Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 700 in window, 26261602 - 26261646, 45 bps 
B D                     Human  aattgacaaatcggatctaattaaactaaaaagcttctgcacagc
B D                     Chimp  aattgacaaattggatctaattaaactaaaaagcttctgcacagt
B D                   Gorilla  aattgacaaatcggatctaattaaactaaaaagcatctgcacagc
B D                 Orangutan  aattgacaaatcggatctaattaaactaaaaagcttctgcacagc
B D                    Gibbon  agttgacaaattggatctaattaaactgaaaagcttctgcacagc
B D       Crab-eating macaque  aattgacaaattggatctaattaaactaaaacgtttctgcacagc
B D                    Baboon  aattgacaaattggatttaattaaactaaaacgtttctgcacagc
B D              Green monkey  aattgacaaattggatctaattaaactaaaacgtttctgcacagc
B D                  Hedgehog  =============================================
B D                Guinea pig  =============================================
B D                      Pika  =============================================
B D                    Rabbit  =============================================
B D                     Shrew  =============================================
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  =============================================
            Brush-tailed rat  =============================================
B D                    Turkey  =============================================
B D                   Chicken  =============================================
  D              Mallard duck  =============================================
          Tibetan ground jay  =============================================
B D               Zebra finch  =============================================
  D    White-throated sparrow  =============================================
  D            Painted turtle  =============================================
  D           Green seaturtle  =============================================
B D        American alligator  =============================================
  D             Scarlet macaw  =============================================
B D                Budgerigar  =============================================
B D                   Opossum  =============================================
                  Chinchilla  =============================================
B D            Naked mole-rat  =============================================
      Lesser Egyptian jerboa  =============================================
  D       Collared flycatcher  =============================================
B D       Medium ground finch  =============================================
  D          Peregrine falcon  =============================================
  D              Saker falcon  =============================================
  D                    Parrot  =============================================
            Cape golden mole  =============================================
          Chinese tree shrew  =============================================
         Cape elephant shrew  =============================================
B D                   Wallaby  =============================================
B D                   Manatee  =============================================
B D           Chinese hamster  =============================================
                Prairie vole  =============================================
                    Aardvark  =============================================
B D                  Elephant  =============================================
B D                    Tenrec  =============================================
B D                       Cat  =============================================
B D                   Megabat  =============================================
B D                  Bushbaby  =============================================
B D                       Pig  =============================================
  D  Chinese softshell turtle  =============================================
B D                   Ferret   =============================================
B D                   Dolphin  =============================================
B D                       Rat  =============================================
B D                     Mouse  =============================================
B D                     Panda  =============================================
               Domestic goat  =============================================
B D                     Sheep  =============================================
            Tibetan antelope  =============================================
             Star-nosed mole  =============================================
              Bactrian camel  =============================================
B D                    Alpaca  =============================================
              Pacific walrus  =============================================
            Black flying-fox  =============================================
B D          White rhinoceros  =============================================
B D                     Horse  =============================================
B D                  Squirrel  =============================================
B D                 Armadillo  =============================================
                Weddell seal  =============================================
        David's myotis (bat)  =============================================
               Big brown bat  =============================================
B D                  Microbat  =============================================
B D           Squirrel monkey  =============================================
B D                       Dog  =============================================
B D                       Cow  =============================================
                Killer whale  =============================================

Alignment block 2 of 700 in window, 26261647 - 26262641, 995 bps 
B D                     Human  aaaataaactatcattagagtgaacaggcaacctacagaatgggagaaaattttggcaatctacccatct
B D                     Chimp  aaaataaactatcattagagtgaacaggcaacctacagaatgggagaaaattttggcaatctacccatct
B D                   Gorilla  aaaataaactatcattagagtgaacaggcaacctacagaatgggagaaaattttggcaatctacccatct
B D                 Orangutan  aaaagaaactatcattagagtgaacaggcaacctacagaatgggagaaaattttggcaatctacccatct
B D                    Gibbon  aaaagaaactatcattagagtgaacaggcaacctacagaatgggagaaaattttggcaatctacccatct
B D       Crab-eating macaque  aaaagaaattatcattagagtgaacaggcaacctacagaatgggagaaaattttggcaatccacccatct
B D                    Baboon  aaaagaaattatcattagagtgaacaggcaacctacagaatgggagaaaattttggcaatccacccatct
B D              Green monkey  ataagaaattaccattagagtgaacaggcaacctacagaatgggagaaaattttggcaatccacccatct
B D           Squirrel monkey  agaataaactatcattaacatgaacaggcaacctacagaatgggagaaaatttttgcagtctacccgcct
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rhesus  ======================================================================
            Brush-tailed rat  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                   Megabat  ======================================================================
B D                  Bushbaby  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                   Dolphin  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
             Star-nosed mole  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D                 Armadillo  ======================================================================
                Weddell seal  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
B D                       Dog  ======================================================================
B D                       Cow  ======================================================================
                Killer whale  ======================================================================

                        Human  gagaagggtctaatatccagaatttacaagga----acttaaatatatttacaagaaaaagac------a
                        Chimp  gagaagggtctaatatccagaatttacaagga----acttaaatatatttacaagaaaaagac------a
                      Gorilla  gagaagggtctaatatccagaatttacaagga----acttaaatatatttacaagaaaaagac------g
                    Orangutan  gagaagggtctaatatccagaatttacaagga----gcttaaatatatttacaagaaaaagac------a
                       Gibbon  gagaagggtctaatatccagaatttacaagga----acttaaatatatttacaggaaaaagac-------
          Crab-eating macaque  gacaagggtctaatatccagaatttacaagga----gcttaaatatatttacaagaaaaagac-------
                       Baboon  gacaagggtctaatatccagaatttacaagga----acttaaatatatttacaagaaaaagac-------
                 Green monkey  gacaagggtctaatatccggaatttacaaggaacttacttaaatatatttacaagaaaaagac-------
              Squirrel monkey  gacaagggtctaatatccagaatacacaaaga----acttaaacatattcatgagaaaaagaaaaagaaa
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aacaaccccatcaaaaagcaggcaaaagatatgaacagacacttcttaaaagaagacatttatgcagcta
                        Chimp  aacaaccccatcaaaaagcaggcaaaagagatgaacagacacttcttaaaagaagacatttatgcagcta
                      Gorilla  aacaaccccatcaaaaagcaggcaaaagatatgaacagacacttcttaaaagaagacatttatgcagcta
                    Orangutan  aagaactccatcaaaaagcaggcaaaatatatgaacagacacttcttaaaataagacatttatacagcta
                       Gibbon  ---aaccccatcaaaaagcaggcaaaagatgcgaacagacacttcttaaaagaagatatttatgcagcta
          Crab-eating macaque  ---aaccccatcaaaaagtgggcaaaagagatgaacagacacttcttaaaagaagacatttatgcagcta
                       Baboon  ---aaccccatcaaaaagtgggcaaaagagatgaacagacacttcttaaaagaagacatttatgcagcta
                 Green monkey  ---aaccccatcaaaaagtgggcaaaagagatgaacagacacttcttaaaagaagacatttatgcagcta
              Squirrel monkey  aacaaccccatcaaaaagctggcaaaagatataaacagacacttctcaaaagaggaaatgtatgcagcta
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  ataagc--atgaaaaaaagctcaacatcacggataatcacagaaatgtaaataaaaaccacaatgagata
                        Chimp  ataagc--atgaaaaaaagctcaacatcacggataatcacagaaatgtaaataaaaaccacaatgagata
                      Gorilla  ataagc--atgaaaaaaagctcaacatcacggatcatcacagaaatgtaaataaaaaccacaatgagata
                    Orangutan  ataagc--atgaaaaaaagctcattatcacggatcatcacagaaatgtaaatcaaaaccacaatgagata
                       Gibbon  ataaac--atgaaaaaaagctcaacatcacggatcatcacagaaatgtaaatcaaaaccacaatgagata
          Crab-eating macaque  ataagc--acg-aaaaaatctcaacatcactgatcatcagagaaatgtaaatcaaaaccacaatgaagta
                       Baboon  ataagc--acg-aaaaaagctcaacatcacagatcatcagagaaatgtaaatcaaaaccacaatgaggta
                 Green monkey  ataagc--acgaaaaaaagctcaacatcactgatcatcagagaaatgtaaatcaaaaccacaatgaggta
              Squirrel monkey  acaaacatatgaaaaaaagctcgacatcactgatcatc--agaaatgcaaatcaaaactacaatgagata
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  ccaaatcacaccagtcagaatgatgattattaaaacgtcaggaaataataaatgctggtgaggctatgga
                        Chimp  ccaaatcacaccagtcagaatgatgattattaaaacgtcaggaaataatagatgctggtgaggctatgga
                      Gorilla  ccaaatcacaccagtcagaatgatgattattaaaacgtcaggaaataatagatgctggtgaggctatgga
                    Orangutan  ccaaatcacaccagtcagaatgatgattattaaaacgtcaggaaataatagatgctggtgaggctgtgga
                       Gibbon  ccaaatcacacgagtcagaatgatgattattaaaacgtcaggaaataatagatgctggtgaggctgtgga
          Crab-eating macaque  ccaaatcacaccagtcagaatgatgattattaaaacatcaggaaataatagatgttggtgaggctgtgga
                       Baboon  ccaaatcacaccagtcagaatgatgattattaaaacatcaggaaataatagatgttggtgaggctgtgga
                 Green monkey  ccaaatcacaccagttagaatgatgattattaaaacatcaggaaataatagatgttggtgaggctgtgaa
              Squirrel monkey  tcaactcatgccaatcagaatggtgattattaaaaaatcaggaaataatagatgctggtgaggctgtgga
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  gaaataggaacgcttttacactgttggtgggaatgtaaattagttcaatcattgtggaagac-agtatgg
                        Chimp  gaaataggaacgcttttacactgttggtgggaatgtaaattagttcaatcattgtggaagac-agtatgg
                      Gorilla  gaaataggaatgcttttacactgttggtgggaatgtaaattagttcaatcattgtggaagacaagtatgg
                    Orangutan  gaaataggaacgcttttacactgttggtgggaatgtaaattagttcaatcattgtggaagac-agtatgg
                       Gibbon  gaaataggaacgcttttacactgttggtgggaatgtaaattagttcaatcattgtggaagac-agtatgg
          Crab-eating macaque  gaaatacgaatgcttttacattgttggtgggaatgtaaattagttcaatcattgtgaaagac-agtatgg
                       Baboon  gaaatatgaatgcttttacattgttggtgggaatgtaaattagttcaatcattgtgaaagac-agtatgg
                 Green monkey  gaaatacgaatgcttttacattgttggtaggaatgtaaattagttcaatcattgtgaaagtc-agtatgg
              Squirrel monkey  gaaataggaacacttttacactattggtgggaatgtaaattagttcaatcattgtggaagac-agtatgg
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  agattcctta--aggatctagaaccagaaataccacttgacccagcaatcccattactggggatataccc
                        Chimp  agattcctta--aggatctagaaccagaaataccatttgacccagcaatcccattactggggatataccc
                      Gorilla  agattcctta--aggatctagaaccagaaataccatttgacccagcaatcccatnactggggatataccc
                    Orangutan  agattcctta--aggatctagaaccagaaataccatttgacccagcaatcccattactggggatataccc
                       Gibbon  ggattcctta--aggatctaaaaccagaaataccatttgacccagcaatcccattactggggatataacc
          Crab-eating macaque  tgattcctta--aggagctagaaccagaaataccatttgacccagcaatcccattactgggtatataccc
                       Baboon  tgattcctta--aggagctagaaccagaaataccatttgacccagcaatcccattactgggtatataccc
                 Green monkey  tgattcctta--aggagctagagccagaaataccatttgacccagcaatcccattactgggtatataccc
              Squirrel monkey  tgattcctcaagaggatctagaaccagaaataccatttgacccagcaatcccattattgcgtatataccc
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aaaggaatataaatcattctgctataaagacacatgcacacatatgtttattgcagcactatttac-aac
                        Chimp  aaaggaatataaatcattctactataaagacacatgcacacatatgtttattgcagcactatttac-aac
                      Gorilla  aaaggaatataaatcattctactataaagacacatgcacacatatgtttattgcagcactatttac-aac
                    Orangutan  aaaggaatataaatcattctactataaagacacatgcacacatatgttcattgcagcactatttac-aat
                       Gibbon  aaaggaatataaatcattctactataaagacacatgcacacatatgtttattgcagcactatttac-aac
          Crab-eating macaque  aaaggaatataaatcattctactataaagacacatgcacacgtatgtttattgcagcactatttac-aac
                       Baboon  aaaggaatataaatcattctactataaagacacatgcacacgtatgtttattgcagcactatttac-aac
                 Green monkey  aaaggattataaatcattctactataaagacacatgcacacatatgtttattgcagcactatttac-aac
              Squirrel monkey  aaaggaatatgaattattcta-tataaagacacatgcatatgtatgtttattgcagcactatttacaaat
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  agcaaagacatggagccaacccaaatgcccatcaatgatagactggataaagaaaatatggtacagatat
                        Chimp  agcaaagacatggagccaacccaaatgcccatcaatgatagactggataaagaaaatatggtacagatat
                      Gorilla  agcaaagacatggagccaacccaaatgcccatcaatgatagactggataaagaaaatatggtacagatat
                    Orangutan  agcaaagacatggagccaacccaaatgcccatcaatgatagactggataaagaaaatatgatacagatat
                       Gibbon  agcaaagacatggagccaacccaaatgcccatcaatgatagactggataaagaaaatatggtacagatat
          Crab-eating macaque  agcaaagacatggagccaacccaaatgcccatcaatgatagactggataaagaaaatatggtacatatac
                       Baboon  agcaaagacatggagccaacccaaatgcccatcaatgatagactggataaagaaaatatggtacatatac
                 Green monkey  agcaaagacatggagccaacccaaatgcccatcaatgatagactggataaagcaaatatggtacatatac
              Squirrel monkey  agcaaaaatatg-----------cacgcccatcaataatagactggataaagaaaatgtggtacatatac
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  accatggcatactatgcagccataaaaaggaatgagatcatggcctttgcagggatatggatgaagctgg
                        Chimp  accatggcatactatgcagccataaaaaggaatgagatcatgtcctttgcagggatatggatgaagctgg
                      Gorilla  accatggcatactatgcagccataaaaaggaatgagatcatgtcctttgcagggatatggatgaagctgg
                    Orangutan  accatggcataccatgcagccataaaaaggaatgaaatcatgtcctttgcagggacatggatgaagctgg
                       Gibbon  accatggcatactatgcagccataaaaaggaatgagatcgtgtcctttgcagggacatggatgaagctgg
          Crab-eating macaque  accatggcatactacacagccataaagaggaatgagatcatgtcctttgcagggacatggatgaagctgg
                       Baboon  accatggcatactacacagccataaagaggaatgagatcatgtcctttgcagggacatggatgaagctgg
                 Green monkey  accatggcatactacgcagccataaagaggaatgagatcatgtcctttgcagggacatggatgaagctgg
              Squirrel monkey  accatggcatattatgcagccataaaaagttatgagattatgtcctttgcagggacatggatgaagctgg
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aagccatcatccttagcaaactaacacaggaacagaa-aaccaaacactgcatgctctcactcataagtg
                        Chimp  aagccatcatccttagcaaactaacacaggaacagaa-aaccaaacactgcatgctctcactcataagtg
                      Gorilla  aagccatcatccttagcaaactaacacaggaacagaa-aaccaaacactgcatgctctcactcataagtg
                    Orangutan  aagccatcatccttagcaaatgaacacaggaacagaa-aaccaaacactgcatgctctcactcataagtg
                       Gibbon  aagccatcatccttagcaaactaacacaggaacagaa-aaccaaacactgcatgctctcactcataagtg
          Crab-eating macaque  aagccatcatccttagcaaactaacacaggaacagaa-aaccaaacactgcatgctctcactcataagtg
                       Baboon  aagccatcatccttagcaaactaacacaggaacagaa-aaccaaacactgcatgctctcactcataagtg
                 Green monkey  aagccatcatccttagcaaactaacacaggaacagaagaaacaaacactgcatgctctcactcataagtg
              Squirrel monkey  aagccatcatcctcagcaaactaacacaggaacagaa-aatcaaacactgcatgttctcattcataagtg
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  ggagttgaacat--agaacacatgggcacagagaggggaacaacacacaccagggcctatt-ggggggt-
                        Chimp  ggagttgaacat--agaacacatgggcacagagaggggaacaacacacaccagggcctatt-ggggggt-
                      Gorilla  ggagttgaacat--agaacacatgggcacagagaggggaacaacacacaccagggcctatt-ggggggt-
                    Orangutan  ggagttgaacactgagaacacat-ggcacagagaggggaataacacacaccagggcctatt-ggggggtg
                       Gibbon  ggagttgaacactgagaacacat-ggcacagagaggggaacagcacacaccagggcctatt-ggggagt-
          Crab-eating macaque  ggagtggaacattgagaacacatggacacagagaggggaacaacacacatcagggcctatt-gcggggt-
                       Baboon  ggagtggaacattgagaacacatggacacagagaggggaacaacacacatcagggcctat--------t-
                 Green monkey  ggagtggaacattgagaacacatggacacagagaggggaacaacacacatcagggcctattgggggggt-
              Squirrel monkey  ggagctgaacactgagaacacatgcacacagagaggggaacaacacacatcagggcctatt---------
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  ggggggtaaggtgtgaggggaaggaacttagaggatgggtcaataggtgcagtaaaccaccaaggctcac
                        Chimp  ggggggtaaggtgtgaggggaaggaacttagaggatgggtcaataggtgcagtaaaccaccaaggctcac
                      Gorilla  ggggagtaaggtgtgaggggaaggaacttagaggacgggtcaataggtgcagtaaaccacaaaggctcac
                    Orangutan  ggggggtaaggtgtgaggggaaggaacttagaggatgggtcaataggtgcagcaaaccaccaaggctcac
                       Gibbon  ggggggtaaggtgtgaggggaaggaacttagaggatgggtcaataggcgcagcaaaccaccaaggcacac
          Crab-eating macaque  ggggggtggggggtgaaggaaaggaacttagaggacgggtcaataggtgcagcaaaccaccatggcacat
                       Baboon  ggggggtggggggtgaaggaaaggaacttagaggacgggtcaataggtgcagcaaaccaccatggcacat
                 Green monkey  ggggggtggggggtgaaggaaaggaacttagaggacaggtcaataggtgcagcaaaccaccatggcacac
              Squirrel monkey  gggggttgggaagtgaggggaagaaacttagagggcgggtcaataggtgcagcaaaccaccatggcacat
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  atatacctatgtaacaaacctgcacattctgcccatgtatcc-----ttttttttttagaataaataaag
                        Chimp  atatacctatgtaacaaacctgcacattctgcccatgtatcc----tttttttttttagaataaagaaag
                      Gorilla  atatacctatgtaacaaacctgcacattctgcccatgtatcc----tttttttttttagaataaataaag
                    Orangutan  atatacctgtgtaacaaacctgcacattctgcacatgtatcccctttttttttttttagaataaataaag
                       Gibbon  gtatacctatgtaacaaacctgcacattctgcacatgtatcc------cttttttttagaataaata---
          Crab-eating macaque  gtatacctatgtaacaaacctgtacgttctgcacatatatccctttttttcttttttagaataaataaag
                       Baboon  gtatacctatgtaacaaacctgcatgttctgcacatatatccctttttttcttttttag----aataaag
                 Green monkey  gtatacctatgtaacaaacctgcacattctgcacatatatccctttttttcttttttagaataaataaag
              Squirrel monkey  gtatacctatgtaacaaacctgcacgttctgcacatgtatcc----catttttttttagaagaaataaaa
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ======================================================================
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aaaaaaatttaaaaagacacaaattaccaa-------aataaaaaatc
                        Chimp  aaaaaaatttaaaaagacacaaattaccaa-------aataaaaaatc
                      Gorilla  aaaaaaatttaaaaagacacaaattaccaa-------aataaaaaatt
                    Orangutan  -aaaaaatttaaaaagacacaaattaccaa-------aataaaaaact
                       Gibbon  -aaaaaatttaaaaagatacaaattaccaa-------aataaaaaact
          Crab-eating macaque  -aaaaaaataaaaaagacacaaattaccaa-------aaaaaaaaaaa
                       Baboon  -aaaaaaataaaaaagacacaaattaccaaaaaaaacaaaaaaacaaa
                 Green monkey  -aaaaaaataaaaaagacacaaattatcaa-------aaaaaaaaact
              Squirrel monkey  -taataaaaaaagaagatacaaattaccaa-------aatcaaaaaca
                     Hedgehog  ================================================
                   Guinea pig  ================================================
                         Pika  ================================================
                       Rabbit  ================================================
                        Shrew  ================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Rhesus  ================================================
             Brush-tailed rat  ================================================
                       Turkey  ================================================
                      Chicken  ================================================
                 Mallard duck  ================================================
           Tibetan ground jay  ================================================
                  Zebra finch  ================================================
       White-throated sparrow  ================================================
               Painted turtle  ================================================
              Green seaturtle  ================================================
           American alligator  ================================================
                Scarlet macaw  ================================================
                   Budgerigar  ================================================
                      Opossum  ================================================
                   Chinchilla  ================================================
               Naked mole-rat  ================================================
       Lesser Egyptian jerboa  ================================================
          Collared flycatcher  ================================================
          Medium ground finch  ================================================
             Peregrine falcon  ================================================
                 Saker falcon  ================================================
                       Parrot  ================================================
             Cape golden mole  ================================================
           Chinese tree shrew  ================================================
          Cape elephant shrew  ================================================
                      Wallaby  ================================================
                      Manatee  ================================================
              Chinese hamster  ================================================
                 Prairie vole  ================================================
                     Aardvark  ================================================
                     Elephant  ================================================
                       Tenrec  ================================================
                          Cat  ================================================
                      Megabat  ================================================
                     Bushbaby  ================================================
                          Pig  ================================================
     Chinese softshell turtle  ================================================
                      Ferret   ================================================
                      Dolphin  ================================================
                          Rat  ================================================
                        Mouse  ================================================
                        Panda  ================================================
                Domestic goat  ================================================
                        Sheep  ================================================
             Tibetan antelope  ================================================
              Star-nosed mole  ================================================
               Bactrian camel  ================================================
                       Alpaca  ================================================
               Pacific walrus  ================================================
             Black flying-fox  ================================================
             White rhinoceros  ================================================
                        Horse  ================================================
                     Squirrel  ================================================
                    Armadillo  ================================================
                 Weddell seal  ================================================
         David's myotis (bat)  ================================================
                Big brown bat  ================================================
                     Microbat  ================================================
                          Dog  ================================================
                          Cow  ================================================
                 Killer whale  ================================================

Inserts between block 2 and 3 in window
B D      Crab-eating macaque 15bp
B D                   Baboon 15bp
B D             Green monkey 6bp

Alignment block 3 of 700 in window, 26262642 - 26263279, 638 bps 
B D                     Human  -a-aaggattgtaagggatattattaataactttattccaataacttaggaaacttatatgaaaagaaca
B D                     Chimp  -a-aaggattgtaagagatattattaataactttattccaataacttaggaaacttatatgaaaagaaca
B D                   Gorilla  -a-aaggattgtaagggatattattaataactttattccaataacttaggaaacttatatgaaaagaaca
B D                 Orangutan  -ataaggattgtaagggatattattaataactttattccaataacttaggaaacttatatgaaaagaaca
B D                    Gibbon  -aaaaggattgtaagggatattattaataactttattccaataacttaggaaacttatatgaaaagaaca
B D                    Rhesus  --aaaggattgtaagggatattattaataactttattctgataatttaggaaacttacatgaaaagaaca
B D       Crab-eating macaque  --aaaggattgtaagggatattattaataactttattccgataatttaggaaacttacatgaaaagaaca
B D                    Baboon  --aaaggattgtaaggcatattattaataactttattccgataatttaggaaacttacatgaaaagaaca
B D              Green monkey  --aaaggattgtaagggatattattaataactttattccaataatttaggaaacttacatgaaaagaaca
B D           Squirrel monkey  aaaaggaatttaaggggatattatcaatagctttattccaataacttagacaacttatatgaaatgaaca
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                   Megabat  ======================================================================
B D                  Bushbaby  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                   Dolphin  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
             Star-nosed mole  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
B D                 Armadillo  ======================================================================
                Weddell seal  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
B D                       Dog  ======================================================================
B D                       Cow  ======================================================================
                Killer whale  ======================================================================

                        Human  catttccaaaaagtcgcaattaacacatttgacccaggaagaaatagaaaatttgagtaggcatataata
                        Chimp  catttccaaaaagtcgcaattaacacatttgacccaggaagaaatagaaaatttgagtaggcatataata
                      Gorilla  catttccaaaaagttgcaattaacacatttgacccaggaagaaatagaaaatttgagtaggcatataata
                    Orangutan  catttccaaaacgtcgcaattaacacatttgacccaggaagaaatagaaaatttgagtaggcatataata
                       Gibbon  catttccaaaaagtcacaattaacacatttgacccaggaagaaatagaaaatttgagtaggcatataata
                       Rhesus  catttccaaaaagtcacagttaacacatttgacccaggaagaaatagaaaatttgagtaggcatataata
          Crab-eating macaque  catttccaaaaagtcacaattaacacatttgacccaggaagaaatagaaaatttgagtaggcatataata
                       Baboon  catttccaaaaagtcacaattaacacatttgacccaggaagaaatagaaaatttgagtaggcatataata
                 Green monkey  gatttccaaaaagtcacaattaacacatttgacccaggaagaaatagaaaatttgagtaggcatataata
              Squirrel monkey  catttctaaaaagtcacaattaacacatttgacccaggaagaaatagaaaatttgagtagggatataaca
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aataaataaagtaaattagttattaaaaatcctcccacaaagacaaacccaggcccagatagctttactg
                        Chimp  aataaataaagtaaattagttattaaaaatcctcccacaaagacaaacgcaggcccagatagctttactg
                      Gorilla  aataaataaagtaaattagttattaaaaatcctcccacaaagacaaacccaggcccagatagctttactg
                    Orangutan  aataaataaagtaaattagttattaaaaatcttcccacaaagacaaacccaggcccagatagctttactg
                       Gibbon  aataaataaagtaaattagttattaaaaatcttcccacaaagacaaacccagacccagatagctttactg
                       Rhesus  aataaataaagtaaattagttattaagaatcttcccacaaagacaaacccaggctcagatagctttactg
          Crab-eating macaque  aataaataaagtaaattagttattaagaatcttcccacaaagacaaacccaggctcagatagctttactg
                       Baboon  aataaataaagtaaattagttattcagaatcttcccacaaagacaaacccaggctcagatagctttactg
                 Green monkey  aataaataaagtaaattagttattaagaatcttcccacaaagacaaacccaggctcagatagctttactg
              Squirrel monkey  aataaa-------------ttattaaaaatcttcccacaaagacaaacccaggcccagacagctttactg
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  gtgaattctatctaatatttaaagacgtattgtcagtccttaacaaatttgtttaggaagtaaaggaggg
                        Chimp  gtgaattctatctaatatttaaagacgtattgtcagtccttaacaaatttgtttaggaagtaaaggaggg
                      Gorilla  gtgaattctatctaatatttaaagacgtattgtcagtcgttaacaaatttgtttaggaagtaaaggaggg
                    Orangutan  gtgaattctatctaatatttaaagacgtcttgtcagtccttaacaaatttgtttaggaagtaaaggagag
                       Gibbon  gtgaattctatctaatatttaaagacgtattatcagtccttaacaaatttgttcaggaagtaaaggaggg
                       Rhesus  gtgaattctatctaatatttaaagacgtactgtcagtcctttacaaatttgtttaggaagtaaaggaggg
          Crab-eating macaque  gtgaattctatctaatatttaaagacgtactgtcagtcctttacaaatttgtttaggaagtaaaggaggg
                       Baboon  gtgaattctatctaatatttaaagacatattgtcagtcctttacaaatttgtttaggaagtaaaggaggg
                 Green monkey  gtgaattctatctaatatttaaagacgtattgtcagccctttacaaatttgtttaggaagtaaaggaggg
              Squirrel monkey  gtgacttctatctaatatttaaagaagtactgtcagtcctttacaaatttgtttaggaagtaaaggagga
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aacacttcctaattcattctatgagaccagtatttccctagtaccaaagccaaacaaagacctcacaaga
                        Chimp  aacacttcctaattcattctatgagaccagtatttccctagtaccaaagccaaacaaagacctcacaaga
                      Gorilla  aacacttcctaattcattctatgagaccagtatttccctagtaccaaagccaaacaaagacctcagaaga
                    Orangutan  aacacttcccaattcattctatgagaccattatttccccagtaccaaagccaaacaaagacctcacaaga
                       Gibbon  aacacttcccaattcattctataagaccagtatttccccagtaccaaagccaaacaaagacctcacaaga
                       Rhesus  aacacttcccagttcattctatgaaaccagtatttccccagtaccaaagccaaaaaaagacctcacaaga
          Crab-eating macaque  aacacttcccagttcattctatgaaaccagtatttccccagtaccaaagccaaaaaaagacctcacaaga
                       Baboon  aacacttcccagttcattctatgaaaccagtatttccccagtaccaaagccaaaaaaagacctcacaaga
                 Green monkey  aacacttcccagttcattctgtgaaaccagtatttccccagtaccaaagccaaaaaaagacctcacaaga
              Squirrel monkey  aacacttttcaactcattctatgaggccagtatttccccagtaccaaagcc----aaagacctcacaaga
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aaaggaaactatagacaaatagccttcatgaacacagacataataattactaccacaatattatcaaatt
                        Chimp  aaaggaaactatagacaaatagccttcatgaacacagacataataattactaccacaatattatcaaatt
                      Gorilla  aaaggaaactatagacaaatagccttcatgaacacagacataataattactaccacaatattatcaaatt
                    Orangutan  aaatgaaactatagacaaatagccttcatgaacacagacataataattactaccacaatattatcaaatt
                       Gibbon  aaaggaaactatagacaaatagccttcatgaacacagacataataattactaccacaatattatgaaatt
                       Rhesus  aaaggaaactacagacaaatagccttcatgaacacagacataataattactaccacaatattattaaatt
          Crab-eating macaque  aaaggaaactatagacaaatagccttcatgaacacagacataataattactaccacaatattattaaatt
                       Baboon  aaaggaaactatagacaaatagccttcatgaacacagacataataattactaccacaatattattaaaat
                 Green monkey  aaaggaaactatagacaaatagccttcatgaacacagacataataattactaccacaatattattaaatt
              Squirrel monkey  aaaggacgctatagaccaatagccttcatgaacacaggcataataattactaacacaatattatcaaatt
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aaatccagcaacatataaaatgaattatacaccaagacaaagtatcccagagttatcaaaagtttatccc
                        Chimp  aaatccagcaacatataaaatgaattatacaccaagacaaagtatcccagagttatcaaaggtttatccc
                      Gorilla  aaatccagcaacatataaaatgaattatacaccaagacaaagtatcccagagttatcaaaggtttatccc
                    Orangutan  aaatccagcaacatataaaatgaattatacaccaagacaaagtatcccagagttatcaaaggtttatccc
                       Gibbon  aaatccagcaacatataaaatgaattatacaccaagacaaagtagcccagagttatcaaaggtttatccc
                       Rhesus  aaatccagcaacatataaaatgaattatacaccaagacaaagtatcccagagttatcaaa-gtttatccc
          Crab-eating macaque  aaatccagcaacatataaaatgaattatacaccaagacaaagtatcccagagttatcaaa-gtttatccc
                       Baboon  aaatccagcaacatataaaatgaattatacaccaagacaaagtatcccagagttgtcaaa-gtttatccc
                 Green monkey  aaatccagcaac--ataaaatgaattatacaccaagacaaaatatcccagagttatcaaa-gtttatccc
              Squirrel monkey  aaatccagcaacatataaaatgaattatatgccaagacaaagtatcccagatttgtcaaaggtttatccc
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aggaatgcaaagttgctttctgatctgaaaatcaacctaaaacaggaaggacaaataccacaatgcccat
                        Chimp  aggaatgcaaagttgctttccgatctgaaaatcaacctaaaacaggaaggacaaataccacaatgcccat
                      Gorilla  aggaatgcaaagttgctttctgatctgaaaatcaacctaaaacaggaaggacaaataccacaatgcccat
                    Orangutan  aggaatgcaaagttgctttctgatctgaaaatcaacctaaaacaggaaggataaataccacaatgcccat
                       Gibbon  aggaatgcaaagttgctttctaatctgaaaatcaacctaacacaggaaggacaaataccacaatgcccat
                       Rhesus  aggaaagtaaagttgctttctgatctgaaaatcaacctaaaacaggaaggacaaataccacaatgcctat
          Crab-eating macaque  aggaaagtaaagttgctttctgatctgaaaatcaacctaaaacaggaaggacaaataccacaatgcctat
                       Baboon  aggaaagcaaagttactttctgatctgaaaatcaacctaaaacaggaaggacaaataccacaatgcctat
                 Green monkey  aggaaagcgaagttgctttctgatttgaaaatcaacctaaaacaggaaggacaaataccacaatgcctat
              Squirrel monkey  aggaatgcaaagttgttttcagatctgaaaatcaacctgaaacaggaaggacaaacaccac-gtgctcat
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  ctcgatagatacataaaaagcatttgacaaaatctaatatccatttatgattaaaaactctcaacaaatt
                        Chimp  ctcgatagatacataaaaagcatttgacaaaatctaatatccatttatgattaaaaactctcaacaaatt
                      Gorilla  ctcgatagatacataaaaagcatttgacaaaatctaatatccatttatgattaaaaactctcaacaaatt
                    Orangutan  ctcgatagatatagaaaaagcatttgacaaaatctaatatccatttatgattaaaaactctcaacaaatt
                       Gibbon  ctcaatagatacagaaaaagcatttgacaaaatctaatatccatttatgattaaaaactctcaacaaatt
                       Rhesus  ttcaatagatacagaaaaagcatttgacaaaacctaatgtccacttacgattaaaaactctcaacaaatt
          Crab-eating macaque  ttcaatagatacagaaaaagcatttgacaaaacctaatgtccacttacgattaaaaactctcaacaaatt
                       Baboon  ttcaatagatacagaaaaagcatttgacaaaacataacgtccacttacgattaaaaactctcaacaaatt
                 Green monkey  ttcaatagatacagaaaaagtatttgacaaaacctaatgtccacttatgattaaaaactctcaacaaatt
              Squirrel monkey  ctcaatagatacagaaagagaatttgacaaaatctaatattcac------ttaaaaactctcagtgaatt
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                    Armadillo  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  aagaataaac
                        Chimp  aagaataaac
                      Gorilla  aagaataaac
                    Orangutan  aagaataaac
                       Gibbon  aagaataaac
                       Rhesus  aagaataaac
          Crab-eating macaque  aagaataaac
                       Baboon  aagaataaac
                 Green monkey  aagaataaac
              Squirrel monkey  aagaataaac
                     Hedgehog  ==========
                   Guinea pig  ==========
                         Pika  ==========
                       Rabbit  ==========
                        Shrew  ==========
               Golden hamster  NNNNNNNNNN
             Brush-tailed rat  ==========
                       Turkey  ==========
                      Chicken  ==========
                 Mallard duck  ==========
           Tibetan ground jay  ==========
                  Zebra finch  ==========
       White-throated sparrow  ==========
               Painted turtle  ==========
              Green seaturtle  ==========
           American alligator  ==========
                Scarlet macaw  ==========
                   Budgerigar  ==========
                      Opossum  ==========
                   Chinchilla  ==========
               Naked mole-rat  ==========
       Lesser Egyptian jerboa  ==========
          Collared flycatcher  ==========
          Medium ground finch  ==========
             Peregrine falcon  ==========
                 Saker falcon  ==========
                       Parrot  ==========
             Cape golden mole  ==========
           Chinese tree shrew  ==========
          Cape elephant shrew  ==========
                      Wallaby  ==========
                      Manatee  ==========
              Chinese hamster  ==========
                 Prairie vole  ==========
                     Aardvark  ==========
                     Elephant  ==========
                       Tenrec  ==========
                          Cat  ==========
                      Megabat  ==========
                     Bushbaby  ==========
                          Pig  ==========
     Chinese softshell turtle  ==========
                      Ferret   ==========
                      Dolphin  ==========
                          Rat  ==========
                        Mouse  ==========
                        Panda  ==========
                Domestic goat  ==========
                        Sheep  ==========
             Tibetan antelope  ==========
              Star-nosed mole  ==========
               Bactrian camel  ==========
                       Alpaca  ==========
               Pacific walrus  ==========
             Black flying-fox  ==========
             White rhinoceros  ==========
                        Horse  ==========
                     Squirrel  ==========
                    Armadillo  ==========
                 Weddell seal  ==========
         David's myotis (bat)  ==========
                Big brown bat  ==========
                     Microbat  ==========
                          Dog  ==========
                          Cow  ==========
                 Killer whale  ==========

Alignment block 4 of 700 in window, 26263280 - 26264149, 870 bps 
B D                     Human  aag---aaaaaacaaacaattccat-----gaaaaac-aaaacaa--ccccattaaaaagtgggaaaagg
B D                     Chimp  aag---aaaaaacaaacaattccac-----aaaaaac-aaaacaa--ccccattaaaaagtgggcaaagg
B D                   Gorilla  aagaaaaaaaaacaaacaattccat-----gaaaaac-aaaacaa--ccccattaaaaagtgggcaaagg
B D                 Orangutan  aag--aaaaaaacaaacaactccat-----gaaaaac-aaaacaa--ccccattaaaaagtgggcaaagg
B D                    Gibbon  aag---aaaaaaaaaacaactccat-----gaaaaac-aaaacaa--ccccattaaaaagtgggcaaaag
B D                    Rhesus  aag---aaaaaaa----aactccat-----gaaaaacaaaaacaa--ccccattaaaaa-tgggcaaagg
B D       Crab-eating macaque  aag---aaaaaaa----aactccat-----gaaaaacaaaaacaa--ccccattaaaaa-tgggcaaagg
B D                    Baboon  aag---aaaaaaa----aactccat-----gaaaaacaaaaacaa--ccccattaaaaa-tgggcaaagg
B D              Green monkey  aag---aaaaaaa----aactccat-----gaaaaacaaaaacaa--ccccattaaaaa-tgggcaaagg
B D           Squirrel monkey  aag---gaaaaaa---caactccat-----gaaaaac-aaaacaa--ccccattaaaaagtgggcaaagg
B D                 Armadillo  aat---acaaaaagaacacttccatctcaaaaataat-aagacaaagtctaatctaaaaatggacaagat
B D                  Hedgehog  ======================================================================
B D                Guinea pig  ======================================================================
B D                      Pika  ======================================================================
B D                    Rabbit  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Brush-tailed rat  ======================================================================
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
                  Chinchilla  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
B D           Chinese hamster  ======================================================================
                Prairie vole  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
B D                   Megabat  ======================================================================
B D                  Bushbaby  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                   Dolphin  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
B D                     Panda  ======================================================================
               Domestic goat  ======================================================================
B D                     Sheep  ======================================================================
            Tibetan antelope  ======================================================================
             Star-nosed mole  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
            Black flying-fox  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Squirrel  ======================================================================
                Weddell seal  ======================================================================
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
B D                  Microbat  ======================================================================
B D                       Dog  ======================================================================
B D                       Cow  ======================================================================
                Killer whale  ======================================================================

                        Human  acatgaacaggcacttctcaaaagaagacattcatgcagccaacaaacatatgaaaaaa-gctcaacatc
                        Chimp  acatgaacaggcacttctcaaaagaagacattcatgcagccaataaacatatgaaaaaa-gctcaacatc
                      Gorilla  acatgaacaggcacttctcaaaagaagacattcatgcagccaacaaacatatgaaaaaa-gctcaacatc
                    Orangutan  acatgaacaggcacttctcaaaagaagacattcatgcagccaacaaacataagaaaaag-gctcaacatt
                       Gibbon  acatgaacaggcacttctcaaaagaaga----catgcagccaacaaacatatgaaaaaa-gctcaacatc
                       Rhesus  acatgaacaggcacttctcaaaagaagacattcatgcagccaataaacatatgaaaaaa-gctcaatatc
          Crab-eating macaque  acatgaacaggcacttctcaaaagaagacattcatgcagccaataaacatatgaaaaaa-gctcaatatc
                       Baboon  acatgaacaggcacttctcaaaagaagacattcatgcagccaataaacatatgaaaaaa-gctcaatatc
                 Green monkey  acatgaacaggcacttctcaaaagaagacattcatgcagccaataaacatatgaaaaaa-gctcaatatc
              Squirrel monkey  acatgaacagacatttctcaaatgaagacattcatgtggccaagaaacatatgaaaaaa-gttcaatatc
                    Armadillo  atttaaatagacattccaccaaagaacatatatgaatggctaacaaggatttgaaaagatgttcaacatc
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  actgatcatttgat---tgcaaatcaaaa--cc-agtg---------------------agataccatct
                        Chimp  actgatcatttgat---tgcaaatcaaaa--cc-agtg---------------------agataccatct
                      Gorilla  actgatcatttgat---tgcagatcaaaa--cc-agtg---------------------agataccatct
                    Orangutan  gctgatcatttgat---tgcaaatcaaaa--cc-agtgagataccatctcacactagtcagataccatct
                       Gibbon  actgatcattccat---tgcaaatcaaaa--cc-aacg---------------------agttaccatct
                       Rhesus  actgaacattagagaaatgcaaatcaaaa--cc-aatg---------------------agataccatct
          Crab-eating macaque  actgaacattagagaaatgcaaatcaaaa--cc-aatg---------------------agataccatct
                       Baboon  actgaacattagagaaatgcaaatcaaaa--cc-aatg---------------------agataccatct
                 Green monkey  actgaacattagagaaatgcaaatcaaaa--cc-aatg---------------------agatactatct
              Squirrel monkey  actgattattagagaaatgcaaattgaaaacac-aatg---------------------agataccatct
                    Armadillo  attggtccttagggaaatgtaaatcaaaa--cagaaca---------------------agataccattt
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  cacaccagtcagaatggcgattattaaaaagtcaagaaacaacagatgctggcaaggttgcagagaaata
                        Chimp  cacaccagtcagaatggcgattattaaaaagtcaagaaacaacagatgctggcaaggttgcagagaaata
                      Gorilla  cacaccagtcagaatggcgattattaaaaagtcaaggaacaacagatgctggcaaggttgcagagaaata
                    Orangutan  cacactagtcagaatggcgattattaaaaagtcaagaaacaacagatgctggcaaggttgcagagaaata
                       Gibbon  cacaccagtcagaatggtg---attaaaaagtcaagaaacaacagatgctggcaaggttgcagagaaata
                       Rhesus  cacaccagtcagaatggtgattattaaaaagtcaagaaacaacagatgctggcaaggttgcagagaaata
          Crab-eating macaque  cacaccagtcagaatggtgattattaaaaagtcaagaaacaacagatgctggcaaggttgcagagaaata
                       Baboon  cacaccagtcagaatggtgattattaaaaagtcaagaaacaacagatgctggcaaggttgcagagaaata
                 Green monkey  cacaccagtcagaatggtgattattaaaaagtcaagaaataacagaaactggcaaggttgcagagaaata
              Squirrel monkey  cacaccagtcagaatggtggttattaaaaagtcaagaaacaatagatgctggcaaggttgcagagagata
                    Armadillo  cacacccactagaatgtctataattaaaaaggctgacactaacaagtgttggagctgatatggagaaatt
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  ggaatgcttttacactgtttgtgggaatgtaaattagttcagccattgtggaagatggcatggtgattcc
                        Chimp  ggaatgcttttacactgtttgtgggaatgtaaattagttcagccattgtggaagatggcatggtgattcc
                      Gorilla  ggaatgcttttacactgttt-tgggaatgtaaattagttcagccattgtggaagatggcgtggtgattcc
                    Orangutan  ggaatgtttttacagtgtttgtgggaatgtaaattagttcagccattgtggaagatggcatggtgattcc
                       Gibbon  ggaatgcttttacactgtttgtgggaatgtaaattagttcagccattgtggaagatggcatggtgattcc
                       Rhesus  ggaatgcttttacactgtttgtgggaatgtaaattagttcaaccattgtggaagatggcac-gtgattcc
          Crab-eating macaque  ggaatgcttttacactgtttgtgggaatgtaaattagttcaaccattgtggaagatggcac-gtgattcc
                       Baboon  ggaatgcttttacactgtttgtgggaatgtaaattagttcaaccattgtggaagatggcac-gtgattcc
                 Green monkey  ggaatgcttttacactgtttgtgggaatgtaaattagttcaaccattgtggaagatggcac-gtgattcc
              Squirrel monkey  gaaatgcttttacactgtttgtagaaatgtaaattagttcaagcattgtggaagatggcatggtgattcc
                    Armadillo  ggaaccctcgtgcgttgctggcaggaatgtaa---agtatggctgttttaaaaaacagtttttcagtttc
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  tcaaggaactaaaaccagaaataccatttgacccagcaatcccattactggggatatacccaaaggaata
                        Chimp  tcaaggaactaaaaccagaaatactacttgacccagcaatccctttactggggatatacccaaaggaata
                      Gorilla  tcaaggaactaaaaccagaaataccatttgatccagcaatccctttactggggatatacccaaaggaata
                    Orangutan  tcaaggatctaaaaccagaaataccatttgacccagcaatccctttactggggatatacccaaaggaata
                       Gibbon  tcaaggatctaaaaccagaaataccatttgacccagcaatccctttactggggatatacccaaaggaata
                       Rhesus  tcaaggatctaaaaccagaaatatcatttgacctagcaatccctttactggagacattcccaaaggaata
          Crab-eating macaque  tcaaggatctaaaaccagaaatatcatttgacctagcaatccctttactggagacattcccaaaggaata
                       Baboon  tcaaggatctaaaaccagaaataccatttgacctagcaatccctttactggagatattcccaaaggaata
                 Green monkey  tcaaggatctaaaaccagaaataccatttgacctagcaatccctttactggagatattcccaaaggaata
              Squirrel monkey  tcaaggatctagaaccaaaaataccatttgagctggcaacccctttactgggtatatacccaaaggaata
                    Armadillo  ttaaatagttaaacataaacttaccatagaatccagctattctatc-ctaggactctatccaagagaaat
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  taaatcattctattacaaagatatatgggcacatatgttcattgcagcactattcacaatagcaaagaca
                        Chimp  taaatcattctattacaaagatatatgcgcacatatgttcattgcagcactattcacaatagcaaagaca
                      Gorilla  taaatcattctattacaaagatatatgcgcacatatgttcattgcagcactattcacaatagcaaagaca
                    Orangutan  taaatcattctattacaaagatatatgcgcacatatgttcattgcagcactattcacaatagcaaagaca
                       Gibbon  taaatcattctattacaaagatatatgtgcacatatgttcattgcagcactattcacaatagcaaagaca
                       Rhesus  taaatcattatattacaaagatatatgcatgcatatgttcattgcatcactattcaccatagcaaagaca
          Crab-eating macaque  taaatcattatattacaaagatatatgcatgcatatgttcattgcatcactattcaccatagcaaagaca
                       Baboon  taaatcattatattacaaagatatacgcatgcatatg-tcactgcatcactattcaccatagcaaagaca
                 Green monkey  taaatcattatattacaaagatatatgcatgcatatgttcattgcatcactattcaccatagcaaagacg
              Squirrel monkey  taaatcattctgttaaaaagatacatgcacgcatatgttcatttcagcactattcacaatagcaaagacg
                    Armadillo  taaaacatatgtccacacaaaga------ctcaaatattcataactgcatcattcataacagtccaaaac
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  tggaatcaacccaaatgcccatcaatgacagactggataaagaaaatgtggtacatatacaccatgacat
                        Chimp  tggaatcaacccaaatgcccatcaatgacagactggataaagaaaatgtggtacatatacaccatgacat
                      Gorilla  tggaatcaacccaaatgcccatcaatgacagactggataaagaaaatgtggcacatatacaccatggcat
                    Orangutan  tggaatcaacccaaatgcccatcaatgatagactggataaagaaaatgtggtacatatacaccatggcat
                       Gibbon  tggaatcaa-ccaaatgcccatcaatgatagactggataaagaaaatgtggtacatatacaccatggcat
                       Rhesus  tggaatcaacccagatgcccatcaatgatagactggataaagaaaatgtggtacatatacaccgtggcat
          Crab-eating macaque  tggaatcaacccagatgcccatcaatgatagactggataaagaaaatgtggtacatatacaccgtggcat
                       Baboon  tggaatcaacccagatgcccatcaatgatagactggataaagaaaatgtggtacatatacaccgtggcat
                 Green monkey  tggaatcaacccagatgcccatcaatgatagactggataaagaaaatgtggtacatatacaccatggcat
              Squirrel monkey  tggaatcaacccaaatgtccatcaagaatagactggataaagaaaatgtggtacatatacaccatggcat
                    Armadillo  tagacacaatccaaatgtacatc-atctgggaatggataaacaaaatgtgttgtatccaaataatcaaat
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  agtatgcagccataaaaaggaatga---gatcatgtcctttgcagggacatgggtggagctggaaaccat
                        Chimp  agtatgcagccataaaaaggaatga---gatcatgtcctttgcagggacatgggtggagctggaaaccat
                      Gorilla  agtatgcagccataaaaaggaatga---gatcatgtcctttgcagggacatgggtggagctggaaaccat
                    Orangutan  actatgcagccataaaaaggaatga---gatcatgtcctttgcagggatatggatggagccggaaaccat
                       Gibbon  actatgcagccataaaaaggaatga---gatcatgtcctttgcagggacatggatggagctggaaacgat
                       Rhesus  actatgaagccataaaaaggaacga---gatcatgtcctttgcagggacatggatggagctggaaaccat
          Crab-eating macaque  actatgaagccataaaaaggaacga---gatcatgtcctttgcagggacatggatggagctggaaaccat
                       Baboon  actatgaagccataaaaaggaacga---gatcatgtcctttgcagggacgtggatggagctggaaaccat
                 Green monkey  actatgcagccataaaaaggaacga---gatcatgtcctttgcagggatatggatggagctggaaaccat
              Squirrel monkey  attatgcagccataaaaaggaatga---gatcatgtcctctgtagggacatgggtggagttggaaactat
                    Armadillo  actattcaataatttaaacaaactactgaaacatgctat-------aacatggctgaatctcaagaatat
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  tgtccttagcaaactaacgcaggaacagaaaacaagacaccctatg----ttctcacttataagtgggag
                        Chimp  tgtcctcagcaaactaacacaggaacagaaaacaagacaccctatg----ttctcacttataagtgggag
                      Gorilla  tgtccttagcaaactaacgcaggaacagaaaacaagacaccctatg----ttctcacttataagtgggag
                    Orangutan  tgtccttagcaaactaacgcaggaacagaaaacaagacaccctatg----ttctcacttataagtgggag
                       Gibbon  tgtccttagcaaactaacgcaggaacggaaaacaagacaccctatg----ttctcacttataagtgggag
                       Rhesus  catcctcagcaaactaacacagaaacagaaaataagacaccctatg----ttctcacctataagtgggag
          Crab-eating macaque  catcctcagcaaactaacacagaaacagaaaataagacaccctatg----ttctcacctataagtgggag
                       Baboon  catcctcagcaaactaacacagaaacagaaaataagacaccctatg----ttctcacctataagtgggag
                 Green monkey  catcctcagcaaactaacacagaaacagaaaataagacaccctatg----ttcttacctataagtgggag
              Squirrel monkey  tacccttagcaaactaacacagaaacagaaaataagacacttcatg----ttctcacttataagtaggag
                    Armadillo  tatattttgtgaaagttgccagtaacaaaagactacatagtgcatgatactttctaattatacgaaatgt
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  ctgaacaatgagaacac------atgggaaggggaacaacaca-cactgggtcctgttggcgggtgggtt
                        Chimp  ctgaacaatgagaacac------atgggaaggggaacaacaca-cactgggtcctgttggcgggtgggtt
                      Gorilla  ctgaacaatgagaacac------atgggaaggggaacaacaca-cactgggtcctgttggcgggtgggtt
                    Orangutan  ctgaacaatgagaacac------atgggaaggggaacaacaca-cactgggtcctgttggcgggggggtt
                       Gibbon  ctgaacaatgagaacac------atgggaaggggaacaacaca-cactgggtcctgttggtgggtgggtt
                       Rhesus  ctgaacaatgagaacac------atgggaaggagaacaacaca-cactgggtcctgttggcaggtgggtt
          Crab-eating macaque  ctgaacaatgagaacac------atgggaaggagaacaacaca-cactgggtcctgttggcaggtgggtt
                       Baboon  ctgaacaatgagaacac------atgggaaggag---aacaca-cactgggtgctgttggcaggtgggtt
                 Green monkey  ctgaacaatgagaacac------atgggaaggagaacaacaca-cactgggtcctgttggcaggtgggtt
              Squirrel monkey  ctaaacagtgagaacacatggaaatggggaggagaaca--aca-cactggagcctgtagacaggtgggtt
                    Armadillo  ctagaaaaggaaaac--------tggagacatagagcagcagatctatggctgctgtgggctag------
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  gcagggaag--gagagcattaggaaaaatagctaatgcatgctgggcttaatacctaggtgatgggttga
                        Chimp  gcagggaag--gaaagcattaggaaaaatagctaatgcatgctgggcttaatacctaggtgacgggttga
                      Gorilla  gcagggaag--gagagcattagg-aaaatagctaatgcatgctgggcttaatacctaggtgacgggttga
                    Orangutan  gcagggaag--gagagcattaggaaaaatagctaatgcatgctgggcttaatacctaggtgacaggttga
                       Gibbon  gcagggaag--gagagcatcaggataaatagctaatgcatgctgggcttaatacctaggtgatgggttga
                       Rhesus  tcagggaag--gagagcattaggaaaaatagctaatgcatgctgggcttaataccagggtgatgggttga
          Crab-eating macaque  gcagggaag--gagagcattaggaaaaatagctaatgcatgctgggcttaataccagggtgatgggttga
                       Baboon  gcagggaag--gagagcattaggaaaaatagctaatgcatgctgggcttaataccagggtgatgggttga
                 Green monkey  gcaggaaag--gagagcattaggaaaaatagataatgcatgctgggcttaataccagggtgatgggttga
              Squirrel monkey  gcagggagggagagagaattaggaaaaatagctaatgcatgctgggcttaatacctaggtgacaggttga
                    Armadillo  -------ag--gagag-attgg--taattaact--------------------------------gtaaa
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  taggtgcagcaaatcaccatggcacatgtttagctaagtaaaaaatctgcacatcctgcacatgtgccct
                        Chimp  taggtgcagcaaatcaccatggcacatgtttagctaagtaaaaaatctgcacatcctgcacatgtgccct
                      Gorilla  taggtgcagcaaatcaccatgacacatgtttagctaagtaacaaacctgcacatcctgcacatgtgccct
                    Orangutan  tcggtgcagcaaatcaccatggcacatgtttagctaagtaacaaacctgcacatcctgcacgtgtgccct
                       Gibbon  taggtgcagcaaatcaccatggcacatgtttagctaagtaacaaacctgcacatcctgcacgtgtgccct
                       Rhesus  taggtacagcaaatctccatggcacatgtttagcaaagtaacaaacctgcacatcccgcacatgtgccct
          Crab-eating macaque  taggtacagcaaatctccatggcacatgtttagcaaagtaacaaacctgcacatcccgcacatgtgccct
                       Baboon  taggtacagcaaatctccatggcacatgtttagcaaagtaacaaacctgcacatcctgcacctgtgccct
                 Green monkey  taggtacagcaaatctccatggcacatgtttagcaaagtaacaaacctgcacatcctgcacatgtgccct
              Squirrel monkey  taggggaagcaaaccaccatggcacatgtttagctaagtaacaaacctgcacatcctgcacatgtgccat
                    Armadillo  cagg--cagttaatcatca-------------------------------------------------ct
                     Hedgehog  ======================================================================
                   Guinea pig  ======================================================================
                         Pika  ======================================================================
                       Rabbit  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Brush-tailed rat  ======================================================================
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
                   Chinchilla  ======================================================================
               Naked mole-rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
              Chinese hamster  ======================================================================
                 Prairie vole  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
                          Cat  ======================================================================
                      Megabat  ======================================================================
                     Bushbaby  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================
                      Ferret   ======================================================================
                      Dolphin  ======================================================================
                          Rat  ======================================================================
                        Mouse  ======================================================================
                        Panda  ======================================================================
                Domestic goat  ======================================================================
                        Sheep  ======================================================================
             Tibetan antelope  ======================================================================
              Star-nosed mole  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
             Black flying-fox  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================
                     Squirrel  ======================================================================
                 Weddell seal  ======================================================================
         David's myotis (bat)  ======================================================================
                Big brown bat  ======================================================================
                     Microbat  ======================================================================
                          Dog  ======================================================================
                          Cow  ======================================================================
                 Killer whale  ======================================================================

                        Human  agaacttaaaagaaa
                        Chimp  agaacttaaaagaaa
                      Gorilla  agaacttaagagaaa
                    Orangutan  agaacttaaaataaa
                       Gibbon  agaacttaaaataaa
                       Rhesus  ggaacttaaaataaa
          Crab-eating macaque  ggaacttaaaataaa
                       Baboon  ggaacttaaaataaa
                 Green monkey  ggaacttaaaataaa
              Squirrel monkey  ggaacttaaaataaa
                    Armadillo  aga------------
                     Hedgehog  ===============
                   Guinea pig  ===============
                         Pika  ===============
                       Rabbit  ===============
                        Shrew  ===============
               Golden hamster  NNNNNNNNNNNNNNN
             Brush-tailed rat  ===============
                       Turkey  ===============
                      Chicken  ===============
                 Mallard duck  ===============
           Tibetan ground jay  ===============
                  Zebra finch  ===============
       White-throated sparrow  ===============
               Painted turtle  ===============
              Green seaturtle  ===============
           American alligator  ===============
                Scarlet macaw  ===============
                   Budgerigar  ===============
                      Opossum  ===============
                   Chinchilla  ===============
               Naked mole-rat  ===============
       Lesser Egyptian jerboa  ===============
          Collared flycatcher  ===============
          Medium ground finch  ===============
             Peregrine falcon  ===============
                 Saker falcon  ===============
                       Parrot  ===============
             Cape golden mole  ===============
           Chinese tree shrew  ===============
          Cape elephant shrew  ===============
                      Wallaby  ===============
                      Manatee  ===============
              Chinese hamster  ===============
                 Prairie vole  ===============
                     Aardvark  ===============
                     Elephant  ===============
                       Tenrec  ===============
                          Cat  ===============
                      Megabat  ===============
                     Bushbaby  ===============
                          Pig  ===============
     Chinese softshell turtle  ===============
                      Ferret   ===============
                      Dolphin  ===============
                          Rat  ===============
                        Mouse  ===============
                        Panda  ===============
                Domestic goat  ===============
                        Sheep  ===============
             Tibetan antelope  ===============
              Star-nosed mole  ===============
               Bactrian camel  ===============
                       Alpaca  ===============
               Pacific walrus  ===============
             Black flying-fox  ===============
             White rhinoceros  ===============
                        Horse  ===============
                     Squirrel  ===============
                 Weddell seal  ===============
         David's myotis (bat)  ===============
                Big brown bat  ===============
                     Microbat  ===============
                          Dog  ===============
                          Cow  ===============
                 Killer whale  ===============

Alignment block 5 of 700 in window, 26264150 - 26264162, 13 bps 
B D                     Human  aattaaaag-aaaa
B D                     Chimp  aattaaaag-aaaa
B D                   Gorilla  aattaaaag-aaaa
B D                 Orangutan  aattaaaag-aaaa
B D                    Gibbon  aat-----g-aaaa
B D                    Rhesus  aattaaaag-gaaa
B D       Crab-eating macaque  aattaaaag-gaaa
B D                    Baboon  aattaaaagaaaaa
B D              Green monkey  aattaaaag-aaaa
B D           Squirrel monkey  aattaaaag-aaaa
             Tibetan antelope  aattaaaaa-gtta
B D                       Cow  aattaaaaa-tgta
B D                  Hedgehog  ==============
B D                Guinea pig  ==============
B D                      Pika  ==============
B D                    Rabbit  ==============
B D                     Shrew  ==============
              Golden hamster  NNNNNNNNNNNNNN
            Brush-tailed rat  ==============
B D                    Turkey  ==============
B D                   Chicken  ==============
  D              Mallard duck  ==============
          Tibetan ground jay  ==============
B D               Zebra finch  ==============
  D    White-throated sparrow  ==============
  D            Painted turtle  ==============
  D           Green seaturtle  ==============
B D        American alligator  ==============
  D             Scarlet macaw  ==============
B D                Budgerigar  ==============
B D                   Opossum  ==============
                  Chinchilla  ==============
B D            Naked mole-rat  ==============
      Lesser Egyptian jerboa  ==============
  D       Collared flycatcher  ==============
B D       Medium ground finch  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
  D                    Parrot  ==============
            Cape golden mole  ==============
          Chinese tree shrew  ==============
         Cape elephant shrew  ==============
B D                   Wallaby  ==============
B D                   Manatee  ==============
B D           Chinese hamster  ==============
                Prairie vole  ==============
                    Aardvark  ==============
B D                  Elephant  ==============
B D                    Tenrec  ==============
B D                       Cat  ==============
B D                   Megabat  ==============
B D                  Bushbaby  ==============
B D                       Pig  ==============
  D  Chinese softshell turtle  ==============
B D                   Ferret   ==============
B D                   Dolphin  ==============
B D                       Rat  ==============
B D                     Mouse  ==============
B D                     Panda  ==============
               Domestic goat  ==============
B D                     Sheep  ==============
             Star-nosed mole  ==============
              Bactrian camel  ==============
B D                    Alpaca  ==============
              Pacific walrus  ==============
            Black flying-fox  ==============
B D          White rhinoceros  ==============
B D                     Horse  ==============
B D                  Squirrel  ==============
B D                 Armadillo  --------------
                Weddell seal  ==============
        David's myotis (bat)  ==============
               Big brown bat  ==============
B D                  Microbat  ==============
B D                       Dog  ==============
                Killer whale  ==============

Alignment block 6 of 700 in window, 26264163 - 26264164, 2 bps 
B D                     Human  aa
B D                     Chimp  aa
B D                   Gorilla  aa
B D                 Orangutan  aa
B D                    Gibbon  aa
B D                    Rhesus  aa
B D       Crab-eating macaque  aa
B D                    Baboon  aa
B D              Green monkey  aa
B D           Squirrel monkey  a-
B D                    Rabbit  aa
             Tibetan antelope  -a
B D                       Cow  -a
B D                       Dog  aa
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                      Pika  ==
B D                     Shrew  ==
              Golden hamster  NN
            Brush-tailed rat  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
                  Chinchilla  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Cape golden mole  ==
          Chinese tree shrew  ==
         Cape elephant shrew  ==
B D                   Wallaby  ==
B D                   Manatee  ==
B D           Chinese hamster  ==
                Prairie vole  ==
                    Aardvark  ==
B D                  Elephant  ==
B D                    Tenrec  ==
B D                       Cat  ==
B D                   Megabat  ==
B D                  Bushbaby  ==
B D                       Pig  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
B D                   Dolphin  ==
B D                       Rat  ==
B D                     Mouse  ==
B D                     Panda  ==
               Domestic goat  ==
B D                     Sheep  ==
             Star-nosed mole  ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  ==
B D                 Armadillo  --
                Weddell seal  ==
        David's myotis (bat)  ==
               Big brown bat  ==
B D                  Microbat  ==
                Killer whale  ==

Alignment block 7 of 700 in window, 26264165 - 26264166, 2 bps 
B D                     Human  ca
B D                     Chimp  ca
B D                   Gorilla  ca
B D                 Orangutan  ca
B D                    Gibbon  ca
B D                    Rhesus  ca
B D       Crab-eating macaque  ca
B D                    Baboon  ca
B D              Green monkey  ca
                 Prairie vole  ca
B D           Chinese hamster  ca
B D                    Rabbit  ca
             Tibetan antelope  ca
B D                       Cow  cc
B D                       Dog  ca
B D                  Hedgehog  ==
B D                Guinea pig  ==
B D                      Pika  ==
B D                     Shrew  ==
              Golden hamster  NN
            Brush-tailed rat  ==
B D                    Turkey  ==
B D                   Chicken  ==
  D              Mallard duck  ==
          Tibetan ground jay  ==
B D               Zebra finch  ==
  D    White-throated sparrow  ==
  D            Painted turtle  ==
  D           Green seaturtle  ==
B D        American alligator  ==
  D             Scarlet macaw  ==
B D                Budgerigar  ==
B D                   Opossum  ==
                  Chinchilla  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
  D                    Parrot  ==
            Cape golden mole  ==
          Chinese tree shrew  ==
         Cape elephant shrew  ==
B D                   Wallaby  ==
B D                   Manatee  ==
                    Aardvark  ==
B D                  Elephant  ==
B D                    Tenrec  ==
B D                       Cat  ==
B D                   Megabat  ==
B D                  Bushbaby  ==
B D                       Pig  ==
  D  Chinese softshell turtle  ==
B D                   Ferret   ==
B D                   Dolphin  ==
B D                       Rat  ==
B D                     Mouse  ==
B D                     Panda  ==
               Domestic goat  ==
B D                     Sheep  ==
             Star-nosed mole  ==
              Bactrian camel  ==
B D                    Alpaca  ==
              Pacific walrus  ==
            Black flying-fox  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Squirrel  ==
B D                 Armadillo  --
                Weddell seal  ==
        David's myotis (bat)  ==
               Big brown bat  ==
B D                  Microbat  ==
B D           Squirrel monkey  --
                Killer whale  ==

Inserts between block 7 and 8 in window
            Tibetan antelope 1bp
B D                      Cow 4bp

Alignment block 8 of 700 in window, 26264167 - 26264167, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
                 Prairie vole  g
B D           Chinese hamster  g
B D                    Rabbit  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D          White rhinoceros  a
B D                       Dog  a
B D                  Hedgehog  =
B D                Guinea pig  =
B D                      Pika  =
B D                     Shrew  =
              Golden hamster  N
            Brush-tailed rat  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  =
          Chinese tree shrew  =
         Cape elephant shrew  =
B D                   Wallaby  =
B D                   Manatee  =
                    Aardvark  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
B D                   Megabat  =
B D                  Bushbaby  =
B D                       Pig  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
B D                       Rat  =
B D                     Mouse  =
B D                     Panda  =
             Star-nosed mole  =
              Pacific walrus  =
            Black flying-fox  =
B D                     Horse  =
B D                  Squirrel  =
B D                 Armadillo  -
                Weddell seal  =
        David's myotis (bat)  =
               Big brown bat  =
B D                  Microbat  =
B D           Squirrel monkey  -

Inserts between block 8 and 9 in window
B D                      Dog 2bp

Alignment block 9 of 700 in window, 26264168 - 26264168, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Bushbaby  a
                 Prairie vole  g
B D           Chinese hamster  g
B D            Naked mole-rat  a
B D                Guinea pig  a
B D                    Rabbit  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Dog  a
                Big brown bat  a
B D                  Hedgehog  =
B D                      Pika  =
B D                     Shrew  =
              Golden hamster  N
            Brush-tailed rat  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
                  Chinchilla  =
      Lesser Egyptian jerboa  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  =
          Chinese tree shrew  =
         Cape elephant shrew  =
B D                   Wallaby  =
B D                   Manatee  =
                    Aardvark  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
B D                   Megabat  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
B D                       Rat  =
B D                     Mouse  =
B D                     Panda  =
             Star-nosed mole  =
              Pacific walrus  =
            Black flying-fox  =
B D                  Squirrel  =
B D                 Armadillo  -
                Weddell seal  =
        David's myotis (bat)  =
B D                  Microbat  =
B D           Squirrel monkey  -

Inserts between block 9 and 10 in window
B D                   Rabbit 3bp

Alignment block 10 of 700 in window, 26264169 - 26264169, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Bushbaby  g
       Lesser Egyptian jerboa  a
                 Prairie vole  t
B D           Chinese hamster  t
B D                     Mouse  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
B D                    Rabbit  a
B D                       Pig  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  a
B D                       Dog  a
                Big brown bat  a
B D                  Hedgehog  =
B D                      Pika  =
B D                     Shrew  =
              Golden hamster  N
            Brush-tailed rat  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  =
          Chinese tree shrew  =
         Cape elephant shrew  =
B D                   Wallaby  =
B D                   Manatee  =
                    Aardvark  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
B D                   Megabat  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
B D                       Rat  =
B D                     Panda  =
             Star-nosed mole  =
              Pacific walrus  =
            Black flying-fox  =
B D                  Squirrel  =
B D                 Armadillo  -
                Weddell seal  =
        David's myotis (bat)  =
B D                  Microbat  =
B D           Squirrel monkey  -

Alignment block 11 of 700 in window, 26264170 - 26264170, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Bushbaby  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
                 Prairie vole  g
B D           Chinese hamster  g
B D                     Mouse  g
B D            Naked mole-rat  a
B D                Guinea pig  g
                   Chinchilla  g
B D                    Rabbit  g
B D                       Pig  a
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  t
B D                       Cow  c
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  g
B D          White rhinoceros  g
B D                       Dog  g
                Big brown bat  g
B D                  Hedgehog  =
B D                      Pika  =
B D                     Shrew  =
              Golden hamster  N
            Brush-tailed rat  =
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  =
          Chinese tree shrew  =
         Cape elephant shrew  =
B D                   Wallaby  =
B D                   Manatee  =
                    Aardvark  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Cat  =
B D                   Megabat  =
  D  Chinese softshell turtle  =
B D                   Ferret   =
B D                       Rat  =
B D                     Panda  =
             Star-nosed mole  =
              Pacific walrus  =
            Black flying-fox  =
B D                 Armadillo  -
                Weddell seal  =
        David's myotis (bat)  =
B D                  Microbat  =
B D           Squirrel monkey  -

Alignment block 12 of 700 in window, 26264171 - 26264173, 3 bps 
B D                     Human  agt
B D                     Chimp  agt
B D                   Gorilla  agt
B D                 Orangutan  agt
B D                    Gibbon  agt
B D                    Rhesus  agt
B D       Crab-eating macaque  agt
B D                    Baboon  agt
B D              Green monkey  agt
B D           Squirrel monkey  aat
B D                  Bushbaby  agt
B D                  Squirrel  aat
       Lesser Egyptian jerboa  atc
                 Prairie vole  aac
B D           Chinese hamster  aat
B D                     Mouse  gaa
B D            Naked mole-rat  aat
B D                Guinea pig  agt
                   Chinchilla  aat
             Brush-tailed rat  aat
B D                    Rabbit  aat
B D                       Pig  aat
B D                    Alpaca  act
               Bactrian camel  act
B D                   Dolphin  aat
                 Killer whale  cat
             Tibetan antelope  aat
B D                       Cow  aat
B D                     Sheep  aat
                Domestic goat  aat
B D                     Horse  aac
B D          White rhinoceros  aat
B D                       Dog  aac
                Big brown bat  aat
B D                  Hedgehog  ===
B D                      Pika  ===
B D                     Shrew  ===
              Golden hamster  NNN
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Cape golden mole  ===
          Chinese tree shrew  ===
         Cape elephant shrew  ===
B D                   Wallaby  ===
B D                   Manatee  ===
                    Aardvark  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
B D                   Megabat  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
B D                       Rat  ===
B D                     Panda  ===
             Star-nosed mole  ===
              Pacific walrus  ===
            Black flying-fox  ===
B D                 Armadillo  ---
                Weddell seal  ===
        David's myotis (bat)  ===
B D                  Microbat  ===

Alignment block 13 of 700 in window, 26264174 - 26264253, 80 bps 
B D                     Human  ag-aagggaac--------ttcttcaacttgtggatttggtggcttttg--------tacaattctctaa
B D                     Chimp  ag-aagggaac--------ttcttcaacttgtggatttggtggcttttg--------tacaattctctaa
B D                   Gorilla  ag-aagggaac--------ttcttcaacttgtggatttggtggcttctg--------tacaattctctaa
B D                 Orangutan  ag-aagggaac--------ttcttcaacttgtggatttggtggcttttg--------tacaattctctaa
B D                    Gibbon  ag-aagggaac--------ttcttcaacttgtggatttggtggcttttt--------tacaattctctaa
B D                    Rhesus  ag-aagggaac--------ttcttcaacttgtggatttggtggcttttg--------tacaattctctaa
B D       Crab-eating macaque  ag-aagggaac--------ttcttcaacttgtggatttggtggcttttg--------tacaattctctaa
B D                    Baboon  ag-aagggaac--------ttcttcaacttgtggatttgctggcttttg--------tacaattctttaa
B D              Green monkey  ag-aagggaac--------ttcttcaacttgtggatttggtggcttttg--------tacaattctctaa
B D           Squirrel monkey  ag-aagggagc--------ttcttcaacttgtggatttcgtggcttttg--------tacaattctctaa
B D                  Bushbaby  ag-aaggaaac--------ttctccaacgtatggatttggtgatatttg--------cgcaattctctaa
B D                  Squirrel  tg-aaggaaatatccccagcccct------gtggcttg-gtagtgtttg--------cacaattctctaa
       Lesser Egyptian jerboa  ag-aaggaa----------tttct-------tcaacct-gtggctttggggtgtccccacagttctaaaa
                 Prairie vole  ag-aagagaac--------tttct------atccattt-gtgccaataa--------ta-aactctctaa
B D           Chinese hamster  agaaaaaaaac--------tttct------gccaactt-gtgccgatca--------cataactctccaa
B D                     Mouse  aa-aagaaaac--------tttct------gtcaatct-gtatggatga--------cttgagtctctac
B D            Naked mole-rat  ag-aaggaaac--------tttttcaacctgtagatttggtggcatttc--------tacaattctgtaa
B D                Guinea pig  ag-aagaaaac--------ttcttcaggctgtatatttggtgacatttg--------tacaattctataa
                   Chinchilla  ag-aagaaaac--------atcctcaacctatagattttgtgatagttg--------tataattctataa
             Brush-tailed rat  ag-aagaaaac--------ttctttagctggcagatttggtgacacatg--------tacaattttataa
B D                    Rabbit  ag-aagggaat--------tccttcaacccgtgaatttgatggtgcttg--------cacaattctctaa
B D                      Pika  ag-aggggaat--------ttcttccacgtgtggattctgtggtgcttt--------caacgctctctaa
B D                       Pig  ag-aagagaat--------ttcttcaaactgtgaatgtaatgatgcttt--------ctcaattctctaa
B D                    Alpaca  ag-aaaggaat--------tcctctggcctgtggatgttgtgatgtgtt--------ctcaatcctctaa
               Bactrian camel  ag-aaaggaat--------tcctctggcctgtggatgttgtgatgtgtt--------ctcaatcctctaa
B D                   Dolphin  ag-aagggaat--------ttctccaacctgtggatgtagtgatgcttt--------ctgaattctctaa
                 Killer whale  ag-aagggaat--------ttctccaacctgtggatgtagtgacgcttt--------ctgaattctctaa
             Tibetan antelope  ag-aagggaat--------ttctctaaactatggatgtagtgatacttt--------ctcgatactctaa
B D                       Cow  at-aagggaat--------ttctccaacctatgaatgtagtgatgcttt--------ctcaatactctaa
B D                     Sheep  ag-aagggaat--------ttctctaaactatgaatgtcgtgatacttt--------ctcgatactctaa
                Domestic goat  ag-aagggaat--------ttctctaaactatgaatgtcgtgatacttt--------ctcgatactctaa
B D                     Horse  ag-aagggacc--------ttcttcaagctgtggatgtagtgatgcttg--------ctcaactctataa
B D          White rhinoceros  ag-aagggaac--------ttcttcaacctgtggatgtggtgatgcttg--------ctcaactctataa
B D                       Dog  ag-aagagaac--------ttcttcaatctgtggatatggtgatggtta--------tttatgtctctaa
             Black flying-fox  ag-aagagaac--------ttcttcaacctgtgaatgtggtaa----tg--------ctcaattctctaa
B D                   Megabat  ag-aagagaac--------ttcttcaacctgtgaatgtggtaa----tg--------cccaattctctaa
                Big brown bat  ag-aagggaac--------ttcttcaaccc-tggatgttgtgc---ttg--------agcaacaccctaa
B D                 Armadillo  ----------------------------------ttgtggcgatgtttt--------cacaa--cactaa
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
B D                       Cat  ======================================================================
  D  Chinese softshell turtle  ======================================================================
B D                   Ferret   ======================================================================
B D                       Rat  ======================================================================
B D                     Panda  ======================================================================
             Star-nosed mole  ======================================================================
              Pacific walrus  ======================================================================
                Weddell seal  ======================================================================
        David's myotis (bat)  ======================================================================
B D                  Microbat  ======================================================================

                        Human  atttactac-aataatttaagtt--------tagat
                        Chimp  atttactac-aataatttaagtt--------tagat
                      Gorilla  atttactac-aataatttaagtt--------tagat
                    Orangutan  gtttactac-aataatttaagtt--------tagat
                       Gibbon  atttactac-aataatttaagtt--------tagat
                       Rhesus  atttactac-aataatttaattt--------taggt
          Crab-eating macaque  atttactac-aataatttaattt--------taggt
                       Baboon  atttactac-aataatttaattt--------tagat
                 Green monkey  atttactac-aataatttaattt--------taggt
              Squirrel monkey  atttactac-aataatttaattc--------tagat
                     Bushbaby  atttactat-aatcatttaactg--------tatac
                     Squirrel  atttactgc-aaatatttaattg--------aatac
       Lesser Egyptian jerboa  atttgctaa-cacaatttaaccg--------agcac
                 Prairie vole  atttactac-cctgatttaattt--------aatac
              Chinese hamster  atgtactac-aacgatttcattt--------aatgc
                        Mouse  attttcta--aatgatttagtgt--------actgc
               Naked mole-rat  atttactat-aatgatttcattc--------aatac
                   Guinea pig  atttactat-aatgatttcattg--------aatac
                   Chinchilla  atttactat-aatgatttcattg--------aatac
             Brush-tailed rat  atttaccat-aatgatttcatgg--------aatac
                       Rabbit  agtcactat-aattatttgattg--------aatct
                         Pika  agtaaaggc-agtgatttgagtg--------aacac
                          Pig  acttaccac-aatcatttaattg--------tatgt
                       Alpaca  atttactgc-aattattcaattc--------tgta-
               Bactrian camel  atttactgc-aattatttaattc--------tgta-
                      Dolphin  atttactgc-agtcatctaatt--------------
                 Killer whale  atttactgc-agtcatctaatt--------------
             Tibetan antelope  atctgctgcaagtcatttaattg--------tgtaa
                          Cow  atttgctgcaaggtgtttaattg--------tgtaa
                        Sheep  atttgctgcaagtcatttaattc--------tgtaa
                Domestic goat  atttgctgcaagtcatttaattg--------tgtaa
                        Horse  atttactac-aatcatctaattg--------tatag
             White rhinoceros  atttactac-aatcctctaattg--------tatat
                          Dog  atttaatac-aaccatttaattggaggttattaaat
             Black flying-fox  atttactac-aatcat-taattg--------tatat
                      Megabat  att---tac-aatcat-taattg--------tatat
                Big brown bat  attcactgc-aatcat-taattg--------catat
                    Armadillo  acttactaa-aatcatttcattc--------taggc
                     Hedgehog  ====================================
                        Shrew  ====================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Turkey  ====================================
                      Chicken  ====================================
                 Mallard duck  ====================================
           Tibetan ground jay  ====================================
                  Zebra finch  ====================================
       White-throated sparrow  ====================================
               Painted turtle  ====================================
              Green seaturtle  ====================================
           American alligator  ====================================
                Scarlet macaw  ====================================
                   Budgerigar  ====================================
                      Opossum  ====================================
          Collared flycatcher  ====================================
          Medium ground finch  ====================================
             Peregrine falcon  ====================================
                 Saker falcon  ====================================
                       Parrot  ====================================
             Cape golden mole  ====================================
           Chinese tree shrew  ====================================
          Cape elephant shrew  ====================================
                      Wallaby  ====================================
                      Manatee  ====================================
                     Aardvark  ====================================
                     Elephant  ====================================
                       Tenrec  ====================================
                          Cat  ====================================
     Chinese softshell turtle  ====================================
                      Ferret   ====================================
                          Rat  ====================================
                        Panda  ====================================
              Star-nosed mole  ====================================
               Pacific walrus  ====================================
                 Weddell seal  ====================================
         David's myotis (bat)  ====================================
                     Microbat  ====================================

Inserts between block 13 and 14 in window
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp

Alignment block 14 of 700 in window, 26264254 - 26264255, 2 bps 
B D                     Human  -tt
B D                     Chimp  -tt
B D                   Gorilla  -tt
B D                 Orangutan  -tt
B D                    Gibbon  -tt
B D                    Rhesus  -tt
B D       Crab-eating macaque  -tt
B D                    Baboon  -tt
B D              Green monkey  -tt
B D           Squirrel monkey  -tt
B D                  Bushbaby  -tt
B D                  Squirrel  -tt
       Lesser Egyptian jerboa  -tc
                 Prairie vole  -t-
B D           Chinese hamster  -t-
B D                     Mouse  -t-
B D            Naked mole-rat  -ac
B D                Guinea pig  -tc
                   Chinchilla  -tc
             Brush-tailed rat  -tc
B D                    Rabbit  -at
B D                      Pika  -tt
B D                       Pig  -t-
             Tibetan antelope  -t-
B D                       Cow  -t-
B D                     Sheep  -t-
                Domestic goat  -t-
B D                     Horse  -t-
B D          White rhinoceros  -t-
B D                       Dog  -t-
             Black flying-fox  -t-
B D                   Megabat  -t-
                Big brown bat  -t-
B D                  Microbat  -t-
B D                 Armadillo  tt-
B D                  Hedgehog  ===
B D                     Shrew  ===
              Golden hamster  NNN
B D                    Turkey  ===
B D                   Chicken  ===
  D              Mallard duck  ===
          Tibetan ground jay  ===
B D               Zebra finch  ===
  D    White-throated sparrow  ===
  D            Painted turtle  ===
  D           Green seaturtle  ===
B D        American alligator  ===
  D             Scarlet macaw  ===
B D                Budgerigar  ===
B D                   Opossum  ===
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D                    Parrot  ===
            Cape golden mole  ===
          Chinese tree shrew  ===
         Cape elephant shrew  ===
B D                   Wallaby  ===
B D                   Manatee  ===
                    Aardvark  ===
B D                  Elephant  ===
B D                    Tenrec  ===
B D                       Cat  ===
  D  Chinese softshell turtle  ===
B D                   Ferret   ===
B D                   Dolphin  ---
B D                       Rat  ===
B D                     Panda  ===
             Star-nosed mole  ===
              Bactrian camel  ---
B D                    Alpaca  ---
              Pacific walrus  ===
                Weddell seal  ===
        David's myotis (bat)  ===
                Killer whale  ---

Inserts between block 14 and 15 in window
B D                      Pig 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Dog 1bp

Alignment block 15 of 700 in window, 26264256 - 26264270, 15 bps 
B D                     Human  acaa-----------------------------------------------------tgggtacattt
B D                     Chimp  ataa-----------------------------------------------------tgggtacattt
B D                   Gorilla  acaa-----------------------------------------------------tgggtacattt
B D                 Orangutan  acaa-----------------------------------------------------tgggtacattg
B D                    Gibbon  acaa-----------------------------------------------------tgggtacattt
B D                    Rhesus  acaa-----------------------------------------------------tggatacattt
B D       Crab-eating macaque  acaa-----------------------------------------------------tggatacattt
B D                    Baboon  acaa-----------------------------------------------------tggatacattt
B D              Green monkey  acaa-----------------------------------------------------tggatacattt
B D           Squirrel monkey  acaa-----------------------------------------------------tgggtgcattt
B D                  Bushbaby  aaaa-----------------------------------------------------taggtgaattt
B D                  Squirrel  acaa-----------------------------------------------------caagtaaattt
       Lesser Egyptian jerboa  acaa-----------------------------------------------------tagg-agaatt
                 Prairie vole  -----------------------------------------------------------------act
B D           Chinese hamster  -----------------------------------------------------------------act
B D                     Mouse  -----------------------------------------------------------------gtt
B D            Naked mole-rat  acaa-----------------------------------------------------catttaatact
B D                Guinea pig  ccaa-----------------------------------------------------catttaata-t
                   Chinchilla  acaa-----------------------------------------------------catttactact
             Brush-tailed rat  --------------------------------------------------------------accact
B D                    Rabbit  acaa--------------------------------------------------------gtaaattt
B D                      Pika  acaa-----------------------------------------------------caggtggattt
B D                       Pig  ataa-----------------------------------------------------taggtaaattt
B D                    Alpaca  ---------------------------------------------------------t-------ttt
               Bactrian camel  ---------------------------------------------------------t-------ttt
B D                   Dolphin  ---------------------------------------------------------gagataaattt
                 Killer whale  ---------------------------------------------------------gtgataaattt
             Tibetan antelope  acaa-----------------------------------------------------taaataaattt
B D                       Cow  acaa-----------------------------------------------------tagataaattt
B D                     Sheep  ataa-----------------------------------------------------tagataaattt
                Domestic goat  acaataaataaattttattacacaaaaattatatctaatgcttttagataattacaataaataaattt
B D                     Horse  acaa-----------------------------------------------------taggtaaattt
B D          White rhinoceros  acaa-----------------------------------------------------taggtaaattt
B D                       Cat  acag-----------------------------------------------------taggtaaattt
B D                       Dog  ataa-----------------------------------------------------taggtaaattt
B D                   Ferret   acag-----------------------------------------------------taggtaaattt
B D                     Panda  acag-----------------------------------------------------taggtaaattt
               Pacific walrus  acag-----------------------------------------------------taggtaaattt
                 Weddell seal  acag-----------------------------------------------------taggtaaattt
             Black flying-fox  acaa-----------------------------------------------------taggtaaa-tt
B D                   Megabat  acaa-----------------------------------------------------taggtaaa-tt
                Big brown bat  acaa-----------------------------------------------------taggtaaattt
B D                  Microbat  acca-----------------------------------------------------tgtttctcttt
B D                 Armadillo  acaa-----------------------------------------------------aaggtacagtt
B D                  Hedgehog  ====================================================================
B D                     Shrew  ====================================================================
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Turkey  ====================================================================
B D                   Chicken  ====================================================================
  D              Mallard duck  ====================================================================
          Tibetan ground jay  ====================================================================
B D               Zebra finch  ====================================================================
  D    White-throated sparrow  ====================================================================
  D            Painted turtle  ====================================================================
  D           Green seaturtle  ====================================================================
B D        American alligator  ====================================================================
  D             Scarlet macaw  ====================================================================
B D                Budgerigar  ====================================================================
B D                   Opossum  ====================================================================
  D       Collared flycatcher  ====================================================================
B D       Medium ground finch  ====================================================================
  D          Peregrine falcon  ====================================================================
  D              Saker falcon  ====================================================================
  D                    Parrot  ====================================================================
            Cape golden mole  ====================================================================
          Chinese tree shrew  ====================================================================
         Cape elephant shrew  ====================================================================
B D                   Wallaby  ====================================================================
B D                   Manatee  ====================================================================
                    Aardvark  ====================================================================
B D                  Elephant  ====================================================================
B D                    Tenrec  ====================================================================
  D  Chinese softshell turtle  ====================================================================
B D                       Rat  ====================================================================
             Star-nosed mole  ====================================================================
        David's myotis (bat)  ====================================================================

Inserts between block 15 and 16 in window
B D                      Dog 132bp

Alignment block 16 of 700 in window, 26264271 - 26264279, 9 bps 
B D                     Human  tatta---tatg
B D                     Chimp  tatta---tatg
B D                   Gorilla  tatta---catg
B D                 Orangutan  tatta---tatg
B D                    Gibbon  tatta---tatg
B D                    Rhesus  tatta---tagg
B D       Crab-eating macaque  tatta---tagg
B D                    Baboon  tatta---tagg
B D              Green monkey  tatta---tagg
B D           Squirrel monkey  tatta---tatg
B D                  Bushbaby  tattg---tatg
B D                  Squirrel  tatta---tatt
       Lesser Egyptian jerboa  tattg---gaca
                 Prairie vole  gatct---tgta
B D           Chinese hamster  gattt---taca
B D                     Mouse  gattt---tgta
B D            Naked mole-rat  gagg--------
B D                Guinea pig  gagg--------
                   Chinchilla  gagg--------
             Brush-tailed rat  gagg--------
B D                    Rabbit  tattg---tata
B D                      Pika  tattc---tatg
B D                       Pig  -attg---taca
B D                    Alpaca  tatta---caca
               Bactrian camel  tatta---cata
B D                   Dolphin  catta---taca
                 Killer whale  catta---taca
             Tibetan antelope  tatta---cgta
B D                       Cow  tatta---caca
B D                     Sheep  tatta---cgta
                Domestic goat  tatta---caca
B D                     Horse  tatta---tgca
B D          White rhinoceros  tatta---t-cc
B D                       Cat  tatta---catg
B D                       Dog  tgtta---tata
B D                   Ferret   tactg---tata
B D                     Panda  tatta---tata
               Pacific walrus  tatta---tata
                 Weddell seal  tatta---tata
             Black flying-fox  tatta---tata
B D                   Megabat  tatta---tata
                Big brown bat  tatta---tata
B D                  Microbat  tattagtgtaga
B D                 Armadillo  tatca---tatg
B D                  Hedgehog  ============
B D                     Shrew  ============
              Golden hamster  NNNNNNNNNNNN
B D                    Turkey  ============
B D                   Chicken  ============
  D              Mallard duck  ============
          Tibetan ground jay  ============
B D               Zebra finch  ============
  D    White-throated sparrow  ============
  D            Painted turtle  ============
  D           Green seaturtle  ============
B D        American alligator  ============
  D             Scarlet macaw  ============
B D                Budgerigar  ============
B D                   Opossum  ============
  D       Collared flycatcher  ============
B D       Medium ground finch  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
  D                    Parrot  ============
            Cape golden mole  ============
          Chinese tree shrew  ============
         Cape elephant shrew  ============
B D                   Wallaby  ============
B D                   Manatee  ============
                    Aardvark  ============
B D                  Elephant  ============
B D                    Tenrec  ============
  D  Chinese softshell turtle  ============
B D                       Rat  ============
             Star-nosed mole  ============
        David's myotis (bat)  ============

Inserts between block 16 and 17 in window
                Prairie vole 4bp
B D          Chinese hamster 4bp
B D                    Mouse 4bp

Alignment block 17 of 700 in window, 26264280 - 26264466, 187 bps 
B D                     Human  taaattaca---catctgtatagctattc-a-aa--aaat--taa---------acatggctaaa-tttc
B D                     Chimp  taaattaca---catctatatagctattc-a-aa--aaat--ttt---------aaatggctaaa-tttc
B D                   Gorilla  taaactaca---cgtctgtatagctattc-a-aa--aaat--aaa---------aaatggctaaa-tttc
B D                 Orangutan  taaattaca---cgtctgtatagctattc-a-aa--aaat--aaa---------aaatggctaaa-tttc
B D                    Gibbon  taaattaca---catctgtatagctattc-a-aa--aaat--aaa---------aaatggctaaa-gttc
B D                    Rhesus  taaattaca---catctgtatagctattc-a-aa--aaat--aaa---------aaatggctcaa-gtcc
B D       Crab-eating macaque  taaattaca---catctgtatagctattc-a-aa--aaat--aaa---------aaatggctaaa-gtcc
B D                    Baboon  taaattaca---cgtctgtatagctattc-a-aa--aaat--aaa---------aaatggctaaa-gtcc
B D              Green monkey  taaattaca---cgtctgtatagctattc-a-aa--aaat--aaa---------aaatggctaaa-gtcc
B D           Squirrel monkey  taaattata---cctctgtatagccatgcaa-aa--aaat--gaa---------aaatggctaaa-gtgc
B D                  Bushbaby  taaattata---cttcagtatagctattc-t-aa--caga--tga---------aaatggttaag-atgc
B D                  Squirrel  taaattatg---cctcagtatagctatta-t-aa--aaat--gaa---------aaatgataaag-atac
       Lesser Egyptian jerboa  taagttaca---catcacggtggctgttg-t-ga--taag--gaa---------cactggccatg-----
                 Prairie vole  taaagctca---cctcggc----------------------------------------gctaag-atgc
B D           Chinese hamster  taaggctca---cctcagtgtggctttta-t-aa--gaat--gaa---------gagaggctaag-atgc
B D                     Mouse  taggtccca---cctcactgtgactttca-taaa--aaat--gaa---------gagaggctatg-atgc
B D                       Rat  taggtctca---cctcggtgtggctttca-t-gg--aaac--gaa---------gagaggctaag-acgc
B D            Naked mole-rat  taaatggca---gctcagtgcagctatta-t-aa--aaag--gaa---------aaatgactaat-gtat
B D                Guinea pig  taaatgata---cctcagtgtagctatta-t-aa--aaat--aat---------gaatgattaat-atat
                   Chinchilla  taaatgaca---cctcagtgtaactatta-t-aa--aaat--gac---------aaatgaccaat-atat
             Brush-tailed rat  taaacgata---cctcaaggtagctatga-t-ga--aagt--gac---------aaatgactaacgatac
B D                    Rabbit  taaactgta---cttgggtgtagctaatt-taca--agat--gac---------aagcggctaag-gtgc
B D                      Pika  taaagtgca---cttcagcatagctatta-taaa--agat--g------------agtggctaag-gtgc
B D                       Pig  taaattata---cctcggtata---attt-t-a------c--taa---------aaaaatctaag-gtat
B D                    Alpaca  caaattatc---cctcagtgtagctatta-t-a------c--aaatttttttttaaatgcctaag-gt--
               Bactrian camel  caaattatc---cctcagtgtagctatta-t-a------c--aaa-ttttttttaaatgcctaag-gt--
B D                   Dolphin  caaattata---cctcagtgtagctatta-t-aaaaaagc--aaa---------aaatgtctaag-gtct
                 Killer whale  caaattata---cctcagtgtagctatta-t-aaaaaagc--aaa---------aaatgtctaag-gtgt
             Tibetan antelope  aaaattata---tct--atgtagctatta-t-tt-----t--aaa---------aaatgctttta-gtat
B D                       Cow  aaaattata---tctcagtgtagctatta-t-ta-----a--aca---------taatgcctata-gtat
B D                     Sheep  aaaattata---tct--atgtagctatta-t-tt-----t--taa---------aaatgctttta-gtat
                Domestic goat  aaaattata---tct--atgtagctatta-t-tt-----t--aaa---------aaatgctttta-gtat
B D                     Horse  taaattata---tctcagtacagctatta-t-aag-aaat--gaa---------aaatgtgtaag-gtgt
B D          White rhinoceros  taaatggta---tctcagtacagctatta-t-gaa-aaat--gaa---------aaatgtctaag-gtgt
B D                       Cat  taaatcata---cctcagtatagctattg-t-aaa-aaat--gaa---------aaagttctaac-atgt
B D                       Dog  taaattata---cctcaatatagctatta-c-aga-aaataagaa---------aaatgtctaaa-gtgt
B D                   Ferret   taaacttta---cctcaatataaatatca-t-aga-aaat--tga---------aaatgtccaag-gtgt
B D                     Panda  taaattata---cctcagtatagctgtta-c-aga-aaat--tga---------aaatgtctaag-gtgt
               Pacific walrus  taaattata---cctcaatatagctatta-c-aga-aaat--tga---------aaatgtctaag-gtgt
                 Weddell seal  taaattata---cttcaatatagctatta-t-aga-aaat--tga---------aaatgtctaag-gtgt
             Black flying-fox  taaatctta---cttcagtatagctatta-t-aaa-aaat--gaa---------aaatgtctaag-gtgt
B D                   Megabat  taaatctta---cttcagtatagctatta-t-aaa-aaat--gaa---------aaatgtctaag-gtgt
                Big brown bat  -------ta---ccttagtatagctatta-t-aaagaaat--aaa---------aaagatctaaa-gtgt
B D                  Microbat  -------ta---ccttagaatagctatta-t-aaaaaaat--aaa---------aaagatctaaa-gtgt
B D                 Armadillo  taaactatatcccctcaata-acttatta-t-aca-tagt--gga---------aattgtctaag-gtgt
B D                  Hedgehog  ======================================================================
B D                     Shrew  ======================================================================
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Turkey  ======================================================================
B D                   Chicken  ======================================================================
  D              Mallard duck  ======================================================================
          Tibetan ground jay  ======================================================================
B D               Zebra finch  ======================================================================
  D    White-throated sparrow  ======================================================================
  D            Painted turtle  ======================================================================
  D           Green seaturtle  ======================================================================
B D        American alligator  ======================================================================
  D             Scarlet macaw  ======================================================================
B D                Budgerigar  ======================================================================
B D                   Opossum  ======================================================================
  D       Collared flycatcher  ======================================================================
B D       Medium ground finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D                    Parrot  ======================================================================
            Cape golden mole  ======================================================================
          Chinese tree shrew  ======================================================================
         Cape elephant shrew  ======================================================================
B D                   Wallaby  ======================================================================
B D                   Manatee  ======================================================================
                    Aardvark  ======================================================================
B D                  Elephant  ======================================================================
B D                    Tenrec  ======================================================================
  D  Chinese softshell turtle  ======================================================================
             Star-nosed mole  ======================================================================
        David's myotis (bat)  ======================================================================

                        Human  -ctcattcttatca-gtaggagctgttatgagcaa---gaagt--agatctttat-----tatgttctct
                        Chimp  -ctcattcttatca-gtaggaactgttatgagcaa---gaagt--agatctttat-----tatgttctct
                      Gorilla  -ctcattcttatca-gtaggagctgttatgagcaa---gaagt--agatctttat-----tatgttctct
                    Orangutan  -ctcattcttatta-gtagaagctgttatgaccaa---gaagt--agatctttat-----tatgttctct
                       Gibbon  -ctcattcttatca-gtagaagctgttatgagcaa---gaggt--agatctttat-----tatgttctct
                       Rhesus  -ctcattcttatca-gtagaagctactatgagcaa---gaggt--agatctttat-----tatgttctct
          Crab-eating macaque  -ctcattcttatca-gtagaagctactatgagcaa---gaggt--agatctttat-----tatgttctct
                       Baboon  -ctcattcttatca-gtagaagctactatgagcaa---gaagt--agatctttat-----tatgttctct
                 Green monkey  -ctcattcttatca-gtagaagctactatgagcaa---gaagt--agatctttat-----tatgttctct
              Squirrel monkey  -ctcattcttatca-gtagaagctgctatgagcaa---aaagt--agatctttat-----tatgttctct
                     Bushbaby  -ttcattcctatca-gaagaagctgtt-------------------------------------------
                     Squirrel  -ttaaatctcttagtagaagg--ttctataggcaa---gaatt--gtatgcttat-----tatgttccct
       Lesser Egyptian jerboa  -----ggcctatca-gtacag--tgctgtagacca---gaggccaccacatctac-----cacgctc--t
                 Prairie vole  -tgaagtctcttta--gggac--tgctgaggatga---cagcg------gtctgt-----tatgttc--t
              Chinese hamster  -ttaacttttatca-ggggag--tgctgaggatga---cagcg----------gt-----tatgttc--t
                        Mouse  -caaagccttatca-ggacag--tgctggggatga---gagcg------gtgtgt-----tatgttc--t
                          Rat  -cccagtctgctca-ggacag--ggctggggagga---aagtg------gtttgt-----tcttttc---
               Naked mole-rat  -ttaaattttatca-gtaaaa-ttgctataggcaa---gaa-----tatgtttat-----tatattctct
                   Guinea pig  -ttaaatcttattg-gtaaaagttgccataggcaa---gaact--gtgtgtttgt-----tatgttctct
                   Chinchilla  -ttaaattttatca-gtaaaagttg-tataggcaa---gaact--gtgtgtttat-----tatgttctct
             Brush-tailed rat  -ttaaattttatca-gtaaaagttgctataggcaa---gagtt--gtgtatttat-----tacgttctct
                       Rabbit  tttaattcttatca-gtagaaactttcataagcga---gaagt--gcatctttat-----tacgttctct
                         Pika  tttaatccttaccg-gtagaaactgccaaaggcaa---gaagt--ggatctttagtttaatatgttccct
                          Pig  -ttaattcttatca-gtagaagctgctatagccaa---taaat--gtatttttat-----tatgttctct
                       Alpaca  -----ttcttatca-gtggaagctgctataggtaa---gaagt--gtatctttat-----tacgttctct
               Bactrian camel  -----ttcttatca-gtggaagctactataagtaa---gaagt--gtatctttat-----tacgttctct
                      Dolphin  -ttaattcttatca-gtagaagctgctacaggcca---aaagt--gtacctttac-----tatgttctct
                 Killer whale  -ttaattcttatca-gtagaagctgctacaggcca---aaagt--gtacctttac-----tatgttctct
             Tibetan antelope  -ttaattctcatca-gtagaagatgctataagcaa---gacgt--gtacctttac-----tatgttctct
                          Cow  -tgaattctcatca-gtagaagatgctataagcaa---gaagt--gaacctttac-----tatgttctct
                        Sheep  -ttaattctcatca-gtagaagatgctataagcaa---gaagt--gta-ccttat-----tatgttctct
                Domestic goat  -ttaattctcatca-gtagaagatgctataagcaa---gaagt--gtatctttat-----tatgttctct
                        Horse  -ttaattcttatct-gtagaagccactataggcag---gaagt--gtatctttac-----tatcttctcc
             White rhinoceros  -ttaattcttatca-gtagaagctgctataagtaa---gaggt--gcatctttat-----tatcttctct
                          Cat  -ttaattcttatca-gtagaaaccactataggcaa---gaaga--gtatctttat-----tatgttgtct
                          Dog  -ttaattctt-tca-atagaagccactaaaggtaa---gaaga--gtatctttat-----tatgttctct
                      Ferret   -ttaattcta-tca-atagaagttactatagggaa---gaaga--gtatctttat-----tatgttctct
                        Panda  -----ttctt-tca-atagaagtcactatagacaa---gaaga--gtatctttat-----tatgttctct
               Pacific walrus  -ttaattctt-tca-atagaagtcactataggcaa---gaaga--gtatctttat-----tatgttctct
                 Weddell seal  -ttaattctt-tca-atagaagtcactataggcaa---gaaga--gtatctttat-----tatgttctct
             Black flying-fox  -ttaattcttttca-gtagaagtccctaaagacaa---gaagt--atatctttat-----aatgttctc-
                      Megabat  -ttaattcttttca-gtagaagtccctaaagacaa---gaagt--atatctttat-----aatgttctc-
                Big brown bat  -ttaattcttatc----agaagttgctatagataa---gaagc--atatctttat-----tatctt----
                     Microbat  -ttaattcttatc----agaagttgctatagacaa---gaagt--gtatctttat-----tatatt----
                    Armadillo  -ttcattctcatca-cgagaagctgctacaggtgaagcaaagt--gtatctctat-----tatgttc--t
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
     Chinese softshell turtle  ======================================================================
              Star-nosed mole  ======================================================================
         David's myotis (bat)  ======================================================================

                        Human  tt----ggagcac-agctcattaggattgc----tcaatca-ttttttagtcaatta-ctcaact--gag
                        Chimp  tt----ggagcac-agctcattaggattgc----tcaatca-ttttttagtcaatta-ctcaatt--gag
                      Gorilla  tt----ggagcac-agctcattaggattgc----tcaatca-ttttttagtcaatta-ctcaatt--gag
                    Orangutan  tt----ggagcac-agctcattaggattgc----tcaatca-ttttttagtcaatta-ctcaatt--gag
                       Gibbon  tt----ggagcac-agctcattaggattgt----tcaatca-ttttttagtcaatta-ctcaact--gag
                       Rhesus  tt----ggagcac-agctcattaggattgc----tcaatcatttttttagtcaatta-ctcaatt--gag
          Crab-eating macaque  tt----ggagcac-agctcattaggattgc----tcaatcatttttttagtcaatta-ctcaatt--gag
                       Baboon  tt----ggagcac-agctcattaggattgc----tcaatca-ttttttagtcaatta-ctcaatt--gag
                 Green monkey  tt----ggagcat-agctcattaggattgc----tcaatca-ttttttagtcaatta-ctcaatt--gag
              Squirrel monkey  tt----ggagcac-agctcattaggattgc----tcaatca-ttttttagtaaatta-ctcaact--ggg
                     Bushbaby  ----------------ctcattaggattac----ttaatca-atttgtagtaaatta-ctcaact--gag
                     Squirrel  tt----ggagcac-aaaacattaggattcc----tcaa-----cttttagtgaatga-ttcaattgagat
       Lesser Egyptian jerboa  tttcacatagcgt-tgctccttagctttgc----ccagtgc-acttttaacaa---a-ctccatt--gaa
                 Prairie vole  tt----ggattgt-tgctcattaggttctc----tcaa-tt-gtttttaatgaatga-ctccatt--gat
              Chinese hamster  tt----gggttgt-tgctcattagagctgc----tcaacct-atttttagttgatta-ctccact--gat
                        Mouse  tt----ggatggg-tgctcattaggtttgc----tcaatct-atttttaatgaatta-ctccatt--gat
                          Rat  --------atggt-tgttcattaggcttgc----tcaatct-gctcttaatgaatta-ctccatt--gat
               Naked mole-rat  tt----ggctcac-agctcattagtgttac----ttaa-----------------ta-ctcagtt--gag
                   Guinea pig  tt----gacacac-agctcattagtgttactttatcaa-----------------ta-ctcaatt--gag
                   Chinchilla  tt----gacacac-agctcattaatgttac----tcaa-----------------ta-ttcaatt--gag
             Brush-tailed rat  gc----aacacac-agttcattaatgttacttaatcag-----------------ta-tccaatt--gtg
                       Rabbit  tt----ggagcat-ggatcattaggtttgc----tcag-----tttttcataaatta-ctcaatt--gag
                         Pika  tt----gcagagtcgggtcattagggttgctcaatcag-----tttttagtaaatta-ctccatt--gag
                          Pig  tt----gggttac-aactcattaagattgc----acaacca-atttttagtagttta-ttcaa----aag
                       Alpaca  ct----agcacac-agctcattaaggttgc----tcagtca-atttttagtagttta-tacaatc--gag
               Bactrian camel  cc----agcgcac-agctcattaaggttgc----ttagtca-atttttagtagttta-tacaatc--gag
                      Dolphin  tt----ggaacac-agctcattaagattgc----tcaatca-atctttagtagttta-ctcaatt--gag
                 Killer whale  tt----ggaacac-agctcattaagattgc----tcaatca-atctttagtagttta-ctcaatt--gag
             Tibetan antelope  tt----ggagcac-agctcattaagattgc--------tca-atccttagtggttta-ctcaatt--gag
                          Cow  tt----ggagcac-agctcattaagattgc--------tca-atctttagtggttta-ctcaatt--gag
                        Sheep  tt----ggagcac-agctcattaagattgc--------tca-atccttagtggttta-ctcaatt--gag
                Domestic goat  tt----ggagcac-agctcattaagattgc--------tca-atccttagtggttta-ctcaatt--gag
                        Horse  tt----agagcac-agctcattaagattgc----tgaatca-atttttagtaattta-ttcaatt--gag
             White rhinoceros  tt----ggagcac-agctcattaagattgc--------tca-atttatagtaattta-ttcaatt--gag
                          Cat  tt----ggaacat-aactcatcaagatt-c----tcaatca-atttttagtaattta-ttcaa-t--gaa
                          Dog  tt----agaatac-aactcatca--gttac----tcaatca-atttttggtaattta-ttcaatt--gag
                      Ferret   tt----agagcac-aactcctcaagatcac----tcaatca-atttttagtaattta-ttctatt--gag
                        Panda  tt----cgaacac-aactcatcaagattac----tcagtca-atttttagtaattta-ttcagtt--gag
               Pacific walrus  tt----agaacac-aactcatccagattac----tcaatca-atttttagtatttta-ttcaatt--gaa
                 Weddell seal  tt----agaacac-aactcatcaagattac----tcaatca-atttttagtaattta-ttcaatt--gag
             Black flying-fox  -t----ggagcgt-agttcattaaagtccc----tcaatca-atttttagtaattta-ttcaatt--gag
                      Megabat  -t----ggagcgt-agttcattaaagtcgc----tcaatca-atttttagtaattta-ttcaatt--gag
                Big brown bat  -t----agagtac-agttcattaagattgc----tcaatca-atttttag-gatgta-tttaatt--gtg
                     Microbat  -t----agagtac-agttcattaagattgc----tcaatca-atttttag-aatgtattttaatc--atg
                    Armadillo  gt----agagcat-agctcatgagtgttgc----tcagtca-gtttttaata----a-ctcaatt--gag
                     Hedgehog  ======================================================================
                        Shrew  ======================================================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Turkey  ======================================================================
                      Chicken  ======================================================================
                 Mallard duck  ======================================================================
           Tibetan ground jay  ======================================================================
                  Zebra finch  ======================================================================
       White-throated sparrow  ======================================================================
               Painted turtle  ======================================================================
              Green seaturtle  ======================================================================
           American alligator  ======================================================================
                Scarlet macaw  ======================================================================
                   Budgerigar  ======================================================================
                      Opossum  ======================================================================
          Collared flycatcher  ======================================================================
          Medium ground finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Parrot  ======================================================================
             Cape golden mole  ======================================================================
           Chinese tree shrew  ======================================================================
          Cape elephant shrew  ======================================================================
                      Wallaby  ======================================================================
                      Manatee  ======================================================================
                     Aardvark  ======================================================================
                     Elephant  ======================================================================
                       Tenrec  ======================================================================
     Chinese softshell turtle  ======================================================================
              Star-nosed mole  ======================================================================
         David's myotis (bat)  ======================================================================

                        Human  ct----------ttaaa-aa---actaatcatg-tt
                        Chimp  ct----------ttaaa-aa---actaatcatg-tt
                      Gorilla  ct----------ttaaa-aa---actaatcatg-tt
                    Orangutan  ct----------ttaaa-aa---actaatcatg-tt
                       Gibbon  ct----------ttaaa-aa---attaatcatg-tt
                       Rhesus  ct----------ttaaa-aa---actaatcatg-tt
          Crab-eating macaque  ct----------ttaaa-aa---actaatcatg-tt
                       Baboon  ct----------ttaaa-aa---actaatcatg-tt
                 Green monkey  ct----------ttcaa-aa---actaatcatg-tt
              Squirrel monkey  ct----------tcaaa-aa---actaatcatg-ct
                     Bushbaby  ct----------ccaaa-aa---accaatcatg-tt
                     Squirrel  tt-----------aaaa-ga----tgaatcatgaat
       Lesser Egyptian jerboa  ct-----------tcac-at----gggctaac----
                 Prairie vole  tt------aaagaccaa-aa----cg---actg-tt
              Chinese hamster  tt------aaaaacaaa-ga----ggaataatg-ct
                        Mouse  ttaaaaaaaaaaacaaa-ga----agaataatg-ct
                          Rat  tt------aaagacaaa-ga----agaataatg---
               Naked mole-rat  ct----------ttaaacaa----ttcatcatg-tt
                   Guinea pig  tt----------ttaaa-aa----ttaatcaca-ta
                   Chinchilla  tt----------ttaca-aa----ttaatcatg-tt
             Brush-tailed rat  tt----------ttaaa-aa----tcaatcatg-tt
                       Rabbit  ct----------tctaa-aa-aaaccaaccgtg-at
                         Pika  ct----------tttaa-aagaagccaaccgtg-tt
                          Pig  ct----------ttcag-aa---attaaagatg-tt
                       Alpaca  ct----------tcaaa-aa---attaaccatg-tt
               Bactrian camel  ct----------tcaaa-aa---attaaccatg-tt
                      Dolphin  at----------tttaa-aa---actaaccatg-tt
                 Killer whale  at----------tttaa-aa---actaaccatg-tt
             Tibetan antelope  at----------tttaa-aa---actaaccata-tt
                          Cow  at----------ttaaa-aa---actaatcgta-tt
                        Sheep  at----------tttaa-aa---actaaccata-tt
                Domestic goat  at----------tttaa-aa---actaaccata-tt
                        Horse  ct----------ttaaa-aa---attagccatg-tt
             White rhinoceros  ct----------ttcaa-aa---attaacaaca-tt
                          Cat  ct----------ttaaa-aa---gttaaccatg-tt
                          Dog  ct----------ttaaa-aa---attag-catg-tt
                      Ferret   ct----------ttaga-aa---gtgaaacatg-tt
                        Panda  ct----------ttaaa-ga---attaaccatg-tt
               Pacific walrus  ct----------ttaaa-at---attaaccatg-tt
                 Weddell seal  ct----------ttaaa-at---attaaccatg-tt
             Black flying-fox  ct----------tttaa-aa---attaatcatg-tt
                      Megabat  ct----------tttaa-aa---attaatcatg-tt
                Big brown bat  ca----------tttaa-aa---attaaccatg-tt
                     Microbat  ct----------tttaa-aa---gttaaccatg-tt
                    Armadillo  tt----------tacaa-aa----tcaatcatg-tt
                     Hedgehog  ====================================
                        Shrew  ====================================
               Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                       Turkey  ====================================
                      Chicken  ====================================
                 Mallard duck  ====================================
           Tibetan ground jay  ====================================
                  Zebra finch  ====================================
       White-throated sparrow  ====================================
               Painted turtle  ====================================
              Green seaturtle  ====================================
           American alligator  ====================================
                Scarlet macaw  ====================================
                   Budgerigar  ====================================
                      Opossum  ====================================
          Collared flycatcher  ====================================
          Medium ground finch  ====================================
             Peregrine falcon  ====================================
                 Saker falcon  ====================================
                       Parrot  ====================================
             Cape golden mole  ====================================
           Chinese tree shrew  ====================================
          Cape elephant shrew  ====================================
                      Wallaby  ====================================
                      Manatee  ====================================
                     Aardvark  ====================================
                     Elephant  ====================================
                       Tenrec  ====================================
     Chinese softshell turtle  ====================================
              Star-nosed mole  ====================================
         David's myotis (bat)  ====================================

Inserts between block 17 and 18 in window
B D                    Horse 239bp

Alignment block 18 of 700 in window, 26264467 - 26264492, 26 bps 
B D                     Human  ccatggac--t---a--------------t-gacattcaagtagct
B D                     Chimp  ccatggac--t---a--------------t-gacattcaagtagct
B D                   Gorilla  ccatggac--t---a--------------t-gacattcaagtagct
B D                 Orangutan  ccatggac--t---a--------------t-gacattcaagtagct
B D                    Gibbon  ccatggac--t---a--------------t-gacattcaactagct
B D                    Rhesus  ccatggac--t---a--------------t-gacatttaagtagct
B D       Crab-eating macaque  ccatggac--t---a--------------t-gacatttaagtagct
B D                    Baboon  ccatggac--t---a--------------t-gatattcaagtagct
B D              Green monkey  tcatggac--t---a--------------t-gacattcaagtagct
B D           Squirrel monkey  ccatggac--t---a--------------t-gacattcaagtagct
B D                  Bushbaby  ccatggac--t---atatggaggatagcct-ggcattcaagttgtt
B D                  Squirrel  ccatggaa--t---tcacaaccaatagcct-ggaatttgggctgct
       Lesser Egyptian jerboa  -----------------caacctctaggct-ggtactcaaatcatg
                 Prairie vole  ccccggat--g---gcacatcctacagcct----------------
B D           Chinese hamster  cccaggat--g---gtgcatcctccagcct-ggtgcctgacctgtt
B D                     Mouse  ccccagat--g---gtacaacctacaacct-tgtgcctgacctctt
B D                       Rat  -----gat--g---gtacgacctacggcct-ggcacctgacctgtc
B D            Naked mole-rat  ctgtgggc--tactatacaacccatatcca-gacattcaagttgct
B D                Guinea pig  ccacgggc--tgctgtacaacccatgccta-agcattcaagttgtt
                   Chinchilla  ctgtgggc--tgttatataacccatgtcca-ggcattcaggttgct
             Brush-tailed rat  ctctgggc--t--------acccaggtcca-ggcattcaagttgct
B D                    Rabbit  cca--------------------------t-ggcattcgagttacc
B D                      Pika  ccatgcac--a-----acaacccagagcct-ggcactcaggtcatt
B D                       Pig  caatggat--t---atataatatatagcct-ggcattcaag-----
B D                    Alpaca  ccaggaac--t---atacaccctgtagcct-ggc-----------t
               Bactrian camel  ccaggaactat---atacaccctgtagcct-ggc-----------t
B D                   Dolphin  ccatggac--t---atacaacctatagcct-ggcattcaagttatt
                 Killer whale  ccatggac--t---atacaacctatagcct-ggcattcaagttatt
             Tibetan antelope  ccatggac--t---atacaacctaaagcct-agcatttaagttatt
B D                       Cow  ccatgaac--t---atacaacctaaagcct-agcatttaagttatt
B D                     Sheep  ccacggac--t---atacaacctaaagcct-agcatttaagttatt
                Domestic goat  ccgtggac--t---atacaacctaaagcct-agcatttaagttatt
B D                     Horse  atgtggac--t---atttgacctgtagcct-ggcattcaagttgct
B D          White rhinoceros  acatggac--t---atagaatctacagcct-tgcatttgagttgct
B D                       Cat  ccatggac--t---atacaatctatagcct-ggcactcaagttgct
B D                       Dog  ccatggac--t---gtagaatctatagcct-ggcattcaagttgct
B D                   Ferret   ccatggac--t---gtataatctatagcct-ggcattcaagttgct
B D                     Panda  ccatggac--t---gtgtaatctatagcct-ggcattcaagttgct
               Pacific walrus  ccatggac--t---gtataatctatagcct-gacattcaagttgct
                 Weddell seal  ccatggac--t---gtataatctatagcct-ggcattcaagttgcc
             Black flying-fox  ccat---------------------------ggcagtcaagtcgct
B D                   Megabat  ccat---------------------------ggcagtcaagtcgct
                Big brown bat  ccatagac--t---atgcaacctatagcctgggcattcaagttgct
B D                  Microbat  ccatagac--t---atacaacctatagcct-ggcattcaagttgct
B D                 Armadillo  ccatggcc--t------------ctagcct-ggcatttaagatgtt
B D                  Hedgehog  ==============================================
B D                     Shrew  ==============================================
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Turkey  ==============================================
B D                   Chicken  ==============================================
  D              Mallard duck  ==============================================
          Tibetan ground jay  ==============================================
B D               Zebra finch  ==============================================
  D    White-throated sparrow  ==============================================
  D            Painted turtle  ==============================================
  D           Green seaturtle  ==============================================
B D        American alligator  ==============================================
  D             Scarlet macaw  ==============================================
B D                Budgerigar  ==============================================
B D                   Opossum  ==============================================
  D       Collared flycatcher  ==============================================
B D       Medium ground finch  ==============================================
  D          Peregrine falcon  ==============================================
  D              Saker falcon  ==============================================
  D                    Parrot  ==============================================
            Cape golden mole  ==============================================
          Chinese tree shrew  ==============================================
         Cape elephant shrew  ==============================================
B D                   Wallaby  ==============================================
B D                   Manatee  ==============================================
                    Aardvark  ==============================================
B D                  Elephant  ==============================================
B D                    Tenrec  ==============================================
  D  Chinese softshell turtle  ==============================================
             Star-nosed mole  ==============================================
        David's myotis (bat)  ==============================================

Inserts between block 18 and 19 in window
B D                Armadillo 1bp

Alignment block 19 of 700 in window, 26264493 - 26264493, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  c
B D           Chinese hamster  c
B D                     Mouse  c
B D                       Rat  c
B D            Naked mole-rat  a
B D                Guinea pig  g
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
                Big brown bat  a
B D                  Microbat  a
B D                  Hedgehog  =
B D                     Shrew  =
              Golden hamster  N
B D                    Turkey  =
B D                   Chicken  =
  D              Mallard duck  =
          Tibetan ground jay  =
B D               Zebra finch  =
  D    White-throated sparrow  =
  D            Painted turtle  =
  D           Green seaturtle  =
B D        American alligator  =
  D             Scarlet macaw  =
B D                Budgerigar  =
B D                   Opossum  =
  D       Collared flycatcher  =
B D       Medium ground finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
  D                    Parrot  =
            Cape golden mole  =
          Chinese tree shrew  =
         Cape elephant shrew  =
B D                   Wallaby  =
B D                   Manatee  =
                Prairie vole  -
                    Aardvark  =
B D                  Elephant  =
B D                    Tenrec  =
B D                       Pig  -
  D  Chinese softshell turtle  =
             Star-nosed mole  =
B D                 Armadillo  =
        David's myotis (bat)  =

Alignment block 20 of 700 in window, 26264494 - 26264506, 13 bps 
B D                     Human  catgtccttgcca
B D                     Chimp  catgtccttgcca
B D                   Gorilla  catgtccttgcca
B D                 Orangutan  catgtccttgcca
B D                    Gibbon  catgtccttgcca
B D                    Rhesus  catgtccttgtca
B D       Crab-eating macaque  catgtccttgtca
B D                    Baboon  cgtgtccttgtca
B D              Green monkey  catgtccttgtca
B D           Squirrel monkey  cgtgttcttgcta
B D                  Bushbaby  catgtcctttcca
B D                  Squirrel  catatcattgcta
       Lesser Egyptian jerboa  tct--cgtcc---
                 Prairie vole  ---ggcgtcg---
B D           Chinese hamster  tggggcatcg---
B D                     Mouse  tgtggcaccg---
B D                       Rat  tgtggcatcg---
B D            Naked mole-rat  cacatcact-cca
B D                Guinea pig  catgtcaccgcca
                   Chinchilla  catgtcactgtca
             Brush-tailed rat  cgtgtcactgtca
B D                    Rabbit  caggcccttgcca
B D                      Pika  catgccctgacca
B D                       Pig  -------ttgcta
B D                    Alpaca  caagttcttacta
               Bactrian camel  caagttcttacta
B D                   Dolphin  catgtctttgcta
                 Killer whale  catgtctttgcta
             Tibetan antelope  catgtcttcacta
B D                       Cow  catgacttcacta
B D                     Sheep  catgtcttcacta
                Domestic goat  catgtcttcacta
B D                     Horse  cacgtccttgcca
B D          White rhinoceros  catgtccttgcca
B D                       Cat  catgttcttgcca
B D                       Dog  catgttcttgcca
B D                   Ferret   catgttcttgctg
B D                     Panda  catgttcttgcca
               Pacific walrus  catgttcttgtca
                 Weddell seal  catgttcttgtca
             Black flying-fox  c-tgtccttatca
B D                   Megabat  c-tgtccttatca
                Big brown bat  tatatccttggca
B D                  Microbat  tatatccttggca
B D                  Elephant  catgctatatcca
B D                   Manatee  cgtgctatatcca
             Cape golden mole  catgctatatcca
B D                 Armadillo  catgtccttgcca
B D                  Hedgehog  =============
B D                     Shrew  =============
              Golden hamster  NNNNNNNNNNNNN
B D                    Turkey  =============
B D                   Chicken  =============
  D              Mallard duck  =============
          Tibetan ground jay  =============
B D               Zebra finch  =============
  D    White-throated sparrow  =============
  D            Painted turtle  =============
  D           Green seaturtle  =============
B D        American alligator  =============
  D             Scarlet macaw  =============
B D                Budgerigar  =============
B D                   Opossum  =============
  D       Collared flycatcher  =============
B D       Medium ground finch  =============
  D          Peregrine falcon  =============
  D              Saker falcon  =============
  D                    Parrot  =============
          Chinese tree shrew  =============
         Cape elephant shrew  =============
B D                   Wallaby  =============
                    Aardvark  =============
B D                    Tenrec  =============
  D  Chinese softshell turtle  =============
             Star-nosed mole  =============
        David's myotis (bat)  =============

Inserts between block 20 and 21 in window
B D                 Squirrel 1bp
      Lesser Egyptian jerboa 1bp
                Prairie vole 1bp
B D          Chinese hamster 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D           Naked mole-rat 1bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 353bp
B D                     Pika 1bp
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 1bp
B D                 Microbat 1bp

Alignment block 21 of 700 in window, 26264507 - 26264543, 37 bps 
B D                     Human  ta-ctaattatctt---ttaactactcttttttttttttt-t-------
B D                     Chimp  ta-ctaattatctt---ttaactactc---tttttttttt-t-------
B D                   Gorilla  ta-ctaattatctt---ttaactactcttttttttttttt-t-------
B D                 Orangutan  ta-ctaattatctt---ttaactactc-----tttttttt-t-------
B D                    Gibbon  ta-ctaattatctt---ttaactactc------ttttttt-t-------
B D                    Rhesus  ta-ctaattatctt---ttaactactc-----tttttttt-c-------
B D       Crab-eating macaque  ta-ctaattatctt---ttaactactc------ttttttt-c-------
B D                    Baboon  ta-ctaattatctt---ttaactactc------ttttttt-c-------
B D              Green monkey  ta-ctaattatctt---ttaactactc------ttttttt-c-------
B D           Squirrel monkey  ta-ctaattatctt---ttaactactc-tttttttttttt-c-------
B D                  Bushbaby  ca---aattatctt---ttaactactt---------attt-t-------
B D                  Squirrel  aa-ctgattctctt--------tactc------t----tt-t-------
       Lesser Egyptian jerboa  ag-ccgattctctt--------tcatt------cccattt-t-------
                 Prairie vole  ga-cgaactctcgt--------t-------------gttt-c-------
B D           Chinese hamster  ga-ctaagtctc--------------------------tt-c-------
B D                     Mouse  ga-ctgaatctctt--------tagtt------ctcactt-t-------
B D                       Rat  ga-ctaagtctctt--------tagtt------cccactt-t-------
B D            Naked mole-rat  ga-ctaattctctt--------tatct------t--attt-t-------
B D                Guinea pig  ga-ctaatt--------------atct------t--attt-t-------
                   Chinchilla  ga-ctaattctctt--------tacct------t--attt-t-------
             Brush-tailed rat  ga-ctcattctttt--------catct------t--agtt-c-------
B D                    Rabbit  ca-ctaattctctt---ttaactgccc------t--gtgt-t-------
B D                      Pika  aa-ctacttctcttttattaactgcct------t--gttt-t-------
B D                       Pig  aa-catattctctt---at--ttactc------t--ttttgc-------
B D                    Alpaca  aa-cttactctctt---ttatctactc------t--gtc----------
               Bactrian camel  aa-cttactctgtt---ttatctactc------t--gttt-c-------
B D                   Dolphin  aa-cttattctcta---ctctctactc------t--gttt-c-------
                 Killer whale  aa-cttattctcta---ctctctactc------t--gttt-c-------
             Tibetan antelope  a-----attctatc---tt------------------------------
B D                       Cow  aa-ctcattctatc---ta------------------------------
B D                     Sheep  aa-ttcattctatc---tt------------------------------
                Domestic goat  aa-ttcattctatc---tt------------------------------
B D                     Horse  aa-cttattc--tt---ttatctattc------t--attt-c-------
B D          White rhinoceros  aa-cttattc--tt---ttatctgttc------t--gttc-c-------
B D                       Cat  aa-tttattctgtt---ttatccactc------t--gttt-c-------
B D                       Dog  aa-tttattctctt---ttatctactc------t--tttt-c-------
B D                   Ferret   aa-tttattctctt---ttatctactc------t--gttt-c-------
B D                     Panda  aa-tttattctctt---ttatctactc------t--gttt-c-------
               Pacific walrus  aa-tttattctctt---ttatctactc------t--gttt-c-------
                 Weddell seal  aa-tttattctctt---ttatctactc------t--gttt-c-------
             Black flying-fox  aa-ctcactctctt---ttgtctactc------t--gttt-c-------
B D                   Megabat  aa-cttactctctt---ttgtctactc------t--gttt-c-------
                Big brown bat  ga-tttattctctt---ttatctactc------t--gttt-t-------
B D                  Microbat  ga-tttattctctt---ttatctactc------t--attt-t-------
B D                  Elephant  ta-ctta----ctt---taatctattg------t--g-tt-t-------
B D                   Manatee  ta-cttactctctt---tagcctactg------t--gttt-t-------
             Cape golden mole  ta-cttattctctt---ttacctactg------t----tt-t-------
B D                 Armadillo  cagtttattctctt---t-atctattc------t----tt-ttcccttc
B D                  Hedgehog  =================================================
B D                     Shrew  =================================================
              Golden hamster  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Turkey  =================================================
B D                   Chicken  =================================================
  D              Mallard duck  =================================================
          Tibetan ground jay  =================================================
B D               Zebra finch  =================================================
  D    White-throated sparrow  =================================================
  D            Painted turtle  =================================================
  D           Green seaturtle  =================================================
B D        American alligator  =================================================
  D             Scarlet macaw  =================================================
B D                Budgerigar  =================================================
B D                   Opossum  =================================================
  D       Collared flycatcher  =================================================
B D       Medium ground finch  =================================================
  D          Peregrine falcon  =================================================
  D              Saker falcon  =================================================
  D                    Parrot  =================================================
          Chinese tree shrew  =================================================
         Cape elephant shrew  =================================================
B D                   Wallaby  =================================================
                    Aardvark  =================================================
B D                    Tenrec  =================================================
  D  Chinese softshell turtle  =================================================
             Star-nosed mole  =================================================
        David's myotis (bat)  =================================================

Inserts between block 21 and 22 in window
B D                  Gorilla 39bp

Alignment block 22 of 700 in window, 26264544 - 26264565, 22 bps 
B D                     Human  cctaaaagcagctttttgtacc
B D                     Chimp  cctaaaagcagctttttgtacc
B D                   Gorilla  cctaaaagcagatttttgtacc
B D                 Orangutan  cctaaaagcagctttttgtacc
B D                    Gibbon  cctaaaagcagctttttgtacc
B D                    Rhesus  cctaaaagcagctttttccacc
B D       Crab-eating macaque  cctaaaagcagctttttccacc
B D                    Baboon  cctaaaggcagctttttccacc
B D              Green monkey  cctaaaagcagctttttccacc
B D           Squirrel monkey  cctaaaagcaacattttgtacc
B D                  Bushbaby  tctaaaagca------------
B D                  Squirrel  tctcaaactaactttctatacc
       Lesser Egyptian jerboa  cctcaaagcagcccgttccccc
                 Prairie vole  ccccaaagcaggttcctgtccc
B D           Chinese hamster  ccccaaagcagctttctgtccc
B D                     Mouse  ccct-aagcagctttctgtccc
B D                       Rat  ccctaaagcagctttctgtcgc
B D            Naked mole-rat  cttcaaagcagctttttgcact
B D                Guinea pig  cttcaaaaaagtcttttgcact
                   Chinchilla  cttcaaggcagctttttgccct
             Brush-tailed rat  cttcaaagcagctctttgcact
B D                    Rabbit  tctcaaagcagctttgtgtgcc
B D                      Pika  tctcaaagttgctttgtatgtc
B D                       Pig  cctcaaagaggttttttgtatc
B D                    Alpaca  --------------------cc
               Bactrian camel  cctcagagcagctttttgtacc
B D                   Dolphin  cctcaaagcaggtttttgtacc
                 Killer whale  cctcaaagcaggtttttgtacc
             Tibetan antelope  -ctcaaagcagcttcttgtacc
B D                       Cow  -ctcaaagcagcttcttgtacc
B D                     Sheep  -ctcaaagcagcttcttgtacc
                Domestic goat  -ctcaaagcagcttcttgtacc
B D                     Horse  cctcagtgcagctttttgtacc
B D          White rhinoceros  ccttgaagcaatcttttgtaca
B D                       Cat  caccaaagcagcttttggtatc
B D                       Dog  catcaaagcagctttttgtgcc
B D                   Ferret   catcaaagcagcttttag-acc
B D                     Panda  catcaaagcagcttttag-acc
               Pacific walrus  catcaaagcagcttttag-acc
                 Weddell seal  catcaaagcagcttttag-acc
             Black flying-fox  catccaagtggccttttgcacc
B D                   Megabat  cctccaagtggccttttgcacc
                Big brown bat  cctcaaagtgg-gttttgtacc