa-aa--
       Lesser Egyptian jerboa  ---a-acca-----------------ga-aaa-
              Chinese hamster  ---a-gctt-----------------tg-aaaa
               Golden hamster  ---a-gctt-----------------tg-aaaa
                          Rat  ---a-gttt-----------------ta-aaag
               Naked mole-rat  ---a-gact-----------------ag-aaaa
                   Guinea pig  ---a-gatt-----------------ag-aaaa
                   Chinchilla  ---a-gact-----------------ag-aaaa
             Brush-tailed rat  ---a-gact-----------------ag-aaaa
                       Rabbit  ---a-gcct-----------------ga-agaa
                         Pika  ---a-tcct-----------------ag-aaaa
                          Pig  ---a-gcct-----------------ag-agaa
                       Alpaca  ---c-gctc-----------------ag-agaa
               Bactrian camel  ---c-actc-----------------ag-agaa
                      Dolphin  ---a-gcct-----------------ag-agga
                 Killer whale  ---a-gcct-----------------ag-agga
             Tibetan antelope  ---aggcct-----------------ag-agaa
                          Cow  ---a-gcca-----------------ag-agaa
                        Sheep  ---aggcct-----------------ag-agaa
                Domestic goat  ---aggcct-----------------ag-agaa
                        Horse  ---a-gcct-----------------ag-aaaa
             White rhinoceros  ---a-gcct-----------------ag-aaaa
                          Cat  ---a-gcca-----------------cg-gaaa
                          Dog  ---a-gcct-----------------ag-gaaa
                      Ferret   ---a-gcct-----------------ag-gaaa
                        Panda  ---a-gcct-----------------ag-caca
               Pacific walrus  ---a-gcct-----------------ag-gaaa
                 Weddell seal  ---a-gcct-----------------ag-gaaa
             Black flying-fox  ccta-gccttaaaaa----aaaaaaaaa-aaaa
                      Megabat  ccta-gccttaaaaaaaataaaaaaaaa-aaaa
                Big brown bat  ctta-gcct-----------------ag-aaaa
         David's myotis (bat)  atta-gcat-----------------ag-gaaa
                     Microbat  atta-gcat-----------------ag-aaaa
              Star-nosed mole  ---a-gcct-----------------ga-a---
                     Elephant  ---a-gcct-----------------ag-aaaa
          Cape elephant shrew  ---a-ggct-----------------ag-aaaa
                      Manatee  ---a-gcct-----------------ag-aaaa
                       Tenrec  ---a-gcct-----------------ag-aata
                     Aardvark  ---a-gcct-----------------ag-aaaa
                        Mouse  =================================
                 Nile tilapia  =================================
             Peregrine falcon  =================================
                 Saker falcon  =================================
     Mexican tetra (cavefish)  =================================
                  Spotted gar  =================================
                   Coelacanth  =================================
                    Zebrafish  =================================
                  Rock pigeon  =================================
                 Mallard duck  =================================
                    Tetraodon  =================================
     Chinese softshell turtle  =================================
                      Chicken  =================================
          Medium ground finch  =================================
                       Turkey  =================================
                X. tropicalis  =================================
               Painted turtle  =================================
                  Zebra finch  =================================
          Collared flycatcher  =================================
           American alligator  =================================
           Tibetan ground jay  =================================
                       Lizard  =================================
       White-throated sparrow  =================================
                      Wallaby  =================================
              Tasmanian devil  =================================
                     Platypus  =================================
       Spiny softshell turtle  =================================
              Green seaturtle  =================================
                      Opossum  =================================
                    Armadillo  =================================
             Cape golden mole  =================================

Inserts between block 1 and 2 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
B D          Chinese hamster 1841bp
              Golden hamster 755bp
B D                      Rat 707bp
B D           Naked mole-rat 5bp
B D               Guinea pig 5bp
                  Chinchilla 5bp
            Brush-tailed rat 5bp

Alignment block 2 of 429 in window, 43444566 - 43444566, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -c
B D           Squirrel monkey  -a
B D                  Bushbaby  -a
           Chinese tree shrew  -c
B D                    Rabbit  -c
B D                      Pika  -a
B D                       Pig  -a
B D                    Alpaca  -t
               Bactrian camel  -t
B D                   Dolphin  -a
                 Killer whale  -a
             Tibetan antelope  -g
B D                       Cow  -a
B D                     Sheep  -g
                Domestic goat  -g
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -a
         David's myotis (bat)  -a
B D                  Microbat  -a
B D                  Elephant  c-
          Cape elephant shrew  t-
B D                   Manatee  t-
B D                    Tenrec  t-
                     Aardvark  t-
             Star-nosed mole  --
              Golden hamster  ==
B D                       Rat  ==
B D                     Mouse  ==
B D              Nile tilapia  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
    Mexican tetra (cavefish)  ==
                 Spotted gar  ==
B D                Coelacanth  ==
B D                 Zebrafish  ==
  D               Rock pigeon  ==
  D              Mallard duck  ==
B D                 Tetraodon  ==
  D  Chinese softshell turtle  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                    Turkey  ==
B D             X. tropicalis  ==
  D            Painted turtle  ==
B D               Zebra finch  ==
  D       Collared flycatcher  ==
B D        American alligator  ==
          Tibetan ground jay  ==
B D                    Lizard  ==
  D    White-throated sparrow  ==
B D                Guinea pig  ==
            Brush-tailed rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                  Squirrel  ==
B D           Chinese hamster  ==
B D                   Wallaby  ==
B D           Tasmanian devil  ==
B D                  Platypus  ==
  D    Spiny softshell turtle  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
      Lesser Egyptian jerboa  ==
B D                 Armadillo  ==
            Cape golden mole  ==

Inserts between block 2 and 3 in window
B D                 Bushbaby 5bp
          Chinese tree shrew 5bp
B D                   Rabbit 5bp
B D                     Pika 5bp
B D                      Pig 5bp
B D                   Alpaca 5bp
              Bactrian camel 5bp
B D                  Dolphin 5bp
                Killer whale 5bp
            Tibetan antelope 5bp
B D                      Cow 5bp
B D                    Sheep 5bp
               Domestic goat 5bp
B D                    Horse 5bp
B D         White rhinoceros 5bp
B D                      Cat 4bp
B D                      Dog 5bp
B D                  Ferret  5bp
B D                    Panda 5bp
              Pacific walrus 5bp
                Weddell seal 5bp
            Black flying-fox 5bp
B D                  Megabat 5bp
               Big brown bat 5bp
        David's myotis (bat) 5bp
B D                 Microbat 5bp

Alignment block 3 of 429 in window, 43444567 - 43444688, 122 bps 
B D                     Human  ----att-taaaccaag---ctccaatttctcataga-aa------------------------------
B D                     Chimp  ----att-taaaccaag---ctccaatttctcataga-aa------------------------------
B D                   Gorilla  ----att-taaaccaag---ctccaatttctcataga-aa------------------------------
B D                 Orangutan  ----att-taaaccaag---ctccaatttctcataga-aa------------------------------
B D                    Gibbon  ----att-taaaccaag---ctccaatttctcataga-aa------------------------------
B D                    Rhesus  ----atc-tgaaccaag---ctccaatttctgataga-aa------------------------------
B D       Crab-eating macaque  ----atc-tgaaccaag---ctccaatttctgataga-aa------------------------------
B D                    Baboon  ----atc-tgaaccagg---ctccaatttctgataga-aa------------------------------
B D              Green monkey  ----atc-tgaaccaag---ctccaatttctgataga-aa------------------------------
B D                  Marmoset  ----atc-tgaaccaag---cttcaatttctcataaa-aa------------------------------
B D           Squirrel monkey  ----atc-caaaccaag---cttcaatttctcataaa-aa------------------------------
B D                  Bushbaby  ----act-aaaatcacg---tttcaatttctgttaga-aa------------------------------
           Chinese tree shrew  ----act-taaattaag---tttccattcctcttgca-ag------------aggtaagtggtatgataa
B D                  Squirrel  ----act-tgaatcaag---ctttgatttatcttaga-aa------------------------------
       Lesser Egyptian jerboa  -----------accaac-----------tctcgtgga-aa------------------------------
B D           Chinese hamster  ----act-taaattaag---ctccag--tctcttgga-aa------------------------------
               Golden hamster  ----act-taaattaag---cttcag--tctcttgga-aa------------------------------
B D                       Rat  ----act-tgaatcaag---cttcaatctctcttaga-aa------------------------------
B D            Naked mole-rat  ----gct-tgaatcaag---ttttgatttctcttaga-aa------------------------------
B D                Guinea pig  ----cct-tgaaccaag---ctttgatttctcttaga-aa------------------------------
                   Chinchilla  ----cct-tgaatcaag---cttggatttctcttaga-aa------------------------------
             Brush-tailed rat  ----cct-ttaatcaag---ctttgatt--tcttaga-aa------------------------------
B D                    Rabbit  ----act-tgaagcaaa---cttcaatttgccttagg-aa------------------------------
B D                      Pika  ----att-tgaatcaaa---cttcattttgtcttagg-aa------------------------------
B D                       Pig  ----act-tgaatcaa------tcagtttctcttaga-ga------------------------------
B D                    Alpaca  ----act-taaatcaag---cttctatttctcttaga-ga------------------------------
               Bactrian camel  ----tct-taaatcaag---cttctatgtctcttaga-ga------------------------------
B D                   Dolphin  ----aac-tgaatcaag---cttctatttctcttaga-ga------------------------------
                 Killer whale  ----aat-tgaatcaag---cttctatttctcttaga-ga------------------------------
             Tibetan antelope  ----atg-tgcagcaaa---cttctatttcttttcga-ga------------------------------
B D                       Cow  ----acgttgcagcaag---cttctatttctcttaga-ga------------------------------
B D                     Sheep  ----atg-tgcagcaag---cttctatttctttttga-ga------------------------------
                Domestic goat  ----atg-tgcagcaag---cttctatttcttttcga-ga------------------------------
B D                     Horse  ----acc-tgaatcaag---cttctatttctcttaga-ga------------------------------
B D          White rhinoceros  ----acc-tgaatcaag---tttctatttctcttaga-gg------------------------------
B D                       Cat  ----agt-tgaatcaag---cttctctatctcttaga-ga------------------------------
B D                       Dog  ----att-tgaatcaag---attctatttctcttaga-ga------------------------------
B D                   Ferret   ----act-tgaatcaag---cttctattcctcttaga-ga------------------------------
B D                     Panda  ----act-tgaatcaag---tttctacttctcttaga-ga------------------------------
               Pacific walrus  ----act-tgaatcaag---cttctgtttctcttaga-ga------------------------------
                 Weddell seal  ----act-tgaatcaag---cttctgtttctcttaga-ga------------------------------
             Black flying-fox  ----act-tgaatcaagcttcttctatttctcttagg-ga------------------------------
B D                   Megabat  ----act-tgaatcaagcttcttctatttctcttagg-ga------------------------------
                Big brown bat  ----act-tgaatcaag---cttctatttctcttaga-ga------------------------------
         David's myotis (bat)  ----act-tgaatcaag---cttctatttctcttaga-ga------------------------------
B D                  Microbat  ----act-tgaatcaag---cttctatttctcttaga-ga------------------------------
              Star-nosed mole  --------------aag-----------tctttcaga-ga------------------------------
B D                  Elephant  agtcact-tgaataatg---cttcgatttctcttaga-ga------------------------------
          Cape elephant shrew  cttcact-tgaaccaaa---cttccatttctcttgaa-aa------------------------------
B D                   Manatee  attcact-tgactcaag---ctttgatttctcttaga-ga------------------------------
B D                    Tenrec  cttccgt-ggaatcatg---cttccatttctcttaagcga------------------------------
                     Aardvark  cttcgct-tgaatcaag---ctttgatttctcttaga-gaaatgttaaagagatgtcaggggtaccagag
B D                     Mouse  ======================================================================
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Wallaby  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
B D                 Armadillo  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ------------ccc-tgtctt-caagatctgccacacatatgaaaagttgcaatgccagaag--cacat
                        Chimp  ------------ccc-tgtctt-caagatctgccacacatatgaaaagttgcaatgccagaag--cacat
                      Gorilla  ------------ccc-tgtctt-caagatctgccacacatatgagaagttgcaatgccagaag--cacat
                    Orangutan  ------------ccc-tgtctt-caagatctgccacacatatgaaaagttgcaatgccagaag--cacat
                       Gibbon  ------------ccc-tgtctt-caagatctgccacacatatgaaaagttgcaatgccagaag--cacat
                       Rhesus  ------------ccc-tgtctt-caagatctgccacacataagaaaagttgcaatgccagaag--cacat
          Crab-eating macaque  ------------ccc-tgtctt-caagatctgccacacataagaaaagttgcaatgccagaag--cacat
                       Baboon  ------------ccc-tgtctt-caagatctgccacacataagaaaagttgcaatgccagaag--cacat
                 Green monkey  ------------ccc-tgtctt-caagatctgccacacatatgaaaagttgcaatgccagaag--cacat
                     Marmoset  ------------ccc-tgtctt-caagatctgacacacatacaaaaagctgcaatgccagaag--catat
              Squirrel monkey  ------------ccc-tgtttt-caagatctgccacacatacaaaaagctgcaatgccagaag--catat
                     Bushbaby  ------------acc-tgtcct-taagatttgccacacatacaaaaagctaaaataccaaaag--cacgt
           Chinese tree shrew  tt----------aca-tgacct-taagacctgctttacacattaaaagttgaaatgccataag--cacat
                     Squirrel  -------------------cct-taagatcggccataaacagaaaaagttaaaatgccagaag--tatat
       Lesser Egyptian jerboa  ------------ccc-tgccct-tatgatgtgccacacaagaaaaaag--aaaaaggcagaag--tgtat
              Chinese hamster  --------------c-tgtcct-taagatttgccacatacaggaaaagctaaaatgccacaag--tttat
               Golden hamster  ------------ctc-tgtcct-taagatctgccacatacaggaaaagctaaaatgccacacg--tctat
                          Rat  ------------ctc-tacagt-taagacctgctacatccagggcaag--gaaatgcagca-g--cctgt
               Naked mole-rat  ------------ttc-tatcct-taagatctgccatacatagttaaaggtaaaatagtagaag--gagat
                   Guinea pig  ------------ttc-tgtcat-taagatctgcgacacattgttaaaggtgaaatagcagaag--ggtat
                   Chinchilla  ------------ttc-tgtcct-taagatctgccacacatagttaaaggtgaagtatcagaag--ggtat
             Brush-tailed rat  ------------ttc-tg---t-taagattagcaacacatagcaaaaggttaaataccagaag--ggtat
                       Rabbit  ------------ctc-tggcct-taagatttgacttacatatgaaaagttaaaatgaca-gag--tgcat
                         Pika  ------------tcc-tgtctt-tgg----------------gaaaagttaag--gacgtaag--tgcgt
                          Pig  ------------actgtgtcct--aatatctgccacacatatgaaaagttgaaatgctggaag--catgt
                       Alpaca  ------------tctgcgtcct--gag----------------aaaagctggaatgcctgaag--cacat
               Bactrian camel  ------------tctgcatcct--gag----------------aaaagctggaatgcctgaag--cacat
                      Dolphin  ------------gctgtatcct--aagatcggccacacatatgaaaagttgaaatgccagaag--cacgt
                 Killer whale  ------------gctgtatcct--aagatcggccacacatatgaaaagttgaaatgccagaag--cacgt
             Tibetan antelope  ------------tctgtgtcct--aat------------------tagttaaaatgccagaagcacacat
                          Cow  ------------tctgtgtcct--aat------------------tagtcgaaatgccagaagcacacgt
                        Sheep  ------------tctgtgtcct--aat------------------tagtcaaaatgccagaagcacacat
                Domestic goat  ------------tctgtgtcct--aat------------------tagtcaaaatgccagaagcacacat
                        Horse  ------------tcc-tatcct--aagatctgtcacacatacaaaaagttgaaatgccagaag--cacat
             White rhinoceros  ------------ccc-tgtcct--aagatctgccacacatatgaaaagttgaaatgccagaag--cacat
                          Cat  ------------ccc-tgtcct--aagatctgccacacgtacggaag-ttgaaatgccagaaa--cacat
                          Dog  ------------ccc-catcct--aagatctgccacacatatggata-ttgaaatgctgaaag--caaat
                      Ferret   ------------ccc-tgtcct--aagatctgccacacatatggaaa-ttg---------------aaat
                        Panda  ------------ccc-tgtcct--aagatctgccacacatatggaaa-ttg-aacgctgaaag--caaac
               Pacific walrus  ------------ccc-tgtccc--aagatctgccacacatgttgaaa-ttgaaatgccgaaag--caaat
                 Weddell seal  ------------ccc-tgtccc--aagatctgccacacatattgaaa-ttgaaatgccaaaag--caaat
             Black flying-fox  ------------ccc-tgtcct--aagatatgccatacatataaaaaactgaaatgccagaag--cacat
                      Megabat  ------------ccc-tgtcct--aagatatgccatacatataaaaaactgaaatgccagaag--cacat
                Big brown bat  ------------ccc-tgtcct--aagatcggcc--acatataaaaggttgaaatgccagaag--cacat
         David's myotis (bat)  ------------ccc-tgtcct--aagatctgcc--acatataaaaggttgaaatgccagaag--cacat
                     Microbat  ------------ccc-tgtcct--aagatctgcc--acatataaaaggttgaaatgccagaag--cacat
              Star-nosed mole  ------------cct-----cc--aagagttgccccacacacgaaaagctgaaatgcgagatg--cacag
                     Elephant  ------------cct-tgcccc-taacatctgccacagataggaaaagctgaaatgccaga-g--tgcag
          Cape elephant shrew  ------------cca-tgccccttgagatccgccagagagaggaaacgctgaggaggcaaa-g--tgagt
                      Manatee  ------------cct-tgcccc-taacatctgcaacagatacgaaaagctgaaatgccaga-g--tgtat
                       Tenrec  ------------cct-tgcccc-taagatctgccaaagaagggaaaagctggag-gccaga-g--agcac
                     Aardvark  ttagcatctcacact-tgaccc-taagatctgccatagatataaaaagctgaaatcccaga-g--tgcac
                        Mouse  ======================================================================
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
                    Tetraodon  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
                      Wallaby  ======================================================================
              Tasmanian devil  ======================================================================
                     Platypus  ======================================================================
       Spiny softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================
                    Armadillo  ======================================================================
             Cape golden mole  ======================================================================

                        Human  gcttctgaac-----aaaaagt---atacca-gtgaa-aac-tat-tgt
                        Chimp  gcttctgaac-----aaaaagt---atacca-gtgaa-aac-tat-tgt
                      Gorilla  gcttctgaac-----aaaaagt---atacca-gtgaa-aac-tat-tgt
                    Orangutan  gcttctgaac-----aaaaagt---atacca-atgaa-aac-tat-tgt
                       Gibbon  gcttctgaac-----aaaaagt---atacca-atgaa-aac-tat-tgt
                       Rhesus  gcttctgaac-----aaaaagt---atacca-atgaa-aac-tat-tgt
          Crab-eating macaque  gcttctgaac-----aaaaagt---atacca-atgaa-aac-tat-tgt
                       Baboon  gcttctgaac-----aaaaagt---atacca-atgaa-aac-tat-tgt
                 Green monkey  gcttctgaac-----aaaaagt---atacca-atgaa-aac-tat-tgt
                     Marmoset  gcttctgaac-ttaacaaaagc---atacaa-acaaa-aac-tat-tgt
              Squirrel monkey  gcttcggaac-ttaacaaaagc---atacaa-acgaa-aac-tac-tgt
                     Bushbaby  gcttctgagc-ttaagaaaagc---atcctg-atgat-aac-tac-cat
           Chinese tree shrew  gcttctaacc-ttaacaaaagc---ctcctg-gtgaa-aaa-tac-tgc
                     Squirrel  gcttca------taacaaaagcgttattatg-atgaa-aac-aat-tat
       Lesser Egyptian jerboa  gcttcagagc-ttaacaaaagc---atcctg-gttca-gct-aac----
              Chinese hamster  gtgttggagctttaacaaaggc---atccct-atgca-aac-aat-tat
               Golden hamster  gtgttggagctttaacaaaggc---attcct-atgca-aac-aat-aat
                          Rat  gtcttagacctttaacaaaggc---atccct-ctgca-aac-aat-aat
               Naked mole-rat  gcttcagagc-ttaacaaatgc---accctg-gtgaa-----aacacat
                   Guinea pig  gcttcagagc-ttaacaaaagc---atgc-----------------cac
                   Chinchilla  gcttcagagc-ttaacaaaagc---gtcctg-atgga-----aat-cac
             Brush-tailed rat  gcttcagaga-ttaacaaaagc---atcctg-atgaaaaac-aat-cac
                       Rabbit  gctttggagc-ttaacaaaaac---atcctg-atgaa-aac-aat-cat
                         Pika  gctttggaat-ttaaaaaaaga---atactg-atgaa-aac-aat-tag
                          Pig  gcttctgagt-tgaacagaagt---atcaggaatgaa-gac-agt-cat
                       Alpaca  gcttctgagt-ttaacaaaagt---gtca-g-atgaa-aac-tat-cat
               Bactrian camel  gcttctgaat-ttaacaaaagt---gtca-g-atgaa-aac-tat-cat
                      Dolphin  gcttctgagt-ttcacaaaagt---atcagg-atgaa-aac-tat-caa
                 Killer whale  gcttctgagt-ttcacaaaagt---atcagg-atgaa-aac-tat-caa
             Tibetan antelope  gcttctgagt-ttcaca----------cagg-atgaa-aac-tat-cat
                          Cow  gcttctgagt-ttcaca----------cagg-atgaa-aac-cat-cat
                        Sheep  gcttctgagt-tttaca----------cagg-atgga-aac-tat-cat
                Domestic goat  gcttctgagt-ttcaca----------cagg-atgaa-aac-tat-cat
                        Horse  gcttctgagc-ttaacaaaagc---atccgg-a-gga-aac-tac-cat
             White rhinoceros  gcttctgagc-ttcacaaaagc---atcccg-atgaa-aac-tat-caa
                          Cat  gcttctgagc-ttaacaaaagc---atcctg-ataaa-aat-gat-gat
                          Dog  gcttctgagt-ttaacaaaagc---atcctg-attaa-aaa--------
                      Ferret   gcttctgagc-ttaacaaaagc---atcttg-ataaa-aaatgac-tgt
                        Panda  gcttctgagc-ttaacaaaagc---atcctg-ataaa-aaacaat-cgt
               Pacific walrus  gcttctg------------agc---atcctg-ataaa-aacccat-ggc
                 Weddell seal  gcttctgagc-ttaacaaaagc---atcctg-ataaa-aacccat-ggc
             Black flying-fox  gcttccgagt-ttaacaaaagc---atctca-atgaa-aac-tat-tat
                      Megabat  gcttccgagt-ttaacaaaagc---atctca-atgaa-aac-tat-tat
                Big brown bat  gtttctgaga-ttaacaaaagc---atctga-atgaa-aac-tat-cat
         David's myotis (bat)  gtttctgaga-ttaacaaaagc---atccgg-atgaa-aac-tat-cat
                     Microbat  gtttctgaga-ttaacaaaagc---atccgg-atgaa-aac-tat-cat
              Star-nosed mole  acttctgagc-ttaacaaaaac---atcctg-atg---aac-taa-tat
                     Elephant  gcttctgagc-ttaacaatagc---atcctg-atgca-aac-tat-cat
          Cape elephant shrew  g---ctgagc-ttaacaataac---atcctg-atgaa-aac-tac-cag
                      Manatee  gcctctgagc-ttaacaataac---atcctg-atgaa-aac-tat-cat
                       Tenrec  gctcctgagc-ctaacactggc---atcttg-gtgaa-aac-tct-c--
                     Aardvark  gcttctgagc-ttaacaacagc---atccta-atgaa-aat-tac-cat
                        Mouse  =================================================
                 Nile tilapia  =================================================
             Peregrine falcon  =================================================
                 Saker falcon  =================================================
     Mexican tetra (cavefish)  =================================================
                  Spotted gar  =================================================
                   Coelacanth  =================================================
                    Zebrafish  =================================================
                  Rock pigeon  =================================================
                 Mallard duck  =================================================
                    Tetraodon  =================================================
     Chinese softshell turtle  =================================================
                      Chicken  =================================================
          Medium ground finch  =================================================
                       Turkey  =================================================
                X. tropicalis  =================================================
               Painted turtle  =================================================
                  Zebra finch  =================================================
          Collared flycatcher  =================================================
           American alligator  =================================================
           Tibetan ground jay  =================================================
                       Lizard  =================================================
       White-throated sparrow  =================================================
                      Wallaby  =================================================
              Tasmanian devil  =================================================
                     Platypus  =================================================
       Spiny softshell turtle  =================================================
              Green seaturtle  =================================================
                      Opossum  =================================================
                    Armadillo  =================================================
             Cape golden mole  =================================================

Alignment block 4 of 429 in window, 43444689 - 43444745, 57 bps 
B D                     Human  gcagtg--------aaa----aa-ggcatctggtgaa--acgtgtt--gaaaaaaaggtgggggggg-ag
B D                     Chimp  gcagtg--------aaa----aa-ggcatctggtgaa--acgtgtt--gaaaaaaaggtgggggggg-ag
B D                   Gorilla  gcggtg--------aaa----aa-ggcatttggtgaa--acgtgtt--gaaaaaaaggtgggggggg-ag
B D                 Orangutan  gcagtga-------aaa----aa-ggcatttggtgaa--atgggtt--gaaaaaaaggt-tgggggg-ag
B D                    Gibbon  acagtga-------aaa----aa-ggcatttggtgaa--acgggtt--gaaaaaaaggt-ggggggg-ag
B D                    Rhesus  gtagtga-------aaa----aa-ggcatttggtgaa--atgcgtt---aaaaaaaggtggggagga-ag
B D       Crab-eating macaque  gtagtga-------aaa----aa-ggcatttggtgaa--atgcgtt---aaaaaaaggtggggggga-ag
B D                    Baboon  gtagtga-------aaa----aa-ggcatttggtgaa--atgcgtt---aaaaaaaggtggggggga-ag
B D              Green monkey  gtagtga-------aaa----aa-ggcatttggtgaa--atgcatt---aaaaaaag--ggggggga-ag
B D                  Marmoset  gcagtga-------aaa----ac-agcatttggtaaa--acgcgtt---aaaaaaa----agaaaga-ag
B D           Squirrel monkey  gcagtga-------aaa----aa-ggcatttggtaaa--acgcgtt---aaa----------aaaga-aa
B D                  Bushbaby  gcaattat------aaa----aa-agcatctggtgaa--atgtgtt---aaaaggaa-----aaaga-ag
           Chinese tree shrew  acaatgg-------aaa----aa-agcacttggtaat--atctatt--gaaatgaaa---------a-ag
B D                  Squirrel  gcaatga-------aaaaaacaa-agaatttgc---a--aaatgtg---ttaaggaa-----aaaga-ag
       Lesser Egyptian jerboa  -tggtga-------aag----aa-ggggttcgctgag--acacgta---tgcaggaa-----gatgacgg
B D           Chinese hamster  gcaatga-------aaa----aa-ggcttttagttac--acatgta---tgcacgac-----aatga-ag
               Golden hamster  gcaatga-------aaa----aa-ggcttttagttaa--acatgtg---tgctcgaa-----aatga-ag
B D                       Rat  gcaacgg-------aag----ag-ggctttcagttaa--acgtgtg---tacaagaa-----aatga-ag
B D            Naked mole-rat  gcaatga-------aaa----ca-cgcatttgggaat--atgtgat---aaaaagca-----aaaga-ag
B D                Guinea pig  gcaatgg-------aaa----ct-tgc--ttagggaa--aggggat---aaaag-ca-----agaga-ag
                   Chinchilla  acaacgc-------aaa----ct-cgcattcggggaa--aggtgac---aaaaa-ca-----agaga-ag
             Brush-tailed rat  atgtcag-------aaa----ca-tgcatgtggggaa--aggtgat---aaaaagca-----agaga-ag
B D                    Rabbit  gcaattaaaaggggaaa----aa-agcatttggtagg--acatgat---aaagg-ag-----aaaga-ag
B D                      Pika  gcaattttaa----aaa----aa-agcagttggtgag--acatgat---aaag----------aaga-aa
B D                       Pig  gcaaaga-------aaa----ga-cgcatttggggaa--acgcatt---aaaaggaa-----aaatgtaa
B D                    Alpaca  gcaaaga-------aaa----ga-agcatttggggaa--atgtgtt---aaaagtaa-----aaata-ag
               Bactrian camel  gcaaaga-------aaa----ga-agcatttggggaa--atgtgtt---aaaagtaa-----aaata-ag
B D                   Dolphin  gcaaaga-------aat----ga-agcacttggggaa--acgtgtt---aaaagtaa-----aaata-ag
                 Killer whale  gcaaaga-------aat----ga-agcacttggggaa--acgtgtt---aaaagtaa-----aaata-ag
             Tibetan antelope  gcaaaga-------aaa----ga-agtatttggggaa--acgct------------g-----aaata-ag
B D                       Cow  gcaaaga-------aaa----ga-agtatttggggaaacacgtt------------g-----aaata-ag
B D                     Sheep  gcaaaga-------aaa----ga-agtatttggggaa--acgct------------g-----aaata-ag
                Domestic goat  gcaaaga-------aaa----ga-agtatttggggaa--acgct------------g-----aaata-ag
B D                     Horse  gcaatga-------aaa----ga-agcatttggtgaa--ccatatt---aaaagtga-----aaata-ag
B D          White rhinoceros  gcaatga-------aaa----ga-agcatttggtgaa--acacatt---aaaagtaa-----aaata-ag
B D                       Cat  gcaatga-------aaa----ga-agaatttggtgaa--atgtgct---acaagtaa-----aacgg-ag
B D                       Dog  --aaaaa-------aaa----tg-atcgtgctttg----tggtgtc---acaagtaa-----aaat--ag
B D                   Ferret   gcaatga-------aaa----ga-ggcattcagtgaa--ccgtgtt---acaaatta-----aaata-ag
B D                     Panda  gcaatga-------aaa----ga-agcattccgtgaa--ctgtgtt---acaagtga-----aaata-ag
               Pacific walrus  acaacga-------aaa----ga-agccttcagtgaa--ccgtgtc---acaagtaa-----aaata-ag
                 Weddell seal  gcaatga-------aaa----ga-agccttcagtgaa--ctgtgtc---tcaagtaa-----aaata-ag
             Black flying-fox  gcaataa-------aaa----agaagcatttaatgaa--acgtgtt---aa----aa-----aaaca-ag
B D                   Megabat  gcaataa-------aaa----ag-agcatttagtgaa--acgtgtt---aa----aa-----aaaca-ag
                Big brown bat  acaat----------aa----ga-agcatttggtgaa--atatgct---aaaaataa-----aaata-ag
         David's myotis (bat)  gcaatga-------gaa----ga-agcatttggtgaa--atatgtt---aaaaataa-----aaata-ag
B D                  Microbat  gcaatga-------gaa----ga-agcatttggtgaa--atatgtt---aaaaataa-----aaata-ag
              Star-nosed mole  gcaacta-------cca----ga-aatatttggtgaa--acatgtt---caaagtaa-----gaagc-ag
B D                  Elephant  gaaatga-------aaa----ga-agcatttggcaaaacatgtgtt---acaagtaa-----aacta-ag
          Cape elephant shrew  gaaatga-------aaa----ga-agtatttaccaagatatgggtt---agaagtaa-----aaaca-ag
B D                   Manatee  gaaatga-------aga----ga-cgcatttgccaaaacacgtgtt---aaaaataa-----aacta-ag
B D                    Tenrec  gaaatgg-------gaa----ga-ggtgtttggcaaaccgtgtgtc---ctgagcga-----aaatg-ag
                     Aardvark  gaaatga-------aaa----ga-agcatttggcaaa--atgtgtt---aaaagtga-----aaata-ag
B D           Tasmanian devil  --gaagt-------aaa----at-atgatttgtagaa--ttgtgttttacagaataa-----aaaca-ag
B D                     Mouse  ======================================================================
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Wallaby  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
B D                 Armadillo  ======================================================================
            Cape golden mole  ======================================================================

                        Human  gtatc-
                        Chimp  gtatc-
                      Gorilla  gtatc-
                    Orangutan  gtatc-
                       Gibbon  gtatc-
                       Rhesus  gtatc-
          Crab-eating macaque  gtatc-
                       Baboon  gtatc-
                 Green monkey  gtatc-
                     Marmoset  gtatt-
              Squirrel monkey  gtatt-
                     Bushbaby  gtatt-
           Chinese tree shrew  gcgtc-
                     Squirrel  gtat--
       Lesser Egyptian jerboa  gcatc-
              Chinese hamster  ttatc-
               Golden hamster  ttacc-
                          Rat  ctatc-
               Naked mole-rat  aaatg-
                   Guinea pig  caacg-
                   Chinchilla  aaatg-
             Brush-tailed rat  cagcg-
                       Rabbit  gtatc-
                         Pika  gtatt-
                          Pig  gtatc-
                       Alpaca  gtatc-
               Bactrian camel  gtatc-
                      Dolphin  gcata-
                 Killer whale  gcata-
             Tibetan antelope  gtatc-
                          Cow  gtatc-
                        Sheep  gtatc-
                Domestic goat  gtatc-
                        Horse  gtatc-
             White rhinoceros  gtctg-
                          Cat  ttatc-
                          Dog  gtatc-
                      Ferret   gtatc-
                        Panda  gtatc-
               Pacific walrus  gtatc-
                 Weddell seal  gtatc-
             Black flying-fox  at----
                      Megabat  at----
                Big brown bat  gtatc-
         David's myotis (bat)  gtatc-
                     Microbat  gtatc-
              Star-nosed mole  atatt-
                     Elephant  gtttt-
          Cape elephant shrew  gtaca-
                      Manatee  gttac-
                       Tenrec  gcaat-
                     Aardvark  gtacc-
              Tasmanian devil  aaaatg
                        Mouse  ======
                 Nile tilapia  ======
             Peregrine falcon  ======
                 Saker falcon  ======
     Mexican tetra (cavefish)  ======
                  Spotted gar  ======
                   Coelacanth  ======
                    Zebrafish  ======
                  Rock pigeon  ======
                 Mallard duck  ======
                    Tetraodon  ======
     Chinese softshell turtle  ======
                      Chicken  ======
          Medium ground finch  ======
                       Turkey  ======
                X. tropicalis  ======
               Painted turtle  ======
                  Zebra finch  ======
          Collared flycatcher  ======
           American alligator  ======
           Tibetan ground jay  ======
                       Lizard  ======
       White-throated sparrow  ======
                      Wallaby  ======
                     Platypus  ======
       Spiny softshell turtle  ======
              Green seaturtle  ======
                      Opossum  ======
                    Armadillo  ======
             Cape golden mole  ======

Inserts between block 4 and 5 in window
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp

Alignment block 5 of 429 in window, 43444746 - 43444759, 14 bps 
B D                     Human  cacac----ac----------------------acc-----catt-
B D                     Chimp  tacac----ac----------------------acc-----catt-
B D                   Gorilla  cacac----ac----------------------acc-----catt-
B D                 Orangutan  cacac----ac----------------------acc-----catt-
B D                    Gibbon  cacac----ac----------------------acc-----catt-
B D                    Rhesus  cacac----ac----------------------acc-----catt-
B D       Crab-eating macaque  cacac----ac----------------------acc-----catt-
B D                    Baboon  cacac----ac----------------------acc-----catt-
B D              Green monkey  cacac----ac----------------------acc-----catt-
B D                  Marmoset  caccccc--ac----------------------ccc-----catt-
B D           Squirrel monkey  caccccccaac----------------------ccc-----catt-
B D                  Bushbaby  ttca-----at----------------------ccc-----caga-
           Chinese tree shrew  tgca-----tc----------------------ccc-----caat-
B D                  Squirrel  -------------attc-------------a-cccc-----tagt-
B D           Chinese hamster  ---------------------------------cca-----caag-
               Golden hamster  ---------------------------------ccc-----caga-
B D                     Mouse  ---------------------------------cac-----acac-
B D                       Rat  ---------------------------------ccc-----agag-
B D            Naked mole-rat  ---------cacc--------------------ccc-----tagt-
B D                Guinea pig  ---------ca----------------------ccc-----cagc-
                   Chinchilla  ---------ca-c--------------------ccc-----cagc-
             Brush-tailed rat  ---------ca-c--------------------ccc-----cagt-
B D                    Rabbit  --------------tgc-------------attgcc-----caat-
B D                      Pika  --------------tgc-------------attccc-----cagt-
B D                       Pig  --------------tct-------------agaccc-----caat-
B D                    Alpaca  --------------tcc-------------acccccctcttcaat-
               Bactrian camel  --------------tcc-------------acccccctcttcaat-
B D                   Dolphin  --------------tcc-------------acc-cc-----caat-
                 Killer whale  --------------tcc-------------acc-cc-----caat-
             Tibetan antelope  --------------tcc-------------gcctcc-----cagt-
B D                       Cow  --------------tcc-------------acctcc-----cagt-
B D                     Sheep  --------------tcc-------------gcctcc-----cagt-
                Domestic goat  --------------tct-------------gcctcc-----cagt-
B D                     Horse  --------------tct-------------accccc-----aaat-
B D          White rhinoceros  --------------ttc-------------acccct-----caat-
B D                       Cat  --------------tcc-------------atcccc-----taat-
B D                       Dog  --------------cccccaattcctttttcccccc-----caat-
B D                   Ferret   --------------c-c-------------accccc-----caat-
B D                     Panda  --------------ccc-------------accccc-----caat-
               Pacific walrus  --------------cac-------------accccc-----caat-
                 Weddell seal  --------------cac-------------actccc-----ccat-
             Black flying-fox  --------------------------------cccc-----catt-
B D                   Megabat  --------------------------------cccc-----catt-
                Big brown bat  --------------tct-------------a-tccc-----catt-
         David's myotis (bat)  --------------tct-------------a-gccc-----catt-
B D                  Microbat  --------------tct-------------a-gccc-----catt-
              Star-nosed mole  --------------ctt-------------actccc-----caat-
B D                  Elephant  -------------------------------ccccc----------
          Cape elephant shrew  -------------------------------cttcc----------
B D                   Manatee  -------------------------------ccccc----------
B D                    Tenrec  -------------------------------tcctc----------
                     Aardvark  -------------------------------tcctc-----catc-
B D           Tasmanian devil  ----------------------------atattctc-----tactc
B D              Nile tilapia  ==============================================
  D          Peregrine falcon  ==============================================
  D              Saker falcon  ==============================================
    Mexican tetra (cavefish)  ==============================================
                 Spotted gar  ==============================================
B D                Coelacanth  ==============================================
B D                 Zebrafish  ==============================================
  D               Rock pigeon  ==============================================
  D              Mallard duck  ==============================================
B D                 Tetraodon  ==============================================
  D  Chinese softshell turtle  ==============================================
B D                   Chicken  ==============================================
B D       Medium ground finch  ==============================================
B D                    Turkey  ==============================================
B D             X. tropicalis  ==============================================
  D            Painted turtle  ==============================================
B D               Zebra finch  ==============================================
  D       Collared flycatcher  ==============================================
B D        American alligator  ==============================================
          Tibetan ground jay  ==============================================
B D                    Lizard  ==============================================
  D    White-throated sparrow  ==============================================
B D                   Wallaby  ==============================================
B D                  Platypus  ==============================================
  D    Spiny softshell turtle  ==============================================
  D           Green seaturtle  ==============================================
B D                   Opossum  ==============================================
      Lesser Egyptian jerboa  ----------------------------------------------
B D                 Armadillo  ==============================================
            Cape golden mole  ==============================================

Alignment block 6 of 429 in window, 43444760 - 43444776, 17 bps 
B D                     Human  t--cttatacacacat-cc-------------c
B D                     Chimp  t--cttacacacacat-cc-------------c
B D                   Gorilla  t--cttacacacacat-cc-------------c
B D                 Orangutan  t--cttacacacacat-cc-------------c
B D                    Gibbon  t--cttacacacacat-cc-------------c
B D                    Rhesus  t--ctcacacacacat-cc-------------c
B D       Crab-eating macaque  t--ctcacacacacat-cc-------------c
B D                    Baboon  t--ctcacacacacat-cc-------------c
B D              Green monkey  t--ctcacacacacat-cc-------------c
B D                  Marmoset  t--cttacatacacat-cc-------------c
B D           Squirrel monkey  t--cttacatacacat-cc-------------c
B D                  Bushbaby  t--cctacatacacag-cc-------------t
           Chinese tree shrew  t--cctacaaacacat-cc-------------t
B D                  Squirrel  c--cctatgtatacat-c--------------c
       Lesser Egyptian jerboa  -----ctcacaaacag-ttcttgggcatgcacc
B D           Chinese hamster  agccccatccacgaag-ct-------------c
               Golden hamster  g--cccatccacacag-ct-------------c
B D                     Mouse  a--cacacacacacag-ct-------------c
B D                       Rat  t--catacacacacag-ct-------------c
B D            Naked mole-rat  t--cctacatgtatat-tc-------------c
B D                Guinea pig  t--cctacatacatgt-tc-------------c
                   Chinchilla  t--cctacacacatgt-tc-------------t
             Brush-tailed rat  t--cctacatgtgtgt-tc-------------t
B D                    Rabbit  t--cctatg-acacat-tc-------------t
B D                      Pika  t--cctaca-acacat-cc-------------t
B D                       Pig  t--cctgcacacatac-cc-------------c
B D                    Alpaca  t--cctacacacatacttc-------------c
               Bactrian camel  t--cctacacacatacttc-------------c
B D                   Dolphin  t--cctacatacatac-cc-------------c
                 Killer whale  t--cctacatacatat-cc-------------c
             Tibetan antelope  t--cctacatatatac-tc-------------c
B D                       Cow  t--cctacatatatat-tc-------------c
B D                     Sheep  t--cctacatatatac-tc-------------c
                Domestic goat  t--cctacatatatac-tc-------------c
B D                     Horse  t--cctacatacgtat-cc-------------t
B D          White rhinoceros  t--cctacatacatat-cc-------------c
B D                       Cat  t--cctacatacagat-cc-------------c
B D                       Dog  t--cctatatacagat-cc-------------c
B D                   Ferret   t--actacatacagat-cc-------------c
B D                     Panda  t--cctacatacagat-cc-------------c
               Pacific walrus  t--cctacatacagat-cc-------------c
                 Weddell seal  t--cctacaaacagat-cc-------------c
             Black flying-fox  t--cccacatacacat-tc-------------c
B D                   Megabat  t--cccacatacacat-tc-------------c
                Big brown bat  t--cctacatacacat-tc-------------c
         David's myotis (bat)  t--cctgcatacacat-tc-------------c
B D                  Microbat  t--cctgcatacacat-tc-------------c
              Star-nosed mole  t--cctacattcacag-cc-------------c
B D                  Elephant  a--gccatacacacat-ct-------------t
          Cape elephant shrew  ---tcaacacatacgt-ct-------------t
B D                   Manatee  c--gca--acgcacat-ct-------------t
B D                    Tenrec  ---------ctcgcat-cc-------------t
                     Aardvark  c--cctaaacatacat-cc-------------t
B D           Tasmanian devil  ----ctttacg-caat-cc-------------a
B D                   Wallaby  t--ccttcactcccac-cc-------------c
B D              Nile tilapia  =================================
  D          Peregrine falcon  =================================
  D              Saker falcon  =================================
    Mexican tetra (cavefish)  =================================
                 Spotted gar  =================================
B D                Coelacanth  =================================
B D                 Zebrafish  =================================
  D               Rock pigeon  =================================
  D              Mallard duck  =================================
B D                 Tetraodon  =================================
  D  Chinese softshell turtle  =================================
B D                   Chicken  =================================
B D       Medium ground finch  =================================
B D                    Turkey  =================================
B D             X. tropicalis  =================================
  D            Painted turtle  =================================
B D               Zebra finch  =================================
  D       Collared flycatcher  =================================
B D        American alligator  =================================
          Tibetan ground jay  =================================
B D                    Lizard  =================================
  D    White-throated sparrow  =================================
B D                  Platypus  =================================
  D    Spiny softshell turtle  =================================
  D           Green seaturtle  =================================
B D                   Opossum  =================================
B D                 Armadillo  =================================
            Cape golden mole  =================================

Inserts between block 6 and 7 in window
B D          Tasmanian devil 3bp
B D                  Wallaby 3bp

Alignment block 7 of 429 in window, 43444777 - 43444804, 28 bps 
B D                     Human  atatcattct------------------------------------------------------------
B D                     Chimp  atatcattct------------------------------------------------------------
B D                   Gorilla  atatcattct------------------------------------------------------------
B D                 Orangutan  atatcattct------------------------------------------------------------
B D                    Gibbon  atatcattct------------------------------------------------------------
B D                    Rhesus  atatcattct------------------------------------------------------------
B D       Crab-eating macaque  atatcattct------------------------------------------------------------
B D                    Baboon  atatcattct------------------------------------------------------------
B D              Green monkey  atatcattct------------------------------------------------------------
B D                  Marmoset  atatcattct------------------------------------------------------------
B D           Squirrel monkey  atataattct------------------------------------------------------------
B D                  Bushbaby  atatcatttt------------------------------------------------------------
           Chinese tree shrew  gtatcatttt------------------------------------------------------------
B D                  Squirrel  acatcattct------------------------------------------------------------
       Lesser Egyptian jerboa  tcattattct------------------------------------------------------------
B D           Chinese hamster  acatcattct------------------------------------------------------------
               Golden hamster  acatcattct------------------------------------------------------------
B D                     Mouse  acatcattct------------------------------------------------------------
B D                       Rat  ctatcactct------------------------------------------------------------
B D            Naked mole-rat  acattattct------------------------------------------------------------
B D                Guinea pig  gcattattct------------------------------------------------------------
                   Chinchilla  acattattct------------------------------------------------------------
             Brush-tailed rat  acattattgt------------------------------------------------------------
B D                    Rabbit  gtatcattct------------------------------------------------------------
B D                      Pika  gtatcattct------------------------------------------------------------
B D                       Pig  ctatctttct------------------------------------------------------------
B D                    Alpaca  ttattattct------------------------------------------------------------
               Bactrian camel  ttatcattct------------------------------------------------------------
B D                   Dolphin  ctatcattct------------------------------------------------------------
                 Killer whale  ctatcattct------------------------------------------------------------
             Tibetan antelope  ctattgctct------------------------------------------------------------
B D                       Cow  ctattgctct------------------------------------------------------------
B D                     Sheep  ctatcgctct------------------------------------------------------------
                Domestic goat  ctatcgctct------------------------------------------------------------
B D                     Horse  atatcatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
B D          White rhinoceros  ttatcattct------------------------------------------------------------
B D                       Cat  ctatcattct------------------------------------------------------------
B D                       Dog  ctatcatttt------------------------------------------------------------
B D                   Ferret   ctatcattct------------------------------------------------------------
B D                     Panda  ctatcatact------------------------------------------------------------
               Pacific walrus  ctatcattct------------------------------------------------------------
                 Weddell seal  ctatcattct------------------------------------------------------------
             Black flying-fox  c---------------------------------------------------------------------
B D                   Megabat  c---------------------------------------------------------------------
                Big brown bat  ctatcattct------------------------------------------------------------
         David's myotis (bat)  ctatcattcc------------------------------------------------------------
B D                  Microbat  ctatcattct------------------------------------------------------------
              Star-nosed mole  ctatcattct------------------------------------------------------------
B D                  Elephant  ctttcattct------------------------------------------------------------
          Cape elephant shrew  ctatcattct------------------------------------------------------------
B D                   Manatee  ctatcattct------------------------------------------------------------
B D                    Tenrec  cagtcacttt------------------------------------------------------------
                     Aardvark  ctatcattct------------------------------------------------------------
B D                   Opossum  atatcactca------------------------------------------------------------
B D           Tasmanian devil  atacctatct------------------------------------------------------------
B D                   Wallaby  atatcagcct------------------------------------------------------------
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D                 Armadillo  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ----------------------------------------cgatc--atctc--aggaa----t---ag
                        Chimp  ----------------------------------------cgatc--atctc--aggaa----t---ag
                      Gorilla  ----------------------------------------cgatc--atctc--aggaa----t---ag
                    Orangutan  ----------------------------------------caatc--atctc--aggaa----t---ag
                       Gibbon  ----------------------------------------ctatc--atctc--aggaa----t---ag
                       Rhesus  ----------------------------------------cgatc--atctc--aggaa----t---ag
          Crab-eating macaque  ----------------------------------------cgatc--atctc--aggaa----t---ag
                       Baboon  ----------------------------------------cgatc--atctc--aggaa----t---ag
                 Green monkey  ----------------------------------------tgatc--atctc--aggaa----t---ag
                     Marmoset  ----------------------------------------taatc--atctc--aggag----t---aa
              Squirrel monkey  ----------------------------------------taatc--atctc--aggaa----t---aa
                     Bushbaby  ----------------------------------------caatc--atctc--aagaa----c---a-
           Chinese tree shrew  ----------------------------------------caaac--atctt--gggaa----c---ag
                     Squirrel  ----------------------------------------caatc--atccc--aggaa----c---ca
       Lesser Egyptian jerboa  ----------------------------------------caaac--cctca--g-gaa----c---ag
              Chinese hamster  ----------------------------------------cagtc--atctc--a-gaa----g---ag
               Golden hamster  ----------------------------------------cagcc--atctc--a-gaa----g---ag
                        Mouse  ----------------------------------------cagtc--atctc--a-gac----c---ag
                          Rat  ----------------------------------------caatc--atctc--a-gaa----c---ag
               Naked mole-rat  ----------------------------------------taatc--acatc--aagta----c---ag
                   Guinea pig  ----------------------------------------taatc--acatc--aagca----c---ag
                   Chinchilla  ----------------------------------------cgatc--acacc--aggta----c---ag
             Brush-tailed rat  ----------------------------------------tgatc--acacc--aggta----cagaag
                       Rabbit  ----------------------------------------caatc--atttc--aggaa----t---ag
                         Pika  ----------------------------------------caatcttttttc--aggaa----t---a-
                          Pig  ----------------------------------------caatc--atctc--aggaagaggg---ag
                       Alpaca  ----------------------------------------ccatc--atctc--agaaa----c---ag
               Bactrian camel  ----------------------------------------ccatc--atctc--agaaa----c---gg
                      Dolphin  ----------------------------------------caatc--atctc--aggaa----c---ag
                 Killer whale  ----------------------------------------caatc--atctc--aggaa----c---ag
             Tibetan antelope  ----------------------------------------caatc--ctccc--aggaa----c---aa
                          Cow  ----------------------------------------caatc--ctccc--aggaa----c---aa
                        Sheep  ----------------------------------------caatc--ctccc--aggaa----c---aa
                Domestic goat  ----------------------------------------caatc--ctccc--aggaa----c---aa
                        Horse  nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngggca---------------aa----c---ag
             White rhinoceros  ----------------------------------------caatc--atctc--aggaa----c---ag
                          Cat  ----------------------------------------gaatc--atctc--aggaa----c---ag
                          Dog  ----------------------------------------gagtc--atctc--aggaa----c---ag
                      Ferret   ----------------------------------------gaatc--atctc--aggaa----c---ag
                        Panda  ----------------------------------------gaatc--atctc--agcaa----c---ag
               Pacific walrus  ----------------------------------------gaatc--atctc--aggaa----c---ag
                 Weddell seal  ----------------------------------------gaat---atctc--aggaa----c---ag
             Black flying-fox  -----------------------------------------aatc--atctctcaagaa----g---aa
                      Megabat  ------------------------------------------atc--atctc------a----g---ag
                Big brown bat  ----------------------------------------caatc--atctc--aggaa----t---gg
         David's myotis (bat)  ----------------------------------------caatc--atccc--aggaa----t---gg
                     Microbat  ----------------------------------------caatc--atctc--aggaa----t---gg
              Star-nosed mole  ----------------------------------------caatc--atttc--aggaa----t---gg
                     Elephant  ----------------------------------------caatc--agctc--agcaa----c---ag
          Cape elephant shrew  ----------------------------------------caatt--atctc--accaa----c---ag
                      Manatee  ----------------------------------------caatc--agctc--aacaa----c---ag
                       Tenrec  ----------------------------------------ccatg--ggctc--atcaa----c---ag
                     Aardvark  ----------------------------------------caatc--agctc--agcaa----g---aa
                      Opossum  ----------------------------------------caaag--atctc--aggaa----c---ag
              Tasmanian devil  ----------------------------------------caaag--aactc--agaga----c---aa
                      Wallaby  ----------------------------------------gaaag--aaccc--aggga----c---ag
                 Nile tilapia  =====================================================================
             Peregrine falcon  =====================================================================
                 Saker falcon  =====================================================================
     Mexican tetra (cavefish)  =====================================================================
                  Spotted gar  =====================================================================
                   Coelacanth  =====================================================================
                    Zebrafish  =====================================================================
                  Rock pigeon  =====================================================================
                 Mallard duck  =====================================================================
                    Tetraodon  =====================================================================
     Chinese softshell turtle  =====================================================================
                      Chicken  =====================================================================
          Medium ground finch  =====================================================================
                       Turkey  =====================================================================
                X. tropicalis  =====================================================================
               Painted turtle  =====================================================================
                  Zebra finch  =====================================================================
          Collared flycatcher  =====================================================================
           American alligator  =====================================================================
           Tibetan ground jay  =====================================================================
                       Lizard  =====================================================================
       White-throated sparrow  =====================================================================
                     Platypus  =====================================================================
       Spiny softshell turtle  =====================================================================
              Green seaturtle  =====================================================================
                    Armadillo  =====================================================================
             Cape golden mole  =====================================================================

Alignment block 8 of 429 in window, 43444805 - 43444809, 5 bps 
B D                     Human  ggatc
B D                     Chimp  ggatc
B D                   Gorilla  ggatc
B D                 Orangutan  ggatc
B D                    Gibbon  ggatc
B D                    Rhesus  ggatc
B D       Crab-eating macaque  ggatc
B D                    Baboon  ggatc
B D              Green monkey  ggatc
B D                  Marmoset  gaatt
B D           Squirrel monkey  gaatt
B D                  Bushbaby  gcatc
           Chinese tree shrew  ggatc
B D                  Squirrel  agatc
       Lesser Egyptian jerboa  ggagc
B D           Chinese hamster  ggatc
               Golden hamster  ggatc
B D                     Mouse  ggatc
B D                       Rat  gggtc
B D            Naked mole-rat  aggtc
B D                Guinea pig  aggta
                   Chinchilla  aggtc
             Brush-tailed rat  aggtc
B D                    Rabbit  ggatc
B D                      Pika  ggatc
B D                       Pig  ggagc
B D                    Alpaca  agatc
               Bactrian camel  agatc
B D                   Dolphin  ggatc
                 Killer whale  ggatc
             Tibetan antelope  ggatc
B D                       Cow  gggtc
B D                     Sheep  ggatc
                Domestic goat  ggatc
B D                     Horse  gattc
B D          White rhinoceros  tgatc
B D                       Cat  ggatc
B D                       Dog  gaatc
B D                   Ferret   ggacc
B D                     Panda  ggatc
               Pacific walrus  ggatc
                 Weddell seal  ggatc
             Black flying-fox  ggatc
B D                   Megabat  agatc
                Big brown bat  ggatc
         David's myotis (bat)  ggatc
B D                  Microbat  ggatc
              Star-nosed mole  acatc
B D                  Elephant  ggatc
          Cape elephant shrew  agctc
B D                   Manatee  ggatc
B D                    Tenrec  ggagc
                     Aardvark  ggatc
B D                   Opossum  aaatt
B D           Tasmanian devil  aagtc
B D                   Wallaby  aaatc
  D            Painted turtle  gtatc
B D              Nile tilapia  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
    Mexican tetra (cavefish)  =====
                 Spotted gar  =====
B D                Coelacanth  =====
B D                 Zebrafish  =====
  D               Rock pigeon  =====
  D              Mallard duck  =====
B D                 Tetraodon  =====
  D  Chinese softshell turtle  =====
B D                   Chicken  =====
B D       Medium ground finch  =====
B D                    Turkey  =====
B D             X. tropicalis  =====
B D               Zebra finch  =====
  D       Collared flycatcher  =====
B D        American alligator  =====
          Tibetan ground jay  =====
B D                    Lizard  =====
  D    White-throated sparrow  =====
B D                  Platypus  =====
  D    Spiny softshell turtle  =====
  D           Green seaturtle  =====
B D                 Armadillo  =====
            Cape golden mole  =====

Alignment block 9 of 429 in window, 43444810 - 43444825, 16 bps 
B D                     Human  aaca-gag---taat-gtac-a----
B D                     Chimp  aaca-gag---taat-gtac-a----
B D                   Gorilla  aaca-gag---taat-gtac-a----
B D                 Orangutan  aaca-gag---taat-gtac-a----
B D                    Gibbon  aaca-aag---taat-gtac-a----
B D                    Rhesus  aaca-gag---taat-gcac-a----
B D       Crab-eating macaque  aaca-gag---taat-gcac-a----
B D                    Baboon  aaca-gag---taat-gcac-a----
B D              Green monkey  aaca-gag---taat-gcac-a----
B D                  Marmoset  aacc-gag---taat-gtac-a----
B D           Squirrel monkey  aaca-gag---taat-gcac-a----
B D                  Bushbaby  aaca-gag---cgat-acac-a----
           Chinese tree shrew  aaca-cag---taat-atac-a----
B D                  Squirrel  aatg-gag---caac-tcac-a----
       Lesser Egyptian jerboa  acga-gaa---gtat-gcac-a----
B D           Chinese hamster  aaca-gag---caaaggcac-a----
               Golden hamster  aaca-gag---caac-acac-a----
B D                     Mouse  agta-cag---tagt-gcac-a----
B D                       Rat  agta-cag---gaag-acac-a----
B D            Naked mole-rat  aaca-gag---taat-gcat-a----
B D                Guinea pig  aaca-gga---taag-gcat-g----
                   Chinchilla  aaca-ggg---gaag-gcat-g----
             Brush-tailed rat  aaca-ggg---taa--gcag-g----
B D                    Rabbit  agca-ggt---catt-gtac-a----
B D                      Pika  aacacatt---tttt-gtac-a----
B D                       Pig  aacc-gag---tact-gcac-a----
B D                    Alpaca  aaca-gag---caat-gtac-a----
               Bactrian camel  aaca-gag---caat-gtac-a----
B D                   Dolphin  aaca-gagtaataat-gtac-a----
                 Killer whale  aaca-gagtaataat-gtac-a----
             Tibetan antelope  aaca-gag---taat-gtac-a----
B D                       Cow  aaca-gag---taat-gtac-a----
B D                     Sheep  aaca-gag---taat-gcac-a----
                Domestic goat  aaca-gag---taat-gcac-a----
B D                     Horse  aacg-gac---tcat-gtacaa----
B D          White rhinoceros  aaca-gag---tcat-gtac-a----
B D                       Cat  aaga-gag---taat-gtgc-a----
B D                       Dog  aaga-gag---taat-gtac-a----
B D                   Ferret   aaga-gag---taat-gtac-a----
B D                     Panda  aaga-gag---taat-gtac-a----
               Pacific walrus  aaga-gag---taat-gtac-t----
                 Weddell seal  aaga-gag---taat-gtac-a----
             Black flying-fox  aaca-gaa---aaat-gcac-a----
B D                   Megabat  -aca-g-a---aaat-gcac-a----
                Big brown bat  aaca-gaa---taat-gcac-a----
         David's myotis (bat)  aaca-gaa---taat-gcac-a----
B D                  Microbat  caca-gaa---taat-gcac-a----
              Star-nosed mole  aaca-gag---taac-atac-a----
B D                  Elephant  aaca-gag---taat-gtac-g----
          Cape elephant shrew  aaaa-gag---taac-atgc-a----
B D                   Manatee  aaca-gag---cagt-gtac-g----
B D                    Tenrec  aaca-gaa---tagc-ccac-a----
                     Aardvark  caca-gag---caaa-tgac-a----
B D                   Opossum  aaaa-gaa---ggaa-atgc-a----
B D           Tasmanian devil  aaaa-gaa---ggaa-atgc-a----
B D                   Wallaby  aaaa--aa---ggaa-atgc-a----
B D        American alligator  -----aaa---aaaa-tcac-ataca
  D            Painted turtle  -----tac---aaaa-tcac-agg--
B D              Nile tilapia  ==========================
  D          Peregrine falcon  ==========================
  D              Saker falcon  ==========================
    Mexican tetra (cavefish)  ==========================
                 Spotted gar  ==========================
B D                Coelacanth  ==========================
B D                 Zebrafish  ==========================
  D               Rock pigeon  ==========================
  D              Mallard duck  ==========================
B D                 Tetraodon  ==========================
  D  Chinese softshell turtle  ==========================
B D                   Chicken  ==========================
B D       Medium ground finch  ==========================
B D                    Turkey  ==========================
B D             X. tropicalis  ==========================
B D               Zebra finch  ==========================
  D       Collared flycatcher  ==========================
          Tibetan ground jay  ==========================
B D                    Lizard  ==========================
  D    White-throated sparrow  ==========================
B D                  Platypus  ==========================
  D    Spiny softshell turtle  ==========================
  D           Green seaturtle  ==========================
B D                 Armadillo  ==========================
            Cape golden mole  ==========================

Inserts between block 9 and 10 in window
B D       American alligator 1bp
  D           Painted turtle 3bp

Alignment block 10 of 429 in window, 43444826 - 43444854, 29 bps 
B D                     Human  gaggt-ataaaaaga-aaag-ctagcaaaggc
B D                     Chimp  gaggt-ataaaaaga-aaag-ctagcaaaggc
B D                   Gorilla  gaggt-ataaaaaga-aaag-ctagcaaaggc
B D                 Orangutan  gaggt-atagaaaga-aaag-ctagcgaaggc
B D                    Gibbon  gagat-ataaaaaga-aaag-ctagcaaaggc
B D                    Rhesus  gagat-ataaaaaga-aaag-ctagcaaaggc
B D       Crab-eating macaque  gagat-ataaaaaga-aaag-ctagcaaaggc
B D                    Baboon  gagat-ataaaaaga-aaag-ctagcaaaggc
B D              Green monkey  gagat-ataaaaaga-aaag-ctagcaaaggc
B D                  Marmoset  gaggt-ataaaaaga-aaag-ctagaaaaggc
B D           Squirrel monkey  gaggt-ataaaaaga-gaaa-ctagaaaaggc
B D                  Bushbaby  aaggt-ataaaaaga----------------c
           Chinese tree shrew  aag-t-atgaaaagagaaag-ctaac-aagac
B D                  Squirrel  aagat-acaaaaggaaaaaa-ctagagaaggc
       Lesser Egyptian jerboa  a---g-actacggcaagaag-cttgccagggc
B D           Chinese hamster  aag-g-actaaagagaaaag-tgagcaggggc
               Golden hamster  gag-g-actaaagagaaaag-tgagcagggac
B D                     Mouse  aag-g-actaagaagaaaa-------------
B D                       Rat  aa--g-actaagaataaaat-ggagccagg--
B D            Naked mole-rat  aaggt-acagaaagagaaag-ctaacaaaggc
B D                Guinea pig  aaggt-gcagaaagaggaag-ctaacaaaggc
                   Chinchilla  aaggt-acagaaagaggaag-ctaacacaggc
             Brush-tailed rat  aaggt-acagaaagagaaag-ctaacaaaggc
B D                    Rabbit  aaggc-ataaaaagagaaag-ctagcaaaggc
B D                      Pika  aaggctttaaagaaaaaaag-ctagcaaaggc
B D                       Pig  aaggt-ataaaacga-----------aaagga
B D                    Alpaca  aaggt-atgaaaagacagag-ctagcaaaggc
               Bactrian camel  aaggt-atgaaaagacagag-ctagcaaaggc
B D                   Dolphin  aaggt-ataaaaagagaaag-ttagcaagggc
                 Killer whale  aaggt-ataaaaagagaaag-ctagcaagggc
             Tibetan antelope  aagat-ataaaaagaggaag-ctagcaagggc
B D                       Cow  aaggt-ataaaaagagaaag-ctagcaagggc
B D                     Sheep  aaggt-ataaaaag-gcaag-c--gcaagggc
                Domestic goat  aaggt-ataaaaagaggaag-ctagcaagggc
B D                     Horse  aaggc-ataaacgaggaaac-ctcgaaaaggc
B D          White rhinoceros  aaggt-ataaaaagagaaag-ccagaaaaggc
B D                       Cat  aaggt-ataaagagagaaag-cttgcaaaggc
B D                       Dog  aagat-ataaagagagaaag-cttg-aaaggc
B D                   Ferret   aaggt-ataaagagggaaag-cttgccaaggc
B D                     Panda  aaagt-ataaagagagaaag-cttgcaaaggc
               Pacific walrus  aagat-ataaagagagaaag-cttgcaaaggc
                 Weddell seal  aagat-ataaagagaaaaag-cttgcaaaggc
             Black flying-fox  aaagt-at--aacaggaaag-ctagcaaaggc
B D                   Megabat  aaagt-at---acaggaaag-ctagcaaaggc
                Big brown bat  aaggt-ataaaaagagaaag-ctaacaaaggc
         David's myotis (bat)  aaggt-ataaaaagagaaag-ctaggaaaggc
B D                  Microbat  aaggt-ataaaaagagaaag-ctagccaaggc
              Star-nosed mole  aagga-ataaaaagaggaag-ttagcaaaggc
B D                  Elephant  aaggt-ggaaaaagaaaaaa-ctagcaaaggc
          Cape elephant shrew  aaggt-agtaaatgagaagg-ctggtgaaggc
B D                   Manatee  aaggt-acaaaaagagaaag-ctagcaaaggc
             Cape golden mole  gaggt-agaaaaagagaggc-ctatc-aaggc
B D                    Tenrec  gaatc-cacaagagggaaag-ctggc-cacgc
                     Aardvark  aaggt-agaaaacaagaaag-gaagcaaaggt
B D                   Opossum  gaggg-atatagatagaaag-ctggcaaaggt
B D           Tasmanian devil  gagtt-aagaaaacaaaaat-ctggcaaagga
B D                   Wallaby  gacgt-ataaagacagaaag-ctggcaaaggg
B D        American alligator  aaact-gcaaaagta-aatg-ttagtgaaaat
  D           Green seaturtle  gaatt-gcaaaaacg-aatg-ttagtgaaaat
  D            Painted turtle  gaatt-gcaaaaatg-aattcttagtgaaaat
B D              Nile tilapia  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
    Mexican tetra (cavefish)  ================================
                 Spotted gar  ================================
B D                Coelacanth  ================================
B D                 Zebrafish  ================================
  D               Rock pigeon  ================================
  D              Mallard duck  ================================
B D                 Tetraodon  ================================
  D  Chinese softshell turtle  ================================
B D                   Chicken  ================================
B D       Medium ground finch  ================================
B D                    Turkey  ================================
B D             X. tropicalis  ================================
B D               Zebra finch  ================================
  D       Collared flycatcher  ================================
          Tibetan ground jay  ================================
B D                    Lizard  ================================
  D    White-throated sparrow  ================================
B D                  Platypus  ================================
  D    Spiny softshell turtle  ================================
B D                 Armadillo  ================================

Alignment block 11 of 429 in window, 43444855 - 43444975, 121 bps 
B D                     Human  a-------agcaaa--gc----------caccatgta---ggagt-----------aaggaac---tgca
B D                     Chimp  a-------agcaaa--gc----------caccatgta---ggagt-----------aaggaac---tgca
B D                   Gorilla  a-------agcaaa--gc----------caccatgta---ggagt-----------aaggaac---tgca
B D                 Orangutan  a-------agcaaa--gc----------caccatgca---ggagt-----------aaggaac---tgca
B D                    Gibbon  a-------agcaaa--gc----------caccatgta---ggagt-----------aaggaac---tgca
B D                    Rhesus  a-------agcaaa--gc----------caccatgca---ggaat-----------aaggaac---tgca
B D       Crab-eating macaque  a-------agcaaa--gc----------caccatgca---ggaat-----------aaggaac---tgca
B D                    Baboon  a-------agcaaa--gc----------caccatgta---ggaat-----------aaggaac---tgca
B D              Green monkey  a-------agcaaa--gc----------caccatgta---ggaat-----------aaggaac---tgca
B D                  Marmoset  a-------agcaaa--gc----------cactatatg---ggagt-----------aaggaac---tgca
B D           Squirrel monkey  a-------agcaaa--gc----------cactacatt---gaagt-----------aaggaac---tgca
B D                  Bushbaby  a-------agcaaa--ga----------c---atgca---ggagttccttcttctcaaggaac---tgca
           Chinese tree shrew  a-------agcaaa--aa----------c---atgca---tgagt-----------aaggaat---tgtg
B D                  Squirrel  a-------aacaaa--ac----------c---ctgca---ggcat-----------gaggaac---tgct
       Lesser Egyptian jerboa  g-------aggaga--------------------gcagatggcac-----------gaggagcaagtgca
B D           Chinese hamster  a-------agcaaa--ag----------c---atgca---ggcct-----------gaggagc---tgcg
               Golden hamster  a-------agcaaa--ag----------c---atgca---ggcct-----------gaggagc---tgta
B D                     Mouse  ----------------------------------------------------------------------
B D                       Rat  c-------agcaga--ag----------t---acgca---ggcct-----------gaagcat-------
B D            Naked mole-rat  a-------agcaaa--aa----------c---atgca---ggagt-----------aaggaac---tgca
B D                Guinea pig  a-------agccaa--ag----------c---atgca---gcaat-----------aaggagc---gaca
                   Chinchilla  a-------agccaa--aa----------c---atgcg---ggaat-----------aaagagc---tgcg
             Brush-tailed rat  g-------agccaa--aa----------c---acgca---ggaat-----------aaggagc---tgca
B D                    Rabbit  a-------ggc-aa--aa----------c---gtgca---ggagt-----------aaggaac---tgca
B D                      Pika  a-------ggcaaa--aa----------c---atgca---ggagt-----------acggaac---tgta
B D                       Pig  a-------agcaaa--aa----------c---atgca---ggagt-----------aaggaag---gaca
B D                    Alpaca  a-------agcaaa--aa----------c---atgca---ggagt-----------aaggaag---tgca
               Bactrian camel  a-------agcaaa--aa----------c---gtgca---ggagt-----------aaggaag---tgca
B D                   Dolphin  a-------agcaaa--aa----------c---atgca---ggagt-----------aaggaag---taca
                 Killer whale  a-------agcaaa--aa----------c---atgca---ggagt-----------aaggaag---taca
             Tibetan antelope  a-------agcgaa--aa----------c---ctgcc---gcagc-----------aaggagg---tgca
B D                       Cow  a-------agcaaa--aa----------c---ctgca---gcggc-----------aaggagg---tgca
B D                     Sheep  a-------agcgaa--aa----------c---ctgcc---gcagc-----------aaggagg---tgca
                Domestic goat  a-------agcgaa--aa----------c---ctgcc---gcagc-----------aaggagg---tgca
B D                     Horse  a-------agcaac--ag----------a---a-gca---ggagt-----------aaggacc---tgca
B D          White rhinoceros  a-------agcaac--aa----------c---atgca---ggagc-----------aaggaac---tgca
B D                       Cat  a-------agcaaa--aa----------c---atgca---gaat------------aaggaac---tcca
B D                       Dog  a-------agcaaa--aa----------c---atgca---gaag------------agggaac---tcca
B D                   Ferret   a-------aacaaa--aa----------c---atgca---gaaa------------aaggaac---tcca
B D                     Panda  a-------agcaaa--aa----------c---atgca---gaga------------aaggaac---tcca
               Pacific walrus  a-------agcaaa--aa----------c---atgca---gaaa------------aaggaac---tcca
                 Weddell seal  a-------agcaaa--aa----------c---atgca---gaaa------------aaggaac---tcca
             Black flying-fox  a-------agcaaa--aa----------c---atgca---ggagt-----------aaggaac---tata
                Big brown bat  a-------agcaca--aa----------c---aggca---ggagt-----------aaggagc---taca
         David's myotis (bat)  a-------agcaca--aa----------c---aggca---ggagt-----------aaggagc---taca
B D                  Microbat  a-------agcaca--aa----------c---aggca---ggagg-----------aaggagc---taca
              Star-nosed mole  a-------agcaaa--aa----------c---atgca---agagg-----------aaagaac---taaa
B D                  Elephant  a-------agcaaa--aa----------c---acaca---agagt-----------aaggaac---tgca
          Cape elephant shrew  g-------ag--aa--ac----------c---acaca---a-acc-----------aggggcc---cgca
B D                   Manatee  a-------agcaaa--aa----------c---acgca---agagt-----------aaggaac---tgca
             Cape golden mole  a-------tgtaaa--aa----------c---atgca---ggagc-----------aagaaac-atgctg
B D                    Tenrec  a-------gggaaa--aa----------c---acaca---agaga-----------gaggagc---gaca
                     Aardvark  a-------agcaaa--ga--------------actca---ggagt-----------aaagagc---tgac
B D                   Opossum  --------agaata--aa----------a---acaa-----gact-----------aaatcat---cacg
B D           Tasmanian devil  --------aaaaaaataa----------a---ataaa---caagc-----------aacc-at---catg
B D                   Wallaby  --------gaaaaa--aa----------c---ataaa---agggt-----------aacctat---cata
B D        American alligator  acacccccctcaaa--cc----------tccaatgca---agagt-----------aaatcac---cacg
  D           Green seaturtle  a-------atcaaa--aaaa--------caccataca---agagta----------aaatcac---caca
  D            Painted turtle  a-------agcaaa--acaaaaaaaccccaccatgca---agagta----------aaataac---caca
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Armadillo  ======================================================================

                        Human  taggaaacagt-ag--t-aa----aggtgt-gggttg----tgtcc-agttt-----------------t
                        Chimp  taggaaacagt-ag--t-aa----aggtgt-gggttg----tgtcc-agttt-----------------t
                      Gorilla  taggaaacagt-ag--t-aa----aggcat-gggttg----tgtcc-agttt-----------------t
                    Orangutan  taggagacagc-ag--t-aa----aggtgt-gggttg----tgtcc-agttt-----------------t
                       Gibbon  taggaaacagc-ag--t-aa----acgtgt-gggttg----tgtcc-agttt-----------------t
                       Rhesus  taggaaacagc-ag--t-aa----aggtgt-gggttg----tgtcc-agttt-----------------t
          Crab-eating macaque  taggaaacagc-ag--t-aa----aggtgt-gggttg----tgtcc-agttt-----------------t
                       Baboon  taggaaacagc-ag--t-aa----aggtgt-gggttg----tgtcc-agttt-----------------t
                 Green monkey  taggaaacagc-ag--t-aa----aggtgt-cggttg----tgtcc-agttt-----------------t
                     Marmoset  taggaaacagc-ag--t-aa----aggtgt-gggctg----tgtcc-agttt-----------------t
              Squirrel monkey  taggaaacagc-agtat-aa----aggtgt-gggttg----tgtcc-agttt-----------------t
                     Bushbaby  c------------------------ggtgt-aggttg----tacct-agtttaaaaaaacccaaacaaac
           Chinese tree shrew  gagtgaatgac-ag--c-aa----agg-ga-aggttg----tgccc-agtat------------------
                     Squirrel  ggggaa-cagc-ag--c-aa----aagcat-aggtgg----tgccc-agctt-----------------t
       Lesser Egyptian jerboa  cagtgggcagc-ag--c-aagggcaggcag-aggctg----gactc-agctt-----------------t
              Chinese hamster  taggaaatggc-ag--c-aa----aggtgg-aggctg----tgccc-agcct-----------------t
               Golden hamster  gaggagacggc-ag--c-aa----aggcgg-aggctg----tgccc-agttt-----------------t
                        Mouse  -------caac-ag--c-aa----aggggg-aagctc----tgccc-agctt-----------------t
                          Rat  ----aagcagc-ca--t-ga----aggcag-aagctc----tgccc-agctc-----------------t
               Naked mole-rat  tagtaaacagc-ag--c-aa----aggcgt-aggttg----ttcccttgctt-----------------t
                   Guinea pig  cagtaaacagc-ag--c-ag----aggtgt-aggttg----taccc-agctt-----------------t
                   Chinchilla  tagtaaacacc-ag--c-aa----aggcgt-aggttg----taccc-agctt-----------------t
             Brush-tailed rat  tagtaaacagc-ag--c-aa----aggcgt-aggtcg----tacct-agctc-----------------t
                       Rabbit  tagtaaacagc-tg--c-aa----aggcataaaattg----ggccc-aatct-----------------t
                         Pika  cagtaaacact-gg--c-aa----agacat-aggttg----tgtcc-aacct-----------------t
                          Pig  tggcaaacagcaag--c-aa----aggcag-agtttg----agcct-ggttt-----------------t
                       Alpaca  tagtaaat----------------aggcag-agcttg----tgcct-ggctt-----------------g
               Bactrian camel  tagtaaac----------------aagcag-agcttg----tgcct-ggctt-----------------g
                      Dolphin  tagtaaatagc-ag--c-aa----aggcag-agtttg----tgcct-ggttt-----------------t
                 Killer whale  tagtaaatagc-ag--c-aa----aggcag-agtttg----tgcct-ggttt-----------------a
             Tibetan antelope  gagtaaatatc-ag--c-aa----aggtag-agtgtg----tgcct-ggttt-----------------t
                          Cow  gagtaaatagc-ag--c-aa----aggtag-agtgtg----tgcct-ggttt-----------------t
                        Sheep  gagtaaatatc-ag--c-aa----aggtag-agtgtg----tcctt-ggttt-----------------t
                Domestic goat  cagtaaatatc-ag--c-aa----aggtag-agtgtg----tgcct-ggttt-----------------t
                        Horse  tagcaaacagg-ag--c-aa----aggcaa-agcttg----tgccc-agttt-----------------t
             White rhinoceros  tagtaaacagc-ag--c-aa----aggcat-agcttg----tgccc-agttt-----------------t
                          Cat  tagtaaacagc-ag--c-aa----aggcat-agcttg----tgcct-ggttt-----------------t
                          Dog  tagtaaacagc-ag--c-aa----aggcat-agcttg----tgcct-ggttt-----------------t
                      Ferret   tagtaaacagc-ag--c-ga----aggcat-agcttg----tgcct-ggttt-----------------a
                        Panda  tagtaaacagc-ag--c-aa----aggcat-agcttg----tgcct-ggttt-----------------a
               Pacific walrus  tagtaaacagc-ag--c-aa----aggcat-agcttg----tgcct-gcttt-----------------a
                 Weddell seal  tagtaaacagc-ag--c-aa----aggcat-agcttg----tgcct-gcttt-----------------a
             Black flying-fox  tagcagacagc-ag--c-aa----aggcat-agcttg----tgctc-aattt-----------------a
                Big brown bat  gagtagacagtgag--g-ag----ctgcat-agcttg----tgcct-gtttt----------------gt
         David's myotis (bat)  gagtagacagtgag--g-ag----ctgcat-agcttg----tgcct-ggttt-----------------t
                     Microbat  gagtagacagtgag--g-ag----ctgcat-agcttg----tgcct-gg-tt-----------------t
              Star-nosed mole  cagtaaacagc-ag--t-aa----gg--ag-agtttg----tgccc-agttt-----------------a
                     Elephant  tagtaaacagc-cg--c-aa----aggcat-aggctg----tgctc-agtta-----------------a
          Cape elephant shrew  gagcaggctgg-cg----gc----tggtac-aagccaggcctgctc-atctg-----------------a
                      Manatee  cagtaaacagc-ag--c-aa----aggtgt-agactg----tgcct-agtta-----------------a
             Cape golden mole  ttgtaaacagc-aa--a--------ggcat-aggctg----tgccc-agtta-----------------a
                       Tenrec  cagtaaatggc-ag--c------------------------tgccc-tgtta-----------------a
                     Aardvark  taataaacagt-ag--caaa----aggtgt-aggctg----ggccc-agtta-----------------a
                      Opossum  tggcacacagc-ag--t-ga----cagggc-cgccag----cgccc-aaggg-----------------a
              Tasmanian devil  tgg--gttagt-ag--a-ga----caaagt-cgccac----tgccc-acgca-----------------a
                      Wallaby  tggc-aacagc-ag--c-ga----cagacc-taccag----tgccc-aagtg-----------------a
           American alligator  tggtgaacatc-ag--c-aa----aacctc-acccag----tgccc-agcta-----------------a
              Green seaturtle  tggcaaacatc-ag--c-aa----agcctc-atccag----tgccc-agcta-----------------a
               Painted turtle  tggcaaacatc-ag--c-aa----agcctc-atccag----tgccc-agcta-----------------a
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
                    Tetraodon  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
                     Platypus  ======================================================================
       Spiny softshell turtle  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Armadillo  ======================================================================

                        Human  -t-a---aaa-----------------------------------a--caggactt-attcacaggccat
                        Chimp  -t-a---aaa-----------------------------------a--caggactt-attcacaggccat
                      Gorilla  -t-a---aaa-----------------------------------a--caggactt-attcacaggccat
                    Orangutan  -t-a---aaa-----------------------------------c--cggaactt-attcacaggccat
                       Gibbon  -t-a---aaa-----------------------------------a--caggactt-attcacaggccat
                       Rhesus  -t-a---aaa-----------------------------------a--caggactt-attcataggccat
          Crab-eating macaque  -t-a---aaa-----------------------------------a--caggactt-attcataggccat
                       Baboon  -t-a---aaa-----------------------------------a--caggactt-attcacaagccat
                 Green monkey  -t-a---aaa-----------------------------------a--caggactt-attcacaggccat
                     Marmoset  -t-a---aaa-----------------------------------a--caggactc-attcacaggccac
              Squirrel monkey  -t-a---aaa-----------------------------------a--caggactc-attcacaggccat
                     Bushbaby  -a-a---aaa-----------------------------------a--caggactt-attcacaggccat
           Chinese tree shrew  ---a---aga-----------------------------------a--caggactt-attcacaggccat
                     Squirrel  -g-a---aaa---------------------gg------------a--caggactt-attcacaggccat
       Lesser Egyptian jerboa  -g-ac--gag-----------------------------------a--cacagcgt-agtgaccggccgc
              Chinese hamster  -g-a---aaa-----------------------------------a--caggcctt-attcacaggccat
               Golden hamster  -g-a---aaa-----------------------------------a--taggcctt-attcacaggccat
                        Mouse  -g-a---aaa-----------------------------------a--caggactt-attcccaggtcta
                          Rat  -g-a---caa-----------------------------------a--caggacgt-attcccaggcct-
               Naked mole-rat  -g-aa--aaa-----------------------------------a--caagattt-attcacaggccat
                   Guinea pig  -gaaa--aaa-----------------------------------a--tgagacgt-atgcataggccgt
                   Chinchilla  -g-aa--aaa-----------------------------------a--caagacat-attcttaggcagt
             Brush-tailed rat  -g-aa--aaa-----------------------------------a--caagacgc-attcacaggctgt
                       Rabbit  -t-ca--aaa-----------------------------------a--aaggactt-attttcaggccat
                         Pika  -t-ta--aaa-----------------------------------a--caggactt-attcacaggcaat
                          Pig  -a-aa--aaa-----------------------------------a--caggactt-attcacaggccat
                       Alpaca  -a-aa--aaa-----------------------------------c--cagaactt-attcacaggccat
               Bactrian camel  -a-aa--aaa-----------------------------------c--cagaactt-attcacaggccat
                      Dolphin  aa-aa--aaa-----------------------------------a--caggacttaattcacaggccat
                 Killer whale  aa-aa--aaa-----------------------------------a--caggacttaattcacaggccat
             Tibetan antelope  -a-aa--aag-----------------------------------c--ctggactt-attcacaggccat
                          Cow  -a-aa--aag-----------------------------------c--ctggactt-attcacaggctat
                        Sheep  -a-aa--agg-----------------------------------c--ctggactt-attcacaggccat
                Domestic goat  -a-aa--agg-----------------------------------c--ctggactt-attcacaggccat
                        Horse  -a-aa--aaa-----------------------------------a--caggactt-actcacaggccac
             White rhinoceros  -a-aa--aaa-----------------------------------a--taggactt-attcacaggccat
                          Cat  -t-aa--aaa----------------------a------------a--caggactt-attcacaggccat
                          Dog  -a-aa--aaa---------acaaaaaacacaaa------------a--caggactt-attcacaggccat
                      Ferret   -a-aa--aaa-aaaacaaaacaacaacaacaaa------------a-tgaggactt-attcacaggccat
                        Panda  -a-aa--aaa--------------------aaa------------gaccaggactc-attcacaggccat
               Pacific walrus  -a-ga--acaaccaccaccaccacaacaacaaa------------acccaggactt-agtcacaggccat
                 Weddell seal  -a-aa--aca---------acaacaacaacaaa------------acccaggactt-attcacaggccat
             Black flying-fox  -a-aa--caa----------atgaacaaacaaacaaacaaaaaacc--cagaactt-attcacaggccat
                Big brown bat  -g-tg--tgt----------gtgtgtgtgttta------------a--cagaattt-attcacaggccaa
         David's myotis (bat)  -t-tt--tgt----------gtgtgttttttaa------------a--caggattt-attcacaggccat
                     Microbat  -t-tt--tgt----------gtgtgttttttaa------------a--caggattt-attcacaggccat
              Star-nosed mole  -a-aa--aaa---------------------aa------------g--cagttctt-attcacaggccat
                     Elephant  -a-aaa-aca----------aattaattcacta------------a--taggactt-gttcgcaggcccc
          Cape elephant shrew  -a-aaacatg----------gatcaattcattg------------a--cagg-ttt-gtttaaaggccac
                      Manatee  -a-aaa-aga----------aattaat----ta------------a--caggactt-gttcacaggccct
             Cape golden mole  -a-a-----a----------aattaatt----a------------g--cgggactt-gtttgcagaccac
                       Tenrec  -g-a---ata----------aattaattcacga------------a--cgggactt-ggtcgctggtccc
                     Aardvark  -a-aa--ata----------aattaaataatta------------a--caggactt-gtttgtaggccac
                      Opossum  -a-a---aac-----------------------------------a--cacgtctc-agccacagaccat
              Tasmanian devil  -a-a---aat-----------------------------------a--cacgtctt-agccgcagac---
                      Wallaby  -a-a---aat-----------------------------------a--cacctctt-tgccacagaccac
           American alligator  -a-----aaa-----------------------------------a--catgcctt-agctgcaggccat
              Green seaturtle  -c-----aaa-----------------------------------a--catgcctt-agccacaggccat
               Painted turtle  -c-----aaa-----------------------------------a--catgcctt-agccacaggccat
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
                    Tetraodon  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
                     Platypus  ======================================================================
       Spiny softshell turtle  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Armadillo  ======================================================================

                        Human  ggag-c----aaacacc-----------------------------------------------------
                        Chimp  ggag-c----aaacacc-----------------------------------------------------
                      Gorilla  ggag-c----aaacacc-----------------------------------------------------
                    Orangutan  gaag-c----aaacacc-----------------------------------------------------
                       Gibbon  ggag-c----aaacacc-----------------------------------------------------
                       Rhesus  ggag-c----aaacacc-----------------------------------------------------
          Crab-eating macaque  ggag-c----aaacacc-----------------------------------------------------
                       Baboon  ggag-c----aaacacc-----------------------------------------------------
                 Green monkey  ggag-c----aaacacc-----------------------------------------------------
                     Marmoset  ggag-c----aaacacc-----------------------------------------------------
              Squirrel monkey  ggag-c----aaacacc-----------------------------------------------------
                     Bushbaby  agag-c----aaacatc-----------------------------------------------------
           Chinese tree shrew  ggag-c----aaacacc-----------------------------------------------------
                     Squirrel  ggag-c----aaacact-----------------------------------------------------
       Lesser Egyptian jerboa  ggag-c----aagcact-----------------------------------------------------
              Chinese hamster  ggag-c----aaacacc-----------------------------------------------------
               Golden hamster  ggag-c----aaacacc-----------------------------------------------------
                        Mouse  ggag-t----gaacacc-----------------------------------------------------
                          Rat  ggag-c----aaacacc-----------------------------------------------------
               Naked mole-rat  ggaa-c----aaacacc-----------------------------------------------------
                   Guinea pig  ggaa-c----aaacacc-----------------------------------------------------
                   Chinchilla  ggaa-c----aaacacc-----------------------------------------------------
             Brush-tailed rat  ggaa-c----caacacc-----------------------------------------------------
                       Rabbit  ggag-caaagaaacacc-----------------------------------------------------
                         Pika  gaag-c----aaacacc-----------------------------------------------------
                          Pig  gaag-a----aaacacc-----------------------------------------------------
                       Alpaca  ggag-a----aaacacc-----------------------------------------------------
               Bactrian camel  ggag-a----aaacacc-----------------------------------------------------
                      Dolphin  ggag-a----aaacacc-----------------------------------------------------
                 Killer whale  ggag-a----aaacacc-----------------------------------------------------
             Tibetan antelope  ggag-a----aaacacc-----------------------------------------------------
                          Cow  ggag-------aacacc-----------------------------------------------------
                        Sheep  ggag-a----aaacacc-----------------------------------------------------
                Domestic goat  ggag-a----aaacacc-----------------------------------------------------
                        Horse  ggaacc----aaacacc-----------------------------------------------------
             White rhinoceros  ggag-c----aaacacc-----------------------------------------------------
                          Cat  ggag-t----aaacacc-----------------------------------------------------
                          Dog  ggag-c----aaacacc-----------------------------------------------------
                      Ferret   ggag-c----aaacacc-----------------------------------------------------
                        Panda  ggag-c----aaac--------------------------------------------------------
               Pacific walrus  ggag-c----aaacacc-----------------------------------------------------
                 Weddell seal  ggag-c----aaacacc-----------------------------------------------------
             Black flying-fox  ggaa-c----gaacacc-----------------------------------------------------
                Big brown bat  ggag-c----aaacacc-----------------------------------------------------
         David's myotis (bat)  ggag-c----aatcacc-----------------------------------------------------
                     Microbat  ggag-c----aaacacc-----------------------------------------------------
              Star-nosed mole  ggag-c----aaacacc-----------------------------------------------------
                     Elephant  agtg-c----aaacact-----------------------------------------------------
          Cape elephant shrew  agag-c----aaacatt-----------------------------------------------------
                      Manatee  gaag-c----aaacact-----------------------------------------------------
             Cape golden mole  agag-c----aaacacttctgaaacaatcaaccctttaaaaagtcaaccctaagactgtaatcattgcaa
                       Tenrec  agag-c----aaacact-----------------------------------------------------
                     Aardvark  agag-c----agacact-----------------------------------------------------
                      Opossum  aggg-c----aaacact-----------------------------------------------------
              Tasmanian devil  -----c----aaacact-----------------------------------------------------
                      Wallaby  agag-c----aaacact-----------------------------------------------------
           American alligator  aaag-t----aaacaca-----------------------------------------------------
              Green seaturtle  agag-t----aaacaca-----------------------------------------------------
               Painted turtle  agag-t----aaataca-----------------------------------------------------
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
                    Tetraodon  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
                     Platypus  ======================================================================
       Spiny softshell turtle  ======================================================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Armadillo  ======================================================================

                        Human  -------------------------ataaatctg
                        Chimp  -------------------------ataaatctg
                      Gorilla  -------------------------ataaatctg
                    Orangutan  -------------------------ataaatctg
                       Gibbon  -------------------------ataaatctg
                       Rhesus  -------------------------ataaatctg
          Crab-eating macaque  -------------------------ataaatctg
                       Baboon  -------------------------ataattctg
                 Green monkey  -------------------------ataaatctg
                     Marmoset  -------------------------ataaacctg
              Squirrel monkey  -------------------------ataaacctg
                     Bushbaby  -------------------------ataaaactg
           Chinese tree shrew  -------------------------ataaacatg
                     Squirrel  -------------------------ctaaatcta
       Lesser Egyptian jerboa  -------------------------gtagactcc
              Chinese hamster  -------------------------ataaactct
               Golden hamster  -------------------------ataaaccct
                        Mouse  -------------------------ataaactct
                          Rat  -------------------------atacactgt
               Naked mole-rat  -------------------------ataaacctg
                   Guinea pig  -------------------------ataaacctg
                   Chinchilla  -------------------------ataaacctg
             Brush-tailed rat  -------------------------atcaacctg
                       Rabbit  -------------------------atacatgtg
                         Pika  -------------------------ataaatctg
                          Pig  -------------------------ataaaactg
                       Alpaca  -------------------------ataaaactg
               Bactrian camel  -------------------------ataaaactg
                      Dolphin  -------------------------ataaaactg
                 Killer whale  -------------------------ataaaactg
             Tibetan antelope  -------------------------ataaaactg
                          Cow  -------------------------ataaaactg
                        Sheep  -------------------------ataaaactg
                Domestic goat  -------------------------ataaaactg
                        Horse  -------------------------ataaacctg
             White rhinoceros  -------------------------ataaacctg
                          Cat  -------------------------ataaacctg
                          Dog  -------------------------ataaacctg
                      Ferret   -------------------------ataaacctg
                        Panda  -----------------------------acctg
               Pacific walrus  -------------------------gcaaacctg
                 Weddell seal  -------------------------ataaacctg
             Black flying-fox  -------------------------ataaacctg
                Big brown bat  -------------------------ataaatctg
         David's myotis (bat)  -------------------------ataaatctg
                     Microbat  -------------------------ataaatctg
              Star-nosed mole  -------------------------ataaaccta
                     Elephant  -------------------------ataaacccg
          Cape elephant shrew  -------------------------tgtgatctg
                      Manatee  -------------------------ataaacctg
             Cape golden mole  tgaaatgaaataaaataggatgaatgtaaagctg
                       Tenrec  -------------------------gtaaacctg
                     Aardvark  -------------------------gtaaacctg
                      Opossum  -------------------------gccaacctg
              Tasmanian devil  -------------------------gccaacttg
                      Wallaby  -------------------------gccaacctg
           American alligator  -------------------------gtaaaacag
              Green seaturtle  -------------------------gtaaaaatg
               Painted turtle  -------------------------gcaaaaatg
                 Nile tilapia  ==================================
             Peregrine falcon  ==================================
                 Saker falcon  ==================================
     Mexican tetra (cavefish)  ==================================
                  Spotted gar  ==================================
                   Coelacanth  ==================================
                    Zebrafish  ==================================
                  Rock pigeon  ==================================
                 Mallard duck  ==================================
                    Tetraodon  ==================================
     Chinese softshell turtle  ==================================
                      Chicken  ==================================
          Medium ground finch  ==================================
                       Turkey  ==================================
                X. tropicalis  ==================================
                  Zebra finch  ==================================
          Collared flycatcher  ==================================
           Tibetan ground jay  ==================================
                       Lizard  ==================================
       White-throated sparrow  ==================================
                     Platypus  ==================================
       Spiny softshell turtle  ==================================
                      Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                    Armadillo  ==================================

Inserts between block 11 and 12 in window
         Cape elephant shrew 597bp

Alignment block 12 of 429 in window, 43444976 - 43444999, 24 bps 
B D                     Human  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D                     Chimp  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D                   Gorilla  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D                 Orangutan  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D                    Gibbon  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D                    Rhesus  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D       Crab-eating macaque  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D                    Baboon  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D              Green monkey  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D                  Marmoset  g--t-------cac--------------------tggatgaaaacaa-----atgc--------------
B D           Squirrel monkey  g--t-------gac--------------------tggatgaaaacaa-----atgc--------------
B D                  Bushbaby  g--t-------cat--------------------tagatggaaacaa-----acac--------------
           Chinese tree shrew  g--t-------cat--------------------tagaatgaaacac-----aggc--------------
B D                  Squirrel  g--t-------cat--------------------tagatggaaacaa-----tggc--------------
       Lesser Egyptian jerboa  a--c-------tgt--------------------cagatggaaacaa-----accg--------------
B D           Chinese hamster  g--t-------tgt--------------------tatatggaaataa-----atgc--------------
               Golden hamster  g--t-------tgt--------------------tatatggaaataa-----acac--------------
B D                     Mouse  g--c-------tgt--------------------tacgtggaaataa-----agga--------------
B D                       Rat  g--t-------tgt--------------------tacagggaaataa-----acgc--------------
B D            Naked mole-rat  g--t-------cat--------------------aagatggaaacaa-----atgc--------------
B D                Guinea pig  a--c-------cat--------------------tagatgcaaacaa-----gtgg--------------
                   Chinchilla  a--c-------cat--------------------tagatggaaacaa-----atgc--------------
             Brush-tailed rat  a--c-------cat--------------------cagatggaaacaa-----atgc--------------
B D                    Rabbit  g--t-------cat--------------------tacatagaaatga-----atat--------------
B D                      Pika  g--c-------tgt--------------------tagatggaaatga-----atgt--------------
B D                       Pig  g--t-------cct--------------------tagatgaaaacaa-----atga--------------
B D                    Alpaca  a--t-------cat--------------------tagaggaaaataa-----atga--------------
               Bactrian camel  a--t-------cat--------------------tagaggaaaataa-----atga--------------
B D                   Dolphin  g--t-------cat--------------------tagatggaaacaa-----atga--------------
                 Killer whale  g--t-------cat--------------------tagatggaaacaa-----atga--------------
             Tibetan antelope  g--t-------cat--------------------tagatgaaaacaa-----atga--------------
B D                       Cow  g--t-------cat--------------------tagatgaaaacaa-----atga--------------
B D                     Sheep  g--t-------cat--------------------tagatgaaaacaa-----atga--------------
                Domestic goat  g--t-------cat--------------------tagatgaaaacaa-----atga--------------
B D                     Horse  g--t-------cat--------------------tagatgaaaacaa-----acac--------------
B D          White rhinoceros  g--t-------cat--------------------tagatgaaaacaa-----atgc--------------
B D                       Cat  gttt-------cat--------------------tagatgaaaacaa-----acgc--------------
B D                       Dog  gttt-------cat--------------------tagatgaaaacaa-----acac--------------
B D                   Ferret   gttt-------cat--------------------tagatggaaacaa-----acac--------------
B D                     Panda  gttt-------cat--------------------gagatgaaaacaa-----acgc--------------
               Pacific walrus  gttt-------cat--------------------cagatgaaaacaa-----atgc--------------
                 Weddell seal  gttt-------cat--------------------cagatgaaaacaa-----acgc--------------
             Black flying-fox  g--t-------gat--------------------tggacaaaaacaa-----atgc--------------
                Big brown bat  g--t-------cat--------------------tagatgaaaacaa-----atgc--------------
         David's myotis (bat)  g--t-------cat--------------------tagatgaaaacaa-----atgc--------------
B D                  Microbat  g--t-------cat--------------------tagatgaaaacaa-----atgc--------------
              Star-nosed mole  g--t-------tat--------------------tagatg-aaacaa-----aggc--------------
B D                  Elephant  g--t-------tat--------------------tagatgaaaacaa-----atgc--------------
B D                   Manatee  g--t-------tat--------------------tacatgaaaacaa-----atgc--------------
             Cape golden mole  a--tgttctcccatgtaaactatcacccaattcatacacacacacaaaaagtctgtctaccctaaatcat
B D                    Tenrec  g--t-------cat--------------------tagaggcaaacaa-----ctgt--------------
                     Aardvark  g--t-------cat--------------------tagatgaaaacaa-----atgc--------------
B D                   Opossum  g--t-------cac--------------------ttgatgaaaataa-----atgt--------------
B D           Tasmanian devil  g--t-------cac--------------------ttgatgaaaataa-----atgt--------------
B D                   Wallaby  g--t-------cac--------------------ttgatgaaaataa-----gtgt--------------
B D        American alligator  a--t-------cac--------------------tagatggaaacaa-----atgt--------------
  D           Green seaturtle  a--t-------cac--------------------tggatggaaacaa-----actt--------------
  D            Painted turtle  a--t-------ccc--------------------tagatggaaacaa-----actt--------------
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
         Cape elephant shrew  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
B D                   Megabat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                 Armadillo  ======================================================================

                        Human  ----------tg
                        Chimp  ----------tg
                      Gorilla  ----------tg
                    Orangutan  ----------tg
                       Gibbon  ----------tg
                       Rhesus  ----------tg
          Crab-eating macaque  ----------tg
                       Baboon  ----------tg
                 Green monkey  ----------tg
                     Marmoset  ----------tg
              Squirrel monkey  ----------tg
                     Bushbaby  ----------tg
           Chinese tree shrew  ----------ta
                     Squirrel  ----------ta
       Lesser Egyptian jerboa  ----------ca
              Chinese hamster  ----------tg
               Golden hamster  ----------tg
                        Mouse  ----------tg
                          Rat  ----------tg
               Naked mole-rat  ----------tg
                   Guinea pig  ----------tg
                   Chinchilla  ----------tg
             Brush-tailed rat  ----------tg
                       Rabbit  ----------ta
                         Pika  ----------ta
                          Pig  ----------tg
                       Alpaca  ----------tg
               Bactrian camel  ----------tg
                      Dolphin  ----------tg
                 Killer whale  ----------tg
             Tibetan antelope  ----------cg
                          Cow  ----------tg
                        Sheep  ----------tg
                Domestic goat  ----------tg
                        Horse  ----------tg
             White rhinoceros  ----------tg
                          Cat  ----------tg
                          Dog  ----------tg
                      Ferret   ----------cg
                        Panda  ----------cg
               Pacific walrus  ----------tg
                 Weddell seal  ----------tg
             Black flying-fox  ----------ta
                Big brown bat  ----------tg
         David's myotis (bat)  ----------tg
                     Microbat  ----------tg
              Star-nosed mole  ----------cg
                     Elephant  ----------tg
                      Manatee  ----------tg
             Cape golden mole  acagtttcaatg
                       Tenrec  ----------tg
                     Aardvark  ----------tg
                      Opossum  ----------tg
              Tasmanian devil  ----------tg
                      Wallaby  ----------tg
           American alligator  ----------tc
              Green seaturtle  ----------tc
               Painted turtle  ----------tc
                 Nile tilapia  ============
             Peregrine falcon  ============
                 Saker falcon  ============
     Mexican tetra (cavefish)  ============
                  Spotted gar  ============
                   Coelacanth  ============
                    Zebrafish  ============
                  Rock pigeon  ============
                 Mallard duck  ============
                    Tetraodon  ============
     Chinese softshell turtle  ============
                      Chicken  ============
          Medium ground finch  ============
                       Turkey  ============
                X. tropicalis  ============
                  Zebra finch  ============
          Collared flycatcher  ============
           Tibetan ground jay  ============
                       Lizard  ============
       White-throated sparrow  ============
          Cape elephant shrew  ============
                     Platypus  ============
       Spiny softshell turtle  ============
                      Megabat  NNNNNNNNNNNN
                    Armadillo  ============

Inserts between block 12 and 13 in window
B D                  Opossum 1bp
B D          Tasmanian devil 1bp
B D                  Wallaby 1bp

Alignment block 13 of 429 in window, 43445000 - 43445030, 31 bps 
B D                     Human  ---aaggccaaagcct-gggggtttt-cagttagta
B D                     Chimp  ---aaggccaaagcct-gggggtttt-cagttagta
B D                   Gorilla  ---aaggccaaagcct-gggggtttt-cagttggta
B D                 Orangutan  ---aaggccaaagcct-gggggtttt-cagttggta
B D                    Gibbon  ---aaggccaaagcct-gggggtttg-cagttggta
B D                    Rhesus  ---aaggcaaaagcct-gggggtttt-cagttggta
B D       Crab-eating macaque  ---aaggcaaaagcct-gggggtttt-cagttggta
B D                    Baboon  ---aaggcaaaagcct-gggggtttt-cagttggta
B D              Green monkey  ---aaggcaaaagtct-gggggtttt-cagttggta
B D                  Marmoset  ---aaggcaaaagcct-gggggtttt-cagttggta
B D           Squirrel monkey  ---aaggcaaaagcct-gggggtttt-cggttggta
B D                  Bushbaby  ---aatgc----------------------ttgat-
           Chinese tree shrew  ---caggcaaaagcct-ggaggtttt-cacctgata
B D                  Squirrel  ---aaggcaaaaacct-ggagctttt-cagttgatg
       Lesser Egyptian jerboa  ---aaggcaaaaacct-ggacgtttt-cacgtggtg
B D           Chinese hamster  ---aaggcaaaaacct-ggaggtttg-cagttggtg
               Golden hamster  ---aaggcaaaaatct-ggaggtttg-cagttggtg
B D                     Mouse  ---aaggcaaaaacat-ggaagtttg-cagttggtg
B D                       Rat  ---aaggcaaaaacat-ggaggtttg-cagttggtg
B D            Naked mole-rat  ---aaggcaaaaacct-gaaagcttt-cagttggtg
B D                Guinea pig  ---aaggcagaaacct-gaaagc-tt-cagttggtg
                   Chinchilla  ---aaggcaaaaacct-gaaagcttt-cagttggcg
             Brush-tailed rat  ---aaggcaaaaactt-gaaagcttt-ccattgctg
B D                    Rabbit  ---aaggcaaaagctt-ggagg--tt-caattggta
B D                      Pika  ---aaagcaaaagctt-ggagg--tt-tagctggta
B D                       Pig  ---agggcaaaagcct-gaaggtttt-ccgttggta
B D                    Alpaca  ---aaggcaaaagcct-ggaggtttt-c--------
               Bactrian camel  ---aaggcaaaagcct-ggaggtttt-c--------
B D                   Dolphin  ---aaggcacaagcct-ggaggtttt-cagtctgta
                 Killer whale  ---aaggcacaagcct-ggaggtttt-cagtctgta
             Tibetan antelope  ---aaggcaaaagcct-gggggtttt-cagttggta
B D                       Cow  ---aaggcaaaagcct-gggggtttt-cagttgcta
B D                     Sheep  ---aaggcaaaagcct-aggggtttt-cagttggta
                Domestic goat  ---aaggcaaaagcct-gggggtttt-cagttggta
B D                     Horse  ---aaggcaaaagtct-ggaggtt------------
B D          White rhinoceros  ---aaggcaaaattct-ggaggtttt-cagtccgta
B D                       Cat  ---aaggcaaaagcct-ggtggtttt-cagtcggtt
B D                       Dog  ---aaggcaaaagcct-ggaggtttt-tagtcggtt
B D                   Ferret   ---aagg-------ct-ggaggtttt-cagtcggtt
B D                     Panda  ---aaggcaaaagcct-ggaggtttt-cagtcggtt
               Pacific walrus  ---aaggcaaaagcct-ggaggttttccagttggtt
                 Weddell seal  ---aaggcaaaagcct-ggaggtttt-cagttggtt
             Black flying-fox  ---aaggcaaaagcgt-ggaagtttt-cagttggta
B D                   Megabat  ---aaggcaaaagcgt-ggacgtttt-cagttggta
                Big brown bat  ---aagacaaaagcct-ggaggtttt-cagattgta
         David's myotis (bat)  ---aagacaaaagcct-ggaggtttt-cagattgta
B D                  Microbat  ---aagacaaaagcct-ggaggtttt-cagactgta
              Star-nosed mole  ---aaggcaaaagcct-ggaggtttc-ccgttggta
B D                  Elephant  ---aaggcaaaagcct-ggaggcttt-cagcaga-a
B D                   Manatee  ---aaggcaaaagcct-ggaggcttt-cagcaga-a
             Cape golden mole  ---aatgcaaaaacct-gaagccttt-tagcaga-a
B D                    Tenrec  ---gaggcaaaagcct-gggggcttt-cggctga-a
                     Aardvark  ---aaggcaaaagcct-ggaggcttt-cagcaga-a
B D                   Opossum  ---aagcc-aaagcccaggaggcttt-cagtaggtg
B D           Tasmanian devil  ---aagccaaaagcccaggagatttt-cagtaggtg
B D                   Wallaby  ---aagccaaaagcccagggggcttt-cagtaggtg
B D        American alligator  aataaaaaagagatacaggaagcttt-ctttctgta
  D           Green seaturtle  a--aacgcaaaggttcaggaaaattt-cagtaggca
  D            Painted turtle  a--aacgcaaaggttcaggaaaattt-cagtaagca
B D              Nile tilapia  ====================================
  D          Peregrine falcon  ====================================
  D              Saker falcon  ====================================
    Mexican tetra (cavefish)  ====================================
                 Spotted gar  ====================================
B D                Coelacanth  ====================================
B D                 Zebrafish  ====================================
  D               Rock pigeon  ====================================
  D              Mallard duck  ====================================
B D                 Tetraodon  ====================================
  D  Chinese softshell turtle  ====================================
B D                   Chicken  ====================================
B D       Medium ground finch  ====================================
B D                    Turkey  ====================================
B D             X. tropicalis  ====================================
B D               Zebra finch  ====================================
  D       Collared flycatcher  ====================================
          Tibetan ground jay  ====================================
B D                    Lizard  ====================================
  D    White-throated sparrow  ====================================
         Cape elephant shrew  ====================================
B D                  Platypus  ====================================
  D    Spiny softshell turtle  ====================================
B D                 Armadillo  ====================================

Inserts between block 13 and 14 in window
  D           Painted turtle 9373bp

Alignment block 14 of 429 in window, 43445031 - 43445044, 14 bps 
B D                     Human  tttcaatcgggaa-g-
B D                     Chimp  tttcaat-gggaa-g-
B D                   Gorilla  tttcaattgggaa-g-
B D                 Orangutan  tttcaattgggaa-c-
B D                    Gibbon  tttcaattgggaa-c-
B D                    Rhesus  tttcaattgggaa-c-
B D       Crab-eating macaque  tttcaattgggaa-c-
B D                    Baboon  tttcaattgggaa-c-
B D              Green monkey  tttcaattgggaa-c-
B D                  Marmoset  tttca-----------
B D           Squirrel monkey  tttcaattggaaa-g-
B D                  Bushbaby  --------ggaaa-c-
           Chinese tree shrew  tttcaaatgggaa-c-
B D                  Squirrel  tttcaaatgggaa-c-
       Lesser Egyptian jerboa  tctcaaatgggca-c-
B D           Chinese hamster  tttcaaatgggaa-c-
               Golden hamster  tttcaaatgggaa-c-
B D                     Mouse  tttcaattgggag-c-
B D                       Rat  tttcaaataggag-c-
B D            Naked mole-rat  tttcaaatgagaa-c-
B D                Guinea pig  tttcaaatgagaa-c-
                   Chinchilla  tttcaaatgagaa-c-
             Brush-tailed rat  tttcaaatgagaa-a-
B D                    Rabbit  tttcaaatgggaa-t-
B D                      Pika  tttcatatgggag-t-
B D                       Pig  tttcaaatgggaa-c-
B D                    Alpaca  ----aaatgggaa-c-
               Bactrian camel  ----aaatgggaa-c-
B D                   Dolphin  tttgaaatgggaa-c-
                 Killer whale  tttgaaatgggaa-c-
             Tibetan antelope  tttcaaataggaa-c-
B D                       Cow  tttcaaataggaa-c-
B D                     Sheep  tttcaaataggaa-c-
                Domestic goat  tttcaaataggaa-c-
B D                     Horse  tttcaaatgggaa-c-
B D          White rhinoceros  tttcaaatgggaa-c-
B D                       Cat  tttcaaatgggaa-c-
B D                       Dog  tttcaaatgagaa-c-
B D                   Ferret   tttcaaatgtgaa-c-
B D                     Panda  tttcaaatgggaa-c-
               Pacific walrus  tttcaaatgggaa-c-
                 Weddell seal  tttcaaatgggaa-c-
             Black flying-fox  tttcaaatgagaa-c-
B D                   Megabat  tttcaaatgagaacc-
                Big brown bat  tttcaaatgggaa-c-
         David's myotis (bat)  tttcaaatgggaa-c-
B D                  Microbat  tttcaaatgggaa-c-
              Star-nosed mole  tttcaaatgggaa-c-
B D                  Elephant  tttcaaatggaaa-c-
B D                   Manatee  tttcaaatggaaa-c-
             Cape golden mole  tttcaaatggaaa-c-
B D                    Tenrec  tttc-aatggaaa-c-
                     Aardvark  ttccaaacggaaa-c-
B D                   Opossum  tttcaaatggcaa-c-
B D           Tasmanian devil  tttcaaatggcaa-c-
B D                   Wallaby  tttcaaatagcaa-c-
B D        American alligator  -gtcacataaaaa-gt
  D           Green seaturtle  -----cataaaaa-gt
B D              Nile tilapia  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
    Mexican tetra (cavefish)  ================
                 Spotted gar  ================
B D                Coelacanth  ================
B D                 Zebrafish  ================
  D               Rock pigeon  ================
  D              Mallard duck  ================
B D                 Tetraodon  ================
  D  Chinese softshell turtle  ================
B D                   Chicken  ================
B D       Medium ground finch  ================
B D                    Turkey  ================
B D             X. tropicalis  ================
  D            Painted turtle  ================
B D               Zebra finch  ================
  D       Collared flycatcher  ================
          Tibetan ground jay  ================
B D                    Lizard  ================
  D    White-throated sparrow  ================
         Cape elephant shrew  ================
B D                  Platypus  ================
  D    Spiny softshell turtle  ================
B D                 Armadillo  ================

Alignment block 15 of 429 in window, 43445045 - 43445057, 13 bps 
B D                     Human  ---ccaataaactatt
B D                     Chimp  ---ccaataaactatt
B D                   Gorilla  ---ccaataaactatt
B D                 Orangutan  ---ccaataaactatt
B D                    Gibbon  ---ccaataaactatt
B D                    Rhesus  ---ccaataaactatt
B D       Crab-eating macaque  ---ccaataaactatt
B D                    Baboon  ---ccaataaactatt
B D              Green monkey  ---ccaataaactatt
B D                  Marmoset  -------------att
B D           Squirrel monkey  ---ccaataaactatt
B D                  Bushbaby  ---ccaataaacta-t
           Chinese tree shrew  ---tgaatatacta--
B D                  Squirrel  ---caaataaactatt
       Lesser Egyptian jerboa  ---cccatgaactatt
B D           Chinese hamster  ---ccaataaactatt
               Golden hamster  ---ccaataaactatt
B D                     Mouse  ---ccaacaaaatatt
B D                       Rat  ---ccaataaactagt
B D            Naked mole-rat  ---tcgataaactatt
B D                Guinea pig  ---tgggtagactgta
                   Chinchilla  ---tggctaaactata
             Brush-tailed rat  ---tggataaactata
B D                    Rabbit  ---cctacaaactatt
B D                      Pika  ---ccaaaaaactatt
B D                       Pig  ---tcaataaactatt
B D                    Alpaca  ---ccaataaactatt
               Bactrian camel  ---ccaataaactatt
B D                   Dolphin  ---ccaataaactatt
                 Killer whale  ---ccaataaactatt
             Tibetan antelope  ---ccaataaactatt
B D                       Cow  ---ccaataaactatt
B D                     Sheep  ---ccaataaactatt
                Domestic goat  ---ccaataaactatt
B D                     Horse  ---ccaataaactatt
B D          White rhinoceros  ---ctaataaactatg
B D                       Cat  ---ccaataaactatt
B D                       Dog  ---ccaataaactatt
B D                   Ferret   ---ccaataaactatt
B D                     Panda  ---ccaataaactatt
               Pacific walrus  ---ccaataaactatt
                 Weddell seal  ---ccaataaactatt
             Black flying-fox  ---ccaataaactata
B D                   Megabat  ---ccaattaactata
                Big brown bat  ---ccaataaagtatg
         David's myotis (bat)  ---ccaataaagtatg
B D                  Microbat  ---ccaataaagtatg
              Star-nosed mole  ---ctgataacctatt
B D                  Elephant  ---caaataagctatt
          Cape elephant shrew  ---ccaagaaactagt
B D                   Manatee  ---ccaataagctatt
             Cape golden mole  ---ccaatatactatt
B D                    Tenrec  ---ccattaaaggact
                     Aardvark  ---ccaataaacaatt
B D                   Opossum  ---ccaataaacaatc
B D           Tasmanian devil  ---ccaataaacaatc
B D                   Wallaby  ---ccaataaacaatc
B D        American alligator  gagttaaaacact---
  D           Green seaturtle  ataccaaaatccc---
B D              Nile tilapia  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
    Mexican tetra (cavefish)  ================
                 Spotted gar  ================
B D                Coelacanth  ================
B D                 Zebrafish  ================
  D               Rock pigeon  ================
  D              Mallard duck  ================
B D                 Tetraodon  ================
  D  Chinese softshell turtle  ================
B D                   Chicken  ================
B D       Medium ground finch  ================
B D                    Turkey  ================
B D             X. tropicalis  ================
  D            Painted turtle  ================
B D               Zebra finch  ================
  D       Collared flycatcher  ================
          Tibetan ground jay  ================
B D                    Lizard  ================
  D    White-throated sparrow  ================
B D                  Platypus  ================
  D    Spiny softshell turtle  ================
B D                 Armadillo  ================

Inserts between block 15 and 16 in window
  D          Green seaturtle 32073bp

Alignment block 16 of 429 in window, 43445058 - 43445069, 12 bps 
B D                     Human  aaaacggagcta
B D                     Chimp  aaaacagagcta
B D                   Gorilla  aaaatggagcta
B D                 Orangutan  aaaacggagcta
B D                    Gibbon  aaaacggagcta
B D                    Rhesus  aaaacggagcta
B D       Crab-eating macaque  aaaacggagcta
B D                    Baboon  aaaacggagcta
B D              Green monkey  aaaacagagcta
B D                  Marmoset  aaaactgagtta
B D           Squirrel monkey  aaaactgagtta
B D                  Bushbaby  gaaactgagcta
B D                  Squirrel  aaaatggagcaa
       Lesser Egyptian jerboa  aaaacagt--tg
B D           Chinese hamster  aaaatggggctg
               Golden hamster  aaaacggggctg
B D                     Mouse  aaaa------tg
B D                       Rat  aaaacagggcta
B D            Naked mole-rat  aaagccatgcca
B D                Guinea pig  aaagccatgctg
                   Chinchilla  aaagccatgcta
             Brush-tailed rat  aaagccatgcta
B D                    Rabbit  aaaatcaagcta
B D                      Pika  aaaattgaacta
B D                       Pig  aaaacctagcta
B D                    Alpaca  aaaatttagcta
               Bactrian camel  aaaatttagcta
B D                   Dolphin  aaaacctagcta
                 Killer whale  aaaacctagcta
             Tibetan antelope  aaaacctagcta
B D                       Cow  aaaacctagcta
B D                     Sheep  aaaacctagcta
                Domestic goat  aaaacctagcta
B D                     Horse  gaagtctacctg
B D          White rhinoceros  agagcctagcta
B D                       Cat  aaaacctagcta
B D                       Dog  aaaacctagcta
B D                   Ferret   aaaacctagcta
B D                     Panda  aaaacctagcta
               Pacific walrus  aaaacttagcta
                 Weddell seal  aaaatttagcta
             Black flying-fox  aaaacctagcta
B D                   Megabat  aaaacctagcta
                Big brown bat  aaaacctagtta
         David's myotis (bat)  aaaacctagcta
B D                  Microbat  aaaacctagtta
              Star-nosed mole  aaaa-ctagcta
B D                  Elephant  aaacctagctac
          Cape elephant shrew  aaacctaa----
B D                   Manatee  aaacctagctac
             Cape golden mole  aaacctagctac
B D                    Tenrec  acacaaggccgc
                     Aardvark  aaacccagctac
B D                   Opossum  tgaatctggcga
B D           Tasmanian devil  caaatctggcca
B D                   Wallaby  caaatctggcaa
B D        American alligator  aagatgtctcta
B D              Nile tilapia  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
    Mexican tetra (cavefish)  ============
                 Spotted gar  ============
B D                Coelacanth  ============
B D                 Zebrafish  ============
  D               Rock pigeon  ============
  D              Mallard duck  ============
B D                 Tetraodon  ============
  D  Chinese softshell turtle  ============
B D                   Chicken  ============
B D       Medium ground finch  ============
B D                    Turkey  ============
B D             X. tropicalis  ============
  D            Painted turtle  ============
B D               Zebra finch  ============
  D       Collared flycatcher  ============
          Tibetan ground jay  ============
B D                    Lizard  ============
  D    White-throated sparrow  ============
B D                  Platypus  ============
  D    Spiny softshell turtle  ============
  D           Green seaturtle  ============
          Chinese tree shrew  ------------
B D                 Armadillo  ============

Inserts between block 16 and 17 in window
B D       American alligator 1716bp

Alignment block 17 of 429 in window, 43445070 - 43445070, 1 bps 
B D                     Human  -------t
B D                     Chimp  -------t
B D                   Gorilla  -------t
B D                 Orangutan  -------t
B D                    Gibbon  -------t
B D                    Rhesus  -------t
B D       Crab-eating macaque  -------t
B D                    Baboon  -------t
B D              Green monkey  -------t
B D                  Marmoset  -------t
B D           Squirrel monkey  -------t
B D                  Bushbaby  -------g
           Chinese tree shrew  -------c
B D                  Squirrel  -------c
       Lesser Egyptian jerboa  -------c
B D           Chinese hamster  -------c
               Golden hamster  -------c
B D                     Mouse  -------t
B D                       Rat  -------c
B D            Naked mole-rat  -------c
B D                Guinea pig  -------c
                   Chinchilla  -------c
             Brush-tailed rat  -------c
B D                    Rabbit  -------c
B D                      Pika  -------c
B D                       Pig  -----c--
B D                    Alpaca  -----c--
               Bactrian camel  -----c--
B D                   Dolphin  -----c--
                 Killer whale  -----c--
             Tibetan antelope  -----c--
B D                       Cow  -----c--
B D                     Sheep  -----c--
                Domestic goat  -----c--
B D                     Horse  ---t----
B D          White rhinoceros  ---c----
B D                       Cat  --c-----
B D                       Dog  -c------
                 Weddell seal  t-------
             Black flying-fox  ----c---
B D                   Megabat  ----c---
                Big brown bat  ----c---
         David's myotis (bat)  ----c---
B D                  Microbat  ----c---
              Star-nosed mole  ------c-
B D                   Opossum  -------t
B D           Tasmanian devil  -------c
B D                   Wallaby  -------t
B D              Nile tilapia  ========
  D          Peregrine falcon  ========
  D              Saker falcon  ========
    Mexican tetra (cavefish)  ========
                 Spotted gar  ========
B D                Coelacanth  ========
B D                 Zebrafish  ========
  D               Rock pigeon  ========
  D              Mallard duck  ========
B D                 Tetraodon  ========
  D  Chinese softshell turtle  ========
B D                   Chicken  ========
B D       Medium ground finch  ========
B D                    Turkey  ========
B D             X. tropicalis  ========
  D            Painted turtle  ========
B D               Zebra finch  ========
  D       Collared flycatcher  ========
B D        American alligator  ========
          Tibetan ground jay  ========
B D                    Lizard  ========
  D    White-throated sparrow  ========
         Cape elephant shrew  --------
B D                     Panda  --------
B D                  Platypus  ========
  D    Spiny softshell turtle  ========
  D           Green seaturtle  ========
              Pacific walrus  --------
B D                   Ferret   --------
B D                    Tenrec  --------
B D                 Armadillo  ========
                    Aardvark  --------
B D                  Elephant  --------
B D                   Manatee  --------
            Cape golden mole  --------

Inserts between block 17 and 18 in window
                Weddell seal 210bp

Alignment block 18 of 429 in window, 43445071 - 43445085, 15 bps 
B D                     Human  tc----cctagattctggc
B D                     Chimp  tc----cctagattctggc
B D                   Gorilla  tc----cctagattctggc
B D                 Orangutan  tc----cctagattctggc
B D                    Gibbon  tc----cctagattctggc
B D                    Rhesus  tc----cctagattctggc
B D       Crab-eating macaque  tc----cctagattctggc
B D                    Baboon  tc----cctagattctggc
B D              Green monkey  tc----cctagattctggc
B D                  Marmoset  tc----cctagattctggc
B D           Squirrel monkey  tc----cctagattctggc
B D                  Bushbaby  tc----cctagattctggt
           Chinese tree shrew  tc----cccggattctggc
B D                  Squirrel  tc----cctagatttgcgc
       Lesser Egyptian jerboa  tc----cctagaatctggc
B D           Chinese hamster  tc----cctccattctggc
               Golden hamster  tc----cctccattctggc
B D                     Mouse  tc----cctacattctggc
B D                       Rat  tc----cctacattccggc
B D            Naked mole-rat  tc----cctagattctggc
B D                Guinea pig  tc----cctggattctggc
                   Chinchilla  tc----cctagattctggc
             Brush-tailed rat  tc----cctagattctggc
B D                    Rabbit  tg----cctacattctggt
B D                      Pika  tc----cctacaatctggc
B D                       Pig  tc----cccagattctggc
B D                    Alpaca  tc----cccagattctggc
               Bactrian camel  tc----cccagattctggc
B D                   Dolphin  tc----cccagattctggc
                 Killer whale  tc----cccagattctggc
             Tibetan antelope  tc----cccagtttctggt
B D                       Cow  tc----cccagtttctggt
B D                     Sheep  tc----cccagtttctggt
                Domestic goat  tc----cccagtttctggt
B D                     Horse  tc----cccagattctggc
B D          White rhinoceros  tc----cccagattctggc
B D                       Cat  tc----cccagattctggc
B D                       Dog  tc----cccagattctggc
B D                   Ferret   tc----cccagattctggc
B D                     Panda  tc----cccagattctggc
               Pacific walrus  tc----cccagattctggc
                 Weddell seal  tc----cccagattctggc
             Black flying-fox  t-----cccagattctggc
B D                   Megabat  t-----cccagattctggc
                Big brown bat  tc----cccagattgtggc
         David's myotis (bat)  tc----cccagattgtggc
B D                  Microbat  tc----cccagattgtggc
              Star-nosed mole  tc----cccagattctggc
B D                  Elephant  tc----cccaaattctggc
          Cape elephant shrew  -------ccaaaatctagc
B D                   Manatee  tg----cccaaattctggc
             Cape golden mole  tc----cccaaattctgac
B D                    Tenrec  tctgctcccccagcctggc
                     Aardvark  tc---ccccaaattctggc
B D                   Opossum  tc----ccaatcttctggc
B D           Tasmanian devil  tc----ctaatgttctggt
B D                   Wallaby  tc----ctaatgttctgga
B D              Nile tilapia  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
    Mexican tetra (cavefish)  ===================
                 Spotted gar  ===================
B D                Coelacanth  ===================
B D                 Zebrafish  ===================
  D               Rock pigeon  ===================
  D              Mallard duck  ===================
B D                 Tetraodon  ===================
  D  Chinese softshell turtle  ===================
B D                   Chicken  ===================
B D       Medium ground finch  ===================
B D                    Turkey  ===================
B D             X. tropicalis  ===================
  D            Painted turtle  ===================
B D               Zebra finch  ===================
  D       Collared flycatcher  ===================
B D        American alligator  ===================
          Tibetan ground jay  ===================
B D                    Lizard  ===================
  D    White-throated sparrow  ===================
B D                  Platypus  ===================
  D    Spiny softshell turtle  ===================
  D           Green seaturtle  ===================
B D                 Armadillo  ===================

Inserts between block 18 and 19 in window
B D               Guinea pig 149bp

Alignment block 19 of 429 in window, 43445086 - 43445096, 11 bps 
B D                     Human  ctataaaacca
B D                     Chimp  ctataaaacca
B D                   Gorilla  ctataaaacca
B D                 Orangutan  ctataaaacca
B D                    Gibbon  ctataaaacca
B D                    Rhesus  ctataaaacca
B D       Crab-eating macaque  ctataaaacca
B D                    Baboon  ctataaaacca
B D              Green monkey  ctataaaacca
B D                  Marmoset  ctataaaacca
B D           Squirrel monkey  ctacaaaacca
B D                  Bushbaby  ctataaaactg
           Chinese tree shrew  ctataaaacca
B D                  Squirrel  caataaaacca
       Lesser Egyptian jerboa  caataccagcc
B D           Chinese hamster  caataaaacca
               Golden hamster  caataaaaccg
B D                     Mouse  caataaaacca
B D                       Rat  caataaaatca
B D            Naked mole-rat  taataaaactg
                   Chinchilla  taataaaactg
             Brush-tailed rat  taataaaa---
B D                    Rabbit  ctataaaacct
B D                      Pika  ctatacaatct
B D                       Pig  ctataaaacca
B D                    Alpaca  ctataaaacca
               Bactrian camel  ctataaaacca
B D                   Dolphin  ctataaatcca
                 Killer whale  ctataaatcca
             Tibetan antelope  ctataaaacca
B D                       Cow  ctataaaacca
B D                     Sheep  ctataaaacca
                Domestic goat  -tataaaacca
B D                     Horse  ctataaaacca
B D          White rhinoceros  ctataaaacca
B D                       Cat  ctataaaacca
B D                       Dog  ctataaaacca
B D                   Ferret   ctataaaacca
B D                     Panda  ctataaaacct
               Pacific walrus  ctataaaacta
                 Weddell seal  ctataaaacca
             Black flying-fox  ctataaaacca
B D                   Megabat  ctagaaaacca
                Big brown bat  ttataaaacca
         David's myotis (bat)  ttataaaacca
B D                  Microbat  ttataaaacca
              Star-nosed mole  ctataaaaccg
B D                  Elephant  atataaaacca
          Cape elephant shrew  atataagacca
B D                   Manatee  atataaaacca
             Cape golden mole  ttataaaacta
B D                    Tenrec  atctaaaacca
                     Aardvark  atataaaacca
B D                   Opossum  cttttaaaggg
B D           Tasmanian devil  ctttgaaaggg
B D                   Wallaby  ctttgaaaggg
B D              Nile tilapia  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
    Mexican tetra (cavefish)  ===========
                 Spotted gar  ===========
B D                Coelacanth  ===========
B D                 Zebrafish  ===========
  D               Rock pigeon  ===========
  D              Mallard duck  ===========
B D                 Tetraodon  ===========
  D  Chinese softshell turtle  ===========
B D                   Chicken  ===========
B D       Medium ground finch  ===========
B D                    Turkey  ===========
B D             X. tropicalis  ===========
  D            Painted turtle  ===========
B D               Zebra finch  ===========
  D       Collared flycatcher  ===========
B D        American alligator  ===========
          Tibetan ground jay  ===========
B D                    Lizard  ===========
  D    White-throated sparrow  ===========
B D                Guinea pig  ===========
B D                  Platypus  ===========
  D    Spiny softshell turtle  ===========
  D           Green seaturtle  ===========
B D                 Armadillo  ===========

Inserts between block 19 and 20 in window
B D                   Tenrec 7bp
B D          Tasmanian devil 1bp

Alignment block 20 of 429 in window, 43445097 - 43445129, 33 bps 
B D                     Human  -ccccac----aagagag-aaa---tc-atct----a-acgg-cctgtg----
B D                     Chimp  -ccccac----aagagag-aaa---tc-atct----a-acgg-cctgtg----
B D                   Gorilla  -ccccac----aagagag-aaa---tc-atct----a-acgg-cctgtg----
B D                 Orangutan  -ccctac----aagagag-aaa---tc-atct----a-acgg-cctgtg----
B D                    Gibbon  -cctcac----aagacag-aaa---tc-atct----a-aggg-cctgtg----
B D                    Rhesus  -ccccac----aggagag-aaa---tc-atct----a-aggg-tctgtg----
B D       Crab-eating macaque  -ccccac----aggagag-aaa---tc-atct----a-aggg-tctgtg----
B D                    Baboon  -ccccac----aggagag-aaa---tc-atct----a-aggg-tctgtg----
B D              Green monkey  -ccccac----aggagag-aaa---tc-atct----a-aggg-tctgtg----
B D           Squirrel monkey  -gcccac----aggagag-aaa---tc-atct----c-aggg-cctgtg----
B D                  Bushbaby  -tcccag----aggagaa-gaaacgtc-agct----a-agga-tttgtg----
           Chinese tree shrew  -tcccag----aggagag-aaa---tc-agct----a-aggg-cctgtg----
B D                  Squirrel  -actcag----aggacag-aaa---tc-agca----aaaggg-cctgt-----
       Lesser Egyptian jerboa  -accccc----aggagag---a---ttcagct----a-aggg-ctggt-----
B D           Chinese hamster  -gcccag----aggagag-aaa---tttagct----a-aggg-ccggt-----
               Golden hamster  -gcccag----aggagag-aaa---ttcagct----a-aggg-ctggt-----
B D                     Mouse  -gcccag----aggagag-aaa---tt-agct----a----------------
B D                       Rat  -gtccag----aggagag-aaa---ttcagct----a-acag-tctgc-----
B D            Naked mole-rat  -ctccgg----aggagag-aaa---tc-agctgagga-aggg-cctgt-----
                   Chinchilla  -cttcag----aggagag-aaa---tc-agct----a-aggg-cctgt-----
             Brush-tailed rat  -ctccag----aggagag-aaa---tc-agct----a-aggg-cctgt-----
B D                    Rabbit  -ccccag----aggagag-aaa---tg-agtg----a-agga-tctgt-----
B D                      Pika  -ccccgg----aggagag-aaa---gc-agtt----a-agga-tctgc-----
B D                       Pig  -ccccgg----aggagag-caa---tc-agct----a-aggg-cctatg----
B D                    Alpaca  -ccacag----aggagag-gaa---tc-agtt----a-agag-cctatg----
               Bactrian camel  -ccacag----aggagag-aaa---tc-agtt----a-aggg-cctacg----
B D                   Dolphin  -ccccag----aggggag-aaa---tc-agct----a-aggg-cctatg----
                 Killer whale  -ccccag----aggagag-aaa---tc-agct----a-aggg-cctatg----
             Tibetan antelope  -ccccag----aggagag-aaa---tc-agct----a-aggg-cctatg----
B D                       Cow  -ctccag----aggagag-aaa---tc-agct----a-aggg-cctatg----
B D                     Sheep  -ccccag----aggagag-aaa---tc-agct----a-aggg-cctatg----
                Domestic goat  -gcccag----aggagag-aaa---tc-agct----a-aggg-cctatg----
B D                     Horse  -ccccag----aggagag-aaa---tc-agct----a-aggg-cctatg----
B D          White rhinoceros  -ccccgg----aggagag-aaa---tc-agct----a-aggg-cctatg----
B D                       Cat  -ctctag----aagagag-aaa---gc-agct----c-aggg-cctgtg----
B D                       Dog  -ctctag----aggagag-aaa---tc-agct----t-cagg-cctgtg----
B D                   Ferret   -ctctag----aggagag-aaa---cc-agca----a-a-gg-ccttag----
B D                     Panda  -ctctag----aggagag-aaa---tc-agca----a-aggg-cctgtg----
               Pacific walrus  ----tag----aggagag-aaa---tc-agga----a-aggg-cctgtg----
                 Weddell seal  -ctctag----aggagagaaaa---tc-agca----a-aggg-cctgtg----
             Black flying-fox  -ccccag----aggaaag-aaa---tc-agct----a-aagg-cctatg----
B D                   Megabat  -ccccag----aggaaag-aaa---tc-agct----a-aagg-cctatg----
                Big brown bat  -ccc--------agagag-aaa---tc-agct----a-aggg-tctatg----
         David's myotis (bat)  -ccc--------agagag-aaa---tc-agct----a-aggg-cctata----
B D                  Microbat  -ccc--------agagag-aaa---tc-agct----a-aggg-cctata----
              Star-nosed mole  -ccccag----aaaagag-aaa---cc-aggt----a-agggttctatg----
B D                  Elephant  --cccag----aggacag-aaa---ca-agct----a-aggg-ccgatg----
          Cape elephant shrew  -ccccaa----aggaaag-aaa---tc-agct----g-atga-ccaatg----
B D                   Manatee  --cccaa----aggagag-aaa---tc-agct----a-aggg-ctgatg----
             Cape golden mole  -ccctag----agg--ag-aat---tc-agcc----a-agag-ccaata----
B D                    Tenrec  -ccccag----aag--ag-aaa---tc-agct----a-agca-cctatg----
                     Aardvark  -ctccag----aggaaag-aaa---tc-agct----a-aagg-ccagtg----
B D                   Opossum  cccccagtcagagcagca-aaa---ct-ggcttc--a-gggt-gcagccagac
B D           Tasmanian devil  cccccagtcaaatcagca-aga---ct-cgcttc--a-gggg-ccaaccagag
B D                   Wallaby  cccccagtcaaagcaaca-aga---ct-ggcttc--a-gggc-ccagccagac
B D              Nile tilapia  =====================================================
  D          Peregrine falcon  =====================================================
  D              Saker falcon  =====================================================
    Mexican tetra (cavefish)  =====================================================
                 Spotted gar  =====================================================
B D                Coelacanth  =====================================================
B D                 Zebrafish  =====================================================
  D               Rock pigeon  =====================================================
  D              Mallard duck  =====================================================
B D                 Tetraodon  =====================================================
  D  Chinese softshell turtle  =====================================================
B D                   Chicken  =====================================================
B D       Medium ground finch  =====================================================
B D                    Turkey  =====================================================
B D             X. tropicalis  =====================================================
  D            Painted turtle  =====================================================
B D               Zebra finch  =====================================================
  D       Collared flycatcher  =====================================================
B D        American alligator  =====================================================
          Tibetan ground jay  =====================================================
B D                    Lizard  =====================================================
  D    White-throated sparrow  =====================================================
B D                Guinea pig  =====================================================
B D                  Platypus  =====================================================
  D    Spiny softshell turtle  =====================================================
  D           Green seaturtle  =====================================================
B D                 Armadillo  =====================================================
B D                  Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 20 and 21 in window
            Cape golden mole 1bp
B D                   Tenrec 4bp
B D                  Opossum 18bp
B D          Tasmanian devil 1bp
B D                  Wallaby 49bp

Alignment block 21 of 429 in window, 43445130 - 43445132, 3 bps 
B D                     Human  tct
B D                     Chimp  tct
B D                   Gorilla  tct
B D                 Orangutan  tct
B D                    Gibbon  tct
B D                    Rhesus  tct
B D       Crab-eating macaque  tct
B D                    Baboon  tct
B D              Green monkey  tct
B D           Squirrel monkey  cct
B D                  Bushbaby  tct
           Chinese tree shrew  tct
B D                  Squirrel  -ct
       Lesser Egyptian jerboa  -ct
B D           Chinese hamster  -ct
               Golden hamster  -ct
B D                       Rat  -tt
B D            Naked mole-rat  -ct
                   Chinchilla  -ct
             Brush-tailed rat  -ct
B D                    Rabbit  -ct
B D                      Pika  -ct
B D                       Pig  tct
B D                    Alpaca  tct
               Bactrian camel  tct
B D                   Dolphin  tcc
                 Killer whale  tcc
             Tibetan antelope  tct
B D                       Cow  act
B D                     Sheep  tct
                Domestic goat  tct
B D                     Horse  tct
B D          White rhinoceros  tct
B D                       Cat  tct
B D                       Dog  tct
B D                   Ferret   tct
B D                     Panda  cct
               Pacific walrus  tct
                 Weddell seal  tct
             Black flying-fox  tct
B D                   Megabat  tct
                Big brown bat  tct
         David's myotis (bat)  tat
B D                  Microbat  tct
              Star-nosed mole  tct
B D                  Elephant  tct
          Cape elephant shrew  tct
B D                   Manatee  tct
             Cape golden mole  tct
B D                    Tenrec  tct
                     Aardvark  tct
B D                   Opossum  gct
B D           Tasmanian devil  --t
B D                     Mouse  ---
B D              Nile tilapia  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
    Mexican tetra (cavefish)  ===
                 Spotted gar  ===
B D                Coelacanth  ===
B D                 Zebrafish  ===
  D               Rock pigeon  ===
  D              Mallard duck  ===
B D                 Tetraodon  ===
  D  Chinese softshell turtle  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Turkey  ===
B D             X. tropicalis  ===
  D            Painted turtle  ===
B D               Zebra finch  ===
  D       Collared flycatcher  ===
B D        American alligator  ===
          Tibetan ground jay  ===
B D                    Lizard  ===
  D    White-throated sparrow  ===
B D                Guinea pig  ===
B D                   Wallaby  ===
B D                  Platypus  ===
  D    Spiny softshell turtle  ===
  D           Green seaturtle  ===
B D                 Armadillo  ===
B D                  Marmoset  NNN

Inserts between block 21 and 22 in window
B D                  Opossum 28bp
B D          Tasmanian devil 2bp

Alignment block 22 of 429 in window, 43445133 - 43445139, 7 bps 
B D                     Human  cct-------------cacc------------
B D                     Chimp  cct-------------cacc------------
B D                   Gorilla  cct-------------cacc------------
B D                 Orangutan  cct-------------cacc------------
B D                    Gibbon  cct-------------cacc------------
B D                    Rhesus  cct-------------cacc------------
B D       Crab-eating macaque  cct-------------cacc------------
B D                    Baboon  cct-------------cacc------------
B D              Green monkey  cct-------------cacc------------
B D           Squirrel monkey  cgt-------------cac-------------
B D                  Bushbaby  cct-------------tgcc------------
           Chinese tree shrew  cct-------------tgcc------------
B D                  Squirrel  cct-------------tgcc------------
       Lesser Egyptian jerboa  cccgct-----gcag-tgac------------
B D           Chinese hamster  cct-------------tgcc------------
               Golden hamster  cct-------------tgcc------------
B D                       Rat  tcc-------------tgcc------------
B D            Naked mole-rat  tct-------------agcc------------
                   Chinchilla  ttg-------------cgcc------------
             Brush-tailed rat  tca-------------cacc------------
B D                    Rabbit  cct-------------tgcc------------
B D                      Pika  cct-------------tgcc------------
B D                       Pig  cct-------------tgcc------------
B D                    Alpaca  cct-------------tgcc------------
               Bactrian camel  cct-------------tgcc------------
B D                   Dolphin  cct-------------tgcc------------
                 Killer whale  cct-------------tgcc------------
             Tibetan antelope  cct-------------tgcc------------
B D                       Cow  cct-------------tgcc------------
B D                     Sheep  cct-------------tgcc------------
                Domestic goat  cct-------------tgcc------------
B D                     Horse  cct-------------tacc------------
B D          White rhinoceros  cct-------------tacc------------
B D                       Cat  cct-------------tgcc------------
B D                       Dog  cct-------------tgcc------------
B D                   Ferret   cct-------------tgcc------------
B D                     Panda  cct-------------tgcc------------
               Pacific walrus  cct-------------tgcc------------
                 Weddell seal  cct-------------tgcc------------
             Black flying-fox  tct-------------cgcc------------
B D                   Megabat  tct-------------cgcc------------
                Big brown bat  cct-------------tgcc------------
         David's myotis (bat)  cct-------------tgcc------------
B D                  Microbat  cct-------------tgcc------------
              Star-nosed mole  ttt-------------tggc------------
B D                  Elephant  cct-------------tgcc------------
          Cape elephant shrew  cct-------------tgtc------------
B D                   Manatee  cct-------------tgcc------------
             Cape golden mole  cct-------------tacc------------
B D                    Tenrec  cct-------------caac------------
                     Aardvark  cct-------------tgcc------------
B D           Tasmanian devil  ---tctcacgagcggatgccagcgctaatgaa
B D                     Mouse  --------------------------------
B D              Nile tilapia  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
    Mexican tetra (cavefish)  ================================
                 Spotted gar  ================================
B D                Coelacanth  ================================
B D                 Zebrafish  ================================
  D               Rock pigeon  ================================
  D              Mallard duck  ================================
B D                 Tetraodon  ================================
  D  Chinese softshell turtle  ================================
B D                   Chicken  ================================
B D       Medium ground finch  ================================
B D                    Turkey  ================================
B D             X. tropicalis  ================================
  D            Painted turtle  ================================
B D               Zebra finch  ================================
  D       Collared flycatcher  ================================
B D        American alligator  ================================
          Tibetan ground jay  ================================
B D                    Lizard  ================================
  D    White-throated sparrow  ================================
B D                Guinea pig  ================================
B D                   Wallaby  ================================
B D                  Platypus  ================================
  D    Spiny softshell turtle  ================================
  D           Green seaturtle  ================================
B D                   Opossum  ================================
B D                 Armadillo  ================================
B D                  Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Alignment block 23 of 429 in window, 43445140 - 43445186, 47 bps 
B D                     Human  acagtgattgctga-taaaaacagcaacc-tcatcttaagaaaaataat
B D                     Chimp  acagtgattgctga-taaaaacagcaagc-tcatcttaagaaaaataat
B D                   Gorilla  acagtgactgctga-taaaaacagcaagc-tcatcttaagaaaaataat
B D                 Orangutan  acagtgattgctga-taaaaacagcaagc-tcatcttaagaaaaataat
B D                    Gibbon  acagtgattgctga-taaaaacagcaagc-tcatcttaagaaaaataat
B D                    Rhesus  acagtgattgctga-taaaaacagcaagc-tcatcttaagaaaaataat
B D       Crab-eating macaque  acagtgattgctga-taaaaacagcaagc-tcatcttaagaaaaataat
B D                    Baboon  acagtgattgctga-taaaaacagcaagc-tcatctt---aaaaataat
B D              Green monkey  acagtgactgctga-taaaaacagcaagc-tcatcttaagaaaaataat
B D           Squirrel monkey  -cagtgattgctga-taaaaacagcaagt-tcatcttaagaaaaataat
B D                  Bushbaby  atagtgactgctga-taaaaacagcaagc--catcttgagaaaaacaat
           Chinese tree shrew  atagtgattgtagg-taaaaccagccagc-tcatcttgagaaaatcaat
B D                  Squirrel  acactgattgctga-taaaa-tagcaagc-tcatcttaagaaaaacaac
       Lesser Egyptian jerboa  tgagtgactgctga-taaaa-cagcaagc-t------------------
B D           Chinese hamster  aca-tgattgctga-taaaa-cggcaagc-tcatcttaagaaaaacaat
               Golden hamster  acagtgattgctga-taaaa-cagcaagc-tcatcttaagaaaaacaat
B D                     Mouse  ----agattgctga-taaaa-cagcaagc-ccattttaagaaaaacagt
B D                       Rat  acggagcttgctga-taaaa-tagcaagc-acatctgaagaaaaacaat
B D            Naked mole-rat  acagtgattgctga-taaaa-cagcaatc-tcatcttaaaaaaaacaat
                   Chinchilla  acagtgattgctga-taaaa-cagcaaac-acatcttaagaaaaacaat
             Brush-tailed rat  atagtgattgctga-taaaa-cagcaaac-acaccttaagaaaaacaac
B D                    Rabbit  acagtgactg-tga-caaca-cagcaagc-tcatcttcagaaaaacaat
B D                      Pika  acagagactgttga-taaaa-cagcaagc-tcatcctaagaaaaacaat
B D                       Pig  atggtgattgctga-taaaaacagcaagc-tcctctcaagaaaaacagt
B D                    Alpaca  atgttgattgctga-taaaaacagtaagc-tcatcttaaggatg-----
               Bactrian camel  atgttgattgctga-taaaaacagtaagc-tcatcttaaggatg-----
B D                   Dolphin  acggtgattgctga-taaaaacagcaagc-tcatcttaagaaaaacagt
                 Killer whale  acggtgattgctga-taaaaacagcaagc-tcatcttaagaaaaacagt
             Tibetan antelope  acagtgactgctga-taaaaacagcaagc-tcatcttaagaaaaacagt
B D                       Cow  acagtgactgctga-taaaaacagcaaac-tcatgttgagaaatacagt
B D                     Sheep  acagtgactgctga-taaaaacagcaaac-tcatcttaagaaaaacagt
                Domestic goat  acagtgactgctga-taaaaacagcaaac-tcatcttaagaaaaacagt
B D                     Horse  aaaatga-tgctga-tgaaaacagcaagc-tcatcttaggaagaacggt
B D          White rhinoceros  acagtgattgctgattaaaaacagcaagc-tcatcttaagaaaaacagt
B D                       Cat  acagtgattgctga-taaaaagaacaagc-gcatcttaagaaaaacagt
B D                       Dog  acagtgattgctga-tagaaagagttaac-gcatcttaagaaaaccagt
B D                   Ferret   acagtgattgctga-taaaaagagcaagc-gcatcttaagaaaaa--gt
B D                     Panda  acagtgattgctga-taaaaagaacaagc-acatcttaagagaaacggt
               Pacific walrus  acagtgactgctga-taaaaagagcaagc-acatcttaagaaaaacagt
                 Weddell seal  acagtgattgctga-taaaaagagcaagt-gcatcttaagaaaaacagt
             Black flying-fox  acagtgattgctga-taaaaacaaaaaac-tcatctt---caaaacagt
B D                   Megabat  acagtgattgctga-taaaaacaaaaaac-tcatctt---caaaacagt
                Big brown bat  acagtgattactga-taaaaacagcaagcttcatcttaagaaaaacagt
         David's myotis (bat)  acagtgattactga-taaaaacagcaagcttcatcttaagaaaaacagt
B D                  Microbat  acagtgattactga-taaaaacagaaagcttcatcttaagaaaaacagt
              Star-nosed mole  acagtgactgctga-taaaaacag------tcatcttgagaaaaacagt
B D                  Elephant  agagtgattgctga-tggaaagagcaagt-tcattgtaaggaaaa----
          Cape elephant shrew  accgtggttgctga-taaaaaccccaagt-ttaacataaggaaaa----
B D                   Manatee  acagtgatcgctga-tcaaaacagcaagt-tcactgcaaggaaaa----
             Cape golden mole  acagtgattgctta-tgaaaagagcaagt-tcatcataatgaaaa----
B D                    Tenrec  acagtgattgctga-ggagaagagcaagt-tcatcttaaggaaaa----
                     Aardvark  acactgaatgctga-tgaaaacagtaagt-tcatagtaaggaaaa----
B D                   Opossum  acagggcttaggga-taaaactggcagac--cctcagaagaaaaacaat
B D           Tasmanian devil  acagggcttcagga-caaaactggcagac--cttcagaagcaaaacaat
B D                   Wallaby  acagggcttagtga-taaaactggcagac--cctcaatagaaaaacaat
B D              Nile tilapia  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
    Mexican tetra (cavefish)  =================================================
                 Spotted gar  =================================================
B D                Coelacanth  =================================================
B D                 Zebrafish  =================================================
  D               Rock pigeon  =================================================
  D              Mallard duck  =================================================
B D                 Tetraodon  =================================================
  D  Chinese softshell turtle  =================================================
B D                   Chicken  =================================================
B D       Medium ground finch  =================================================
B D                    Turkey  =================================================
B D             X. tropicalis  =================================================
  D            Painted turtle  =================================================
B D               Zebra finch  =================================================
  D       Collared flycatcher  =================================================
B D        American alligator  =================================================
          Tibetan ground jay  =================================================
B D                    Lizard  =================================================
  D    White-throated sparrow  =================================================
B D                Guinea pig  =================================================
B D                  Platypus  =================================================
  D    Spiny softshell turtle  =================================================
  D           Green seaturtle  =================================================
B D                 Armadillo  =================================================
B D                  Marmoset  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 23 and 24 in window
B D                   Rhesus 6bp
B D      Crab-eating macaque 6bp
B D                   Baboon 6bp
B D             Green monkey 6bp
B D          Squirrel monkey 10bp
          Chinese tree shrew 1bp

Alignment block 24 of 429 in window, 43445187 - 43445242, 56 bps 
B D                     Human  cccc--ccatccccc-gcaaaggaaacaaacgtacaaa-ga---agacaaag------------------
B D                     Chimp  cccc--ccatccccc-gcaaaggaaacaaacgtacaaa-ga---agacaaag------------------
B D                   Gorilla  cccc--ccgtcccct-gcaaaggaaacaaacctacaaa-ga---agacaaag------------------
B D                 Orangutan  cccc--ctgccccct-gcaaaggaaacaaacctacaaa-ga---agacaaag------------------
B D                    Gibbon  cccc--ccgccccccagcaaaggaaacaaacctacaaa-ga---acacaaag------------------
B D                    Rhesus  cccc--ccaccccc--gcaaaggaaacaaacctacaaa-ga---agacaaag------------------
B D       Crab-eating macaque  cccc--ccaccccc--gcaaaggaaacaaacctacaaa-ga---agacaaag------------------
B D                    Baboon  cccc--ccaccccc--acaaaggaaacaaacctacaaa-ga---agacaaag------------------
B D              Green monkey  cccc--ccaccccc--gcaaaggaaacaaacctacaaa-ga---agacaaag------------------
B D                  Marmoset  cccc--ccacct----gcaaaggaaacaaacctacaaa-ga---agacaaag------------------
B D           Squirrel monkey  ctcc--tcacct----gcaaaggaaacaaaccgccaaa-ga---agacaaag------------------
B D                  Bushbaby  --------acccctctcaaaaggaaacaaacctacaaa-g------acaaag------------------
           Chinese tree shrew  --cc--cca-------caaaagaaaacaagcctacaaa-ga---agacaaag------------------
B D                  Squirrel  --------atcccc--caagtggaaacaaacctacaaagga---agacaaag------------------
       Lesser Egyptian jerboa  ----------------------------accctacaaa--------acaaat------------------
B D           Chinese hamster  --------gt-ccc--caaatggaaacaggcctacaaa-ga---cgacaaag------------------
               Golden hamster  --------gt-ccc--caaatggaaacaggcctacaaa-ga---agacaaag------------------
B D                     Mouse  --------gt-ccc--caaatggaaacaagcctgcaaa-ga---cgacaaag------------------
B D                       Rat  --------gt-ccc--cacatagaaagaggcctgcaaa-ga---agacaaag------------------
B D            Naked mole-rat  --------atcccc--caaatggaaacaaacctacaag-ga---agat-gag------------------
                   Chinchilla  --------attccc--caaatggaaacaaa-ctgcaag-ga---agat-gag------------------
             Brush-tailed rat  --------atcccc--caaatagaaacaca-ctacaag-ga---agat-gag------------------
B D                    Rabbit  --------accccc--caaatggaaacaaaactacagg-ga---agataaag------------------
B D                      Pika  --------acccct--caaatggaaacagaactacaaa-ga---agataaag------------------
B D                       Pig  ---------acccc--c-aatggaaacaaacccacaaa-ga---agacaaag------------------
B D                    Alpaca  -----------------------aaacaaacctacaaa-ga---agacaaag------------------
               Bactrian camel  -----------------------aaacaaacctacaaa-ga---agacaaag------------------
B D                   Dolphin  ---------gctcc--caaatgcaaacaaacctacaaa-ga---agacaaag------------------
                 Killer whale  ---------gctcc--caaatgcaaacaaacctacaaa-ga---agacaaag------------------
             Tibetan antelope  ---------acccc--caaatgcaaacaaacctacaaa-ga---agacaaag------------------
B D                       Cow  ---------acccc--caaatgcaaacaaacctacaaa-ga---cgacaaag------------------
B D                     Sheep  ---------acccc--caaatgcaaacaaacctacaaa-ga---agacaaag------------------
                Domestic goat  ---------acccc--caaatgcaaacaaacctaccaa-ga---agacaaag------------------
B D                     Horse  ---------acccc--a-aatggaaacaaacctatgaa-ga---agacccag------------------
B D          White rhinoceros  ---------acccc--a-aatggaaac-aacccacaaa-ga---agacaaag------------------
B D                       Cat  ---------acccc--caaatggaaacaaacctacaaa-ga---agacaaag------------------
B D                       Dog  ---------acccc--gaaatggaaacaaacctacaaa-ga---agacaaag------------------
B D                   Ferret   ---------acccc--gaaatggaaacaaacttacaaa-ga---agacaaag------------------
B D                     Panda  ---------acccc--gaaatggaaacaaacctacaaa-ga---agacaaag------------------
               Pacific walrus  ---------acccc--gaaatagaaacaaacccata----a---agacaaagtgc---------------
                 Weddell seal  ---------acccc--g-aatagaaacaaacctacaaa-ga---agacaaag------------------
             Black flying-fox  ---------atcac--caaacggaaacaaacctacaaa-ga---agacaaagcacattagcagcacacat
B D                   Megabat  ---------atcac--caaacggaaacaaacctacaaa-ga---agacaaagcacattagcagcacacat
                Big brown bat  ---------acccc--caaatggaaacaaacctacaaa-ga---tgacaaagtgt-------gtgtgtgt
B D                  Microbat  ----------------------------------------------------------------------
              Star-nosed mole  ---------cccct--aaaatggaagcaaacttacaaa-ga---agacaaag------------------
B D                  Elephant  --gt--atatccac--aaat-----ggaaacctacaaa-ga---ggacaaag------------------
          Cape elephant shrew  --ct--ataccctt--caattggaaagaaacgtgcaaa-ga---taac--ag------------------
B D                   Manatee  --ac--gtacctgc--acac-ggaaacaaacctacaaa-ga---agacaaag------------------
             Cape golden mole  --ctacatatccct--caaatggaaacaaatctactaa-ga---agacggaa------------------
B D                    Tenrec  --cg--atagcctt--caaatggaggcaaagc--ctgt-aa---agaccacg------------------
                     Aardvark  --ct--gtattcct--caaatggaaacaaacctacaaa-ga---agacaaag------------------
B D                   Opossum  --------atcccc--caaacagaaagaagccgacaag-cgctgggaccaag------------------
B D           Tasmanian devil  --------atcccc--caaacagaaagatgctgaaaag-cactgagacagag------------------
B D                   Wallaby  --------at-cct--tgaacagaaagaagccaacaag-agctgggacagag------------------
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                Guinea pig  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================
        David's myotis (bat)  ----------------------------------------------------------------------
B D                 Armadillo  ======================================================================

                        Human  -------------------------------------------------------c------at--gcac
                        Chimp  -------------------------------------------------------c------at--gcac
                      Gorilla  -------------------------------------------------------c------at--gcac
                    Orangutan  -------------------------------------------------------c------at--gcat
                       Gibbon  -------------------------------------------------------c------at--gcat
                       Rhesus  -------------------------------------------------------c------at--gcat
          Crab-eating macaque  -------------------------------------------------------c------at--gcat
                       Baboon  -------------------------------------------------------c------at--gcat
                 Green monkey  -------------------------------------------------------c------at--gcat
                     Marmoset  -------------------------------------------------------t------at--gcat
              Squirrel monkey  -------------------------------------------------------t------at--gcac
                     Bushbaby  -------------------------------------------------------c------gc--acac
           Chinese tree shrew  -------------------------------------------------------t------at--acac
                     Squirrel  -------------------------------------------------------c------ac--atac
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
              Chinese hamster  -------------------------------------------------------c------ac--acac
               Golden hamster  -------------------------------------------------------c------ac--acac
                        Mouse  -------------------------------------------------------c------at--acac
                          Rat  -------------------------------------------------------c------at--gcgc
               Naked mole-rat  -------------------------------------------------------c------ac--acac
                   Chinchilla  -------------------------------------------------------t------ac--atac
             Brush-tailed rat  -------------------------------------------------------t------ac--acac
                       Rabbit  -------------------------------------------------------c------ac--acac
                         Pika  -------------------------------------------------------c------tt--cttt
                          Pig  -------------------------------------------------------c------gc--acac
                       Alpaca  -------------------------------------------------------cgcgtgtgc--acac
               Bactrian camel  -------------------------------------------------------cgcgcgtgc--acac
                      Dolphin  -------------------------------------------------------c------ac--acac
                 Killer whale  -------------------------------------------------------c------ac--acac
             Tibetan antelope  -------------------------------------------------------t------gc--acac
                          Cow  -------------------------------------------------------c------gc--acac
                        Sheep  -------------------------------------------------------t------gc--acac
                Domestic goat  -------------------------------------------------------t------gc--acac
                        Horse  -------------------------------------------------------c------ag--acac
             White rhinoceros  -------------------------------------------------------t------atacacac
                          Cat  -------------------------------------------------------c------ac--acac
                          Dog  -------------------------------------------------------c------ac--acat
                      Ferret   -------------------------------------------------------t------gc--acac
                        Panda  -------------------------------------------------------c------ac--gcac
               Pacific walrus  ----------------------------------------gcgtgcgcgcgcacac------ac--acac
                 Weddell seal  -------------------------------------------------------c------ac--acac
             Black flying-fox  gcgtgcttgttggcatccatgcgcatgtgcgcgcacgc--acacgcacgcacgcgc------gc--gcac
                      Megabat  gcgtgcttgtgcacacacatgcgcatgtgcgcgcacgcatacacgcacgcacgcac------ac--acac
                Big brown bat  gcgtgcacgcgcg------------------------------cgcgcacacacac------ac--acac
                     Microbat  ----------------------------------------------------acac------ac--acac
              Star-nosed mole  -------------------------------------------------------c------ac--acac
                     Elephant  -------------------------------------------------------t------gt--gcaa
          Cape elephant shrew  -------------------------------------------------------t------gt--gcag
                      Manatee  -------------------------------------------------------t------gc--gcaa
             Cape golden mole  -------------------------------------------------------t------gt--gtaa
                       Tenrec  -------------------------------------------------------t------gt--gcaa
                     Aardvark  -------------------------------------------------------t------gc--acaa
                      Opossum  -------------------------------------------------------c------aa--acaa
              Tasmanian devil  -------------------------------------------------------c------aa--acaa
                      Wallaby  -------------------------------------------------------c------aa--acaa
                 Nile tilapia  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
     Mexican tetra (cavefish)  ======================================================================
                  Spotted gar  ======================================================================
                   Coelacanth  ======================================================================
                    Zebrafish  ======================================================================
                  Rock pigeon  ======================================================================
                 Mallard duck  ======================================================================
                    Tetraodon  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Turkey  ======================================================================
                X. tropicalis  ======================================================================
               Painted turtle  ======================================================================
                  Zebra finch  ======================================================================
          Collared flycatcher  ======================================================================
           American alligator  ======================================================================
           Tibetan ground jay  ======================================================================
                       Lizard  ======================================================================
       White-throated sparrow  ======================================================================
                   Guinea pig  ======================================================================
                     Platypus  ======================================================================
       Spiny softshell turtle  ======================================================================
              Green seaturtle  ======================================================================
         David's myotis (bat)  ----------------------------------------------------------------------
                    Armadillo  ======================================================================

                        Human  atgc
                        Chimp  atgc
                      Gorilla  atgc
                    Orangutan  atgc
                       Gibbon  atgc
                       Rhesus  atgc
          Crab-eating macaque  atgc
                       Baboon  atgc
                 Green monkey  atgt
                     Marmoset  atgc
              Squirrel monkey  atgc
                     Bushbaby  acgc
           Chinese tree shrew  atgc
                     Squirrel  aagc
       Lesser Egyptian jerboa  ----
              Chinese hamster  atga
               Golden hamster  atga
                        Mouse  atga
                          Rat  agga
               Naked mole-rat  acgc
                   Chinchilla  ac-a
             Brush-tailed rat  atgg
                       Rabbit  atgt
                         Pika  gtgt
                          Pig  --ac
                       Alpaca  acac
               Bactrian camel  acac
                      Dolphin  aaac
                 Killer whale  aaac
             Tibetan antelope  acac
                          Cow  acac
                        Sheep  acac
                Domestic goat  acac
                        Horse  acat
             White rhinoceros  acat
                          Cat  acat
                          Dog  acat
                      Ferret   acac
                        Panda  gcac
               Pacific walrus  acac
                 Weddell seal  acac
             Black flying-fox  acac
                      Megabat  acac
                Big brown bat  acac
                     Microbat  acac
              Star-nosed mole  acat
                     Elephant  gcac
          Cape elephant shrew  acac
                      Manatee  acac
             Cape golden mole  acac
                       Tenrec  acat
                     Aardvark  aaac
                      Opossum  acac
              Tasmanian devil  acca
                      Wallaby  acaa
                 Nile tilapia  ====
             Peregrine falcon  ====
                 Saker falcon  ====
     Mexican tetra (cavefish)  ====
                  Spotted gar  ====
                   Coelacanth  ====
                    Zebrafish  ====
                  Rock pigeon  ====
                 Mallard duck  ====
                    Tetraodon  ====
     Chinese softshell turtle  ====
                      Chicken  ====
          Medium ground finch  ====
                       Turkey  ====
                X. tropicalis  ====
               Painted turtle  ====
                  Zebra finch  ====
          Collared flycatcher  ====
           American alligator  ====
           Tibetan ground jay  ====
                       Lizard  ====
       White-throated sparrow  ====
                   Guinea pig  ====
                     Platypus  ====
       Spiny softshell turtle  ====
              Green seaturtle  ====
         David's myotis (bat)  ----
                    Armadillo  ====

Alignment block 25 of 429 in window, 43445243 - 43445325, 83 bps 
B D                     Human  g------t--------------------ttcaaaggatatgatc--aa-atgc-aaactaataaaataga
B D                     Chimp  g------t--------------------ttcaaaggatatgatc--aa-atgc-aaactaataaaataga
B D                   Gorilla  g------t--------------------ttcaaaggatatgatc--aa-atgc-aaactaataaaataga
B D                 Orangutan  g------t--------------------ttcaaaggatatgatc--aa-atgc-aaactaataaaataga
B D                    Gibbon  a------t--------------------ttcaaaggacatgatc--aa-atgc-aaactaataaaataga
B D                    Rhesus  g------t--------------------ttcaaaggatatgatc--aa-atgc-aaactaataaaacaga
B D       Crab-eating macaque  g------t--------------------ttcaaaggatatgatc--aa-atgc-aaactaataaaacaga
B D                    Baboon  g------t--------------------ttcaaaggatatgatc--aa-atgc-aaactaataaaacaga
B D              Green monkey  g------t--------------------ttcaaaggatatgatc--aa-atgc-aaactaataaaacaga
B D                  Marmoset  a------t--------------------ttcaaagggtattatc--aa-acac-aacctaacagaataga
B D           Squirrel monkey  a------t--------------------ttcaaagggtattatc--aa-acac-aaactaataaaataga
B D                  Bushbaby  a------c--------------------ttccaaagagaagatc--aatttgc-aagccaagatactaga
           Chinese tree shrew  a------t--------------------ttgaaaggagatgatc--aa-atgc-aaactaataaaacaga
B D                  Squirrel  a------t--------------------ttcaaaggatatgaac--aa-atgc-aaaataataaaataga
       Lesser Egyptian jerboa  ----------------------------ttcaaaggatatgatc--aa-atgc-aaactaatgaaataga
B D           Chinese hamster  a---------------------------ttaaaaggatatcatc--aa-atg--aaactaataaaacaga
               Golden hamster  a---------------------------ttaaaaggatatgatc--aa-atg--aaaccaataaaacaga
B D                     Mouse  a------t--------------------ttcaaagggtatgatc--aa-atgc-aaatcaataaaacaca
B D                       Rat  g------g--------------------gtcaaagtgtatgatc--aa-atgc-caaccaacaaaataca
B D            Naked mole-rat  a------t--------------------ttcaaaggatacgatc--aa-atgc-aaactaataaaataaa
                   Chinchilla  a------t--------------------ttcaaaggatgtgatc--aa-atga-aaactaataaaataaa
             Brush-tailed rat  a------t--------------------ttcaagggatatgatc--aa-atgc-aaactaataaaataaa
B D                    Rabbit  ----------------------------ttcaaaggatctgatc--aa-atgc-aaactaataaaataga
B D                      Pika  ----------------------------ttcaaaggatctgatc--aa-atgc-aaaccaataaaataga
B D                       Pig  gca----t--------------------ttcaaagga--tgatc--aa-acgc-aaactcataaagtaga
B D                    Alpaca  acacatac--------------------ttcaaagga--tgatc--aa-atgc-aacctcgtaaaataga
               Bactrian camel  aca-atac--------------------ttcaaagga--tgatc--aa-atgc-aaactcgtaaaataga
B D                   Dolphin  aca----t--------------------ttcaaagga--tgatc--aa-atgc-aaactcataaaataga
                 Killer whale  aca----t--------------------ttcaaagga--tgatc--aa-atgc-aaactcataaaataga
             Tibetan antelope  aca----t--------------------ttcaaagga--tgatc--aa-atgc-aaactcaaaaaataga
B D                       Cow  aca----t--------------------ttcaaagga--tgatc--aa-atgc-aaactcaaaaattaga
B D                     Sheep  aca----t--------------------ttcaaagga--tgatc--aa-atgc-aaactcaaaaaacaga
                Domestic goat  aca----t--------------------ttcaaagga--tgatc--aa-atgc-aaactcaaaaaataga
B D                     Horse  ----------------------------ttcaaagga--tgatc--aa-atgc-caactaataaaacaga
B D          White rhinoceros  ----------------------------ttcaaagga--tgatc--aa-atg--caactaataaaataga
B D                       Cat  ----------------------------ttcaaagga--tgggc--aa-atgc-aaactaataaaacaga
B D                       Dog  ----------------------------ttcaaagga--ggagc--aa-atgc-aaactaataaaacaga
B D                   Ferret   aca--cac--acacacacacac------gtcaaagga--ggagc--aa-atgc-aaactaataaaacaga
B D                     Panda  aca--cac--at----------------ttcaaagga--ggagc--aa-acgc-aaactaataaaacaga
               Pacific walrus  aca--cac--acacacacacacacacgtttaaaagga--agagc--aa-atgc-aaactaataaaacaga
                 Weddell seal  aca--cac--acacacacacacaca---ttagaagga--ggagc--aa-atgc-aaactaacaaaacaga
             Black flying-fox  aca--cac--acacacacacac------ttc-aaggg--tgatc--aa-atgc-aaactgataaaataca
B D                   Megabat  aca--cacatacacacacacac------ttc-aaggg--tgatc--aa-atgc-aaactgataaaataca
                Big brown bat  aca--cac--acacacacacac------ttcaaaggg--tgatc--aa-atgc---actgataaaataga
         David's myotis (bat)  act--cac--acatacacacac------tacaaagtg--tgatc--aa-atgc---attaataaactaga
B D                  Microbat  aca--cac--acacacacacac------ttcaaaggg--tgatc--aa-atgc---attaataaaataga
              Star-nosed mole  ----------------------------ttcaaagga--tgatc--aa-ttgc-aaactaataaaatgga
B D                  Elephant  ------at--------------------ttcaaagag-atgatc--aa-atgc-aaactaataaaataga
          Cape elephant shrew  ------at--------------------tccaaagag-a----c--aa-atgc-aggct-----agcaga
B D                   Manatee  ------at--------------------ttcaaagag-gtgatc--aa-atgc-aaactaataaaataga
             Cape golden mole  ------at--------------------ttcaaagag-atgatc--aa-atac-aaactaataaaataga
B D                    Tenrec  ------at--------------------ttcaaatag-atgatc--aa-atac-aaactaat-acgttga
                     Aardvark  ------at--------------------ttcaaagag-atgat------atgcaaaactaataaaacagg
B D                 Armadillo  ------gt--------------------ttgaaagca-ttta-a--aa-ataa-atactgataaattttt
B D                   Opossum  ------gt--------------------ttcaaaacagatgatttaaa-atgc-aaactaataaaat---
B D           Tasmanian devil  ------gt--------------------ttccaaacggatgacttaaa-atgc-aaactaataaaat---
B D                   Wallaby  ------gt--------------------ttccaaacagatgacttaaa-atgc-aaactaacaaaac---
B D              Nile tilapia  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
    Mexican tetra (cavefish)  ======================================================================
                 Spotted gar  ======================================================================
B D                Coelacanth  ======================================================================
B D                 Zebrafish  ======================================================================
  D               Rock pigeon  ======================================================================
  D              Mallard duck  ======================================================================
B D                 Tetraodon  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Turkey  ======================================================================
B D             X. tropicalis  ======================================================================
  D            Painted turtle  ======================================================================
B D               Zebra finch  ======================================================================
  D       Collared flycatcher  ======================================================================
B D        American alligator  ======================================================================
          Tibetan ground jay  ======================================================================
B D                    Lizard  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                Guinea pig  ======================================================================
B D                  Platypus  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D           Green seaturtle  ======================================================================

                        Human  aacaactaat-aaaaagaaa------tctcagtttgaaatccc-atcagg----a
                        Chimp  aacaactaat-aaaaagaaa------tctcagtttgaaatccc-atcagg----a
                      Gorilla  aacaactaat-aaaaagaaa------tctcagtttgaaatccc-atcagg----a
                    Orangutan  aacaactaat-aaaaagaaa------tctcagtttgaaatccc-atcagg----a
                       Gibbon  aacaactaat-aaaaagaaa------tctcagtttgaaatccc-atcagg----a
                       Rhesus  aacaactaat-aaaaagaaa------tctcagtttgaaatccc-atcagg----a
          Crab-eating macaque  aacaactaat-aaaaagaaa------tctcagtttgaaatccc-atcagg----a
                       Baboon  aacaactaat-aaaaagaaa------tctcagtttgaaatccc-atcagg----a
                 Green monkey  aacaactaat-aaaaagaaa------tctcagtttgaaatccc-atcagg----a
                     Marmoset  aacagctaat-aaaaagaaa------tcccggtttgaaatccc-atcagg----a
              Squirrel monkey  aacagctaat-aaaaagaaa------tccctgtctgaaatccc-atcagg----a
                     Bushbaby  aa---ctaac-aaaaagaaa------tcaggatttggaatctc-accaga----a
           Chinese tree shrew  aatagccata-aaagagaaa------tctggatctggaatccc-accagg----a
                     Squirrel  aacaactcataaaagagaaa------tctggctttggaacctc-tccagg-a---
       Lesser Egyptian jerboa  aacaactcactgaaaagaaa------cctggatttggaatccc-accagga----
              Chinese hamster  aacaactcattaaaaagaaa------tctggacttggaacccc-accaga-----
               Golden hamster  aacaactcattaaaaagaaa------tctggacttggaacccc-accaga-----
                        Mouse  aacaactcattaaaaagaga------tctggatttggaatcct-gccaga-----
                          Rat  agcaactcacaagaaaggga------ccaggatgtggaatcccagctaga-----
               Naked mole-rat  aacaatgcataaaaaggaaa------cccagatttggaatccc-accagg--a--
                   Chinchilla  aacaagtcgttaaaaaaaaa-aaatccctgggtttggaatccc-accagg--a--
             Brush-tailed rat  aataactcattaaaaaaaaacaaacacctgggtttggaatccc-accaga--a--
                       Rabbit  aacaactaat-aaaaagaaa------tttgggtctggaacccc-accaga---a-
                         Pika  aacgactaataaaaaagaaa------tctagacctgaagtccc-atcaga---a-
                          Pig  agcaactaataa-agagaaa------tctgggtttggaatccc-accaga----a
                       Alpaca  aacaactaacaaaatagaaa------tctgggcttggaatccc-accagg----a
               Bactrian camel  aacaactaataaaatagaaa------tctgggcttggaatccc-accagg----a
                      Dolphin  aacaactaataagaaagaaa------tctggatttggactccc-accagg----a
                 Killer whale  aacaactaataagaaagaaa------tctggatttggactccc-accagg----a
             Tibetan antelope  aacaactaataa-aaagaaa------tctggatttggaatccc-accaag----a
                          Cow  aacaactaataa-aaagaaa------tctggatttggaatccc-accaag----a
                        Sheep  aacaactaataa-aaagaaa------cctggatttggaatccc-accaag----a
                Domestic goat  aacaactaataa-aaagaaa------tctggatttggaatccc-accaag----a
                        Horse  aacaactaataaa-aagaaa------tctgggtttggaatccc-accagg----a
             White rhinoceros  aacaat--aaaaa-aataaa------tctgggtttggaatccc-accagg----a
                          Cat  aacagctaataaagaagaaa------tctgggctcggaaccct-accagg----a
                          Dog  aagaactaataaaaaagaaa------tctgggtttggaacccc-accagg----a
                      Ferret   aacaactaataaaaaagaaa------tctgggtttggaacccc-accagg----a
                        Panda  aacaactaataaaaaagaaa------tctgggtttggaacccc-accagg----a
               Pacific walrus  aacaactaataaaaaagaaa------tctgggtttggaacccc-accagg----a
                 Weddell seal  aacaactaataaaaaagaaa------tctgggtttggaacccc-accagg----a
             Black flying-fox  a-----taataacaaagaaa------tctgggtttggaatccc-accagg----a
                      Megabat  a-----taataacaaagaaa------tctgggtttggaatccc-accagg----a
                Big brown bat  aacaactaataacaaagaaa------tctggttttggaattcc-accggg----a
         David's myotis (bat)  aacaactaataacaaagaaa------tccggttttggaattcc-accggg----a
                     Microbat  aacaactaataacaaagaaa------tctggttttggaattcc-accggg----a
              Star-nosed mole  aacaactattaaaaaagaaa------actgagtttggagtccc-accaaa----a
                     Elephant  agcaactaataaaaaagaaa------tttgggtttggaatcct-accaag----a
          Cape elephant shrew  agcaacgagaaagaatgaac------tttgggcttggaatccc-accaag----a
                      Manatee  agcaactaataagaaagaaa------tttgggtttggaattcc-accaag----a
             Cape golden mole  aacaactaataaaaa-gaaa------tttgggtttggaatcct-accaag----a
                       Tenrec  agcacctaatgaaaa--aac------cttgggtttggaatccc-accaag----a
                     Aardvark  agcaactaataaaaatgaaa------tttggctttggaatccc-accaag----a
                    Armadillo  aaaaa--aagaaaaaaaaaa------tttaggtttgaaattct-accagg----a
                      Opossum  --caactaat-gaaaataag------tttgggtttggcatcct-ctcagg----a
              Tasmanian devil  --caactaat-gagaataag------tttgggtttggaatccc-ctcaag----a
                      Wallaby  --caactaat-gaaaataag------tttggatttggaatccc-ctcagg----a
                 Nile tilapia  =======================================================
             Peregrine falcon  =======================================================
                 Saker falcon  =======================================================
     Mexican tetra (cavefish)  =======================================================
                  Spotted gar  =======================================================
                   Coelacanth  =======================================================
                    Zebrafish  =======================================================
                  Rock pigeon  =======================================================
                 Mallard duck  =======================================================
                    Tetraodon  =======================================================
     Chinese softshell turtle  =======================================================
                      Chicken  =======================================================
          Medium ground finch  =======================================================
                       Turkey  =======================================================
                X. tropicalis  =======================================================
               Painted turtle  =======================================================
                  Zebra finch  =======================================================
          Collared flycatcher  =======================================================
           American alligator  =======================================================
           Tibetan ground jay  =======================================================
                       Lizard  =======================================================
       White-throated sparrow  =======================================================
                   Guinea pig  =======================================================
                     Platypus  =======================================================
       Spiny softshell turtle  =======================================================
              Green seaturtle  =======================================================

Inserts between block 25 and 26 in window
B D                      Rat 667bp

Alignment block 26 of 429 in window, 43445326 - 43445348, 23 bps 
B D                     Human  agc----ccatctc---tga--ttctgctct-t
B D                     Chimp  agc----ccatctc---tga--ttctgctct-t
B D                   Gorilla  agc----ccatctc---tga--ttctgctct-t
B D                 Orangutan  agc----ccatctc---tga--ttctgttct-t
B D                    Gibbon  agc----ccatctc---tga--ttctgttct-t
B D                    Rhesus  agt----ccatctc---tga--ttctgttca-t
B D       Crab-eating macaque  agt----ccatctc---tga--ttctgttca-t
B D                    Baboon  agt----ccatctc---tga--ttctgttca-t
B D              Green monkey  agt----ccatctc---tga--ttctgttca-t
B D                  Marmoset  agc----ccatctc---tga--ttctgttct-t
B D           Squirrel monkey  agc----ccatctc---tga--ttctgttct-t
B D                  Bushbaby  gga----caatttc---tga--ttctgttct-t
           Chinese tree shrew  gaa----acatccc---tgactctctgttct-t
B D                  Squirrel  gga----acatctc---tga--ctctgttct-t
       Lesser Egyptian jerboa  -------ccatctc---taa--ctctcttct-t
B D           Chinese hamster  -------ccatctt---tga--ctctattct-t
               Golden hamster  -------ccatctt---tga--ctctattct-t
B D                     Mouse  -------ccatccc---tga--ctctgctct-t
B D            Naked mole-rat  agg----ccatctg---tga-------------
                   Chinchilla  aga----ccatctc---cga-------------
             Brush-tailed rat  gga----ccatttt---tca-------------
B D                    Rabbit  agg----ccatctc---tga--ccctgttct-t
B D                      Pika  gga----ccatctcttttga--ctttgtttt-t
B D                       Pig  aaa----ccatctc---tga--ctccactcc-t
B D                    Alpaca  ggg----ccatctc---tga--ctccatccc-t
               Bactrian camel  gga----ccatctc---tga--ctccatccc-t
B D                   Dolphin  gaa----ccatgtc---tga--ctccatttc-t
                 Killer whale  gaa----ccatgtc---tga--ctccatttc-t
             Tibetan antelope  aaa----ccatctc---tga--ctctgttcc-c
B D                       Cow  aaa----ccatctc---tga--ctccattcc-c
B D                     Sheep  aaa----ccatctc---tga--ctccgttcc-c
                Domestic goat  aaa----ccatctc---tga--ctccgttcc-c
B D                     Horse  gga----ccatctc---tga--ctctgttcc-t
B D          White rhinoceros  gga----ccatctc---tga--ctctgttcc-t
B D                       Cat  ggaccatccatctc---tga--ctctgttcc-t
B D                       Dog  ggaccatccatctc---tga--ctttgttcc-t
B D                   Ferret   ggatcgcccatctc---tga--ctctgttcc-t
B D                     Panda  ggatcggccatctc---tga--ctctgttac-t
               Pacific walrus  ggatcatccatctc---tga--ctctgttcc-t
                 Weddell seal  ggatcatccatctc---tga--ctctgttcc-t
             Black flying-fox  ggc----ccatctc---tga--ctctgttcc-t
B D                   Megabat  ggc----ccatctc---tga--ctctgttcc-t
                Big brown bat  ggc----ccatctc---tga--ctctattct-a
         David's myotis (bat)  gac----ccatctc---tgc--ctctgttct-a
B D                  Microbat  gac----ccatctc---tga--ctctgttct-a
              Star-nosed mole  gga----ccatat----tga--cttttttccgg
B D                  Elephant  cga----ccatgtc---tga--ctctgtc-c-t
          Cape elephant shrew  gga----ccatgtc---tga--gtctgttgt-t
B D                   Manatee  gga----ccatgtc---tga--ctctgttcc-t
             Cape golden mole  ggt----ccatgtc---tgt--ctctgtccc-t
B D                    Tenrec  ggc----cccagac---gga--tgctgttcc-t
                     Aardvark  gga----ccatgcc---tga--ctccattcc-t
B D                 Armadillo  agg----ccacttc---aga--gtttgttcc-t
B D                   Opossum  agg----caat-gt---ggg--ct-ggttct-t
B D           Tasmanian devil  aga----cag--tt---gga--ct--gtttt-t
B D                   Wallaby  agg----caa--gt---gga--ct--gttct-t
B D                       Rat  =================================
B D              Nile tilapia  =================================
  D          Peregrine falcon  =================================
  D              Saker falcon  =================================
    Mexican tetra (cavefish)  =================================
                 Spotted gar  =================================
B D                Coelacanth  =================================
B D                 Zebrafish  =================================
  D               Rock pigeon  =================================
  D              Mallard duck  =================================
B D                 Tetraodon  =================================
  D  Chinese softshell turtle  =================================
B D                   Chicken  =================================
B D       Medium ground finch  =================================
B D                    Turkey  =================================
B D             X. tropicalis  =================================
  D            Painted turtle  =================================
B D               Zebra finch  =================================
  D       Collared flycatcher  =================================
B D        American alligator  =================================
          Tibetan ground jay  =================================
B D                    Lizard  =================================
  D    White-throated sparrow  =================================
B D                Guinea pig  =================================
B D                  Platypus  =================================
  D    Spiny softshell turtle  =================================
  D           Green seaturtle  =================================

Alignment block 27 of 429 in window, 43445349 - 43445359, 11 bps 
B D                     Human  ggaatcctctc--
B D                     Chimp  ggaatcctctc--
B D                   Gorilla  ggaatcctctc--
B D                 Orangutan  ggaatcctc----
B D                    Gibbon  ggaatcctc----
B D                    Rhesus  -gaatcttc----
B D       Crab-eating macaque  ggaatcttc----
B D                    Baboon  ggaatcttc----
B D              Green monkey  ggaatcttc----
B D                  Marmoset  ggaatcctc----
B D           Squirrel monkey  ggaatcctc----
B D                  Bushbaby  ggaatcttc----
           Chinese tree shrew  gcaatcctc----
B D                  Squirrel  ggaatcctc----
       Lesser Egyptian jerboa  ggaatcctc----
B D           Chinese hamster  ggaagcttc----
               Golden hamster  ggaagcttc----
B D                     Mouse  ggaatcttc----
B D                    Rabbit  ggaatcttc----
B D                      Pika  ggaaccttc----
B D                       Pig  ggaagcccc----
B D                    Alpaca  agaatcttc----
               Bactrian camel  agaatcttc----
B D                   Dolphin  agaatcctc----
                 Killer whale  agaatcctc----
             Tibetan antelope  agaatcctc----
B D                       Cow  agaatcctc----
B D                     Sheep  agaatcctc----
                Domestic goat  agaatcccc----
B D                     Horse  agaatcctc----
B D          White rhinoceros  agaatcctc----
B D                       Cat  agaatcctc----
B D                       Dog  agaatcctc----
B D                   Ferret   agaatcctc----
B D                     Panda  agaatcctc----
               Pacific walrus  agaatcctc----
                 Weddell seal  agaatcctc----
             Black flying-fox  agattcccc----
B D                   Megabat  agattcccc----
                Big brown bat  gaatcctct----
         David's myotis (bat)  gaatcctct----
B D                  Microbat  gaatcctct----
              Star-nosed mole  ggaatcctc----
B D                  Elephant  ggaattctc----
          Cape elephant shrew  gtaatcctc----
B D                   Manatee  ggaattctc----
             Cape golden mole  ggaatcctc----
B D                    Tenrec  ggaaccctc----
                     Aardvark  agaatcctc----
B D                 Armadillo  agaatcttc----
B D        American alligator  gggatactc--cc
B D                       Rat  =============
B D              Nile tilapia  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
    Mexican tetra (cavefish)  =============
                 Spotted gar  =============
B D                Coelacanth  =============
B D                 Zebrafish  =============
  D               Rock pigeon  =============
  D              Mallard duck  =============
B D                 Tetraodon  =============
  D  Chinese softshell turtle  =============
B D                   Chicken  =============
B D       Medium ground finch  =============
B D                    Turkey  =============
B D             X. tropicalis  =============
  D            Painted turtle  =============
B D               Zebra finch  =============
  D       Collared flycatcher  =============
          Tibetan ground jay  =============
B D                    Lizard  =============
  D    White-throated sparrow  =============
B D                Guinea pig  =============
            Brush-tailed rat  -------------
B D            Naked mole-rat  -------------
                  Chinchilla  -------------
B D                   Wallaby  -------------
B D           Tasmanian devil  -------------
B D                  Platypus  =============
  D    Spiny softshell turtle  =============
  D           Green seaturtle  =============
B D                   Opossum  -------------

Inserts between block 27 and 28 in window
      Lesser Egyptian jerboa 2bp
B D                    Mouse 4907bp
B D                Armadillo 2bp

Alignment block 28 of 429 in window, 43445360 - 43445387, 28 bps 
B D                     Human  agattctgttcttggaatccaatcccta
B D                     Chimp  cgattctgttcttggaatcctctcccta
B D                   Gorilla  cgattctgttcttggaatcctctcccta
B D                 Orangutan  ----------------------tcccta
B D                    Gibbon  ----------------------tcccta
B D                    Rhesus  ----------------------tcccta
B D       Crab-eating macaque  ----------------------tcccta
B D                    Baboon  ----------------------tcccta
B D              Green monkey  ----------------------tcccta
B D                  Marmoset  ----------------------tcccta
B D           Squirrel monkey  ----------------------tcccta
B D                  Bushbaby  ----------------------tcccca
           Chinese tree shrew  ----------------------tctctg
B D                  Squirrel  ----------------------tcccta
       Lesser Egyptian jerboa  ------------------------ccca
B D           Chinese hamster  ----------------------gcccca
               Golden hamster  ----------------------gcccca
B D            Naked mole-rat  ----ctgt-tcttggaa---tcttacca
                   Chinchilla  ----ctccgtgctggaatcttctttcca
             Brush-tailed rat  ----ctgt-tcttggaa---tctttcta
B D                    Rabbit  ----------------------tcccca
B D                      Pika  ----------------------tccccg
B D                       Pig  ----------------------tctcta
B D                    Alpaca  ----------------------cctcta
               Bactrian camel  ----------------------cctcta
B D                   Dolphin  ----------------------tctcta
                 Killer whale  ----------------------tctcta
             Tibetan antelope  ----------------------tctcta
B D                       Cow  ----------------------tctcta
B D                     Sheep  ----------------------tctcta
                Domestic goat  ----------------------tctcta
B D                     Horse  ----------------------tcccca
B D          White rhinoceros  ----------------------tcccca
B D                       Cat  ----------------------tctccg
B D                       Dog  ----------------------tcccca
B D                   Ferret   ----------------------tctcca
B D                     Panda  ----------------------tccccg
               Pacific walrus  ----------------------tcccca
                 Weddell seal  ----------------------tcccca
             Black flying-fox  ----------------------tcacca
B D                   Megabat  ----------------------tcacca
                Big brown bat  ----------------------tcccca
         David's myotis (bat)  ----------------------ccccca
B D                  Microbat  ----------------------ccccca
              Star-nosed mole  ----------------------tcctca
B D                  Elephant  ------------------------ccca
          Cape elephant shrew  ------------------------acga
B D                   Manatee  ------------------------ccca
             Cape golden mole  ------------------------ccca
B D                    Tenrec  ------------------------ccca
                     Aardvark  ------------------------ccca
B D                 Armadillo  -----------------------tccca
B D                   Opossum  -------------------aaattcctt
B D           Tasmanian devil  -------------------aaattcctc
B D                   Wallaby  -------------------caattcctt
B D        American alligator  aaaatcagttcttggagtctcatctata
B D                       Rat  ============================
B D                     Mouse  ============================
B D              Nile tilapia  ============================
  D          Peregrine falcon  ============================
  D              Saker falcon  ============================
    Mexican tetra (cavefish)  ============================
                 Spotted gar  ============================
B D                Coelacanth  ============================
B D                 Zebrafish  ============================
  D               Rock pigeon  ============================
  D              Mallard duck  ============================
B D                 Tetraodon  ============================
  D  Chinese softshell turtle  ============================
B D                   Chicken  ============================
B D       Medium ground finch  ============================
B D                    Turkey  ============================
B D             X. tropicalis  ============================
  D            Painted turtle  ============================
B D               Zebra finch  ============================
  D       Collared flycatcher  ============================
          Tibetan ground jay  ============================
B D                    Lizard  ============================
  D    White-throated sparrow  ============================
B D                Guinea pig  ============================
B D                  Platypus  ============================
  D    Spiny softshell turtle  ============================
  D           Green seaturtle  ============================

Inserts between block 28 and 29 in window
B D       American alligator 2328bp

Alignment block 29 of 429 in window, 43445388 - 43445400, 13 bps 
B D                     Human  c----ctc--aga--------ctgggc
B D                     Chimp  c----ctc--aga--------ctgggc
B D                   Gorilla  c----ctc--aga--------ctgggc
B D                 Orangutan  c----ctc--aga--------ctgggc
B D                    Gibbon  c----ctc--aga--------ctgggc
B D                    Rhesus  c----cta--aga--------ctggac
B D       Crab-eating macaque  c----cta--aga--------ctggac
B D                    Baboon  c----cta--aga--------ctggac
B D              Green monkey  c----cta--aga--------ctggac
B D                  Marmoset  c----ctc--aga--------ctgggc
B D           Squirrel monkey  c----ctc--agg--------ctgggc
B D                  Bushbaby  c----ttc--tga--------ctggcc
           Chinese tree shrew  c----ttc--gaa--------ctgagt
B D                  Squirrel  c----ctc--tga--------ctaggc
       Lesser Egyptian jerboa  t----ccc--tga--------cctggc
B D           Chinese hamster  a----ccc--taa--------ctgggt
               Golden hamster  a----ccc--taa--------ctgggt
B D            Naked mole-rat  c----ctc--tga--------ctatgc
                   Chinchilla  c----ctc--caa----------gtgc
             Brush-tailed rat  c----ctc--tga--------ctgtgc
B D                    Rabbit  c----ctc--tgg------------gc
B D                      Pika  c----ctc--tga------------ct
B D                       Pig  ctagactc--tga--------ctgggg
B D                    Alpaca  c----ctc--tga--------gtagag
               Bactrian camel  c----ctc--tga--------gtagag
B D                   Dolphin  c----ctc--tga--------ctggag
                 Killer whale  c----ctc--tga--------ctggag
             Tibetan antelope  c----cgc--tga--------ctgagg
B D                       Cow  c----ctc--tga--------ctgggg
B D                     Sheep  c----ctc--tga--------ctgggg
                Domestic goat  c----ctc--tga--------ctgggg
B D                     Horse  c----ctc--tga--------ctgggg
B D          White rhinoceros  c----ctc--tga--------ctgggg
B D                       Cat  c----cac--tga--------gcgggc
B D                       Dog  c----ctctgtga--------gtgggc
B D                   Ferret   c----atc--tga--------gtgggc
B D                     Panda  t----ctc--tga--------gccggc
               Pacific walrus  c----ctc--tga--------gtgggc
                 Weddell seal  c----ctc--tga--------gtgggc
             Black flying-fox  c----ctc--tga--------ctggcg
B D                   Megabat  c----ctc--tga--------ctgggg
                Big brown bat  t----ct--------------------
         David's myotis (bat)  t----ct--------------------
B D                  Microbat  t----ct--------------------
              Star-nosed mole  c----ctc--tgg--------cgggga
B D                  Elephant  c----ccc--tgg--------tctggg
          Cape elephant shrew  c----ccg--tag--------cacagg
B D                   Manatee  c----ccc--agg--------cctggg
             Cape golden mole  c----ccc--tgg--------cctgga
B D                    Tenrec  g----ccc--tgg--------cctggc
                     Aardvark  a----ccc--tgg--------cctggg
B D                 Armadillo  c----ctc--tgg--------cctggg
B D                   Opossum  t----cac--gagttttgtttctgggc
B D           Tasmanian devil  c----cac--aag------ttctgggc
B D                   Wallaby  t----ctc--aagttccacttctgggc
B D                       Rat  ===========================
B D                     Mouse  ===========================
B D              Nile tilapia  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
    Mexican tetra (cavefish)  ===========================
                 Spotted gar  ===========================
B D                Coelacanth  ===========================
B D                 Zebrafish  ===========================
  D               Rock pigeon  ===========================
  D              Mallard duck  ===========================
B D                 Tetraodon  ===========================
  D  Chinese softshell turtle  ===========================
B D                   Chicken  ===========================
B D       Medium ground finch  ===========================
B D                    Turkey  ===========================
B D             X. tropicalis  ===========================
  D            Painted turtle  ===========================
B D               Zebra finch  ===========================
  D       Collared flycatcher  ===========================
B D        American alligator  ===========================
          Tibetan ground jay  ===========================
B D                    Lizard  ===========================
  D    White-throated sparrow  ===========================
B D                Guinea pig  ===========================
B D                  Platypus  ===========================
  D    Spiny softshell turtle  ===========================
  D           Green seaturtle  ===========================

Inserts between block 29 and 30 in window
B D                 Marmoset 122bp
B D          Squirrel monkey 115bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D</