Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 213 in window, 125631007 - 125631010, 4 bps 
B D                     Human  cctt
B D                     Chimp  cctt
B D                   Gorilla  cctt
B D                 Orangutan  tctt
B D                    Gibbon  tctt
B D                    Rhesus  tctt
B D       Crab-eating macaque  tctt
B D                    Baboon  tctt
B D              Green monkey  tctt
B D                  Marmoset  tctt
B D           Squirrel monkey  tctt
B D                  Bushbaby  tctt
B D                  Squirrel  tctt
B D                Guinea pig  actt
                   Chinchilla  actt
             Brush-tailed rat  attt
B D                    Rabbit  tctt
B D                      Pika  tctt
B D                       Pig  tttt
B D                    Alpaca  tttt
               Bactrian camel  tctt
B D                   Dolphin  tctt
                 Killer whale  tctt
             Tibetan antelope  tatt
B D                       Cow  tttt
B D                     Sheep  tatt
B D                     Horse  tctt
B D          White rhinoceros  tctt
             Black flying-fox  tctt
B D                   Megabat  tctt
B D                   Manatee  tttt
                     Aardvark  tctt
B D                 Armadillo  tcct
B D                 Zebrafish  t---
B D                    Tenrec  ====
         Cape elephant shrew  ====
B D                     Panda  ====
               Big brown bat  ====
        David's myotis (bat)  ====
B D                  Microbat  ====
               Domestic goat  ====
              Golden hamster  ====
B D           Chinese hamster  ====
B D                     Mouse  ====
B D                       Rat  ====
                Prairie vole  ====
              Pacific walrus  ====
          Chinese tree shrew  ====
B D                       Cat  ====
B D            Naked mole-rat  ====
      Lesser Egyptian jerboa  ====
B D                   Ferret   ====
B D                       Dog  ====
B D                  Elephant  ====
B D        American alligator  ====
B D                   Chicken  ====
B D                Budgerigar  ====
B D               Zebra finch  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
B D           Tasmanian devil  ====
B D                    Turkey  ====
  D    White-throated sparrow  ====
  D           Green seaturtle  ====
B D                   Opossum  ====
                Weddell seal  ====
  D  Chinese softshell turtle  ====
  D            Painted turtle  ====
            Cape golden mole  ====

Alignment block 2 of 213 in window, 125631011 - 125631070, 60 bps 
B D                     Human  tcatg-tt----ctttatctttccaatgtaagatggct-g-----gacataggggtaagatga-aaattt
B D                     Chimp  tcatg-tt----ctttatctttccaatgtaagatggct-g-----gacataggggtaagatga-aaattt
B D                   Gorilla  tcatg-tt----ctttatctttccaatgtaagatggct-g-----gacataggggtaagatga-aaattt
B D                 Orangutan  tcatg-tt----ctttatctttcctatataagatggct-g-----gacataggggtaagatga-aatttt
B D                    Gibbon  tcatg-tt----ctttatctttccaatataagatggct-g-----gacataggggtaagatga-aatttt
B D                    Rhesus  gcatg-tt----ctttatctttccaatataagatgact-g-----ggcataggagtaagatgc-aatttt
B D       Crab-eating macaque  gcatg-tt----ctttatctttccaatataagatgact-g-----ggcataggagtaagatgc-aatttt
B D                    Baboon  tcatg-tt----ctttatctttccaatataagatggct-g-----ggcataggagtaagatga-aatttt
B D              Green monkey  tcatg-tt----ctttatctttccaatataagatgact-g-----ggcataggagtaagatgc-aatttt
B D                  Marmoset  ttatg-tt----ctttatctttccaatataagatgtct-ggaccggacacagg-gtaagataa-aatttt
B D           Squirrel monkey  ttatg-tt----ctttatctttccagtataaaatgtct-ggaccagacatagg-gtaagatga-aatttt
B D                  Bushbaby  tcat--tt----ctttctctttccaaaataagatggct-a-----aacatagg-ataaaaaga-aatttc
B D                  Squirrel  tcatt-tt----ctttatctttct-------gataact-g-----gatgtaga-gaaagatga-aatttt
B D                Guinea pig  tcctg-tg----ctttattgctccaagataaaatgtttgg-----gacacaga-gttagaaga-aatttg
                   Chinchilla  ttgtg-tt----ctctattgctccaagatataatggct-g-----gacaaag-----agaaga-aatttg
             Brush-tailed rat  ttgtt-tt----ctctattactccaagataaaatttct-g-----aacacaga-gttagaaga-aatatg
B D                    Rabbit  ttatg-tt----ctttgtctttccaatgt-aaatatct-a-----gaaatagg-gtggaaaaa-c-----
B D                      Pika  ttatg-tt----ccttat-tttcca-----agatatct-a-----gaagtagg-atgagtaaa-attttg
B D                       Pig  tcatg-tttttttttaaacttgtccagataagatggca-g-----gatatagg-ctaagaagattatttt
B D                    Alpaca  tcatg-tttt--tttaatctttccaagataagatggct-g-----gatgtggg-atcagaaga-tatttt
               Bactrian camel  tcatg-tttt--tttaatctttccaagataagatggct-g-----gatgtagg-atcagaaga-tatttt
B D                   Dolphin  tcatg-tt----ttttatctttccaagaaaagattact-g-----gatatagg-ataagaaga-tacttt
                 Killer whale  tcat--tt----tttcatctttccaagaaaagattact-g-----gatatagg-ataagaaga-tacttt
             Tibetan antelope  tcata-tt----tttcatctttccaagataagatgact-g-----aatatagg-ataaggaga-tatttt
B D                       Cow  tcata-ttt---tttcatctttccaagataagatgact-a-----gatatagg-ataagaaga-tatttt
B D                     Sheep  tcata-tt----tttcatctttccaagataagatgcct-g-----aatatagg-ataagaaga-tatttt
                Domestic goat  tcgtg-tccg-atttcatctttccaagataagatgact-g-----aatatagg-ataagaaga-tatttt
B D                     Horse  tcaag-tt----cttcctctttccaagataagatggct-g-----gatacagg-gtaagaaga-tatttt
B D          White rhinoceros  tcatg-tt----cttcatctttccaggataagatggct-g-----gatacagg-gtaagaaga-tatttt
             Black flying-fox  tcatg-tt----ctttatctttccaagatatgatggct-g-----gattcagg-gtaagaaga-tatttt
B D                   Megabat  tcatg-tt----ctttatctttccaagatacgatggct-g-----gattcaga-gtaagaaga-tatttt
B D                   Manatee  tcatc-tt------ttatgtttccaagataagatgtct-a-----gacagagg-ataataaga-aacttt
                     Aardvark  ttatcttt------ttatttgtccaagatgaaatgtct-a-----cacataag-ataataaga-aatttt
B D                 Armadillo  tcatg-tt----cattatcttcccaagataaggtggtg-a-----gacacagg-gtaagaaga-catttg
B D                 Zebrafish  -tagg-tt-----ttgatatatttatggtgggaagttg-a-----caaaaatg-atgtggaaa-attaca
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Panda  ======================================================================
               Big brown bat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                  Microbat  ======================================================================
              Golden hamster  ======================================================================
B D           Chinese hamster  ======================================================================
B D                     Mouse  ======================================================================
B D                       Rat  ======================================================================
                Prairie vole  ======================================================================
              Pacific walrus  ======================================================================
          Chinese tree shrew  ======================================================================
B D                       Cat  ======================================================================
B D            Naked mole-rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                   Ferret   ======================================================================
B D                       Dog  ======================================================================
B D                  Elephant  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
B D               Zebra finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                    Turkey  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
                Weddell seal  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ca-----
                        Chimp  ca-----
                      Gorilla  cg-----
                    Orangutan  ca-----
                       Gibbon  ca-----
                       Rhesus  ca-----
          Crab-eating macaque  ca-----
                       Baboon  ca-----
                 Green monkey  ca-----
                     Marmoset  ca-----
              Squirrel monkey  ta-----
                     Bushbaby  aa-----
                     Squirrel  ca-----
                   Guinea pig  aa-----
                   Chinchilla  aa-----
             Brush-tailed rat  aa-----
                       Rabbit  ag-----
                         Pika  ag-----
                          Pig  aa-----
                       Alpaca  aa-----
               Bactrian camel  aa-----
                      Dolphin  aa-----
                 Killer whale  aa-----
             Tibetan antelope  aa-----
                          Cow  aa-----
                        Sheep  aa-----
                Domestic goat  aa-----
                        Horse  aa-----
             White rhinoceros  aa-----
             Black flying-fox  at-----
                      Megabat  at-----
                      Manatee  aa-----
                     Aardvark  aa-----
                    Armadillo  aa-----
                    Zebrafish  aacacca
                       Tenrec  =======
          Cape elephant shrew  =======
                        Panda  =======
                Big brown bat  =======
         David's myotis (bat)  =======
                     Microbat  =======
               Golden hamster  =======
              Chinese hamster  =======
                        Mouse  =======
                          Rat  =======
                 Prairie vole  =======
               Pacific walrus  =======
           Chinese tree shrew  =======
                          Cat  =======
               Naked mole-rat  =======
       Lesser Egyptian jerboa  =======
                      Ferret   =======
                          Dog  =======
                     Elephant  =======
           American alligator  =======
                      Chicken  =======
                   Budgerigar  =======
                  Zebra finch  =======
             Peregrine falcon  =======
                 Saker falcon  =======
              Tasmanian devil  =======
                       Turkey  =======
       White-throated sparrow  =======
              Green seaturtle  =======
                      Opossum  =======
                 Weddell seal  =======
     Chinese softshell turtle  =======
               Painted turtle  =======
             Cape golden mole  =======

Alignment block 3 of 213 in window, 125631071 - 125631079, 9 bps 
B D                     Human  -----ataatgcat
B D                     Chimp  -----ataatgcat
B D                   Gorilla  -----ataatgcat
B D                 Orangutan  -----ataacgcat
B D                    Gibbon  -----ataacgcat
B D                    Rhesus  -----ataacgcat
B D       Crab-eating macaque  -----ataacgcat
B D                    Baboon  -----ataacccgt
B D              Green monkey  -----atgacgcat
B D                  Marmoset  -----ataatacat
B D           Squirrel monkey  -----ataatacat
B D                  Bushbaby  -----gtaat-tat
B D                  Squirrel  -----acaatgagt
B D                Guinea pig  -----at-gtgcat
                   Chinchilla  -----at-acgtat
             Brush-tailed rat  -----at-atgcat
B D                    Rabbit  -----ta-atagat
B D                      Pika  -----ta-gtag--
B D                       Pig  -----ataatgcat
B D                    Alpaca  -----ataatgcat
               Bactrian camel  -----ataatgcat
B D                   Dolphin  -----acaatgcat
                 Killer whale  -----acaatgcat
             Tibetan antelope  -----ataatgcat
B D                       Cow  -----ataacgcat
B D                     Sheep  -----ataatgcat
                Domestic goat  -----ataatgcat
B D                     Horse  -----ataatgcat
B D          White rhinoceros  -----ataatgcac
             Black flying-fox  -----atagtgtat
B D                   Megabat  -----atagtgtat
B D                  Elephant  -----acagtgcat
B D                   Manatee  -----atagtgcat
                     Aardvark  -----ataatgtac
B D                 Armadillo  -----atgatgcat
B D                 Zebrafish  actccttaatgaac
B D                    Tenrec  ==============
         Cape elephant shrew  ==============
B D                     Panda  ==============
               Big brown bat  ==============
        David's myotis (bat)  ==============
B D                  Microbat  ==============
              Golden hamster  ==============
B D           Chinese hamster  ==============
B D                     Mouse  ==============
B D                       Rat  ==============
                Prairie vole  ==============
              Pacific walrus  ==============
          Chinese tree shrew  ==============
B D                       Cat  ==============
B D            Naked mole-rat  ==============
      Lesser Egyptian jerboa  ==============
B D                   Ferret   ==============
B D                       Dog  ==============
B D        American alligator  ==============
B D                   Chicken  ==============
B D                Budgerigar  ==============
B D               Zebra finch  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
B D           Tasmanian devil  ==============
B D                    Turkey  ==============
  D    White-throated sparrow  ==============
  D           Green seaturtle  ==============
B D                   Opossum  ==============
                Weddell seal  ==============
  D  Chinese softshell turtle  ==============
  D            Painted turtle  ==============
            Cape golden mole  ==============

Inserts between block 3 and 4 in window
            Black flying-fox 805bp
B D                  Megabat 810bp
B D                Zebrafish 3bp

Alignment block 4 of 213 in window, 125631080 - 125631102, 23 bps 
B D                     Human  aagc-tttaaagaataaataattt---
B D                     Chimp  aagc-tttaaagaataaataattt---
B D                   Gorilla  aagc-tttaaagaataaataattt---
B D                 Orangutan  aagc-tttaaagaataaataattt---
B D                    Gibbon  aagc-tttgaagaataaataattt---
B D                    Rhesus  aagc-tttaaagaataaataattt---
B D       Crab-eating macaque  aagc-tttaaagaataaataattt---
B D                    Baboon  aagc-tttaaagaataaataattt---
B D              Green monkey  aaac-tttaaagaataaatgattt---
B D                  Marmoset  aaac-gttaaagaataaataattt---
B D           Squirrel monkey  aaac-tttaaagaataaatatttt---
B D                  Bushbaby  aaac-ttttaagaataaataattt---
B D                  Squirrel  aaac-tttttgaaataaatgattt---
B D                Guinea pig  aaac-attttaagataaataattt---
                   Chinchilla  aaat-tttttcaaataaattactt---
             Brush-tailed rat  aatc-ttttaaaagtaaataattt---
B D                    Rabbit  aa-t-tttttagagtaaacaattt---
B D                      Pika  -----tctttagaataaacagttt---
B D                       Pig  aaac-tttttagaataa----ttt---
B D                    Alpaca  aaac-tttttagaataaataattt---
               Bactrian camel  aaac-tttttagaataaataattt---
B D                   Dolphin  aaac-tttttagaataaatagttt---
                 Killer whale  aaac-tttttagaataaataattt---
             Tibetan antelope  aaac-tttttaaaatgaattattt---
B D                       Cow  aaac-tttttaaattgaattattt---
B D                     Sheep  aaac-tttttaaaatgaattattt---
                Domestic goat  aaac-tttttaaaatgaattattt---
B D                     Horse  aagc-tttttaggataaataattt---
B D          White rhinoceros  aagc-atattagaataaataattt---
B D                  Elephant  aaat-tctatag--taaattagtt---
B D                   Manatee  aagt-tttatag--taaataagtt---
                     Aardvark  aagtgtttttaa--taaataattt---
B D                 Armadillo  aaac-tttttagaataaataactt---
B D                 Zebrafish  aagg-tctaaaaaacag--cattttct
B D                    Tenrec  ===========================
         Cape elephant shrew  ===========================
B D                     Panda  ===========================
               Big brown bat  ===========================
        David's myotis (bat)  ===========================
B D                  Microbat  ===========================
              Golden hamster  ===========================
B D           Chinese hamster  ===========================
B D                     Mouse  ===========================
B D                       Rat  ===========================
                Prairie vole  ===========================
              Pacific walrus  ===========================
          Chinese tree shrew  ===========================
            Black flying-fox  ===========================
B D                       Cat  ===========================
B D            Naked mole-rat  ===========================
      Lesser Egyptian jerboa  ===========================
B D                   Ferret   ===========================
B D                       Dog  ===========================
B D        American alligator  ===========================
B D                   Chicken  ===========================
B D                Budgerigar  ===========================
B D               Zebra finch  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
B D           Tasmanian devil  ===========================
B D                    Turkey  ===========================
  D    White-throated sparrow  ===========================
  D           Green seaturtle  ===========================
B D                   Opossum  ===========================
                Weddell seal  ===========================
  D  Chinese softshell turtle  ===========================
  D            Painted turtle  ===========================
B D                   Megabat  ===========================
            Cape golden mole  ===========================

Inserts between block 4 and 5 in window
B D                 Squirrel 1538bp
B D               Guinea pig 1bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                   Rabbit 1bp
B D                     Pika 1bp

Alignment block 5 of 213 in window, 125631103 - 125631145, 43 bps 
B D                     Human  gtggggt----aaaa--acagagt-ggaca-a--taggtgcaagctgg---aaaaa------------
B D                     Chimp  gtagggt----aaaa--acagagt-ggaca-a--taggtgcaagctgg---aaaaa------------
B D                   Gorilla  gtggggt----aaaa--acagagt-ggaca-a--taggtgcaagctgg---aaaaa------------
B D                 Orangutan  gcagggt----aaaa--acagagt-ggaca-a--taggtgcaagctgg---aaaaa------------
B D                    Gibbon  gcagggt----aaaa--acagagt-ggaca-a--caggtgcaagctgg---aaaaa------------
B D                    Rhesus  gcagggt----aaaa--acagagt-ggaca-a--taggtgcaagctgg---aaaaa------------
B D       Crab-eating macaque  gcagggt----aaaa--acagagt-ggaca-a--taggtgcaagctgg---aaaaa------------
B D                    Baboon  gcagggt----aaaa--acagagt-ggaca-a--taggtgcaagctgg---aaaaa------------
B D              Green monkey  gcagggt----aaaa--acagagt-ggaca-a--taggtgcaagctgg---aaaaa------------
B D                  Marmoset  gaggggt----aaaa--atagagt-ggacata--taggtgtgagctgg---gaaaa------------
B D           Squirrel monkey  gaggggt----aaaa--acagagt-ggataaa--taggtgtgagctgg---gaaaa------------
B D                  Bushbaby  tagggac----aaaa--aaagagc-agaca------gatgtaaatcag---aaaaa------------
B D                Guinea pig  tgaggta----aaga--ataggatcaggcaag--tacatggaaactgg---aaaat------------
                   Chinchilla  ggatgca----agga--ataggatcagacaag--cacatgcaagctgg---aaaaa------------
             Brush-tailed rat  ggaggca----agaa--gtaggatcacacaag--cacatgcgggctgg---aaaaa------------
B D                    Rabbit  agatgcc----aaaaagaaaaagtagagcaaa--gagatccaagcagg---aaaaa------------
B D                      Pika  agatgcc----aa----aacaacttagataaa--cagatccaagcagg---aaaac------------
B D                       Pig  tggaggc----aaaa--tgggagt-agacaaa--cagatgcaagctgg---aaa-a------------
B D                    Alpaca  tagatgc----aaac--taagagt-agacaaa--cagatgtaaggtgg---aaata------------
               Bactrian camel  tcgaggc----aaac--taagagt-agacaaa--cagatgcaaggtag---aaata------------
B D                   Dolphin  tggaggc---aaaaa--taagagt-atac-aa--cagatgcaagctgg---aaaaa------------
                 Killer whale  tggaggc---aaaaa--taagagt-atac-aa--cagatgcaagctgg---aaaaa------------
             Tibetan antelope  tggaggc----aaaa--taagagt-attcaaa--cagatgcaagctgg---aaaaa------------
B D                       Cow  tggaggc----aaaa--taagagt-atacaaa--catattcaagctgg---aaaaa------------
B D                     Sheep  tggaggc----aaaa--taagagt-atacaaa--cagatgcaagctgg---aaaaa------------
                Domestic goat  tggaggc----aaaa--taagagt-atacaaa--cagatgcaagctgg---aaaaa------------
B D                     Horse  tggagac----aaaa--taagagt-agacaaa--cagaagcaagttgg---ggaaa------------
B D          White rhinoceros  tggaggc----aaaa--taagagt-agacaaa---agaagcaagctag---aaaaa------------
B D                  Elephant  t-gaggtaaaaaaaa--aaatagt-agacaaa--cagatgcaagctg----agaaa------------
B D                   Manatee  tggaggt-----aaa--aaatagt-agacaaa--cagatgcaagttgg--aaaaaa------------
                     Aardvark  tggaggt-----aaa--aaatagt-agacaaa--tagatgcaacctggaaaaaaaa------------
B D                 Armadillo  tgaaggc----aaaa--aaataat-agacccactcagatgcaagctgg---aaaga------------
B D                 Zebrafish  --------------a--ttagata-aaaaaaa--aaaatgcaggatat---gtcattatttggctcat
B D                    Tenrec  ====================================================================
         Cape elephant shrew  ====================================================================
B D                     Panda  ====================================================================
               Big brown bat  ====================================================================
        David's myotis (bat)  ====================================================================
B D                  Microbat  ====================================================================
              Golden hamster  ====================================================================
B D           Chinese hamster  ====================================================================
B D                     Mouse  ====================================================================
B D                       Rat  ====================================================================
                Prairie vole  ====================================================================
              Pacific walrus  ====================================================================
          Chinese tree shrew  ====================================================================
            Black flying-fox  ====================================================================
B D                       Cat  ====================================================================
B D            Naked mole-rat  ====================================================================
      Lesser Egyptian jerboa  ====================================================================
B D                   Ferret   ====================================================================
B D                       Dog  ====================================================================
B D                  Squirrel  ====================================================================
B D        American alligator  ====================================================================
B D                   Chicken  ====================================================================
B D                Budgerigar  ====================================================================
B D               Zebra finch  ====================================================================
  D          Peregrine falcon  ====================================================================
  D              Saker falcon  ====================================================================
B D           Tasmanian devil  ====================================================================
B D                    Turkey  ====================================================================
  D    White-throated sparrow  ====================================================================
  D           Green seaturtle  ====================================================================
B D                   Opossum  ====================================================================
                Weddell seal  ====================================================================
  D  Chinese softshell turtle  ====================================================================
  D            Painted turtle  ====================================================================
B D                   Megabat  ====================================================================
            Cape golden mole  ====================================================================

Inserts between block 5 and 6 in window
B D               Guinea pig 2bp
                  Chinchilla 1075bp
B D                   Rabbit 1bp
B D                     Pika 1bp
B D                    Horse 2bp
B D         White rhinoceros 1bp
B D                 Elephant 2bp
B D                  Manatee 2bp
                    Aardvark 2bp
B D                Armadillo 2bp

Alignment block 6 of 213 in window, 125631146 - 125631161, 16 bps 
B D                     Human  tga---ctttagatgttaa----
B D                     Chimp  tga---ctttagatgttca----
B D                   Gorilla  tga---ctttagatgttaa----
B D                 Orangutan  tga---ctttagatgttaa----
B D                    Gibbon  tga---ctttagatgttaa----
B D                    Rhesus  tga---ctttcgatgttaa----
B D       Crab-eating macaque  tga---ctttcgatgttaa----
B D                    Baboon  tga---c-ttagatgttaa----
B D              Green monkey  tga---ctttcgatgttaa----
B D                  Marmoset  taa---ctttaaatgttaa----
B D           Squirrel monkey  taa---ctttagatgttaa----
B D                  Bushbaby  aaaagtctttagatatcaa----
B D                Guinea pig  tat---cttttaatgtt------
             Brush-tailed rat  ----------ttaggtt------
B D                    Rabbit  tgt---cttc-aatgttat----
B D                      Pika  tgt---cttcaaatgttaa----
B D                       Pig  tgt---ctttaaatgttaa----
B D                    Alpaca  agt---ctttaaatgttaa----
               Bactrian camel  agt---ctttaaatgttaa----
B D                   Dolphin  tgt---ctttaaatattaa----
                 Killer whale  tgt---ctttaaatattaa----
             Tibetan antelope  tgt---ctttacatgttaa----
B D                       Cow  tgt---ctttaaatgtt------
B D                     Sheep  tgt---ctttacatgttaa----
                Domestic goat  tgt---ctttacatgttaa----
B D                     Horse  agt---ctttaaatgttaa----
B D          White rhinoceros  agt---ctttaaatgttag----
B D                  Elephant  agt---ctttaaacattaa----
B D                   Manatee  agt---ctttaaacatcaa----
                     Aardvark  agt---ccttaagc---aa----
B D                 Armadillo  agt---cttttaaagttaa----
B D                 Zebrafish  ------tcacaactattagtaaa
B D                    Tenrec  =======================
         Cape elephant shrew  =======================
B D                     Panda  =======================
               Big brown bat  =======================
        David's myotis (bat)  =======================
B D                  Microbat  =======================
              Golden hamster  =======================
B D           Chinese hamster  =======================
B D                     Mouse  =======================
B D                       Rat  =======================
                Prairie vole  =======================
              Pacific walrus  =======================
                  Chinchilla  =======================
          Chinese tree shrew  =======================
            Black flying-fox  =======================
B D                       Cat  =======================
B D            Naked mole-rat  =======================
      Lesser Egyptian jerboa  =======================
B D                   Ferret   =======================
B D                       Dog  =======================
B D                  Squirrel  =======================
B D        American alligator  =======================
B D                   Chicken  =======================
B D                Budgerigar  =======================
B D               Zebra finch  =======================
  D          Peregrine falcon  =======================
  D              Saker falcon  =======================
B D           Tasmanian devil  =======================
B D                    Turkey  =======================
  D    White-throated sparrow  =======================
  D           Green seaturtle  =======================
B D                   Opossum  =======================
                Weddell seal  =======================
  D  Chinese softshell turtle  =======================
  D            Painted turtle  =======================
B D                   Megabat  =======================
            Cape golden mole  =======================

Inserts between block 6 and 7 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 294bp
B D                    Sheep 293bp
               Domestic goat 294bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                 Elephant 1bp
B D                  Manatee 1bp
                    Aardvark 1bp
B D                Armadillo 1bp

Alignment block 7 of 213 in window, 125631162 - 125631163, 2 bps 
B D                     Human  tc
B D                     Chimp  tc
B D                   Gorilla  tc
B D                 Orangutan  tg
B D                    Gibbon  tc
B D                    Rhesus  tc
B D       Crab-eating macaque  tc
B D                    Baboon  tc
B D              Green monkey  tc
B D                  Marmoset  tc
B D           Squirrel monkey  tc
B D                  Bushbaby  ct
B D                    Rabbit  tg
B D                      Pika  tc
B D                       Pig  tt
B D                    Alpaca  tt
               Bactrian camel  tt
B D                   Dolphin  tt
                 Killer whale  tt
B D                     Horse  tt
B D          White rhinoceros  tt
B D                  Elephant  tc
B D                   Manatee  tc
                     Aardvark  tc
B D                 Armadillo  tc
B D                 Zebrafish  tc
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                     Panda  ==
               Big brown bat  ==
        David's myotis (bat)  ==
B D                     Sheep  ==
B D                  Microbat  ==
            Brush-tailed rat  --
               Domestic goat  ==
              Golden hamster  ==
B D           Chinese hamster  ==
B D                     Mouse  ==
B D                       Rat  ==
                Prairie vole  ==
              Pacific walrus  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
            Black flying-fox  ==
B D                       Cat  ==
B D                Guinea pig  --
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
B D                       Cow  --
B D                   Ferret   ==
            Tibetan antelope  ==
B D                       Dog  ==
B D                  Squirrel  ==
B D        American alligator  ==
B D                   Chicken  ==
B D                Budgerigar  ==
B D               Zebra finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  ==
B D                    Turkey  ==
  D    White-throated sparrow  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
                Weddell seal  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
B D                   Megabat  ==
            Cape golden mole  ==

Alignment block 8 of 213 in window, 125631164 - 125631167, 4 bps 
B D                     Human  -aaaa
B D                     Chimp  -aaaa
B D                   Gorilla  -aaaa
B D                 Orangutan  -aaaa
B D                    Gibbon  -aaaa
B D                    Rhesus  -aaat
B D       Crab-eating macaque  -aaat
B D                    Baboon  -aaat
B D              Green monkey  -aaac
B D                  Marmoset  -aaat
B D           Squirrel monkey  -aaat
B D                  Bushbaby  -aaaa
B D                Guinea pig  -gaaa
             Brush-tailed rat  -caaa
B D                    Rabbit  -aaga
B D                      Pika  -aaga
B D                       Pig  -aaaa
B D                    Alpaca  -aaaa
               Bactrian camel  -aaaa
B D                   Dolphin  -aaaa
                 Killer whale  -aaaa
             Tibetan antelope  -aaaa
B D                       Cow  -aaaa
B D                     Sheep  -aaaa
                Domestic goat  -aaaa
B D                     Horse  -aaaa
B D          White rhinoceros  -aaaa
B D                  Elephant  -aaaa
B D                   Manatee  -agaa
                     Aardvark  -aaaa
B D                 Zebrafish  tgga-
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                     Panda  =====
               Big brown bat  =====
        David's myotis (bat)  =====
B D                  Microbat  =====
              Golden hamster  =====
B D           Chinese hamster  =====
B D                     Mouse  =====
B D                       Rat  =====
                Prairie vole  =====
B D                 Armadillo  -----
              Pacific walrus  =====
                  Chinchilla  =====
          Chinese tree shrew  =====
            Black flying-fox  =====
B D                       Cat  =====
B D            Naked mole-rat  =====
      Lesser Egyptian jerboa  =====
B D                   Ferret   =====
B D                       Dog  =====
B D                  Squirrel  =====
B D        American alligator  =====
B D                   Chicken  =====
B D                Budgerigar  =====
B D               Zebra finch  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D           Tasmanian devil  =====
B D                    Turkey  =====
  D    White-throated sparrow  =====
  D           Green seaturtle  =====
B D                   Opossum  =====
                Weddell seal  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
B D                   Megabat  =====
            Cape golden mole  =====

Inserts between block 8 and 9 in window
            Brush-tailed rat 3229bp

Alignment block 9 of 213 in window, 125631168 - 125631172, 5 bps 
B D                     Human  gtctg
B D                     Chimp  gtctg
B D                   Gorilla  gtctg
B D                 Orangutan  gtctg
B D                    Gibbon  gtctg
B D                    Rhesus  gtctg
B D       Crab-eating macaque  gtctg
B D                    Baboon  gtctg
B D              Green monkey  gtctg
B D                  Marmoset  gtctg
B D           Squirrel monkey  gtctg
B D                  Bushbaby  --ttg
B D                Guinea pig  gtttg
B D                    Rabbit  gtctg
B D                      Pika  attct
B D                       Pig  gtctg
B D                    Alpaca  atctg
               Bactrian camel  atctg
B D                   Dolphin  gattg
                 Killer whale  gattg
             Tibetan antelope  gtcta
B D                       Cow  gtctg
B D                     Sheep  gtcta
                Domestic goat  gtcta
B D                     Horse  atctg
B D          White rhinoceros  gtctg
B D                  Elephant  gtttg
B D                   Manatee  gtttg
                     Aardvark  gtctg
B D                 Zebrafish  atctg
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                     Panda  =====
               Big brown bat  =====
        David's myotis (bat)  =====
B D                  Microbat  =====
            Brush-tailed rat  =====
              Golden hamster  =====
B D           Chinese hamster  =====
B D                     Mouse  =====
B D                       Rat  =====
                Prairie vole  =====
B D                 Armadillo  -----
              Pacific walrus  =====
                  Chinchilla  =====
          Chinese tree shrew  =====
            Black flying-fox  =====
B D                       Cat  =====
B D            Naked mole-rat  =====
      Lesser Egyptian jerboa  =====
B D                   Ferret   =====
B D                       Dog  =====
B D                  Squirrel  =====
B D        American alligator  =====
B D                   Chicken  =====
B D                Budgerigar  =====
B D               Zebra finch  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D           Tasmanian devil  =====
B D                    Turkey  =====
  D    White-throated sparrow  =====
  D           Green seaturtle  =====
B D                   Opossum  =====
                Weddell seal  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
B D                   Megabat  =====
            Cape golden mole  =====

Inserts between block 9 and 10 in window
B D                      Cow 1273bp

Alignment block 10 of 213 in window, 125631173 - 125631191, 19 bps 
B D                     Human  ---gttcaaa-a----tgagaaattca
B D                     Chimp  ---gttcaaa-a----tgagaaattca
B D                   Gorilla  ---gttcaaa-a----tgagaaattca
B D                 Orangutan  ---gttcaaa-a----tgagaaattca
B D                    Gibbon  ---gttcaaa-a----tgagaaattca
B D                    Rhesus  ---cttcaaa-a----taagaaattca
B D       Crab-eating macaque  ---gttcaaa-a----taagaaattca
B D                    Baboon  ---gttcaaa-a----taagaaattca
B D              Green monkey  ---gttcaaa-a----taagaaattca
B D                  Marmoset  ---gttcaaa-a----tgagaaattaa
B D           Squirrel monkey  ---gttcaaa-a----tgagaaattaa
B D                  Bushbaby  ---tttcgaa-a----ggagaaattca
B D                Guinea pig  ---attaaaa-g----taaaaagtcta
B D                    Rabbit  ---atccaaa-a----tgagaatttca
B D                      Pika  ---attcaaaga----tgagaatttca
B D                       Pig  ---gttcaaa-a----ttagaagataa
B D                    Alpaca  ---gctcaaa-a----tgagaaattca
               Bactrian camel  ---gctcaaa-a----tgagaaattca
B D                   Dolphin  ---cttcaaa-a----tgagaacttca
                 Killer whale  ---cttcaaa-a----tgagaaattca
             Tibetan antelope  ---gtttgaa-a----tgagaaattta
B D                       Cow  ---gtttgaa-a----tgagaaattta
B D                     Sheep  ---gtttgaa-a----tgagaaattta
                Domestic goat  ---gtttgaa-a----tgagaaattta
B D                     Horse  ---gttcaaa-a----tgagaagttca
B D          White rhinoceros  ---gttcaaa-a----tgagaaattca
B D                  Elephant  ---gatcaaa-a----tgggaaattca
B D                   Manatee  ---tatcaaa-a----tgggaaattca
                     Aardvark  ---cattaaa-a----tgggaaattca
B D                 Armadillo  -------aaa-a----ttggaaatttt
B D                 Zebrafish  gggcttcaaa-aacatctaaatattca
B D                    Tenrec  ===========================
         Cape elephant shrew  ===========================
B D                     Panda  ===========================
               Big brown bat  ===========================
        David's myotis (bat)  ===========================
B D                  Microbat  ===========================
            Brush-tailed rat  ===========================
              Golden hamster  ===========================
B D           Chinese hamster  ===========================
B D                     Mouse  ===========================
B D                       Rat  ===========================
                Prairie vole  ===========================
              Pacific walrus  ===========================
                  Chinchilla  ===========================
          Chinese tree shrew  ===========================
            Black flying-fox  ===========================
B D                       Cat  ===========================
B D            Naked mole-rat  ===========================
      Lesser Egyptian jerboa  ===========================
B D                   Ferret   ===========================
B D                       Dog  ===========================
B D                  Squirrel  ===========================
B D        American alligator  ===========================
B D                   Chicken  ===========================
B D                Budgerigar  ===========================
B D               Zebra finch  ===========================
  D          Peregrine falcon  ===========================
  D              Saker falcon  ===========================
B D           Tasmanian devil  ===========================
B D                    Turkey  ===========================
  D    White-throated sparrow  ===========================
  D           Green seaturtle  ===========================
B D                   Opossum  ===========================
                Weddell seal  ===========================
  D  Chinese softshell turtle  ===========================
  D            Painted turtle  ===========================
B D                   Megabat  ===========================
            Cape golden mole  ===========================

Inserts between block 10 and 11 in window
B D               Guinea pig 1179bp

Alignment block 11 of 213 in window, 125631192 - 125631202, 11 bps 
B D                     Human  -atacacatttt
B D                     Chimp  -atacacatttt
B D                   Gorilla  -atacacatttt
B D                 Orangutan  -atacacatttt
B D                    Gibbon  -atacacatttt
B D                    Rhesus  -atacacagttt
B D       Crab-eating macaque  -atacacagttt
B D                    Baboon  -atacacagttt
B D              Green monkey  -atacacagttt
B D                  Marmoset  -atacacatttt
B D           Squirrel monkey  -atacacatttt
B D                  Bushbaby  -atacacatttt
B D                    Rabbit  -atgcatatttt
B D                      Pika  -atacacatttt
B D                       Pig  -atacacttttt
B D                    Alpaca  -attcacatttc
               Bactrian camel  -attcacatttc
B D                   Dolphin  -atacacatttt
                 Killer whale  -atacacatttt
             Tibetan antelope  -atacgcatttt
B D                       Cow  -atacacatttt
B D                     Sheep  -atacacatttt
                Domestic goat  -atacacatttt
B D                     Horse  -acacgcatttt
B D          White rhinoceros  -atacacatttt
B D                  Elephant  -atacacatgta
B D                   Manatee  -atacacatgtg
                     Aardvark  -gtatactttta
B D                 Armadillo  -atacacatttt
B D                 Zebrafish  gata-acattgt
B D                    Tenrec  ============
         Cape elephant shrew  ============
B D                     Panda  ============
               Big brown bat  ============
        David's myotis (bat)  ============
B D                  Microbat  ============
            Brush-tailed rat  ============
              Golden hamster  ============
B D           Chinese hamster  ============
B D                     Mouse  ============
B D                       Rat  ============
                Prairie vole  ============
              Pacific walrus  ============
                  Chinchilla  ============
          Chinese tree shrew  ============
            Black flying-fox  ============
B D                       Cat  ============
B D                Guinea pig  ============
B D            Naked mole-rat  ============
      Lesser Egyptian jerboa  ============
B D                   Ferret   ============
B D                       Dog  ============
B D                  Squirrel  ============
B D        American alligator  ============
B D                   Chicken  ============
B D                Budgerigar  ============
B D               Zebra finch  ============
  D          Peregrine falcon  ============
  D              Saker falcon  ============
B D           Tasmanian devil  ============
B D                    Turkey  ============
  D    White-throated sparrow  ============
  D           Green seaturtle  ============
B D                   Opossum  ============
                Weddell seal  ============
  D  Chinese softshell turtle  ============
  D            Painted turtle  ============
B D                   Megabat  ============
            Cape golden mole  ============

Inserts between block 11 and 12 in window
B D                Armadillo 5910bp

Alignment block 12 of 213 in window, 125631203 - 125631205, 3 bps 
B D                     Human  t--ac
B D                     Chimp  t--ac
B D                   Gorilla  t--ac
B D                 Orangutan  t--ac
B D                    Gibbon  t--ac
B D                    Rhesus  t--at
B D       Crab-eating macaque  t--at
B D                    Baboon  t--ac
B D              Green monkey  t--at
B D                  Marmoset  t--ac
B D           Squirrel monkey  t--ac
B D                  Bushbaby  t--at
B D                    Rabbit  ttaac
B D                      Pika  tc-ac
B D                       Pig  t--ac
B D                    Alpaca  t--ac
               Bactrian camel  t--ac
B D                   Dolphin  t--ac
                 Killer whale  t--ac
             Tibetan antelope  t--ac
B D                       Cow  t--ac
B D                     Sheep  t--ac
                Domestic goat  t--ac
B D                     Horse  t--ac
B D          White rhinoceros  t--ac
B D                  Elephant  t--ac
B D                   Manatee  t--ac
                     Aardvark  t--gc
B D                 Zebrafish  t--cc
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                     Panda  =====
               Big brown bat  =====
        David's myotis (bat)  =====
B D                  Microbat  =====
            Brush-tailed rat  =====
              Golden hamster  =====
B D           Chinese hamster  =====
B D                     Mouse  =====
B D                       Rat  =====
                Prairie vole  =====
B D                 Armadillo  =====
              Pacific walrus  =====
                  Chinchilla  =====
          Chinese tree shrew  =====
            Black flying-fox  =====
B D                       Cat  =====
B D                Guinea pig  =====
B D            Naked mole-rat  =====
      Lesser Egyptian jerboa  =====
B D                   Ferret   =====
B D                       Dog  =====
B D                  Squirrel  =====
B D        American alligator  =====
B D                   Chicken  =====
B D                Budgerigar  =====
B D               Zebra finch  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D           Tasmanian devil  =====
B D                    Turkey  =====
  D    White-throated sparrow  =====
  D           Green seaturtle  =====
B D                   Opossum  =====
                Weddell seal  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
B D                   Megabat  =====
            Cape golden mole  =====

Alignment block 13 of 213 in window, 125631206 - 125631211, 6 bps 
B D                     Human  c-ttttt----
B D                     Chimp  c-ttttt----
B D                   Gorilla  c-ttttt----
B D                 Orangutan  ctttttt----
B D                    Gibbon  --ttttt----
B D                    Rhesus  c-ttttt----
B D       Crab-eating macaque  c-ttttt----
B D                    Baboon  c-ttttt----
B D              Green monkey  c-ttttt----
B D                  Marmoset  c-ttttg----
B D           Squirrel monkey  c-ttttg----
B D                  Bushbaby  c-tctat----
B D                    Rabbit  c-tttcc----
B D                      Pika  c-tttct----
B D                       Pig  t-ttctt----
B D                    Alpaca  c-attct----
               Bactrian camel  c-tttct----
B D                   Dolphin  c-tttct----
                 Killer whale  c-tttct----
             Tibetan antelope  c-ttctt----
B D                       Cow  c-ttctt----
B D                     Sheep  c-ttctt----
                Domestic goat  c-ttctt----
B D                     Horse  c-tttct----
B D          White rhinoceros  c-tttct----
B D                  Elephant  -atttct----
B D                   Manatee  -ctttct----
                     Aardvark  -atctct----
B D                 Armadillo  ---cttt----
B D           Tasmanian devil  c-ttttt----
B D                 Zebrafish  -----ataaag
B D                    Tenrec  ===========
         Cape elephant shrew  ===========
B D                     Panda  ===========
               Big brown bat  ===========
        David's myotis (bat)  ===========
B D                  Microbat  ===========
            Brush-tailed rat  ===========
              Golden hamster  ===========
B D           Chinese hamster  ===========
B D                     Mouse  ===========
B D                       Rat  ===========
                Prairie vole  ===========
              Pacific walrus  ===========
                  Chinchilla  ===========
          Chinese tree shrew  ===========
            Black flying-fox  ===========
B D                       Cat  ===========
B D                Guinea pig  ===========
B D            Naked mole-rat  ===========
      Lesser Egyptian jerboa  ===========
B D                   Ferret   ===========
B D                       Dog  ===========
B D                  Squirrel  ===========
B D        American alligator  ===========
B D                   Chicken  ===========
B D                Budgerigar  ===========
B D               Zebra finch  ===========
  D          Peregrine falcon  ===========
  D              Saker falcon  ===========
B D                    Turkey  ===========
  D    White-throated sparrow  ===========
  D           Green seaturtle  ===========
B D                   Opossum  ===========
                Weddell seal  ===========
  D  Chinese softshell turtle  ===========
  D            Painted turtle  ===========
B D                   Megabat  ===========
            Cape golden mole  ===========

Inserts between block 13 and 14 in window
            Tibetan antelope 1713bp
B D                      Cow 2747bp
B D                    Sheep 1683bp
               Domestic goat 1717bp

Alignment block 14 of 213 in window, 125631212 - 125631212, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
B D                    Rabbit  t
B D                      Pika  t
B D                  Elephant  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D           Tasmanian devil  c
B D                 Zebrafish  t
B D                    Tenrec  =
         Cape elephant shrew  =
B D                     Panda  =
               Big brown bat  =
        David's myotis (bat)  =
B D                     Sheep  =
B D                  Microbat  =
            Brush-tailed rat  =
               Domestic goat  =
              Golden hamster  =
B D           Chinese hamster  =
B D                     Mouse  =
B D                       Rat  =
              Bactrian camel  -
B D                    Alpaca  -
                Prairie vole  =
              Pacific walrus  =
B D          White rhinoceros  -
                  Chinchilla  =
          Chinese tree shrew  =
            Black flying-fox  =
B D                       Cat  =
B D                     Horse  -
B D                Guinea pig  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
B D                       Cow  =
                Killer whale  -
B D                   Ferret   =
            Tibetan antelope  =
B D                       Dog  =
B D                  Squirrel  =
B D        American alligator  =
B D                   Chicken  =
B D                Budgerigar  =
B D               Zebra finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                    Turkey  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                   Opossum  =
B D                       Pig  -
                Weddell seal  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                   Dolphin  -
B D                   Megabat  =
            Cape golden mole  =

Inserts between block 14 and 15 in window
B D                   Rabbit 1112bp
B D                     Pika 5655bp
B D                 Elephant 1bp
B D                  Manatee 1bp
                    Aardvark 1bp
B D                Armadillo 1bp
B D          Tasmanian devil 1bp

Alignment block 15 of 213 in window, 125631213 - 125631214, 2 bps 
B D                     Human  -tc
B D                     Chimp  -tc
B D                   Gorilla  -tc
B D                 Orangutan  -tc
B D                    Gibbon  -tt
B D                    Rhesus  -tc
B D       Crab-eating macaque  -tc
B D                    Baboon  -cc
B D              Green monkey  -tc
B D                  Marmoset  -tt
B D           Squirrel monkey  -tt
B D                  Bushbaby  -ct
B D                       Pig  --c
B D                    Alpaca  -tc
               Bactrian camel  -tc
B D                   Dolphin  -ta
                 Killer whale  -ta
B D                     Horse  -tc
B D          White rhinoceros  -tc
B D                  Elephant  -t-
B D                   Manatee  -t-
                     Aardvark  -t-
B D                 Armadillo  -t-
B D           Tasmanian devil  -c-
B D                 Zebrafish  tt-
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                     Panda  ===
B D                    Rabbit  ===
               Big brown bat  ===
        David's myotis (bat)  ===
B D                     Sheep  ===
B D                  Microbat  ===
            Brush-tailed rat  ===
               Domestic goat  ===
              Golden hamster  ===
B D           Chinese hamster  ===
B D                     Mouse  ===
B D                       Rat  ===
                Prairie vole  ===
              Pacific walrus  ===
B D                      Pika  ===
                  Chinchilla  ===
          Chinese tree shrew  ===
            Black flying-fox  ===
B D                       Cat  ===
B D                Guinea pig  ===
B D            Naked mole-rat  ===
      Lesser Egyptian jerboa  ===
B D                       Cow  ===
B D                   Ferret   ===
            Tibetan antelope  ===
B D                       Dog  ===
B D                  Squirrel  ===
B D        American alligator  ===
B D                   Chicken  ===
B D                Budgerigar  ===
B D               Zebra finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                    Turkey  ===
  D    White-throated sparrow  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
                Weddell seal  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
B D                   Megabat  ===
            Cape golden mole  ===

Inserts between block 15 and 16 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
B D                    Horse 1bp
B D         White rhinoceros 1581bp
B D          Tasmanian devil 3bp

Alignment block 16 of 213 in window, 125631215 - 125631215, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                  Bushbaby  t
B D                       Pig  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
B D                     Horse  t
B D                  Elephant  t
B D                   Manatee  t
                     Aardvark  t
B D                 Armadillo  t
B D                 Zebrafish  t
B D                    Tenrec  =
         Cape elephant shrew  =
B D                     Panda  =
B D                    Rabbit  =
               Big brown bat  =
        David's myotis (bat)  =
B D                     Sheep  =
B D                  Microbat  =
            Brush-tailed rat  =
               Domestic goat  =
              Golden hamster  =
B D           Chinese hamster  =
B D                     Mouse  =
B D                       Rat  =
                Prairie vole  =
              Pacific walrus  =
B D          White rhinoceros  =
B D                      Pika  =
                  Chinchilla  =
          Chinese tree shrew  =
            Black flying-fox  =
B D                       Cat  =
B D                Guinea pig  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
B D                       Cow  =
B D                   Ferret   =
            Tibetan antelope  =
B D                       Dog  =
B D                  Squirrel  =
B D        American alligator  =
B D                   Chicken  =
B D                Budgerigar  =
B D               Zebra finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D           Tasmanian devil  =
B D                    Turkey  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                   Opossum  =
B D                    Rhesus  -
                Weddell seal  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                   Megabat  =
            Cape golden mole  =
B D       Crab-eating macaque  -
B D           Squirrel monkey  -
B D                  Marmoset  -
B D                    Baboon  -
B D              Green monkey  -

Inserts between block 16 and 17 in window
B D                 Bushbaby 966bp

Alignment block 17 of 213 in window, 125631216 - 125631216, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Gibbon  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D              Green monkey  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                       Pig  c
B D                    Alpaca  c
               Bactrian camel  c
B D                   Dolphin  c
                 Killer whale  c
B D                     Horse  c
B D                  Elephant  c
B D                   Manatee  c
                     Aardvark  c
B D                 Armadillo  c
B D                 Zebrafish  t
B D                    Tenrec  =
         Cape elephant shrew  =
B D                     Panda  =
B D                    Rabbit  =
               Big brown bat  =
        David's myotis (bat)  =
B D                     Sheep  =
B D                  Microbat  =
            Brush-tailed rat  =
               Domestic goat  =
              Golden hamster  =
B D           Chinese hamster  =
B D                     Mouse  =
B D                       Rat  =
                Prairie vole  =
              Pacific walrus  =
B D          White rhinoceros  =
B D                      Pika  =
                  Chinchilla  =
          Chinese tree shrew  =
            Black flying-fox  =
B D                       Cat  =
B D                Guinea pig  =
B D            Naked mole-rat  =
      Lesser Egyptian jerboa  =
B D                       Cow  =
B D                   Ferret   =
            Tibetan antelope  =
B D                       Dog  =
B D                  Squirrel  =
B D        American alligator  =
B D                   Chicken  =
B D                Budgerigar  =
B D               Zebra finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D           Tasmanian devil  =
B D                    Turkey  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                   Opossum  =
                Weddell seal  =
  D  Chinese softshell turtle  =
  D            Painted turtle  =
B D                   Megabat  =
            Cape golden mole  =
B D                  Bushbaby  =

Inserts between block 17 and 18 in window
B D                      Pig 974bp
B D                    Horse 1091bp

Alignment block 18 of 213 in window, 125631217 - 125631217, 1 bps 
B D                     Human  -c
B D                     Chimp  -c
B D                   Gorilla  -c
B D                 Orangutan  -c
B D                    Gibbon  -c
B D                    Rhesus  -c
B D       Crab-eating macaque  -c
B D                    Baboon  -c
B D              Green monkey  -c
B D                  Marmoset  -c
B D           Squirrel monkey  -c
B D                    Alpaca  -c
               Bactrian camel  -c
B D                   Dolphin  -c
                 Killer whale  -c
B D                  Elephant  -c
B D                   Manatee  -c
                     Aardvark  -c
B D                 Armadillo  -c
B D                 Zebrafish  a-
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                     Panda  ==
B D                    Rabbit  ==
               Big brown bat  ==
        David's myotis (bat)  ==
B D                     Sheep  ==
B D                  Microbat  ==
            Brush-tailed rat  ==
               Domestic goat  ==
              Golden hamster  ==
B D           Chinese hamster  ==
B D                     Mouse  ==
B D                       Rat  ==
                Prairie vole  ==
              Pacific walrus  ==
B D          White rhinoceros  ==
B D                      Pika  ==
                  Chinchilla  ==
          Chinese tree shrew  ==
            Black flying-fox  ==
B D                       Cat  ==
B D                     Horse  ==
B D                Guinea pig  ==
B D            Naked mole-rat  ==
      Lesser Egyptian jerboa  ==
B D                       Cow  ==
B D                   Ferret   ==
            Tibetan antelope  ==
B D                       Dog  ==
B D                  Squirrel  ==
B D        American alligator  ==
B D                   Chicken  ==
B D                Budgerigar  ==
B D               Zebra finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  ==
B D                    Turkey  ==
  D    White-throated sparrow  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D                       Pig  ==
                Weddell seal  ==
  D  Chinese softshell turtle  ==
  D            Painted turtle  ==
B D                   Megabat  ==
            Cape golden mole  ==
B D                  Bushbaby  ==

Inserts between block 18 and 19 in window
B D                   Alpaca 1015bp
              Bactrian camel 1017bp
B D                  Dolphin 1036bp
                Killer whale 6bp
B D                 Elephant 7659bp
B D                  Manatee 6854bp
B D                Armadillo 2bp

Alignment block 19 of 213 in window, 125631218 - 125631220, 3 bps 
B D                     Human  tga
B D                     Chimp  tga
B D                   Gorilla  tga
B D                 Orangutan  tga
B D                    Gibbon  tga
B D                    Rhesus  cga
B D       Crab-eating macaque  cga
B D                    Baboon  cga
B D              Green monkey  cga
B D                  Marmoset  tga
B D           Squirrel monkey  tga
                 Killer whale  cta
                     Aardvark  taa
B D                 Armadillo  tac
B D           Tasmanian devil  tga
B D                 Zebrafish  tgg
B D                    Tenrec  ===
         Cape elephant shrew  ===
B D                     Panda  ===
B D                    Rabbit  ===
               Big brown bat  ===
        David's myotis (bat)  ===
B D                     Sheep  ===
B D                  Microbat  ===
            Brush-tailed rat  ===
               Domestic goat  ===
              Golden hamster  ===
B D           Chinese hamster  ===
B D                     Mouse  ===
B D                       Rat  ===
              Bactrian camel  ===
B D                    Alpaca  ===
                Prairie vole  ===
              Pacific walrus  ===
B D          White rhinoceros  ===
B D                      Pika  ===
                  Chinchilla  ===
          Chinese tree shrew  ===
B D                   Manatee  ===
            Black flying-fox  ===
B D                       Cat  ===
B D                     Horse  ===
B D                Guinea pig  ===
B D            Naked mole-rat  ===
      Lesser Egyptian jerboa  ===
B D                       Cow  ===
B D                   Ferret   ===
            Tibetan antelope  ===
B D                       Dog  ===
B D                  Squirrel  ===
B D                  Elephant  ===
B D        American alligator  ===
B D                   Chicken  ===
B D                Budgerigar  ===
B D               Zebra finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
B D                    Turkey  ===
  D    White-throated sparrow  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
B D                       Pig  ===
                Weddell seal  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
B D                   Dolphin  ===
B D                   Megabat  ===
            Cape golden mole  ===
B D                  Bushbaby  ===

Inserts between block 19 and 20 in window
                    Aardvark 8371bp

Alignment block 20 of 213 in window, 125631221 - 125631248, 28 bps 
B D                     Human  tttatac-atagtt------taactcaag--------------------tttttt
B D                     Chimp  tttatac-atagtt------taactcaag--------------------tttttt
B D                   Gorilla  tttatac-atagtt------taactcaag------------------tttttttt
B D                 Orangutan  tttatac-atagtt------gaactcaag--------------------tttttt
B D                    Gibbon  tttatat-gtagtt------taactcaag--------------------tttttt
B D                    Rhesus  tttatac-atagtt------taactcaag--------------------gttttt
B D       Crab-eating macaque  tttatac-atagtt------taactcaag--------------------gttttt
B D                    Baboon  tttatac-atagtt------taactcaag--------------------gttttt
B D              Green monkey  tttatac-atagtt------taactcaag--------------------gttttt
B D                  Marmoset  ttaaaac-atagtt------taactcaag-----------------ttttttttt
B D           Squirrel monkey  ttgaaac-atagtt------taactcaaggttttttttttttttttttttttttt
                 Killer whale  ttgacataagaata------tagtacatg--------------------tttctt
B D                 Armadillo  agtgtgc-ataattatgtggtaa--------------------------------
B D           Tasmanian devil  aagacat-ataatt------aagcagcag--------------------tgt---
B D                 Zebrafish  ----tat-attgtt------ccat-------------------------------
B D                    Tenrec  =======================================================
         Cape elephant shrew  =======================================================
B D                     Panda  =======================================================
B D                    Rabbit  =======================================================
               Big brown bat  =======================================================
        David's myotis (bat)  =======================================================
B D                     Sheep  =======================================================
B D                  Microbat  =======================================================
            Brush-tailed rat  =======================================================
               Domestic goat  =======================================================
              Golden hamster  =======================================================
B D           Chinese hamster  =======================================================
B D                     Mouse  =======================================================
B D                       Rat  =======================================================
              Bactrian camel  =======================================================
B D                    Alpaca  =======================================================
                Prairie vole  =======================================================
              Pacific walrus  =======================================================
B D          White rhinoceros  =======================================================
B D                      Pika  =======================================================
                  Chinchilla  =======================================================
          Chinese tree shrew  =======================================================
B D                   Manatee  =======================================================
            Black flying-fox  =======================================================
B D                       Cat  =======================================================
B D                     Horse  =======================================================
B D                Guinea pig  =======================================================
B D            Naked mole-rat  =======================================================
      Lesser Egyptian jerboa  =======================================================
B D                       Cow  =======================================================
B D                   Ferret   =======================================================
            Tibetan antelope  =======================================================
B D                       Dog  =======================================================
B D                  Squirrel  =======================================================
B D                  Elephant  =======================================================
B D        American alligator  =======================================================
B D                   Chicken  =======================================================
B D                Budgerigar  =======================================================
B D               Zebra finch  =======================================================
  D          Peregrine falcon  =======================================================
  D              Saker falcon  =======================================================
B D                    Turkey  =======================================================
  D    White-throated sparrow  =======================================================
  D           Green seaturtle  =======================================================
B D                   Opossum  =======================================================
B D                       Pig  =======================================================
                Weddell seal  =======================================================
  D  Chinese softshell turtle  =======================================================
  D            Painted turtle  =======================================================
B D                   Dolphin  =======================================================
                    Aardvark  =======================================================
B D                   Megabat  =======================================================
            Cape golden mole  =======================================================
B D                  Bushbaby  =======================================================

Alignment block 21 of 213 in window, 125631249 - 125631249, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -t
B D                    Gibbon  -t
B D                    Rhesus  -t
B D       Crab-eating macaque  -t
B D                    Baboon  -t
B D              Green monkey  -t
B D                  Marmoset  -t
B D           Squirrel monkey  -t
B D                  Bushbaby  -t
           Chinese tree shrew  -t
B D                  Squirrel  -t
       Lesser Egyptian jerboa  -t
B D            Naked mole-rat  -t
B D                Guinea pig  -t
             Brush-tailed rat  -t
B D                    Alpaca  -t
               Bactrian camel  -t
                 Killer whale  -c
B D                     Sheep  -t
B D          White rhinoceros  -t
B D                       Cat  -t
B D                       Dog  -t
B D                   Ferret   -t
B D                     Panda  -t
               Pacific walrus  -t
                 Weddell seal  -t
             Black flying-fox  -t
B D                   Megabat  -t
                Big brown bat  -t
         David's myotis (bat)  -t
B D                  Microbat  -t
B D                   Manatee  -t
                     Aardvark  -t
B D                 Armadillo  -t
  D               Rock pigeon  -t
  D            Painted turtle  -t
B D                 Zebrafish  a-
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                    Rabbit  ==
               Domestic goat  ==
              Golden hamster  ==
B D           Chinese hamster  ==
B D                     Mouse  ==
B D                       Rat  ==
                Prairie vole  ==
B D                      Pika  ==
                  Chinchilla  ==
B D                     Horse  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
B D        American alligator  ==
B D                   Chicken  ==
B D                Budgerigar  ==
B D               Zebra finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  --
B D                    Turkey  ==
  D    White-throated sparrow  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
B D                       Pig  ==
  D  Chinese softshell turtle  ==
B D                   Dolphin  ==
            Cape golden mole  ==

Inserts between block 21 and 22 in window
                Killer whale 997bp

Alignment block 22 of 213 in window, 125631250 - 125631250, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -t
B D                  Bushbaby  -a
           Chinese tree shrew  -a
B D                  Squirrel  -a
       Lesser Egyptian jerboa  -g
B D            Naked mole-rat  -a
B D                Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  -a
B D                       Pig  -a
B D                    Alpaca  -a
               Bactrian camel  -a
B D                   Dolphin  -a
                 Killer whale  -a
B D                     Sheep  -a
B D                     Horse  -a
B D          White rhinoceros  -a
B D                       Cat  -a
B D                       Dog  -a
B D                   Ferret   -a
B D                     Panda  -a
               Pacific walrus  -a
                 Weddell seal  -a
             Black flying-fox  -a
B D                   Megabat  -a
                Big brown bat  -a
         David's myotis (bat)  -a
B D                  Microbat  -a
B D                  Elephant  -a
B D                   Manatee  -g
                     Aardvark  -a
B D                 Armadillo  -a
  D               Rock pigeon  -g
  D            Painted turtle  -g
B D                 Zebrafish  t-
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                    Rabbit  ==
               Domestic goat  ==
              Golden hamster  ==
B D           Chinese hamster  ==
B D                     Mouse  ==
B D                       Rat  ==
                Prairie vole  ==
B D                      Pika  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D        American alligator  ==
B D                   Chicken  ==
B D                Budgerigar  ==
B D               Zebra finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D           Tasmanian devil  --
B D                    Turkey  ==
  D    White-throated sparrow  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
  D  Chinese softshell turtle  ==
            Cape golden mole  ==

Inserts between block 22 and 23 in window
B D                 Squirrel 3bp

Alignment block 23 of 213 in window, 125631251 - 125631252, 2 bps 
B D                     Human  ac
B D                     Chimp  ac
B D                   Gorilla  ac
B D                 Orangutan  ac
B D                    Gibbon  ac
B D                    Rhesus  ac
B D       Crab-eating macaque  ac
B D                    Baboon  ac
B D              Green monkey  ac
B D                  Marmoset  ac
B D           Squirrel monkey  ac
B D                  Bushbaby  ac
           Chinese tree shrew  ac
B D            Naked mole-rat  ac
B D                Guinea pig  ac
                   Chinchilla  ac
             Brush-tailed rat  at
B D                       Pig  gc
B D                    Alpaca  ac
               Bactrian camel  ac
B D                   Dolphin  ac
                 Killer whale  ac
B D                     Sheep  ac
B D                     Horse  ac
B D          White rhinoceros  ac
B D                       Cat  ac
B D                       Dog  ac
B D                   Ferret   ac
B D                     Panda  ac
               Pacific walrus  ac
                 Weddell seal  gc
             Black flying-fox  ac
B D                   Megabat  ac
                Big brown bat  ac
         David's myotis (bat)  ac
B D                  Microbat  ac
B D                  Elephant  ac
B D                   Manatee  at
                     Aardvark  ac
B D                 Armadillo  ac
B D           Tasmanian devil  -c
  D               Rock pigeon  ac
  D            Painted turtle  ac
B D                 Zebrafish  ac
B D                    Tenrec  ==
         Cape elephant shrew  ==
B D                    Rabbit  ==
               Domestic goat  ==
              Golden hamster  ==
B D           Chinese hamster  ==
B D                     Mouse  ==
B D                       Rat  ==
                Prairie vole  ==
B D                      Pika  ==
      Lesser Egyptian jerboa  --
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Squirrel  ==
B D        American alligator  ==
B D                   Chicken  ==
B D                Budgerigar  ==
B D               Zebra finch  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                    Turkey  ==
  D    White-throated sparrow  ==
  D           Green seaturtle  ==
B D                   Opossum  ==
  D  Chinese softshell turtle  ==
            Cape golden mole  ==

Alignment block 24 of 213 in window, 125631253 - 125631257, 5 bps 
B D                     Human  cagtt
B D                     Chimp  cagtt
B D                   Gorilla  cagtt
B D                 Orangutan  cagtt
B D                    Gibbon  cagtt
B D                    Rhesus  cagta
B D       Crab-eating macaque  cagta
B D                    Baboon  cagta
B D              Green monkey  cagta
B D                  Marmoset  cagta
B D           Squirrel monkey  cagca
B D                  Bushbaby  ccctg
           Chinese tree shrew  cagca
B D                  Squirrel  -agca
       Lesser Egyptian jerboa  -agca
               Golden hamster  -acca
B D            Naked mole-rat  cagca
B D                Guinea pig  cggca
                   Chinchilla  cagca
             Brush-tailed rat  cagca
B D                    Rabbit  cagca
B D                       Pig  cagca
B D                    Alpaca  cag--
               Bactrian camel  cag--
B D                   Dolphin  caaca
                 Killer whale  caaca
B D                     Sheep  tacca
B D                     Horse  cagca
B D          White rhinoceros  cagca
B D                       Cat  tagca
B D                       Dog  tagca
B D                   Ferret   cagca
B D                     Panda  cagca
               Pacific walrus  tagca
                 Weddell seal  tagca
             Black flying-fox  ctaca
B D                   Megabat  ctaca
                Big brown bat  ctaca
         David's myotis (bat)  ctaca
B D                  Microbat  cgaca
B D                  Elephant  cagc-
B D                   Manatee  cagca
                     Aardvark  cagc-
B D                 Armadillo  cagca
B D           Tasmanian devil  taaca
  D               Rock pigeon  caatg
  D            Painted turtle  caatt
B D                 Zebrafish  caatc
B D                    Tenrec  =====
         Cape elephant shrew  =====
               Domestic goat  =====
B D           Chinese hamster  =====
B D                     Mouse  =====
B D                       Rat  =====
                Prairie vole  =====
B D                      Pika  =====
B D                       Cow  =====
            Tibetan antelope  =====
B D        American alligator  =====
B D                   Chicken  =====
B D                Budgerigar  =====
B D               Zebra finch  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                    Turkey  =====
  D    White-throated sparrow  =====
  D           Green seaturtle  =====
B D                   Opossum  =====
  D  Chinese softshell turtle  =====
            Cape golden mole  =====

Inserts between block 24 and 25 in window
      Lesser Egyptian jerboa 3bp
              Golden hamster 2bp
B D                    Sheep 6bp

Alignment block 25 of 213 in window, 125631258 - 125631258, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
       Lesser Egyptian jerboa  g
B D           Chinese hamster  a
               Golden hamster  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                       Pig  g
B D                   Dolphin  g
                 Killer whale  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Elephant  a
B D                   Manatee  a
B D                 Armadillo  g
B D           Tasmanian devil  g
  D               Rock pigeon  g
  D            Painted turtle  g
B D                 Zebrafish  a
B D                    Tenrec  =
         Cape elephant shrew  =
B D                     Sheep  =
               Domestic goat  =
B D                     Mouse  =
B D                       Rat  =
              Bactrian camel  -
B D                    Alpaca  -
                Prairie vole  =
B D                      Pika  =
B D                       Cow  =
            Tibetan antelope  =
B D        American alligator  =
B D                   Chicken  =
B D                Budgerigar  =
B D               Zebra finch  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                    Turkey  =
  D    White-throated sparrow  =
  D           Green seaturtle  =
B D                   Opossum  =
  D  Chinese softshell turtle  =
                    Aardvark  -
            Cape golden mole  =

Alignment block 26 of 213 in window, 125631259 - 125631263, 5 bps 
B D                     Human  -----aaaga----
B D                     Chimp  -----aaaga----
B D                   Gorilla  -----aaaga----
B D                 Orangutan  -----aaaga----
B D                    Gibbon  -----aaaga----
B D                    Rhesus  -----aaaga----
B D       Crab-eating macaque  -----aaaga----
B D                    Baboon  -----aaaga----
B D              Green monkey  -----aaaga----
B D                  Marmoset  -----aaaga----
B D           Squirrel monkey  -----aaaga----
B D                  Bushbaby  -----aaagg----
           Chinese tree shrew  -----gaaga----
B D                  Squirrel  -----aaagg----
       Lesser Egyptian jerboa  -----aaaga----
                 Prairie vole  -----agaaa----
B D           Chinese hamster  -----aaaaa----
               Golden hamster  -----aagaa----
B D                     Mouse  -----aaaga----
B D                       Rat  -----aaaga----
B D            Naked mole-rat  -----aaaga----
B D                Guinea pig  -----aaaga----
                   Chinchilla  -----aaaga----
             Brush-tailed rat  -----aaagt----
B D                    Rabbit  -----aaaga----
B D                       Pig  -----aaaga----
B D                    Alpaca  -----aaaga----
               Bactrian camel  -----aaaga----
B D                   Dolphin  -----aaaga----
                 Killer whale  -----aaaga----
             Tibetan antelope  -----aaaaa----
B D                     Sheep  -----aaaaa----
                Domestic goat  -----aaaaa----
B D                     Horse  -----aaaga----
B D          White rhinoceros  -----aaaga----
B D                       Cat  -----aaaga----
B D                       Dog  -----aaaga----
B D                   Ferret   -----aaaga----
B D                     Panda  -----aaaga----
               Pacific walrus  -----aaaga----
                 Weddell seal  -----aaaga----
             Black flying-fox  -----aaaga----
B D                   Megabat  -----agaga----
                Big brown bat  -----agaga----
         David's myotis (bat)  -----aaaga----
B D                  Microbat  -----aaaga----
B D                  Elephant  -----aaaga----
B D                   Manatee  -----aaaga----
                     Aardvark  ------aaga----
B D                 Armadillo  -----aaaga----
B D           Tasmanian devil  -------gga----
  D               Rock pigeon  -----ggagg----
  D            Painted turtle  -----ggagg----
B D                 Zebrafish  aaaacaaaaacaaa
B D                    Tenrec  ==============
         Cape elephant shrew  ==============
B D                      Pika  ==============
B D                       Cow  ==============
B D        American alligator  ==============
B D                   Chicken  ==============
B D                Budgerigar  ==============
B D               Zebra finch  ==============
  D          Peregrine falcon  ==============
  D              Saker falcon  ==============
B D                    Turkey  ==============
  D    White-throated sparrow  ==============
  D           Green seaturtle  ==============
B D                   Opossum  ==============
  D  Chinese softshell turtle  ==============
            Cape golden mole  ==============

Inserts between block 26 and 27 in window
            Tibetan antelope 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D          Tasmanian devil 2bp

Alignment block 27 of 213 in window, 125631264 - 125631307, 44 bps 
B D                     Human  acatt-tcctgacaattagactctgt---tta-------aa-aa--aaa----gac--aatact
B D                     Chimp  acatt-tcctgacaattagactctga---ttt-------aa-aa--aaa----gac--aatact
B D                   Gorilla  acatt-tcctgacaattagactctga---tta-------aa-aa--aaa----gac--aatact
B D                 Orangutan  acatt-tcctgacaattagactctga---taa-------aataa--aac----gac--aatact
B D                    Gibbon  acatt-tcctgacaattagactctga-----a-------aa-aa--aac----aac--aatact
B D                    Rhesus  acatt-tcctggcatttagactcttc-----t-------aa-aa--aat----gac--catact
B D       Crab-eating macaque  acatt-tcctggcatttagactctta-----t-------aa-aa--aat----gac--catact
B D                    Baboon  acatt-tcctggcatttagactttta-----t-------aa-aa--aat----gac--catact
B D              Green monkey  acatt-tcctggcatttagactctta-----t-------aa-aa--aat----gac--catacc
B D                  Marmoset  gcatt-tcctgtcaactagagtctga---t-a-------aa-aa--aat----gac--aatatg
B D           Squirrel monkey  gcatt-tcctgtcaattagagtctga---t-a-------aa-aaacaat----gac--aatacg
B D                  Bushbaby  atata-tcctggcaattagcatctga---t----------a-ag--aat----aac--aattct
           Chinese tree shrew  acact-tcctggcaattagagtctga---t----------a-aa--aat----acc--agaact
B D                  Squirrel  acattatactggcaattagagtctga---ttacagaataaa-ta--aacaaaaaac--agcact
       Lesser Egyptian jerboa  acatt-tctcaaaaattagagtctta---tta-------aa-aa--aattaaacat--ggtact
                 Prairie vole  aaatt-tcctgccaattagagtctga---ttc------aaa-aa--atttagaaag--gtccct
B D           Chinese hamster  ctact-tcctgtcaattagagtctga---tta-------aa-aa--ttttagaaag--actcct
               Golden hamster  acact-tcctgtcaattagagtctga---ttc-------aa-aa--atttagaaag--gcccct
B D                     Mouse  acatt-tcctgacaattagagtctga---tta------gaa-aa--atttagaaag--gttcct
B D                       Rat  acatt-tcctgccaattagagtctga---tta-------aa-aa--atttagaaag--attcct
B D            Naked mole-rat  acatt-tcctgttaattagagcccaattttta-------ga-aa--aac---------aacatt
B D                Guinea pig  atgtt-tcctgacaattagagtctga---tca-------aa-ca--aacaaacaaacaagcatt
                   Chinchilla  acaat-tcctggtaattaaagtctga---taa-------aa-aa--aaa---------agcatt
             Brush-tailed rat  acatt-tcctggtaatttgagtttga---tta-------ag-aa--aac---------aatgct
B D                    Rabbit  acatt-tcctggcaattagattctga---tag-------aa-at--agc---------agtact
B D                       Pig  acatt-tcctggcaataaggatctga---taa-------aa-at--aac---------accata
B D                    Alpaca  atatt-tcctggcaattaagctctga---ta--------aa-at--aac---------aaaaaa
               Bactrian camel  atatt-tcctggcaattaagctctga---ta--------aa-at--aac---------aaaaaa
B D                   Dolphin  acatt-tcctggcaattagtgtctga---tac-------aa-at--aat---------ggtaca
                 Killer whale  acatt-tccaggcaattagggtctga---taa-------aa-at--aac---------ggtaca
             Tibetan antelope  aagtt-tcctggcaattaggatctga---taa-------aa-ac--aat---------agcact
B D                       Cow  acatt-tcctggcaattatgatctga---taa-------aa-ac--aat---------tgcact
B D                     Sheep  aagtt-tcctggcaattaggatctga---taa-------aa-ac--aat---------agcact
                Domestic goat  aagtt-tcctggcaattaggatctga---taa-------aa-ac--aat---------ggcact
B D                     Horse  acgtt-tcctggcaattagggtctga---taa-------aa-at--agc---------agtact
B D          White rhinoceros  acatt-tcctggcaattagggtctga---taa-------aa-at--aac---------agtact
B D                       Cat  acatt-tcctggcaattaggggctga---taa-------aa-at--aac---------agtact
B D                       Dog  acatt-tcctggcaattagggtctga---taa-------aa-at--aac---------agtact
B D                   Ferret   acatt-tcttggcaattagggtctga---taa-------aa-at--aac---------agtact
B D                     Panda  acatt-tcctggcaattagggtctga---taa-------aa-at--aac---------agtact
               Pacific walrus  acatt-tcctggcaattagggtctga---taa-------aa-at--aat---------agtact
                 Weddell seal  acatt-tcctggcaattagggtctga---taa-------aa-gt--aac---------agtact
             Black flying-fox  acatt-tcctggcaactagggtctga---taa-------aa-at--aac---------agtact
B D                   Megabat  acatt-tcctggcaactagggtctga---taa-------aa-at--aac---------agtacc
                Big brown bat  acatt-tcctggcaaatagggtctga---taa-------aa-at--aac---------agcact
         David's myotis (bat)  acatt-tcctggcaaatagggtctga---taa-------aa-at--aat---------ggcact
B D                  Microbat  acatt-tcctggcaaatagagtctga---taa-------aa-at--aac---------ggcact
B D                  Elephant  aaatt-tcctagcaattagagtctga---taa-------aa-at--aac---------agtact
B D                   Manatee  acatt-tcctggcaattagggtgtga---taa-------aa-at--aag---------gacagt
                     Aardvark  acatt-tcctggcaattaggttctga---taa-------aa-at--cac---------agcact
B D                 Armadillo  acatt-tcctgataattaggatctga---taa-------aa-at--aac---------agtact
B D           Tasmanian devil  gcatt-tcctggcaattagtgtctgg---tta-------gt-at--tgc---------tgagtt
  D               Rock pigeon  gcatt-tcctgacagctcatgactgc---ttg-------gg-gta-aaa---------ggtaca
  D            Painted turtle  gcatt-tcctgagagttaaagactag---ctg-------gg-gt--gaa---------ggcaaa
B D                 Zebrafish  aagtt-ttgatataattatggtgagaaattta-------ca-aa--atc---------aactct
B D                    Tenrec  ================================================================
         Cape elephant shrew  ================================================================
B D                      Pika  ================================================================
B D        American alligator  ================================================================
B D                   Chicken  ================================================================
B D                Budgerigar  ================================================================
B D               Zebra finch  ================================================================
  D          Peregrine falcon  ================================================================
  D              Saker falcon  ================================================================
B D                    Turkey  ================================================================
  D    White-throated sparrow  ================================================================
  D           Green seaturtle  ================================================================
B D                   Opossum  ================================================================
  D  Chinese softshell turtle  ================================================================
            Cape golden mole  ================================================================

Inserts between block 27 and 28 in window
  D              Rock pigeon 2bp
  D           Painted turtle 7298bp

Alignment block 28 of 213 in window, 125631308 - 125631405, 98 bps 
B D                     Human  -----gaagtcaggttattttta-tcaacag-gct---attttcagtgtcctaggaaatgtc--------
B D                     Chimp  -----gaagtcaggttattttta-tcaacag-gct---attttcagtgtcctaggaaatgtc--------
B D                   Gorilla  -----gaagtcaggttattttta-tcaacag-gct---attttcagtgtcctaggaaatgtc--------
B D                 Orangutan  -----gaagtcaggttattttta-tcaacag-gct---attttcagtgtcctaggaaatgtc--------
B D                    Gibbon  -----gaagtcaggttattttta-ccaacag-gct---attttcagtgtcctaggaaatgtc--------
B D                    Rhesus  -----gaagtcaggttattttta-tcaacag-gct---attttcagtgtcctaggaaatgtc--------
B D       Crab-eating macaque  -----gaagtcaggttattttta-tcaacag-gct---attttcagtgtcctaggaaatgtc--------
B D                    Baboon  -----gaagtcaggttattttta-tcaacag-gct---attttcagtgtcctaggaaatgtc--------
B D              Green monkey  -----gaagtcaggctattttta-tcaacag-gct---attttcagcgtcctaggaaatgtc--------
B D                  Marmoset  -----gaagtcagcttattttta-tcaagga-gat---attttcagtgtcctaggaaatgtc--------
B D           Squirrel monkey  -----gaagtcagcttattttta-tcaacaa-gat---attttcagtgtcctaggaaatgtc--------
B D                  Bushbaby  -----aaagtcagtttatttttg-ccaacag-gct---atttttagtatctgcggaaatgtc--------
           Chinese tree shrew  -----aaactcagttt-cgtttg-ccaacagaact---atttttagtatcctaagaaatgtc--------
B D                  Squirrel  -----aaagtcaagtgacttctg-ccaactg-gct---atttttagcatcctag-caatgcc--------
       Lesser Egyptian jerboa  -----aaaattaggttacctttg-ccaaaaa-act---atttttagtatcccaggaaatcca--------
                 Prairie vole  -----aaagttaggttaccttgg-ccaaaag-gct---attcttagcataccaggaaatgct--------
B D           Chinese hamster  -----aaagttaggttaccttgg-ccaaaag-gct---attcttagtgtctcaggaaatgcc--------
               Golden hamster  -----aaagttaggttaccttgg-ccaaaag-gct---attcttagtgtcccaggaaatgcc--------
B D                     Mouse  -----aaagttaggttaccttgg-ccaaaag-gct---attcttagtatcccaggaaatgtt--------
B D                       Rat  -----aaagttaggttaccttgg-ccaaaag-gct---attcttagtatcccggaaaatgct--------
B D            Naked mole-rat  -----aaagtcagattatctttg-ccaagag-gct---att-ttagtatcctaggaaatact--------
B D                Guinea pig  -----gaagtcaggttaactttg-ccaacag-gct---att-tctgtatcttaagaaatggc--------
                   Chinchilla  -----gaagtcgggtaacctttg-ccaacag-gct---att-ttagtatcctaggaaatggt--------
             Brush-tailed rat  -----gaagtcaggttatgtttg-ccaagag-gct---att-ttagtatcctaggaattagt--------
B D                    Rabbit  -----gaagtcaggccactcttg-ccatctg-gct---atttttagtatcctaggaaatgtc--------
B D                       Pig  -----aaggtcataatacctttg-ccaacag-act---atttttaatatcccaggatatgtc--------
B D                    Alpaca  -----aaagtcacattacctttg-ccaacag-gct---acatttagtatccccggaaatgtc--------
               Bactrian camel  -----aaagtcacattacctttg-ccaacag-gct---acatttagtatccccggaaatgtc--------
B D                   Dolphin  -----aaaaccatgttacctgtg-ccaacca-gct---attttcagtatcccaggaaatgtc--------
                 Killer whale  -----aaaaccatgttacctgtg-ccaacca-gct---attttcagtatcccaggaaatgtc--------
             Tibetan antelope  -----aaagtcatgtcacctttg-ccaacag-agt---atttttagtgtcccaggaaatgtc--------
B D                       Cow  -----aaagtcatgtcacctttg-ccaatag-gtt---atttttagtgtcccaggaaatgtc--------
B D                     Sheep  -----aaagtcatgtcacctttg-ccaacag-att---atttttagtgtcccaggaaatgtc--------
                Domestic goat  -----aaagtcatgtcacctttg-ccaatag-att---atttttagtgtcccaggaaatgtc--------
B D                     Horse  -----aaagtcacgttacctttg-ccaacag-gct---atttttagcatcacaggaaatgtc--------
B D          White rhinoceros  -----aaagtcacgttacctttg-ccaacag-gct---atttttagtatcccaggaaatgtc--------
B D                       Cat  -----acagtcaggttacctttg-ccaacag-gct---atttttagtatcccgggaaatgtc--------
B D                       Dog  -----acagtcaggttacctttg-ccaacag-gct---atttttagtatcccaggaaatgtc--------
B D                   Ferret   -----acagtcgggttacctttg-ccagcag-gct---atttttagtatcccaggaaatgtc--------
B D                     Panda  -----atagtcaggttacctttg-ccagcag-gct---atttttagtatcccaggaaatgtc--------
               Pacific walrus  -----acagccaggttacctttg-ccagcag-gct---atttttagtatcccaggaaatatc--------
                 Weddell seal  -----acagccaggttacctttg-ccaacag-gct---atttttagcagcccaggaaatatc--------
             Black flying-fox  -----aaagtcatgtcactcttg-ccaacag-act---attttta-tatcccaggaagtgtc--------
B D                   Megabat  -----aaagtcatgtcactcttg-ccaacag-act---attttta-tatcccaggaagtgtc--------
                Big brown bat  -----aaagtcctgttacttttg-ccaacgg-gct---atttttagtatcccaggaaatgtc--------
         David's myotis (bat)  -----aaagtcctgtgacttttg-ccaacgg-gct---atttttagtatcccaggaaatgtc--------
B D                  Microbat  -----aaagtcctgtgacttttg-ccaacgg-gct---atttttagtatcccaggaaatgtc--------
B D                  Elephant  -----aaagtcaggttacctttg-ccaagaa-gct---atttttagaatcctaggaaatgtc--------
B D                   Manatee  -----gaagtctggttacctttg-ccaagag-gct---atttttagtatcctaggaaatatc--------
                     Aardvark  -----aaagtcggattacgtttg-ccaacag-gct---attattagcatcctaggaaatggc--------
B D                 Armadillo  -----aaaatcagattatctttg-ccaacaa-gtt---atttttagtatcctaggaagtgtc--------
B D           Tasmanian devil  -----aaagccaggtgacctttg-ccagctg-gct---agt---aattgcctagaaaatgtc--------
  D               Rock pigeon  -----gaaaccaccagacttgagtttcacag-gtc---attaactg----ccaggaaatgccaaactcga
B D                 Zebrafish  ttgattaaatcatttaaacattt-tcaatta-gataaaatcttttgtgacctataaatgttt--------
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                      Pika  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
B D               Zebra finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Turkey  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ---tcct----------------ca----actataatgactggtattagaa-------aggttgac-aag
                        Chimp  ---tcct----------------ca----actataatgactggtattagaa-------aggttgac-aag
                      Gorilla  ---tcct----------------ca----actataatgactggtattagaa-------aggttgac-aag
                    Orangutan  ---tcct----------------ca----actataatgactggtattagaa-------aggtt------g
                       Gibbon  ---tcct----------------ca----attataatgactggtattagag-------aggttgac-aag
                       Rhesus  ---tcct----------------ca----accataatgactggtattagaa-------aggttgac-acg
          Crab-eating macaque  ---tcct----------------ca----accataatgactggtattagaa-------aggttgac-acg
                       Baboon  ---tcct----------------ca----accataatgactggtattagaa-------aggttgac-acg
                 Green monkey  ---tcct----------------ca----accataatgactggtattagaa-------aggttgac-acg
                     Marmoset  ---tcct----------------ca----gctgtaatgactggtatttgaa-------aggttgac-atg
              Squirrel monkey  ---tcct----------------ca-------------actggtattagaa-------aggttgac-atg
                     Bushbaby  ---tcct----------------ca----acagcagtgagtggtgttagaa-------atgttggc-ata
           Chinese tree shrew  ---tcct----------------c--------------atcaggattagaa-------atgttgac-acc
                     Squirrel  ---ttct----------------ca----acagcagtgactggattgagaa----------ttggc-aca
       Lesser Egyptian jerboa  ---ctaaactacccttaaaatacta----ctggtgatagccag-attata---------------c-aga
                 Prairie vole  ---ccca----------------cg----ttgatggtgactggaattagaa-------atgttggtaaaa
              Chinese hamster  ---cccg----------------ca----ttggtggtgtctggaattagaa-------atcttggt-aaa
               Golden hamster  ---cccg----------------ca----ttggtggtatctggaattagaa-------atcttggt-aaa
                        Mouse  ---cctg----------------ca----t---tggtgactggaattagaa-------atcttggc-aaa
                          Rat  ---cctg----------------aa----ttggtggtgactggaattggaa-------atcttggc-aaa
               Naked mole-rat  ---tcct----------------caacaggaaggagtgactggtattggaa-------atcttggc-aca
                   Guinea pig  ---ttct----------------c-----aaaggagtgaccagtgctagaa-------atcttggc-aca
                   Chinchilla  ---tcct----------------ca----aaaagagtgactggtattagaa-------atcttggt-aca
             Brush-tailed rat  ---tcct----------------ca----aaaagaatgactagcattagga-------atcttggc-aca
                       Rabbit  ---tcct----------------ca----tcagtcgtgactggtgtcggaa-------atgttggc-aca
                          Pig  ---tcct----------------ca----gcagtagtgactattatgagaa-------atactggc-aca
                       Alpaca  ---tcct----------------ca----tcagtagtgactagtattagaa-------atgttgcc-aca
               Bactrian camel  ---tcct----------------ca----tcagtagtgactagtattagaa-------atgttggt-gca
                      Dolphin  ---tcct----------------ca----tcagtagtgactagta-tagaa-------atgttggc-aaa
                 Killer whale  ---tcct----------------ca----tcagtagtgactagta-cagaa-------atgttggc-aaa
             Tibetan antelope  ---tctt----------------ca----tcagtagtaac-------------------tgctggc-aca
                          Cow  ---tctt----------------ca----tcagtagtgac-------------------tgatggc-aca
                        Sheep  ---tctt----------------ca----tcagtagtaac-------------------tgctggc-aca
                Domestic goat  ---tctt----------------ca----tcagtagaaac-------------------tgctggc-aca
                        Horse  ---tcct----------------ca----tcagtagtgactggtattagaa-------atgttggc-aca
             White rhinoceros  ---tcct----------------ca----tcagtagtgactggtattagaa-------atgttggc-aca
                          Cat  ---tcct----------------ca----tcagtagtgactggtattagaa-------atgctggc-aca
                          Dog  ---tcct----------------ca----tcagtagtgactggtattagaa-------atgctggc-aca
                      Ferret   ---tcct----------------ca----tcagtagtgactggtattagaa-------atgttggc-aca
                        Panda  ---tcct----------------ca----tcagtagtgactggtattagga-------atgttggc-aca
               Pacific walrus  ---tcct----------------ca----tcggtagagactggtattggaa-------atgctggc-aca
                 Weddell seal  ---tcct----------------ca----tcagtagagactggtattagaa-------ctgctggc-aca
             Black flying-fox  ---tcct----------------ca----tcagtagtggctggtattagac-------atgtcggc-tca
                      Megabat  ---tcct----------------ca----tcagcagtggctggtattagac-------atgtcggc-tca
                Big brown bat  ---tcct----------------ca----tcagtactgactggaattggaa-------atgccggc-cca
         David's myotis (bat)  ---tcct----------------ca----tcagtagtgactgggattggaa-------acgcccgt-cca
                     Microbat  ---tcct----------------ca----tcagtagtgactgggattggaa-------atgccggt-cca
                     Elephant  ---tcct----------------ca----tcaatggtgactggcattagaa-------atgccggc-a-a
                      Manatee  ---tcct----------------ca----tcagtagtgactggtattagaa-------atgttggc-a-a
                     Aardvark  ---tcct----------------ca----tcagcagtgaatggtattagat-------acaccggc-a-a
                    Armadillo  ---tcct----------------ca----tcagtagtgagtgatattagaa-------atgttggc-ata
              Tasmanian devil  ---tcca----------------ca----tcagtcattaatggtattagcc-------attttggc-ata
                  Rock pigeon  aggtcat----------------ca----ttacaaatgaaagctgtgaaaagccaaagatgt--------
                    Zebrafish  ---tcat----------------tt----tcattttttaaatgcat------------attt--------
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                         Pika  ======================================================================
           American alligator  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
                  Zebra finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                       Turkey  ======================================================================
       White-throated sparrow  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
             Cape golden mole  ======================================================================

                        Human  acaactt
                        Chimp  acaactt
                      Gorilla  acaactt
                    Orangutan  acaactt
                       Gibbon  acaactt
                       Rhesus  acaactt
          Crab-eating macaque  acaactt
                       Baboon  acaactt
                 Green monkey  acaactt
                     Marmoset  accactt
              Squirrel monkey  accactt
                     Bushbaby  acaactt
           Chinese tree shrew  acaactt
                     Squirrel  actc---
       Lesser Egyptian jerboa  ataagtt
                 Prairie vole  ataattg
              Chinese hamster  ataattt
               Golden hamster  attattt
                        Mouse  ataactt
                          Rat  attattt
               Naked mole-rat  attt---
                   Guinea pig  actt---
                   Chinchilla  actt---
             Brush-tailed rat  actt---
                       Rabbit  ccaactt
                          Pig  ac---tt
                       Alpaca  acaactt
               Bactrian camel  acaactt
                      Dolphin  acaattt
                 Killer whale  acaattt
             Tibetan antelope  acagctt
                          Cow  acagctt
                        Sheep  acagctt
                Domestic goat  acagctt
                        Horse  actgctt
             White rhinoceros  acaactt
                          Cat  acaactt
                          Dog  acaactt
                      Ferret   gcaactt
                        Panda  acaactt
               Pacific walrus  acaactt
                 Weddell seal  acaactt
             Black flying-fox  actg---
                      Megabat  agtg---
                Big brown bat  acgt---
         David's myotis (bat)  tcgt---
                     Microbat  tcgt---
                     Elephant  aaaactt
                      Manatee  aaaactt
                     Aardvark  aaaactt
                    Armadillo  caaactt
              Tasmanian devil  aaagtga
                  Rock pigeon  -------
                    Zebrafish  -------
                       Tenrec  =======
          Cape elephant shrew  =======
                         Pika  =======
           American alligator  =======
                      Chicken  =======
                   Budgerigar  =======
                  Zebra finch  =======
             Peregrine falcon  =======
                 Saker falcon  =======
                       Turkey  =======
       White-throated sparrow  =======
              Green seaturtle  =======
                      Opossum  =======
     Chinese softshell turtle  =======
               Painted turtle  =======
             Cape golden mole  =======

Inserts between block 28 and 29 in window
      Lesser Egyptian jerboa 174bp
B D          Tasmanian devil 7bp
  D              Rock pigeon 1bp
B D                Zebrafish 2bp

Alignment block 29 of 213 in window, 125631406 - 125631429, 24 bps 
B D                     Human  aa--------------acaaaca-----------tactt---atgtgtgtac
B D                     Chimp  aa--------------acaaaca-----------tactt---atgtgtgtac
B D                   Gorilla  aa--------------acaaaca-----------tactt---atgtgtgtac
B D                 Orangutan  aa--------------acaaaca-----------tactt---atgtgtgtac
B D                    Gibbon  aa--------------acaaaca-----------tactt---atgtgtgtac
B D                    Rhesus  aa--------------acaaaca-----------tactt---atatgtgtat
B D       Crab-eating macaque  aa--------------acaaaca-----------tactt---atatgtgtat
B D                    Baboon  aa--------------acaaaca-----------tactt---acatgcgtat
B D              Green monkey  aa--------------acaaaca-----------tactt---atatgtgtac
B D                  Marmoset  aa--------------acaaa-a-----------tacct---atgtgtgtac
B D           Squirrel monkey  aa--------------acaaaca-----------tacct---atgtgtgtac
B D                  Bushbaby  aa--------------ac----a-----------tactc---aagtgtgtgg
           Chinese tree shrew  aa--------------gcaaaca-----------tgctt---atgtgggcag
B D                  Squirrel  ----------------acaaaca-----------cacgt---atgtg--tgc
                 Prairie vole  ------------------aaaca-----------taact---ttgtgcctgg
B D           Chinese hamster  ------------------aaaca-----------tagtt---ttgtggatgg
               Golden hamster  ------------------aaaca-----------tagtt---ttgtggctgg
B D                     Mouse  ------------------aaaca-----------tagtc---atgtggttgg
B D                       Rat  ------------------aaaca-----------tagtt---atgtggctgg
B D            Naked mole-rat  aa--------------acaaaca-----------cac-----atttatgtag
B D                Guinea pig  aa--------------acagaga-----------cactt---acatgtgtcc
                   Chinchilla  aa--------------acagaca-----------gactt---atgtgtgtag
             Brush-tailed rat  aa--------------acaaaca-----------tacct---atgtgtgtag
B D                    Rabbit  aa--------------acaaaca-----------tactt---atgtgtgcag
B D                       Pig  aa--------------acaagcaagcacattcatcattc---atgtatataa
B D                    Alpaca  aa--------------acaagca-----------cattt---atgtgtgtgg
               Bactrian camel  aa--------------acaagca-----------cattt---atgtgtgtgg
B D                   Dolphin  aa--------------acaagca-----------cattt---atgtgtgtag
                 Killer whale  aa--------------acaagca-----------cattt---atgtgtgtag
             Tibetan antelope  aacaatgtgcttacacacaagca-----------tgttt---acgtgtgtag
B D                       Cow  aacaatgtgctcacacacaagcg-----------tgttt---acgtgtgtag
B D                     Sheep  aacaacgtgcttacacacaagca-----------tgttt---acgtgtgtag
                Domestic goat  aacaacgtgcttacacacaagca-----------agttt---acgtgtgtag
B D                     Horse  aa--------------acaaaca-----------cactt---atgtgtggaa
B D          White rhinoceros  aa--------------acaaaca-----------cactt---atgtgtat-a
B D                       Cat  aa--------------acaaaca-----------cactt---atgtttgtag
B D                       Dog  aa--------------acaaaca-----------cactt---atatttgtag
B D                   Ferret   aa--------------acaaaca-----------cactt---atgtttttag
B D                     Panda  aa--------------acaaaca-----------cactt---atgtttgtag
               Pacific walrus  aa--------------acaaaca-----------cactt---atgcttgtag
                 Weddell seal  aa--------------acaaaca-----------cactt---atgtttgtag
             Black flying-fox  aa--------------tcaagcc-----------ttcttattatgtgtgcag
B D                   Megabat  aa--------------tcaagcc-----------ttcttattatgtgtgcag
                Big brown bat  aa--------------accagca-----------tgctc---atgtgtgtag
         David's myotis (bat)  -a--------------accagca-----------ttctc-----gtgtgtag
B D                  Microbat  -a--------------accagca-----------ttctc---atgtgtgtag
B D                  Elephant  aa--------------acaaaga-----------tattt---aagtgtatag
B D                   Manatee  aa--------------acaaaca-----------tactt---aagtgtgtag
                     Aardvark  ga--------------acaaaca-----------tacat---ttgcatgtag
B D                 Armadillo  aa--------------ataaaca-----------tactt---atatgtacag
B D           Tasmanian devil  ------------------aaaga-----------aagct-----gtgtgatg
  D               Rock pigeon  aa--------------taaaact-----------aatta---atgtttttac
B D                 Zebrafish  aa--------------ataaaag-----------tatta---aagttt----
B D                    Tenrec  ====================================================
         Cape elephant shrew  ====================================================
B D                      Pika  ====================================================
      Lesser Egyptian jerboa  ====================================================
B D        American alligator  ====================================================
B D                   Chicken  ====================================================
B D                Budgerigar  ====================================================
B D               Zebra finch  ====================================================
  D          Peregrine falcon  ====================================================
  D              Saker falcon  ====================================================
B D                    Turkey  ====================================================
  D    White-throated sparrow  ====================================================
  D           Green seaturtle  ====================================================
B D                   Opossum  ====================================================
  D  Chinese softshell turtle  ====================================================
  D            Painted turtle  ====================================================
            Cape golden mole  ====================================================

Inserts between block 29 and 30 in window
  D              Rock pigeon 7334bp

Alignment block 30 of 213 in window, 125631430 - 125631476, 47 bps 
B D                     Human  ta-aggctctacagaaca------------ggaatttt-----cctg-aaattaaggg---cagt-----
B D                     Chimp  ta-aggctctacagaaca------------ggaatttt-----cctg-aaattaaggg---cagt-----
B D                   Gorilla  ta-aggctctacagaaca------------ggaatttt-----cctg-aaattaaggg---cagt-----
B D                 Orangutan  ta-aggctctacagaaca------------ggaatttt-----cctg-aaattaagga---cagt-----
B D                    Gibbon  ta-aggctctacagaaca------------ggaatttt-----cctg-aaattaaggg---cagt-----
B D                    Rhesus  ta-aggctctacagaaca------------ggaatttt-----cctg-aaattaaggg---cagtaatta
B D       Crab-eating macaque  ta-aggctctacagaaca------------ggaatttt-----cctg-aaattaaggg---cagtaatta
B D                    Baboon  ta-aggctctacagaaca------------ggaatttt-----cctg-aaatt-----------------
B D              Green monkey  ta-aggctctacagaaca------------ggaatttt-----cctg-aaattaaggg---cagtaatta
B D                  Marmoset  ta-aggctccatagaaca------------ggaattat-----cctg-aaattaaggg---cagt-----
B D           Squirrel monkey  ta-aggctccacagaaca------------ggaattgt-----cctg-aaattaaggg---cagt-----
B D                  Bushbaby  ca-aggctatgcagaact------------agaactt-------ctc-gtattaaata---cagt-----
           Chinese tree shrew  ca-aggttatacagaact------------agaaattc-----cccc-aaatacagca---cagt-----
B D                  Squirrel  tgcaagccaagtaga-ac------------tggagattccctgactg-tggtacagtc------------
                 Prairie vole  tt-aggccacacaga-tg------------agaaac-------tctg-aaatgcagtc------------
B D           Chinese hamster  tg-aggccacacaga-tg------------agaaactt-----tctg-aaatgaagttgtgcact-----
               Golden hamster  tg-aggccacacaga-cg------------ggaaactt-----tctg-aaatgcagttgtgcact-----
B D                     Mouse  tg-aggccacacaga-tg------------aggaac-------actg-aaatgaagcagtgggca-----
B D                       Rat  tg-aggccacacaga-tg------------agaaac-------tctg-aaaagaaacagtgtgca-----
B D            Naked mole-rat  ca-agggtttgcagagtt------------agaaattc-----ccta-aaatgaagaaattcagt-----
B D                Guinea pig  ca-agagtatgtcgagtt------------agcaattc-----ccta-aggcaaagaaattctat-----
                   Chinchilla  ca-agggtacgcagagct-------------ggaaatt-----ccta-aaatgaagaaattcaat-----
             Brush-tailed rat  ca-agggtatgcagaatt------------agaaaatt-----tcta-aaatgaagaaattcgct-----
B D                    Rabbit  tg-aggctacccagaact------------caaagttc-----ccct-atgtaaagaactgcaca-----
B D                       Pig  ta-aagttatactgaact------------agaaatta-----cttg-aaatgaaatc---tgtt-----
B D                    Alpaca  ta-aggttttactgaact------------ggacgttg-----cctg-aaatgaagtc---tgtt-----
               Bactrian camel  ta-aggttttactgaact------------ggaagttg-----cctg-aaatgaagtc---tgtt-----
B D                   Dolphin  ta-aggttatattgaaattacctgaaattaagaaatta-----cctg-aaatgaactc---tgtt-----
                 Killer whale  ta-aggttatgttgaaattacctgaaattaagaaatta-----cctg-aaatgaactc---tgtt-----
             Tibetan antelope  ca-aggttatattgaagt------------agaaatta-----ccca-agataaagtc---tgtt-----
B D                       Cow  tc-aggttatgttgaagt------------agaaatta------cca-agatgaagtc---tgtt-----
B D                     Sheep  ca-agtttatattgaagt------------agaaatta-----ccca-agataaagtc---tgtt-----
                Domestic goat  ca-aggttatattgaagc------------agaaatta-----ccca-agataaagtc---tgtt-----
B D                     Horse  ta-aggttgtgctgaagt------------agaaattc-----cctg-gaatgaagta---ccat-----
B D          White rhinoceros  ta-aggttgtgctgaacc------------agaaattt-----cctg-agatgaagta---cctt-----
B D                       Cat  ta-aggttacattaaact------------agacattc-----cctg-gaatgaagta---cttt-----
B D                       Dog  ta-aggttatattgaact------------agaaatcc-----cctg-aaatgaagta---cttg-----
B D                   Ferret   ta-aggttgtattgaact------------agaaatcc-----ccta-aaatgaagta---cttt-----
B D                     Panda  cg-aggttatattgaact------------agacattc-----cctg-aaatgaagtt---ctt------
               Pacific walrus  ta-aggttatactgaact------------agaaattc-----cctg-caatgaagta---cttt-----
                 Weddell seal  ta-aggttatattgaact------------agaaattc-----cctg-aaatgaagtg---cttt-----
             Black flying-fox  ta-aggtcatacttcacc------------agacattc-----cctg-aaatgaagga---ggcc-----
B D                   Megabat  ta-aggtcatacttcacc------------agacattc-----cctg-aaatgaagga---ggcc-----
                Big brown bat  gg-cagctctgctgagct------------agaagctc-----cccg-aaacaagggc---cttc-----
         David's myotis (bat)  ta-cagctctgccgggct------------agaagctc-----cctg-aaacaagggc---cttc-----
B D                  Microbat  ca-cagctctgccgagct------------agaagctc-----cctg-aaacaagggc---cttc-----
B D                  Elephant  tg-aggttatactgaagt------------gatgattc-----cctgaaaatgaagta---tatt-----
B D                   Manatee  ta-aggttatactgaagt------------aaggattc-----cctgaaaatgaagta---catt-----
                     Aardvark  ta-aggttatactgaact------------aaggattc-----catgaaaatgaaata---tatt-----
B D                 Armadillo  ta-taaccatatgaaact------------aggaattc-----tctg-aaatgaacta---tttt-----
B D           Tasmanian devil  aa-aagtttcattgaact------------agacattg-----cctt-cgattaaaac---aaat-----
B D                 Zebrafish  ---aagttctaaaaaac-------------aacattta-----acca-aaatcaatta---aatt-----
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                      Pika  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
B D               Zebra finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D                    Turkey  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ---------a-aaa
                        Chimp  ---------a-aaa
                      Gorilla  ---------a-aaa
                    Orangutan  ---------a-aaa
                       Gibbon  ---------a-aaa
                       Rhesus  agggcagtaa-aaa
          Crab-eating macaque  agggcagtaa-aaa
                       Baboon  --------------
                 Green monkey  agaccagtaa-aaa
                     Marmoset  ---------a-aaa
              Squirrel monkey  ---------a-aaa
                     Bushbaby  -----------aaa
           Chinese tree shrew  ---------a-aga
                     Squirrel  -----------aga
                 Prairie vole  ----------taag
              Chinese hamster  ---------gtaag
               Golden hamster  ---------gtaag
                        Mouse  ---------g-aag
                          Rat  ---------g-aag
               Naked mole-rat  ---------a-aga
                   Guinea pig  ---------a-aga
                   Chinchilla  ---------a-aga
             Brush-tailed rat  ---------a-aga
                       Rabbit  ---------gtaag
                          Pig  -------------a
                       Alpaca  -------------a
               Bactrian camel  -------------a
                      Dolphin  -------------a
                 Killer whale  -------------a
             Tibetan antelope  -------------a
                          Cow  -------------a
                        Sheep  -------------a
                Domestic goat  -------------a
                        Horse  ---------a-aga
             White rhinoceros  ---------a-aga
                          Cat  ---------a-aga
                          Dog  ---------a-aga
                      Ferret   ---------a-aga
                        Panda  ------------aa
               Pacific walrus  ---------a-aga
                 Weddell seal  ---------a-aga
             Black flying-fox  ---------g-aga
                      Megabat  ---------g-aga
                Big brown bat  ---------a-gag
         David's myotis (bat)  ---------a-gag
                     Microbat  ---------a-gag
                     Elephant  ---------a-aga
                      Manatee  ---------a-aga
                     Aardvark  ---------a-aga
                    Armadillo  ---------a-aga
              Tasmanian devil  ---------c-aaa
                    Zebrafish  ---------a-att
                       Tenrec  ==============
          Cape elephant shrew  ==============
                         Pika  ==============
       Lesser Egyptian jerboa  ==============
           American alligator  ==============
                      Chicken  ==============
                   Budgerigar  ==============
                  Zebra finch  ==============
             Peregrine falcon  ==============
                 Saker falcon  ==============
                  Rock pigeon  ==============
                       Turkey  ==============
       White-throated sparrow  ==============
              Green seaturtle  ==============
                      Opossum  ==============
     Chinese softshell turtle  ==============
               Painted turtle  ==============
             Cape golden mole  ==============

Inserts between block 30 and 31 in window
B D          Tasmanian devil 33944bp

Alignment block 31 of 213 in window, 125631477 - 125631510, 34 bps 
B D                     Human  aa-ttcaggctgtcc---ctctac--aaca---ggggttc----tca
B D                     Chimp  aa-ttcaggctgtcc---ctctac--aaca---ggggttc----tca
B D                   Gorilla  aa-ttcaggctgtcc---ctctac--aaca---ggggttc----tca
B D                 Orangutan  aa-ttcaggctgtcc---ctctac--aaca---ggggttc----tca
B D                    Gibbon  aa-ttcaggctgtcc---ctctac--aaca----gggttc----tca
B D                    Rhesus  aa-atcaggctgtc------ctac--aaca---ggggttc----tca
B D       Crab-eating macaque  aa-atcaggctgtc------ctac--aaca---ggggttc----tca
B D                    Baboon  -a-atcaggctgtc------ctac--aaca---ggggttc----tca
B D              Green monkey  aa-atcagtctgtcc---ttctac--aaca---ggggttc----tca
B D                  Marmoset  aa-ttcaggctgtcc---ctccaa--aaca---ggggttc----tca
B D           Squirrel monkey  aa-ttcaggctatcc---ctccag--aaca---ggggttc----tca
B D                  Bushbaby  aa-ttcagcacatcc---ctccac--agca---ggggttc----tca
           Chinese tree shrew  gg-ctcaggctgcc----ctccat--ggca---gggtttc----tca
B D                  Squirrel  aa-cccaggctg-----actgacc--agca---gggattt----ggg
                 Prairie vole  ac-cctgggctgcccagaccctcc--agca---cggcttc----tca
B D           Chinese hamster  aa-ctttggctgcccacaccctcc--agca---tggcctt----tca
               Golden hamster  ag-ccttggctg-ccacaccctcc--agca---tggctgc----tca
B D                     Mouse  ag-ccttggctgtccaaattttcc--agca---tggcttc----ttc
B D                       Rat  ag-ccttggctgtccagaccctcc--acca---tggcttc----gtg
B D            Naked mole-rat  aa-ttccagccgtct---ctccac--agca---agtttcc----cta
B D                Guinea pig  aatttgcagctgtct---ctccac--agca---aatttcc----ttg
                   Chinchilla  aa-ttacagctgtct---ctccac--agca---aatcccc----tta
             Brush-tailed rat  ag-tggcagctttct---ctccat--agca---aatttcc----tta
B D                    Rabbit  aa-attcaggagact--gctccac--acta---gggcttc----taa
B D                       Pig  ca-ctcaggctgccc---ctcca-----ca----gggtactttctta
B D                    Alpaca  aa-ttcaggctgtcc---ctccac--aaca----gggttctttcttg
               Bactrian camel  aa-ttcaggctgtcc---ctccac--aaca----gggttctttcttg
B D                   Dolphin  ac-ttcaggctgtcc---ctccac--agca----gggctcttt-cta
                 Killer whale  ac-ttcaggctgtcc---ctccac--agca----gggctcttt-cta
             Tibetan antelope  aa-ttaaggctggag---gggcat--ggca----gggttctttccta
B D                       Cow  aa-ttaaggctagag---gggcac--ggca----gggttctttccta
B D                     Sheep  aa-ttaaggctggag---gggcac--ggca----gggttctttccta
                Domestic goat  aa-ttaaggctggag---gggcac--ggca----gggttctttccta
B D                     Horse  ag-ttcaggctctct---ctccac--agca----gggctc----tcg
B D          White rhinoceros  aa-ttcaggctctct---ctctgc--agca----gagctc----tca
B D                       Cat  ag-ttcaggctgtcc---ctccac--agca----gggttc----cca
B D                       Dog  ag-ttta-gctgtcc---ctccac--agca----gggttc----tca
B D                   Ferret   aa-tttaggctgtcc---caccac--acca----gctttc----tca
B D                     Panda  ag-ttgaggctgtcc---ttccac--agca----gggttc----tgg
               Pacific walrus  ag-tttaagctgtcc---ctccac--agca----ggtttc----tca
                 Weddell seal  ag-tttaggctgtcc---ctccac--agca----ggtttc----tca
             Black flying-fox  aa-ttcacgccggcc---gtcccc--agca----gggttc----tca
B D                   Megabat  aa-ttcacgccggcc---gtccgc--agca----gggttc----tca
                Big brown bat  a---ccaggctg-cc---ctgcac--agcg----gggctc----tca
         David's myotis (bat)  a---ccaggctgccc---ctgcac--agc-----gggttc----tca
B D                  Microbat  a---ccaggctgccc---ctgcac--agc-----gggttc----tcg
B D                  Elephant  aa-tgtaggctgtcc---cctcac--cgaa---gggtttt----tca
B D                   Manatee  aa-tgctggctgt-t---cttcac--tgaa---ggatttt----tca
                     Aardvark  aa-tacacgcggtcc---gttcac--tgaa---gtgtttt----tca
B D                 Armadillo  aa-ttcaagctgtcc---ctctacaatgaa---gtttctt----t--
B D                 Zebrafish  -----------------attttaa--aacattaaatgttt----tca
B D                    Tenrec  ===============================================
         Cape elephant shrew  ===============================================
B D                      Pika  ===============================================
      Lesser Egyptian jerboa  ===============================================
B D        American alligator  ===============================================
B D                   Chicken  ===============================================
B D                Budgerigar  ===============================================
B D               Zebra finch  ===============================================
  D          Peregrine falcon  ===============================================
  D              Saker falcon  ===============================================
  D               Rock pigeon  ===============================================
B D           Tasmanian devil  ===============================================
B D                    Turkey  ===============================================
  D    White-throated sparrow  ===============================================
  D           Green seaturtle  ===============================================
B D                   Opossum  ===============================================
  D  Chinese softshell turtle  ===============================================
  D            Painted turtle  ===============================================
            Cape golden mole  ===============================================

Inserts between block 31 and 32 in window
B D                 Elephant 321bp

Alignment block 32 of 213 in window, 125631511 - 125631515, 5 bps 
B D                     Human  tcctc
B D                     Chimp  ccctc
B D                   Gorilla  ccctc
B D                 Orangutan  ccctc
B D                    Gibbon  cccac
B D                    Rhesus  ccctc
B D       Crab-eating macaque  ccctc
B D                    Baboon  ccctc
B D              Green monkey  ccctc
B D                  Marmoset  ccctc
B D           Squirrel monkey  ccctc
B D                  Bushbaby  acccc
           Chinese tree shrew  acctc
B D                  Squirrel  acctc
                 Prairie vole  ccctc
B D           Chinese hamster  ccctc
               Golden hamster  ccctc
B D                     Mouse  tgctc
B D                       Rat  acctc
B D            Naked mole-rat  acctt
B D                Guinea pig  acctt
                   Chinchilla  acttt
             Brush-tailed rat  accta
B D                    Rabbit  aa-tt
B D                       Pig  gcctc
B D                    Alpaca  acctc
               Bactrian camel  acctc
B D                   Dolphin  acctc
                 Killer whale  acctc
             Tibetan antelope  atctc
B D                       Cow  atctc
B D                     Sheep  atctc
                Domestic goat  atctc
B D                     Horse  acctc
B D          White rhinoceros  acctc
B D                       Cat  ac-tc
B D                       Dog  acctc
B D                   Ferret   gcttc
B D                     Panda  gcctc
               Pacific walrus  gcctc
                 Weddell seal  acctc
             Black flying-fox  ctccg
B D                   Megabat  ctccg
                Big brown bat  gtt--
         David's myotis (bat)  gtt--
B D                  Microbat  gtt--
B D                   Manatee  accag
                     Aardvark  tcctg
B D                 Armadillo  acaaa
B D                 Zebrafish  ttttc
B D                    Tenrec  =====
         Cape elephant shrew  =====
B D                      Pika  =====
      Lesser Egyptian jerboa  =====
B D                  Elephant  =====
B D        American alligator  =====
B D                   Chicken  =====
B D                Budgerigar  =====
B D               Zebra finch  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
  D               Rock pigeon  =====
B D           Tasmanian devil  =====
B D                    Turkey  =====
  D    White-throated sparrow  =====
  D           Green seaturtle  =====
B D                   Opossum  =====
  D  Chinese softshell turtle  =====
  D            Painted turtle  =====
            Cape golden mole  =====

Alignment block 33 of 213 in window, 125631516 - 125631613, 98 bps 
B D                     Human  agcagcaatgaca-tttgggattaga-gagt--------cttcgttgtgtgtggacgggagtt-------
B D                     Chimp  agcagcatggaca-tttgggattaga-gagt--------cttcgttgtgtgtggacgggagtt-------
B D                   Gorilla  agcagcactgaca-tttgggattaga-gagt--------cttcgttgtgtgtggacgggagtt-------
B D                 Orangutan  agcagcactgaca-tttgggatcaga-gagt--------cttcgttgtgtgtggacgggagtt-------
B D                    Gibbon  agcagcactgaca-tttgggatcatctgagt--------cttcgttgtgtgtggacgggagtt-------
B D                    Rhesus  agcagcactgaca-ttttggatcata-gagt--------ctttgatgtgtgtgggcgggagtt-------
B D       Crab-eating macaque  agcagcactgaca-ttttgtatcata-gagt--------ctttgatgtgtgtgggcgggagtt-------
B D                    Baboon  agcagcactgaca-ttttggatcata-cagt--------ctttgatgtgtgtgtgcgggagtt-------
B D              Green monkey  agcagcactgaca-ttttggatcata-gagt--------ctttgatgtgtgtgggcgggagtt-------
B D                  Marmoset  agcagcattgact-tttgagatcaga-gagt--------ct--gtt------------aagtt-------
B D           Squirrel monkey  agcagcatcgaca-tttgggatcaga-gagt--------cttcgttgtgcatggacaggagtt-------
B D                  Bushbaby  agcagggtggaca-attgacttaggt-agtt--------ctttgt-------------------------
           Chinese tree shrew  agcaggactgaaa-ttttgattcata-tggt--------cttttt----------------ct-------
B D                  Squirrel  cacagtcctgcag-tttcagaccagg-taat------------------------------tt-------
                 Prairie vole  agcaaaaccaatc-tcttgcatgaac-tcag------------------------------tt-------
B D           Chinese hamster  agcaagatggatt-tcttgcatgaat-tcaa------------------------------tt-------
               Golden hamster  agcaagatctatt-tcttgcatgaat-tcag------------------------------tt-------
B D                     Mouse  agcaagactgact-tcttgcacaaag-gcag------------------------------tt-------
B D                       Rat  agcaagactgact-tcttgcatgaag-tcag------------------------------tc-------
B D            Naked mole-rat  agcaggactgacc-ttttgggtcaga-cagt---------tt-------------------tt-------
B D                Guinea pig  agcaggaatgacc-ttttagattaga-cagt--------att-------------------tt-------
                   Chinchilla  agcaggactgagc-ttttggatcaga-tggt--------att-------------------tt-------
             Brush-tailed rat  agtaggactaact-ctttggatgaga-tagt--------att-------------------tt-------
B D                    Rabbit  agcagtattgaca-ttttggattgca-gacttattttttttt-------------------tt-------
B D                       Pig  ggcagggtcaaca-ttttggatcaga-tatg--------tc--------------------tt-------
B D                    Alpaca  agcaggatcgacatttttggatcaga-tagt--------tc--------------------tt-------
               Bactrian camel  agcaggatcaacatttttggatcaga-tagt--------tc--------------------tt-------
B D                   Dolphin  agcaggatcaaca-ttttggatcaga-tagt--------tc--------------------tt-------
                 Killer whale  agcaggatcaaca-ttttggatcaga-tagt--------tc--------------------tt-------
             Tibetan antelope  agcaggatcagtg-ttttggatcaga-tagt--------tc--------------------tt-------
B D                       Cow  agcaggatcagca-ttttggatcaga-tagt--------tc--------------------tt-------
B D                     Sheep  agcaggatcagtg-ttttggatcaga-tagt--------tc--------------------tt-------
                Domestic goat  agcaggatcagtg-ttttggatcaga-tagt--------tc--------------------tt-------
B D                     Horse  agcatgattgaca-ttttggatcaga-gagt--------cc--------------------tt-------
B D          White rhinoceros  agcatgagtgaca-ttttggatcaga-tagt--------tc--------------------ct-------
B D                       Cat  agcaggactgaca-ttttggatcaga-tggt--------cc--------------------tt-------
B D                       Dog  agcaggattgaca-ttttggatcaga-tagt--------tc--------------------tt-------
B D                   Ferret   cgcaggactgaca-ttttggatcag---agt--------tc--------------------tt-------
B D                     Panda  ggcaggactgaca-ttgtggatgagg-taa----------------------------------------
               Pacific walrus  tgcgggattgaca-ttttggatcaga-tagt--------tc--------------------tt-------
                 Weddell seal  tgcaggattgaca-ttttggatcaga-tagt--------tc--------------------tt-------
             Black flying-fox  agcaggactgacg-tttgggatcaga-gaac--------cc--------------------tt-------
B D                   Megabat  agcagggctgacg-tttgggatcaga-gaac--------cc--------------------tt-------
                Big brown bat  agcagggctgaca-tattggaccaga-cagt--------cc--------------------tg-------
         David's myotis (bat)  agcaggactgaca-tattggatcaga-cagt--------cc--------------------tg-------
B D                  Microbat  agcaggactgaca-tattggatcaga-cagt--------cc--------------------tg-------
B D                   Manatee  cacacgattgaca-ttttgggccaga-attt--------ttttttttt-------------tt-------
                     Aardvark  cacacaattgacc-atttgatccata-cttt--------tcttttttc-------------ttctttttt
B D                 Armadillo  ggcacaattgaca-ttctcagtcaga-taat--------tcttttcat-------------tt-tttggc
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                      Pika  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                  Elephant  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
B D               Zebra finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                    Turkey  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
            Cape golden mole  ======================================================================

                        Human  ----------------gggagg-cag-gg-----------------------------------------
                        Chimp  ----------------gggagg-cag-gg-----------------------------------------
                      Gorilla  ----------------gggagg-cag-gg-----------------------------------------
                    Orangutan  ----------------gggagg-cag-gg-----------------------------------------
                       Gibbon  ----------------gggagg-cag-gg-----------------------------------------
                       Rhesus  ----------------gggagg-cag-gg-----------------------------------------
          Crab-eating macaque  ----------------gggagg-cag-gg-----------------------------------------
                       Baboon  ----------------gggagg-cag-gg-----------------------------------------
                 Green monkey  ----------------gggagg-tag-gg-----------------------------------------
                     Marmoset  ----------------gggaga-cag-gg-----------------------------------------
              Squirrel monkey  ----------------gggaga-cag-gg-----------------------------------------
                     Bushbaby  -----------------ggggt-ctg-gg-----------------------------------------
           Chinese tree shrew  ----------------ggaggg-taa-gg-----------------------------------------
                     Squirrel  ----------------tgcggg-gga-tg-----------------------------------------
                 Prairie vole  ----------------ggttag-gag-gg-----------------------------------------
              Chinese hamster  ----------------tgttag-aaa-gg-----------------------------------------
               Golden hamster  ----------------tgttag-aaa-gg-----------------------------------------
                        Mouse  ----------------tgtaag-aaaggg-----------------------------------------
                          Rat  ----------------tgtaag-gagggg-----------------------------------------
               Naked mole-rat  ----------------tgtggt-gga-gg-----------------------------------------
                   Guinea pig  ----------------tgttgt-gta-gg-----------------------------------------
                   Chinchilla  ----------------tgttgt-gaa-gg-----------------------------------------
             Brush-tailed rat  ----------------tgtggt-gga-ag-----------------------------------------
                       Rabbit  ----------------tttttt-gaa-ggtggagag----------------------------------
                          Pig  ----------------tgctgt-gggaga-----------------------------------------
                       Alpaca  ----------------tgttgt-ggg-ga-----------------------------------------
               Bactrian camel  ----------------tgttgt-ggg-ga-----------------------------------------
                      Dolphin  ----------------tggtgt-acg-gg----gannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
                 Killer whale  ----------------tggtgt-agg-gg-----------------------------------------
             Tibetan antelope  ----------------tgttgt-ggg-ga-----------------------------------------
                          Cow  ----------------tgttgt-ggg-ga-----------------------------------------
                        Sheep  ----------------tgttgt-ggg-ga-----------------------------------------
                Domestic goat  ----------------tgttgt-ggg-ga-----------------------------------------
                        Horse  ----------------tgttgtgggg-ga-----------------------------------------
             White rhinoceros  ----------------tgttgtgggt-ga-----------------------------------------
                          Cat  ----------------tattgtggaa-ga-----------------------------------------
                          Dog  ----------------tgttgtagag-ga-----------------------------------------
                      Ferret   ----------------tgttgg-gag-ga-----------------------------------------
                        Panda  -----------------gttgt-gag-aa-----------------------------------------
               Pacific walrus  ----------------tgttgtggag-ga-----------------------------------------
                 Weddell seal  ----------------tgttgtggag-ga-----------------------------------------
             Black flying-fox  ----------------tgctgtgggg-gc-----------------------------------------
                      Megabat  ----------------tgttgtgggg-gc-----------------------------------------
                Big brown bat  ----------------tgttctgggg-ca-----------------------------------------
         David's myotis (bat)  ----------------tgttccgggg-ca-----------------------------------------
                     Microbat  ----------------tgttctgggg-ca-----------------------------------------
                      Manatee  ----------------tggggg-gga-ca-----------------------------------------
                     Aardvark  ttaaaatttgttgttgttttgt-gga-tt-----------------------------------------
                    Armadillo  agggagaatggggcaggaggaa-gta-gg-----------------------------------------
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                         Pika  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Elephant  ======================================================================
           American alligator  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
                  Zebra finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
              Tasmanian devil  ======================================================================
                       Turkey  ======================================================================
       White-throated sparrow  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
             Cape golden mole  ======================================================================

                        Human  ----------------t---ttg-----tcccatgcattgt-------ttaga-----------agcatc
                        Chimp  ----------------t---ttg-----tcccatgcattgt-------ttaga-----------agcatc
                      Gorilla  ----------------t---ttg-----tcctatgcattgt-------ttaga-----------agcatc
                    Orangutan  ----------------t---ttg-----tcccatgcattgt-------ttaga-----------agcatc
                       Gibbon  ----------------t---ttg-----tcccatgcgttgt-------ttaga-----------agcatc
                       Rhesus  ----------------t---ttg-----tcccatgcattgt-------ttaga-----------agcatc
          Crab-eating macaque  ----------------t---ttg-----tcccatgcattgt-------ttaga-----------agcatc
                       Baboon  ----------------t---ttg-----ccccatgcattgt-------ttaga-----------agcatc
                 Green monkey  ----------------t---ttg-----tcccatgcattgt-------ttaga-----------agcatc
                     Marmoset  ----------------t---ttg-----tcccatgcactgt-------ttggc-----------agcacc
              Squirrel monkey  ----------------t---ttg-----tcccatgcactgt-------ttggc-----------agcacc
                     Bushbaby  ----------------a---ctg-----tcctgtacattgt-------ttacc-----------agcatc
           Chinese tree shrew  ----------------agagtta-----tcccatgcactgg-------ttagc-----------agccta
                     Squirrel  -----------------------------------aaggct-------gcacccattgtgtctgaaggtc
                 Prairie vole  -----------------------------------catggc-------acagc-----------gctatc
              Chinese hamster  -----------------------------------catggc-------acaga-----------agtatc
               Golden hamster  -----------------------------------catggc-------gcagc-----------agtacc
                        Mouse  -----------------------------------tgtggc-------acatc-----------agactc
                          Rat  -----------------------------------catggc-------acagt-----------agaatc
               Naked mole-rat  ----------------g---ctg-----tcccatgcattgt-------taagc-----------agcatc
                   Guinea pig  ----------------g---ttt-----tctcat-cactat-------taagc-----------agcatc
                   Chinchilla  ----------------g---ctg-----tcccaggcatccc-------gatgc-----------agcatc
             Brush-tailed rat  ----------------g---cag-----tcccatgcatcct-------taagc-----------agcatc
                       Rabbit  ----------------g---ttg-----tctcacctgtcgt-------tgaac-----------aatacc
                          Pig  ----------------a---ctg-----ccctgtgcattgt-------ttaac-----------agcatc
                       Alpaca  ----------------g---ctg-----tcccctgcactgt-------ttaac-----------agcatc
               Bactrian camel  ----------------g---ctg-----tcccctgcattgt-------ttaac-----------agcatc
                      Dolphin  nnnnnnnnnnnnnnntg---ggg-----------------------------------------------
                 Killer whale  ----------------g---gagctg--tcccgagcattgt-------ttaac-----------agcatc
             Tibetan antelope  ----------------a---gtg-----gtcccagcattgt-------ttcac-----------agcatc
                          Cow  ----------------a---gtg-----gtcccagcattgt-------ttaac-----------agcatc
                        Sheep  ----------------a---gtg-----gtcccagcattgt-------ttaac-----------atcatc
                Domestic goat  ----------------a---gtg-----gtcccagcattgt-------ttaac-----------agcatc
                        Horse  ----------------g---ctg-----tcccgtgcattgt-------ttatc-----------agcatt
             White rhinoceros  ----------------g---ctg-----tcccgtgcattgt-------ttaac-----------agcatt
                          Cat  ----------------g---ctg-----ttccgtgcattgt-------ttacc-----------agtatc
                          Dog  ----------------g---ctg-----ttctgtgcattgt-------ttaac-----------agtatc
                      Ferret   ----------------g---cag-----atctgtgcattgt-------ttaac-----------agtgtc
                        Panda  ----------------g---ctg-----ttctgtgcagtgt-------ttaac-----------agtatc
               Pacific walrus  ----------------g---ctg-----ttctgtgcattgt-------ttaat-----------agtatc
                 Weddell seal  ----------------g---ctg-----ttctgtgcattat-------ttaat-----------agtatc
             Black flying-fox  ----------------g---cttccacaccccacgcaccgt-------gcaac-----------agcatc
                      Megabat  ----------------g---cttccacaccccacgcaccgt-------gcaac-----------agcatc
                Big brown bat  ----------------g---ctt-----tcccgagcattgt-------g--ac-----------agcacc
         David's myotis (bat)  ----------------g---ctt-----tcccgagcattgt-------g--ac-----------agcacc
                     Microbat  ----------------g---ctt-----tcccgagcattgt-------g--ac-----------agcacc
                      Manatee  ----------------g---ctg-----ttctgtgcattgtaggacatttagc-----------agtatc
                     Aardvark  ----------------a---cta-----tcatgtgcattgt-----gtttggt-----------tgtatc
                    Armadillo  ----------------a---atg-----ttctgtacattgt-------ttagc-----------agtatc
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                         Pika  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                     Elephant  ======================================================================
           American alligator  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
                  Zebra finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
              Tasmanian devil  ======================================================================
                       Turkey  ======================================================================
       White-throated sparrow  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
             Cape golden mole  ======================================================================

                        Human  cctggc
                        Chimp  cctggc
                      Gorilla  cctggc
                    Orangutan  cctggc
                       Gibbon  cctggc
                       Rhesus  cctggc
          Crab-eating macaque  cctggc
                       Baboon  cctggc
                 Green monkey  cctggc
                     Marmoset  cctggc
              Squirrel monkey  cctggc
                     Bushbaby  acaggt
           Chinese tree shrew  actgg-
                     Squirrel  actggc
                 Prairie vole  tctagc
              Chinese hamster  cctctc
               Golden hamster  cttctc
                        Mouse  tctggc
                          Rat  tctggc
               Naked mole-rat  tctggt
                   Guinea pig  actgtc
                   Chinchilla  actggt
             Brush-tailed rat  actggc
                       Rabbit  act---
                          Pig  accagt
                       Alpaca  ------
               Bactrian camel  ------
                      Dolphin  --gggt
                 Killer whale  ccgggt
             Tibetan antelope  attggt
                          Cow  attggt
                        Sheep  actggt
                Domestic goat  actggt
                        Horse  gctggc
             White rhinoceros  gctggc
                          Cat  actggc
                          Dog  actggc
                      Ferret   actggc
                        Panda  actggc
               Pacific walrus  actggc
                 Weddell seal  actggt
             Black flying-fox  cctggc
                      Megabat  cctggc
                Big brown bat  actggc
         David's myotis (bat)  accggc
                     Microbat  accggc
                      Manatee  cttggc
                     Aardvark  cttgc-
                    Armadillo  cctg--
                       Tenrec  ======
          Cape elephant shrew  ======
                         Pika  ======
       Lesser Egyptian jerboa  ======
                     Elephant  ======
           American alligator  ======
                      Chicken  ======
                   Budgerigar  ======
                  Zebra finch  ======
             Peregrine falcon  ======
                 Saker falcon  ======
                  Rock pigeon  ======
              Tasmanian devil  ======
                       Turkey  ======
       White-throated sparrow  ======
              Green seaturtle  ======
                      Opossum  ======
     Chinese softshell turtle  ======
               Painted turtle  ======
             Cape golden mole  ======

Inserts between block 33 and 34 in window
B D                  Manatee 236bp

Alignment block 34 of 213 in window, 125631614 - 125631649, 36 bps 
B D                     Human  ctctaccc---------------------gctagat---gccagtagtac-----tt--gccaag--tg
B D                     Chimp  ctctaccc---------------------gctagat---gccagtagtac-----tt--gccaag--tg
B D                   Gorilla  ctctaccc---------------------gctagat---gccagtagtac-----tt--gccaag--tg
B D                 Orangutan  ctctaccc---------------------gctagat---gccagtagtac-----tt--gccaag--tg
B D                    Gibbon  ctctaccc---------------------gctagat---gccagtagtac-----tt--gccaag--tg
B D                    Rhesus  ctctacct---------------------gctagat---gccaggagtac-----tt--gccaag--tg
B D       Crab-eating macaque  ctctacct---------------------gctagat---gccaggagtac-----tt--gccaag--tg
B D                    Baboon  ctctacct---------------------gctaaat---gccaggagtac-----tt--gccaag--tg
B D              Green monkey  ctctacct---------------------gctagat---gccaggaatac-----tt--gccaag--tg
B D                  Marmoset  ctctagcc---------------------gctacat---gccagcagtac-----tt--gccaag--tg
B D           Squirrel monkey  ctctagcc---------------------gctacat---gccagcagtac-----tt--gccaaa--tg
B D                  Bushbaby  ctctacca---------------------actggat---gccagcagttc-----tt--gtcaag----
           Chinese tree shrew  ctctactc---------------------ccaagat---gtccattgctc-----cc--tcaaaa--cc
B D                  Squirrel  tcctaccg---------------------gctagat---gccaggaga-a-----ct--cacaaa----
                 Prairie vole  ttccacct---------------------gccagatgacgctaggag--a-----ac--catggc--tc
B D           Chinese hamster  ttccacct---------------------accagaa---actagggg--a-----ac--catggg--tc
               Golden hamster  ttccacct---------------------actggat---actaggag--a-----ac--cacggg--tc
B D                     Mouse  ttccacca---------------------accagac-------------------ct--cacaga--ta
B D                       Rat  ttccacca---------------------accagac-------------------ct--cacagg--tc
B D            Naked mole-rat  ttctaccc---------------------aatagat---cccagtagacc-----tt--gccaag--tt
B D                Guinea pig  ttctaccc---------------------accagat---gccagtagacc-----tc--tccaag--tt
                   Chinchilla  ttctaccc---------------------actagat---gccagtagacc-----tc--gccaag----
             Brush-tailed rat  ttctaccc---------------------actagat---gccagtaaacc-----tc--gctaag--cg
B D                    Rabbit  ---------------------------------gaa---------------------------------
B D                       Pig  ctctaccc---------------------acttgat---gccattagtac-----cc--gacaca---g
B D                    Alpaca  ----gccc---------------------actagat---gccagcagtac-----cc--accacg--tt
               Bactrian camel  ----gccc---------------------actagat---gccagcagtac-----cc--accacg--tt
B D                   Dolphin  ttt--------------------------tgggggc---ggca-t------------------------
                 Killer whale  cttcaccagggatggatggagactagggatggagat---gcca-taggac-----cc--gccatg--tt
             Tibetan antelope  cttgaccc---------------------accagat---gccagtagcac-----cc--gccatg--tt
B D                       Cow  cttgaccc---------------------accagat---gccagtagtac-----cc--accagg--tg
B D                     Sheep  cttgaccc---------------------acaagat---gccagtagcac-----cc--gccatg--tt
                Domestic goat  cttgaccc---------------------accagat---gccagtagcac-----cc--gccatg--tt
B D                     Horse  ctctaccc---------------------acgagat---gccagtagtac------t--gccaag--tt
B D          White rhinoceros  ctccaccc---------------------actggat---gctggtagtacggccaag--gccaag--tt
B D                       Cat  ctctaccc---------------------actagat---gccagcagtac-----cc--accaaa--tt
B D                       Dog  ctctaccc---------------------actagat---gccagtagtac-----cc--accaaa--tt
B D                   Ferret   ctctaccc---------------------actagat---gccagtagttc-----cc--accaga--tt
B D                     Panda  ctctaccc---------------------actagat---gccagtagtac-----cc--accaaa--ct
               Pacific walrus  ctctaccc---------------------actagac---gccggtagtac-----cc--accaaa--ct
                 Weddell seal  ctctaccc---------------------actagat---gccagtcgtac-----cc--acaaaa--ct
             Black flying-fox  ctctgccc---------------------accgatg---gcagt-agtgc-----ct--gcca-g--ct
B D                   Megabat  ctccgccc---------------------accgatg---gcagt-agtgt-----ct--gcca-g--ct
                Big brown bat  ctcccccg---------------------acgaggt---gcccg-aagac-----ct--gccaca--tt
         David's myotis (bat)  ctcccccg---------------------actaggt---tcccg-aagac-----ct--gccatg--tt
B D                  Microbat  ctcccccg---------------------acgaggt---gcccg-aagac-----ct--gccacg--tt
B D                   Manatee  ctctaccc---------------------actcgat---gccagtagcac-----ccatctccca----
                     Aardvark  ctctactc---------------------actcgat---gccagtagcat-----tc--ccacct----
B D                 Armadillo  -------------------------------------------gtagaac-----ac--tcccaatt--
B D                    Tenrec  =====================================================================
         Cape elephant shrew  =====================================================================
B D                      Pika  =====================================================================
      Lesser Egyptian jerboa  =====================================================================
B D                  Elephant  =====================================================================
B D        American alligator  =====================================================================
B D                   Chicken  =====================================================================
B D                Budgerigar  =====================================================================
B D               Zebra finch  =====================================================================
  D          Peregrine falcon  =====================================================================
  D              Saker falcon  =====================================================================
  D               Rock pigeon  =====================================================================
B D           Tasmanian devil  =====================================================================
B D                    Turkey  =====================================================================
  D    White-throated sparrow  =====================================================================
  D           Green seaturtle  =====================================================================
B D                   Opossum  =====================================================================
  D  Chinese softshell turtle  =====================================================================
  D            Painted turtle  =====================================================================
            Cape golden mole  =====================================================================

Inserts between block 34 and 35 in window
B D                  Manatee 5bp
                    Aardvark 6bp

Alignment block 35 of 213 in window, 125631650 - 125631698, 49 bps 
B D                     Human  atgacaaccaaaaatgtttcc-------agacctta-ccagatatcctcttgagaca
B D                     Chimp  atgacaaccaaaaatgtttcc-------agacctta-ccagatatcttctcgagaca
B D                   Gorilla  atgacaaccaaaaatgtttcc-------agacctta-ccagatatcctctcgagaca
B D                 Orangutan  ataacaaccaaaaatgtttcc-------agacctta-ccagatatcctctcgagaca
B D                    Gibbon  atgacaaccaaaaatgtttcc-------agacctta-ccagatatcctctcgagaca
B D                    Rhesus  atgacaaccaaaaatgttttc-------agacctta-ccaaatatcctctcaagaca
B D       Crab-eating macaque  atgacaaccaaaaatgttttc-------agacctta-ccaaatatcctctcaagaca
B D                    Baboon  atgacaacaaaaaatgttttc-------agacctta-ccaaatatcctctcgagaca
B D              Green monkey  atgacaaccaaaaatgttttc-------agacctta-ccaaatatcctctcgagaca
B D                  Marmoset  atgacaaccaaaaatgtttcc-------agacctta-ccaggtatcctctagagaca
B D           Squirrel monkey  atgacaaccaaaaatgtttcc-------agacctta-ccagataccctctagagaca
B D                  Bushbaby  -----aagtaaaaatgtcttc-------atacctta-ccaggtatccc-------ga
           Chinese tree shrew  attacaaccaaaaatgtttcc-------a-agttta-ctggatgttccctagggaca
B D                  Squirrel  --gctaac-----atgtctcc-------agaccttacc---aggtgcccccagggac
                 Prairie vole  atgataacggatgata-------------------a-t---gaacactccaaagatc
B D           Chinese hamster  aggagaactgatgatgtcatc-------aggtctta-t---ggacattccaaagacc
               Golden hamster  atgataactgatgatgtcatc-------aggtctta-t---ggacattccaaagacc
B D                     Mouse  ctgataatagatgatgcctct-------agattgta-c---agatacctccaagagc
B D                       Rat  ctgacaacagaggatgcctct-------agattgta-c---agttacctccaagggc
B D            Naked mole-rat  gttctaagta--caagtgtct-------agacctta-ccagatatgccctggggact
B D                Guinea pig  cttctaagca--gaggtctct-------agatctta-cctgacatgtcctggggacc
                   Chinchilla  -ttctaaccg--gcagtctct-------agatctta-ccagatttgccctggggacc
             Brush-tailed rat  cctctaacca--gaagtcttt-------agaactta-cc--atttgctctggggcct
B D                    Rabbit  -----aaccaaaaatgtcccc-------agacctta-tcatatctcttgtagggaca
B D                       Pig  gagacaatcaaaaatgtctcc-------agaccttg-tcagatgtcccacggggata
B D                    Alpaca  gtggcaaccaaaaatgtctcc-------agacattg-tcagaagtcccttggggata
               Bactrian camel  gtggcaaccaaaaatgtctcc-------agacattg-tcagaagtcccttggggaaa
B D                   Dolphin  -cgatggtcagtagt------------------tca-tca--------ttga-----
                 Killer whale  gtgacaaccaaaaatgtcttc-------agacatcg-tcagatgtcccttga-----
             Tibetan antelope  gtga---ccaaaaacgcctcc-------agacactg-ccagatgtcccttggggata
B D                       Cow  gtga---ccaaaaacgtctca-------agacactg-ccagatgtccctcagggata
B D                     Sheep  gtga---ccaaaaacgcctcc-------agacactg-ccagatgtcccttggggata
                Domestic goat  gtga---ccaaaaacgcctcc-------agacactg-ccagatgtcccttggggata
B D                     Horse  gtgacaaacaaaaatgtctcg-------agacagtg-ccagatgtcccctggggata
B D          White rhinoceros  gtgacaaacaaaaatgtctcc-------agacagtg-ccagatggcccctggggata
B D                       Cat  gggacaacccaaaatgtgttc-------agacattg-ccagatatcccctggggaga
B D                       Dog  gtgacaaccagaaatgtcttc-------agacattg-ccagatatcccctggggata
B D                   Ferret   gtgacaaccaaatatgtgttctcacattggatgttg-ccagatgttccctggggata
B D                     Panda  gtgacaaccaaaaatgtcttc---agtcgga----g-acagacgt-ccctggggata
               Pacific walrus  gtgacaaccaaacatgtcttctgacgtcggacgtgg-ccagatgtcccctggagata
                 Weddell seal  gtgacaaccaaacatgtcttctgatgttggacattg-ccagatatcccctggggata
             Black flying-fox  gtggccaccggaaatctctcc-------agactttg-ccaaatggcccc--gggata
B D                   Megabat  gtggccaccggaaatctctcc-------agactttg-ccaaatggcccc--gggata
                Big brown bat  gtgacaactgtgaatgtctcc-------agacactg-ccaggtgccccctagggata
         David's myotis (bat)  gtgacaactgtaaatgtctcc-------agacactg-ccaggtgtcccctggggata
B D                  Microbat  gtgacaactgtaaatgtctcc-------agacactg-ccaggtgtcccctggggata
B D                  Elephant  gtaacaactcagactgtcttc-------aggcgttg-ctgaatgccctctgcagaca
B D                   Manatee  gtaacaacccaaactgtctcc-------agatgttc-ctgagtgccccctgcaggca
                     Aardvark  -taacaacccaaactgtctcc-------agacattt-ctgaatgccccctgcaggca
B D                 Armadillo  gtgacaaccacaaatgtctct-------agacattg-ctaagtgtcccctgggggca
B D                    Tenrec  =========================================================
         Cape elephant shrew  =========================================================
B D                      Pika  =========================================================
      Lesser Egyptian jerboa  =========================================================
B D        American alligator  =========================================================
B D                   Chicken  =========================================================
B D                Budgerigar  =========================================================
B D               Zebra finch  =========================================================
  D          Peregrine falcon  =========================================================
  D              Saker falcon  =========================================================
  D               Rock pigeon  =========================================================
B D           Tasmanian devil  =========================================================
B D                    Turkey  =========================================================
  D    White-throated sparrow  =========================================================
  D           Green seaturtle  =========================================================
B D                   Opossum  =========================================================
  D  Chinese softshell turtle  =========================================================
  D            Painted turtle  =========================================================
            Cape golden mole  =========================================================

Inserts between block 35 and 36 in window
B D                 Squirrel 1bp
B D                    Mouse 1bp
B D                      Rat 127bp
                Killer whale 1bp

Alignment block 36 of 213 in window, 125631699 - 125631712, 14 bps 
B D                     Human  aatcaccc-cattga
B D                     Chimp  aatcaccc-cattga
B D                   Gorilla  aatcaccc-cactga
B D                 Orangutan  aatcaccc-cattga
B D                    Gibbon  aatcaccg-cattga
B D                    Rhesus  aatcaccc-cattga
B D       Crab-eating macaque  aatcaccc-cattga
B D                    Baboon  aatcactc-cattga
B D              Green monkey  aatcacct-cattga
B D                  Marmoset  aatcaccc-cagtga
B D           Squirrel monkey  aatcaccc-cattga
B D                  Bushbaby  agtcacct-catgga
           Chinese tree shrew  a-ccatcc-catggc
B D                  Squirrel  aatcacc--ca----
                 Prairie vole  ---caccattc----
B D           Chinese hamster  ---cacca-cc----
               Golden hamster  ---cacca-ac----
B D                     Mouse  ----acca-cc----
B D            Naked mole-rat  aatcacac-ta----
B D                Guinea pig  agtcacac-ca----
                   Chinchilla  agtcacac-ca----
             Brush-tailed rat  agtcacac-ca----
B D                    Rabbit  aaccaccc-ca----
B D                     Horse  aaccaccc-ca----
B D          White rhinoceros  aaccaccc-ca----
B D                       Cat  aatcaccc-ca----
B D                       Dog  aatcaccc-ca----
B D                   Ferret   agtcaccc-ca----
B D                     Panda  aatcaccc-ca----
               Pacific walrus  aatcaccc-ca----
                 Weddell seal  aatcaccc-ca----
             Black flying-fox  agtcatcc-ca----
B D                   Megabat  agtcaccc-ca----
                Big brown bat  agtcaccc-ca----
         David's myotis (bat)  agtcaccc-ca----
B D                  Microbat  agtccccc-ca----
B D                  Elephant  aattatcc-tg----
B D                   Manatee  aatgatgc-tg----
                     Aardvark  aattttcc-tg----
B D                 Armadillo  aattgtca-ca----
B D                    Tenrec  ===============
         Cape elephant shrew  ===============
B D                     Sheep  ---------------
               Domestic goat  ---------------
B D                       Rat  ===============
              Bactrian camel  ---------------
B D                    Alpaca  ---------------
B D                      Pika  ===============
      Lesser Egyptian jerboa  ===============
B D                       Cow  ---------------
                Killer whale  ===============
            Tibetan antelope  ---------------
B D        American alligator  ===============
B D                   Chicken  ===============
B D                Budgerigar  ===============
B D               Zebra finch  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
  D               Rock pigeon  ===============
B D           Tasmanian devil  ===============
B D                    Turkey  ===============
  D    White-throated sparrow  ===============
  D           Green seaturtle  ===============
B D                   Opossum  ===============
B D                       Pig  ---------------
  D  Chinese softshell turtle  ===============
  D            Painted turtle  ===============
B D                   Dolphin  ---------------
            Cape golden mole  ===============

Alignment block 37 of 213 in window, 125631713 - 125631775, 63 bps 
B D                     Human  tatttgct-gagaact-gt-g--------------------------ttccagtgcc-tta-aa----ga
B D                     Chimp  tatttgct-gagaact-gt-g--------------------------ttccagtgcc-tta-aa----ga
B D                   Gorilla  tatttgct-gagaact-gt-g--------------------------ttccagtgcc-tta-aa----ga
B D                 Orangutan  tatttgct-gagaact-gt-g--------------------------ttccagcgcc-tta-aa----ga
B D                    Gibbon  tacttgct-gagaact-gt-g--------------------------ttccagcgcc-tta-aa----ga
B D                    Rhesus  tatttgtt-gagaact-gt-g--------------------------ttccagctcc-tta-at----ga
B D       Crab-eating macaque  tatttgtt-gagaact-gt-g--------------------------ttccagctcc-tta-at----ga
B D                    Baboon  tatttgtt-gagaact-gt-c--------------------------ttccagctcc-tta-aa----ga
B D              Green monkey  tatttgtt-gagaact-gt-g--------------------------ttccagctcc-tta-aa----ga
B D                  Marmoset  tatttgtt-gagaact-gt-g--------------------------ttccagtgcc-tta-aa----ga
B D           Squirrel monkey  tatttgtt-gagaact-gt-g--------------------------ttccagtgtc-tta-aa----ga
B D                  Bushbaby  gatttgtt-gagatcc-ct-g--------------------------ctccagagcc-tgg-aa----aa
           Chinese tree shrew  gatctgct-gagaact-gt----------------------------ctccacagtc-tca-aa----ga
B D                  Squirrel  ------ct-cagaatc-ag-g--------------------------atccagagcc-tgc-ta----cc
                 Prairie vole  ------ct-gaggacc-ag-----------------------------tccaaagcc-tga-tt----gt
B D           Chinese hamster  ------ct-gaggacc-ag-g---------------------------tccaaagcc-caa-tcaatagt
               Golden hamster  ------ct-gaggacc-ag-a---------------------------tccgaagcc-caa-tcaatagt
B D                     Mouse  ------ctggaggact-gg-g---------------------------tccaaagcc-caa-ta----gt
B D            Naked mole-rat  ------tt-gagaccc-at-g--------------------------gtgccaagcc-tga-aa----ga
B D                Guinea pig  ------ct-gagagcc-at-g--------------------------atccagagcc-ttc-aa----ga
                   Chinchilla  ------ct-gagaccc-aa-g--------------------------aaccagggcc-tga-aa----ga
             Brush-tailed rat  ------gt-gagaccc-at-g--------------------------atccagagcc-tga-ta----aa
B D                    Rabbit  ------tt-aaggttt-at-tgcctggagctatggtgaagctggttaagccactgcc-tga-agcaatgg
B D                       Pig  ---------gtgaacc-attg--------------------------ttccagagcc-tta-aa----ga
B D                    Alpaca  ---------cagaacgttttg--------------------------ttccagagcc-tta-aa----gg
               Bactrian camel  ---------cagaactttttg--------------------------ttccagagcc-tta-aa----gg
                 Killer whale  ----cata-gagaaca-atag--------------------------ttccagagcc-tta-aa----ga
             Tibetan antelope  ---------gagaaca-atga--------------------------ttccagagcc-ttaaaa----ga
B D                       Cow  ---------gagaaca-atga--------------------------ttccagagcc-ttacaa----ga
B D                     Sheep  ---------gagaaca-atga--------------------------ttccagagcc-ttaaaa----ga
                Domestic goat  ---------gagaaca-atga--------------------------ttccagagcc-ttaaaa----ga
B D                     Horse  -----act-gagaacc-attg--------------------------atccatagccttta-aa----ga
B D          White rhinoceros  -----gtt-gagaacc-attg--------------------------ctctgaatc--tta-aa----ga
B D                       Cat  -----gtt-gagaact-tttg--------------------------ctccagagcc-tta-aa----ga
B D                       Dog  -----gtt-gagaatc-atcg--------------------------ctccagagcc-tta-aa----ga
B D                   Ferret   -----gct-gagaatc-attg--------------------------ctccagagcc-tta-aa----ga
B D                     Panda  -----gtt-gagagtc-tttg--------------------------ctccagagcc-tta-aa----ga
               Pacific walrus  -----gtt-gagaatc-attg--------------------------ctccagagcc-tta-aa----ga
                 Weddell seal  -----gtt-gagaatc-actg--------------------------ctccagagcc-tta-aa----g-
             Black flying-fox  -----ggt-gagggcc-attg--------------------------at-tggagcc-tca-ga----ga
B D                   Megabat  -----ggt-gagggcc-attg--------------------------at-tggagcc-tca-ga----ga
                Big brown bat  -----gtg-caggacc-at----------------------------------gtct-cca-ga----gc
         David's myotis (bat)  -----gtg-caggacc-at----------------------------------gtct-cca-ga----gc
B D                  Microbat  -----gtg-caggacc-at----------------------------------gtct-cca-ga----gc
B D                  Elephant  -----gtt-gggatga-agtg--------------------------ttccagagcc-tta-aa----ga
B D                   Manatee  -----att-gagatga-actg--------------------------ttgcagagcc-tta-aa----ga
                     Aardvark  -----gtt-gagatga-atta--------------------------ttccagagcc-tta-aa----aa
B D                 Armadillo  -----gct-gagaagt-tttg--------------------------cttcagagcc-tta-ga----gt
B D                    Tenrec  ======================================================================
         Cape elephant shrew  ======================================================================
B D                       Rat  ======================================================================
B D                      Pika  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D        American alligator  ======================================================================
B D                   Chicken  ======================================================================
B D                Budgerigar  ======================================================================
B D               Zebra finch  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
  D               Rock pigeon  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                    Turkey  ======================================================================
  D    White-throated sparrow  ======================================================================
  D           Green seaturtle  ======================================================================
B D                   Opossum  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                   Dolphin  ----------------------------------------------------------------------
            Cape golden mole  ======================================================================

                        Human  cat--c-------------------ctttaattgtccttactac----------------a---------
                        Chimp  cat--c-------------------ctttaattgtctttactac----------------a---------
                      Gorilla  cat--c-------------------ctttaattgtctttactac----------------a---------
                    Orangutan  cat--c-------------------ctttaattgtctttactac----------------a---------
                       Gibbon  cat--c-------------------ctttaattgtctttactac----------------a---------
                       Rhesus  cat--c-------------------ctttaattgtctttactac----------------a---------
          Crab-eating macaque  cat--c-------------------ctttaattgtctttactac----------------a---------
                       Baboon  cat--c-------------------ctttaattgtctttactac----------------a---------
                 Green monkey  cgt--c-------------------ctttaattgtctttactac----------------a---------
                     Marmoset  cat--c-------------------ctttaattgcctttactac----------------a---------
              Squirrel monkey  cat--c-------------------ttttaattgtctttactac----------------a---------
                     Bushbaby  gat--c-------------------ctttcattgtctttactga----------------a---------
           Chinese tree shrew  cat--c-------------------cttcagggatctttgctac----------------atgtactccc
                     Squirrel  cat--c-------------------ctgtgattgtttttactac----------------a---------
                 Prairie vole  cac--c-----------------------tgttgtctttgt-----------------------------
              Chinese hamster  cat--c-----------------------tgttgtttcagt-----------------------------
               Golden hamster  cac--a-----------------------tgttgtctt--------------------------------
                        Mouse  ca---------------------------ttatgactttgt-----------------------------
               Naked mole-rat  cat--c-------------------ctttcattatatttattgc----------------a---------
                   Guinea pig  tat--c-------------------ctttaattgtatttcttac----------------c---------
                   Chinchilla  cat--c-------------------ctttaattgtacttattac----------------a---------
             Brush-tailed rat  ctt--c-------------------ctctgattgtatttgctac----------------a---------
                       Rabbit  cat--ctaatatgggccagtttgagtcctggctgctctcctttctatccagctccctgcta---------
                          Pig  cat--c-------------------ctttaattgtctttattac----------------a---------
                       Alpaca  cat--c-------------------ctttaattgtctttattac----------------a---------
               Bactrian camel  cat--c-------------------ctttaattgtctttattac----------------a---------
                 Killer whale  gat--c-------------------tcttcattgtctttattaa----------------a---------
             Tibetan antelope  cat--c-------------------ctttaattgtctttattac----------------a---------
                          Cow  cat--c-------------------ctttaattgtctttattac----------------a---------
                        Sheep  cat--c-------------------ctttaattgtctttattac----------------a---------
                Domestic goat  cat--c-------------------ctttaattgtctttattac----------------a---------
                        Horse  cgc--c-------------------ctttaaatatctttattaa----------------c---------
             White rhinoceros  cat--c-------------------ctttaaatatctttattac----------------a---------
                          Cat  tat--t-------------------tttttaat-tgtttattac----------------c---------
                          Dog  -----c-------------------tttttattgcctttattat----------------a---------
                      Ferret   tat--c-------------------gttttgttgtctttattaa----------------c---------
                        Panda  cat--c-------------------tttttattgccttttttac----------------t---------
               Pacific walrus  cat--c-------------------tttttattgtttttattac----------------g---------
                 Weddell seal  cat--c-------------------tttttattgtttttattac----------------g---------
             Black flying-fox  cac--c-------------------ctctaattgtctt--------------------------------
                      Megabat  cac--c-------------------ctctaattgtctt--------------------------------
                Big brown bat  cacatc-------------------cttcagttgtctttagtac----------------a---------
         David's myotis (bat)  cacttc-------------------ctgtagttgtctctagtac----------------a---------
                     Microbat  cacttc-------------------ctgtagttgtctctagtac----------------a---------
                     Elephant  cat--c-------------------ctttaactgcctttaatgc----------------a---------
                      Manatee  cat--c-------------------cttcaactgcctttaatgc----------------a---------
                     Aardvark  cat--c-------------------ctttaactgtctttaatgc----------------a---------
                    Armadillo  cat--t-------------------ctttaattgtttttagtat----------------g---------
                       Tenrec  ======================================================================
          Cape elephant shrew  ======================================================================
                          Rat  ======================================================================
                         Pika  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
           American alligator  ======================================================================
                      Chicken  ======================================================================
                   Budgerigar  ======================================================================
                  Zebra finch  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                  Rock pigeon  ======================================================================
              Tasmanian devil  ======================================================================
                       Turkey  ======================================================================
       White-throated sparrow  ======================================================================
              Green seaturtle  ======================================================================
                      Opossum  ======================================================================
     Chinese softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                      Dolphin  ----------------------------------------------------------------------
             Cape golden mole  ======================================================================

                        Human  atat----------
                        Chimp  atat----------
                      Gorilla  atat----------
                    Orangutan  atat----------
                       Gibbon  atat----------
                       Rhesus  atat----------
          Crab-eating macaque  atat----------
                       Baboon  atat----------
                 Green monkey  atat----------
                     Marmoset  atat----------
              Squirrel monkey  atat----------
                     Bushbaby  atgt----------
           Chinese tree shrew  gtct----------
                     Squirrel  atgt----------
                 Prairie vole  --------------
              Chinese hamster  --------------
               Golden hamster  --------------
                        Mouse  --------------
               Naked mole-rat  ctgt----------
                   Guinea pig  atat----------
                   Chinchilla  atat----------
             Brush-tailed rat  gtat----------
                       Rabbit  atgt----------
                          Pig  atgt----------
                       Alpaca  atgt----------
               Bactrian camel  atgt----------
                 Killer whale  atgt----------
             Tibetan antelope  acat----------
                          Cow  acat----------
                        Sheep  acat----------
                Domestic goat  acat----------
                        Horse  atgt----------
             White rhinoceros  gtgt----------
                          Cat  ttgt----------
                          Dog  ttgt----------
                      Ferret   ttgt----------
                        Panda  ttgt----------
               Pacific walrus  ttgt----------
                 Weddell seal  ttgt----------
             Black flying-fox  --gc----------
                      Megabat  --gc----------
                Big brown bat  aggt----------
         David's myotis (bat)  aggt----------
                     Microbat  aggt----------
                     Elephant  atgtgttccattct
                      Manatee  atgtattccattct
                     Aardvark  atgtattatactct
                    Armadillo  atgtgctccattct
                       Tenrec  ==============
          Cape elephant shrew  ==============
                          Rat  ==============
                         Pika  ==============
       Lesser Egyptian jerboa  ==============
           American alligator  ==============
                      Chicken  ==============
                   Budgerigar  ==============
                  Zebra finch  ==============
             Peregrine falcon  ==============
                 Saker falcon  ==============
                  Rock pigeon  ==============
              Tasmanian devil  ==============
                       Turkey  ==============
       White-throated sparrow  ==============
              Green seaturtle  ==============
                      Opossum  ==============
     Chinese softshell turtle  ==============
               Painted turtle  ==============
                      Dolphin  --------------
             Cape golden mole  ==============

Inserts between block 37 and 38 in window
              Golden hamster 4bp
B D                      Pig 579bp
B D                   Alpaca 10bp
              Bactrian camel 10bp
                Killer whale 10bp
            Tibetan antelope 10bp
B D                      Cow 10bp
B D                    Sheep 10bp
               Domestic goat 10bp
B D                    Horse 10bp
B D         White rhinoceros 10bp
B D                      Cat 10bp
B D                      Dog 10bp
B D                  Ferret  10bp
B D                    Panda 10bp
              Pacific walrus 10bp
                Weddell seal 10bp
            Black flying-fox 10bp
B D                  Megabat 10bp
               Big brown bat 10bp
        David's myotis (bat) 10bp
B D                 Microbat 9bp

Alignment block 38 of 213 in window, 125631776 - 125631778, 3 bps 
B D                     Human  gcc
B D                     Chimp  gcc
B D                   Gorilla  gcc
B D                 Orangutan  gcc
B D                    Gibbon  gcc
B D                    Rhesus  gcc
B D       Crab-eating macaque  gcc
B D                    Baboon  gct
B D              Green monkey  gcc
B D                  Marmoset  gcc
B D           Squirrel monkey  gct
B D                  Bushbaby  gct
           Chinese tree shrew  tcc
B D                  Squirrel  gcc
B D            Naked mole-rat  gtt
B D                Guinea pig  att
                   Chinchilla  gtt
             Brush-tailed rat  gtt
B D                    Rabbit  gcc
B D                       Pig  gcc
B D                    Alpaca  gcc
               Bactrian camel  gcc
                 Killer whale  tgc
             Tibetan antelope  gcc
B D                       Cow  gcc
B D                     Sheep  gcc
                Domestic goat  gcc
B D                     Horse  gta
B D          White rhinoceros  tcc
B D                       Cat  gcc
B D                       Dog  gcc
B D                   Ferret   gcc
B D                     Panda  gcc
               Pacific walrus  gcc
                 Weddell seal  gcc
             Black flying-fox  gcc
B D                   Megabat  gcc
                Big brown bat  gcc
         David's myotis (bat)  gcc
B D                  Microbat  gcc
B D                  Elephant  acc
B D                   Manatee  gcc
                     Aardvark  acc
B D                 Armadillo  g--
B D                    Tenrec  ===
         Cape elephant shrew  ===
              Golden hamster  ===
B D           Chinese hamster  ---
B D                     Mouse  ---
B D                       Rat  ===
                Prairie vole  ---
B D                      Pika  ===
      Lesser Egyptian jerboa  ===
B D        American alligator  ===
B D                   Chicken  ===
B D                Budgerigar  ===
B D               Zebra finch  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
  D               Rock pigeon  ===
B D           Tasmanian devil  ===
B D                    Turkey  ===
  D    White-throated sparrow  ===
  D           Green seaturtle  ===
B D                   Opossum  ===
  D  Chinese softshell turtle  ===
  D            Painted turtle  ===
B D                   Dolphin  ---
            Cape golden mole  ===

Inserts between block 38 and 39 in window
B D           Naked mole-rat 7bp
B D               Guinea pig 7bp
                  Chinchilla 7bp
            Brush-tailed rat 7bp

Alignment block 39 of 213 in window, 125631779 - 125631790, 12 bps 
B D                     Human  taggaccagagt
B D                     Chimp  taggaccagagt
B D                   Gorilla  taggaccagagt
B D                 Orangutan  taggaacagagt
B D                    Gibbon  taggaccagaat
B D                    Rhesus  taggaccagagt
B D       Crab-eating macaque  taggaccagagt
B D                    Baboon  taggaccagagt
B D              Green monkey  taggaccagagt
B D                  Marmoset  tagggcaagagt
B D           Squirrel monkey  tagggccagagc
B D                  Bushbaby  --------gaag
           Chinese tree shrew  cagtgcctgatg
                 Prairie vole  --------gact
B