Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 177 in window, 36874890 - 36874967, 78 bps 
B D                     Human  c----tcgggcatgctcatttacagaagc-cta--aa--------aa-c----aaat--t----t----t
B D                     Chimp  c----tcgggcatgctcatttacagaagc-cta--aa--------aa-c----aaat--t----t----t
B D                   Gorilla  c----tcgggcatgctcatttacagaagc-cta--aa--------aa-c----aaat--t----t----t
B D                 Orangutan  c----tcgggcatgcccatttacagaagc-cta--aa----------------aaat--t----t----t
B D                    Gibbon  c----tcgggcatgcccatttacagaagc-tta--aa--------aa-c----aaat--t----t----c
B D                    Rhesus  c----tcggacatgcccatttacagaagc-cta--aa--------aa-c----aaat--t----t----t
B D       Crab-eating macaque  c----tcggacatgcccatttacagaagc-cta--aa--------aa-c----aaat--t----t----t
B D                    Baboon  c----tcggacatgcccatttacagaagc-cta--aa--------aa-c----aaat--t----t----t
B D              Green monkey  c----tcggacatgcctatttacagaagc-cta--aa--------aa-c----aaat--t----t----t
B D                  Marmoset  c----tcgggcattcccatttacagaagc-cta--ga--------aa-c----aaac--t----t----t
B D           Squirrel monkey  c----tcgggctttcccatttacagaagc-cta--aa--------aa-c----caat--t----t----t
B D                  Bushbaby  c----cggagtaggctcacttacagaagt-cta--aa--------aa-c----aaa--------t----t
           Chinese tree shrew  c----tctagcaagcccacttacagaagc-cta--aa--------aa-ca---aaaa--a----t----c
B D                  Squirrel  c----tctagcatgcctatttacaaagac-cta--aa--------at-c----aaat--a----atgatc
       Lesser Egyptian jerboa  c----tctggcacacccatttggagaaac-caa--aa--------ag-c----aaat--a----a-----
                 Prairie vole  c----tctgtcata-tcatctagagaaac-tta--aa--------ag-c----aatc--a----t----c
B D           Chinese hamster  c----tctgccatt-ccatgtagagaaac-cca--aa--------ag-c----aatc--a----t----c
               Golden hamster  c----tctgctgtg-ccatctagagaaac-cta--aa--------ag-c----aagc--a----t----c
B D                     Mouse  c----tctgccatg-ccatctagagaaac-cta--aa--------ag-c----aatc--a----t-----
B D                       Rat  c----tctgccatg-ccatctagagaaac-cta--aa--------ag-c----catc--a----t-----
B D            Naked mole-rat  ctccttccaccttgccttttttcagaaac-cta--aa--------ag-c----aagt--c----g----t
B D                Guinea pig  c----tccagcttgccctttttcagaaac-caa--aa--------ag-c----aaat--a----a----t
                   Chinchilla  c----tccagcttgctcttttttagaaac-cta--aa--------ag-c----aaaa--a----a----t
             Brush-tailed rat  c----tcccgcttgccctttttcagaaac-tta--aa--------aa-c----aaaa--a----a----t
B D                    Rabbit  c----tcctgcatgcccatttacaaaacc-taa--ca--------ag-t----catt--a----g----c
B D                      Pika  c----tcctgcatgcccctgtagaaatct-aaaacca--------ag-t----aaag--a----t----c
B D                       Pig  c----actagcaagcccatttacagaaac-cta--aa--------aa-c----aaat-aa----t----t
B D                    Alpaca  c----tctagcaagcccattcacagaaac-ttg--aa--------aa-c----a----------------
               Bactrian camel  c----tctagcaagcccattcacagaaac-ttg--aa--------aa-c----a-----a----t----t
B D                   Dolphin  c----tctagcaagcccatttacagaaac-ccc--aa--------aa-c----aaat-aa----t----t
                 Killer whale  c----tctagcaagcccatttacagaaac-ccc--aa--------aa-c----aaat-aa----t----t
             Tibetan antelope  c----tcgagcaagcccattt------tt-cta--aa--------aa-c----atgt-aa----c----t
B D                       Cow  c----ccgagcaagcccattt------at-cta--aa--------aa-c----atgt-aa----c----t
B D                     Sheep  c----tcgagcaagcccattt------at-cta--aa--------aa-c----atgt-aa----c----t
                Domestic goat  c----tcgagcaagcccattt------at-cta--aa--------aa-c----atat-aa----c----t
B D                     Horse  c----tctagcaagcccatttacagaaac-cta--aa--------aa-c----a-----aataat----t
B D          White rhinoceros  c----tctagcaaagccatttacagaaac-tta--aa--------aa-c----a-----aatact----t
B D                       Cat  c----tccagcaagcccatttacagaaac-cta--aa--------aa-c----a-----a----t----c
B D                       Dog  c----tctagcaagtccatttacagaacc-cta--ag--------aa-c----a-----a----t----t
B D                   Ferret   c----tctatcaagcccatttacagaaac-cta--aa--------aa-c----a-----a----t----t
B D                     Panda  c----tctagcaagcccatttacagaaac-cta--aa--------aa-c----a-----a----t----t
               Pacific walrus  c----tctagcaagcccatttacagaaac-cta--aa--------aa-c----a-----a----t----t
                 Weddell seal  c----tctagcaagcccatttacagaaac-cta--aa--------aa-c----a-----a----t----t
             Black flying-fox  c----tctagcaggcccatttacagaaac-cta--aa----aaaata-t----a-----a----t----t
B D                   Megabat  c----accagccagcaca-ctatggaacc-ccc--ca---------a-c----g-----a----c----c
                Big brown bat  c----tctagcaagcccatttacagaaac-ctg--aa----------------a-----a----a----a
         David's myotis (bat)  c----tctagcaagcccatttacagaaac-ttg--aagaaaacaaaa-c----a-----a----a----a
B D                     Shrew  c----tctggcaaaccgatttaaagaaat-cta--aa--------aa-c----------a----t----t
              Star-nosed mole  c---------caaatccattc--agatac-ctc--aa--------aa-c----aaat-aa----t----t
B D                  Elephant  c----tctagcatgcccatttactgaaac-tca--aa--------aa-c----a-----a----t----c
          Cape elephant shrew  c----cctagtaaa------tacagaaac-cta--aa--------ac-a----a-----a----t----a
B D                   Manatee  c----tctagcatgtccatttacagaaac-cta--aa--------aa-caaata-----a----t----c
             Cape golden mole  c----tctggcatgcctatttacagaaaa-tta--aa--------aacc----a-----a----c----c
B D                    Tenrec  c----tctagcacgcccctttccaaacac-cta--at--------aa-c----a-----a----c----c
                     Aardvark  c----cctagggtgcctattttcagaaac-ctg--aa--------aa-ca---a-----a----t----a
B D                 Armadillo  c----tcaggcatgcccgtttacagacac-cta--aa--------aa------a-----a----t----a
B D           Tasmanian devil  c---ttcttaagagcctttaagtggaaacttta--aa--------aa-c----aagttaa----t----c
B D                  Hedgehog  ======================================================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  at-----------cc---ctcatttgt------gggtttctggtgt---tgtggagggc-tt
                        Chimp  at-----------cc---ctcgtttgt------gggtttctggtgt---tgtggagggc-tt
                      Gorilla  at-----------cc---ctcgtttgt------gggtttctggtgt---tgtggagggc-tt
                    Orangutan  at-----------cc---ctcgtttgt------gggtttctggtgt---tgtggagggc-tt
                       Gibbon  at-----------cc---ctcgtttgt------gggtttctggtgt---tgtggagggc-tt
                       Rhesus  at-----------cc---cgcgtttgt------gggtttctggtgt---tgtggagggc-tt
          Crab-eating macaque  at-----------cc---cgcgtttgt------gggtttctggtgt---tgtggagggc-tt
                       Baboon  at-----------cc---cgcgtttgt------gggtttctggtgt---tgtggagggc-tt
                 Green monkey  at-----------cc---cgcgtttgt------gggtttctggtgt---tgtggagggc-tt
                     Marmoset  at-----------cc---cttgtttgt------gggtttctggtgt---tgtggaggtc-tt
              Squirrel monkey  at-----------cc---cttgtttgt------gggtttctggtgt---tgtggagggc-tt
                     Bushbaby  at-----------gt---ctagtatgt------ggatttctggtgt---tgtgaagatc-tt
           Chinese tree shrew  at-----------ca---ctagtttgc------cagttt-tgatgt---tgtggaggcc-tt
                     Squirrel  ac-------------------------------------at----------ttgtgggc-tc
       Lesser Egyptian jerboa  ---------------------------------------ttagta----ggttgtggta-tt
                 Prairie vole  ac-------------------------------------ct----------ttatgagc-tt
              Chinese hamster  ac-------------------------------------ct----------ttatgagc-tt
               Golden hamster  ac-------------------------------------ct----------ttatgagc-tt
                        Mouse  ---------------------------------------ct----------ttatgagc-tt
                          Rat  ---------------------------------------ct----------ttatgagc-tt
               Naked mole-rat  at-----------ca---------------------ctggt----------ttgtgggt-tt
                   Guinea pig  at-----------ca---------------------ccagt----------ttatgggc-tt
                   Chinchilla  at-----------ca---------------------ccagt----------tcgtgagc-tt
             Brush-tailed rat  ac-----------ta---------------------cttct----------t-gtggac-tt
                       Rabbit  ac-----------ca------gtttgt------gggctgctggtgt---tgtggtgggc-tt
                         Pika  gt-----------cc------atgtgt------gggctgctgctgt---ggtgctgggc-tg
                          Pig  at-----------ca---ctattttga------gggcttctggtgt---tgtggagggc-tt
                       Alpaca  at-----------ca---ctagtttgt------agacttctagggc---tgtggagggc-tt
               Bactrian camel  at-----------ca---ctagtttgt------agacttctagggc---tgtggagggc-tt
                      Dolphin  at-----------ca---c-agtttgt------gggcttctggtgttgttgtggacgac-tt
                 Killer whale  at-----------ca---c-agtttgt------gggcttctggtgttgttgtggacgac-tt
             Tibetan antelope  at-----------ca---ctcgtttgt------gggcttctggtgc--ttgtagggggc-tt
                          Cow  at-----------ca---ctagtttgt------gggcttcgggtgc--ttgtagggggc-tt
                        Sheep  at-----------ca---ctcgtttgt------gggcttctggtgc--ttctagggggc-tt
                Domestic goat  at-----------ca---ctcgtttgt------gggcttctggtgc--ttctagggggc-tt
                        Horse  at-----------ca---ctagtttgt------gggcttctggtgt---tgtggaggac-tt
             White rhinoceros  at-----------ca---ctagtttgt------gggcttctggtgt---tgtggagggc-tt
                          Cat  at-----------ca---ctagtttgt------gggcttctagtgt---tgtggaggg----
                          Dog  at-----------ca---ctagtttgt------gggcttctggtgt---cgtggaggg----
                      Ferret   at-----------ca---ctagtctgt------ggacttctggtat---tggggaggg----
                        Panda  at-----------ca---ctacttcgt------gggcttctagtat---tgtggaggg----
               Pacific walrus  at-----------ca---ctagtttgt------gggcttctgatat---tgtggaggg----
                 Weddell seal  at-----------ca---ctagtttgt------gggcttctgatat---tgtggaggg----
             Black flying-fox  at-----------ca---ctagtttgt------gggctgctggta----tgtaaggggc-tt
                      Megabat  ag-----------cc---ctggtgccc------gggcttctgctg----cgcagagggc-tt
                Big brown bat  aatttttttcccccg---ctcatttgt------gggcttctggtgt---tgtggagggt-tt
         David's myotis (bat)  aa-----------cg---ctcgtttgg------gggcttctggtgt---tgtggagggt-tt
                        Shrew  ac-----------ca---ctactttgt------ggacttctgcaat---t----------tt
              Star-nosed mole  at-----------ta---ctattttgt------gagcttctggagc---tgc-gaaggc-tt
                     Elephant  at-----------ca---gtagcttgt------ggacttttagttt---tgtgtagggc-tt
          Cape elephant shrew  at-----------ca---ctaccttgt------gggcttctgggtt---tgtg---------
                      Manatee  gt-----------ca---ctagcttgt------ggacttcgggctt---tgtagagggc-tt
             Cape golden mole  at-----------cagctctagctagt------agacttctggttt---tgtgaaggggctt
                       Tenrec  tt-----------ca---ttagcttgt------gggcgt-tggttc---tctggaaggg-tt
                     Aardvark  at-----------ca---ctagcttgt------ggacctctggttt---tgtggagggc-tt
                    Armadillo  at-----------ca---ctagcttgt------gggc-----------------------tt
              Tasmanian devil  ac-----------ca---taagcttgtcttaacacgttttt--------tggtaagtgg-tt
                     Hedgehog  ==============================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ==============================================================
             Peregrine falcon  ==============================================================
                 Saker falcon  ==============================================================
                      Wallaby  ==============================================================
                  Rock pigeon  ==============================================================
                   Budgerigar  ==============================================================
          Medium ground finch  ==============================================================
              Green seaturtle  ==============================================================
                 Mallard duck  ==============================================================
           American alligator  ==============================================================
          Collared flycatcher  ==============================================================
           Tibetan ground jay  ==============================================================
                X. tropicalis  ==============================================================
                     Platypus  ==============================================================
                      Opossum  ==============================================================
               Painted turtle  ==============================================================
     Chinese softshell turtle  ==============================================================

Alignment block 2 of 177 in window, 36874968 - 36874995, 28 bps 
B D                     Human  tcca---atgtt-------tagaa----gcaa--ta-----t-attttt-a
B D                     Chimp  tcca---atgtt-------tagaa----gcaa--ta-----t-attttt-a
B D                   Gorilla  tcca---atgtt-------tagaa----gcaa--ta-----t-attttt-a
B D                 Orangutan  tcca---atgtt-------tagaa----gcaa--ta-----t-attttt-a
B D                    Gibbon  tcca---atgtt-------tagaa----gcaa--ta-----t-attttt-a
B D                    Rhesus  tcca---atgtt-------tagaa----gcaa--tg-----t-cttttt-a
B D       Crab-eating macaque  tcca---atgtt-------tagaa----gcaa--tg-----t-cttttt-a
B D                    Baboon  tcca---atgtt-------tagaa----gcaa--tg-----t-cttttt-a
B D              Green monkey  tcca---atgtt-------tagaa----gcaa--ta-----t-cttttt-a
B D                  Marmoset  tcca---atgtt-------tagaa----gcaa--tc-----t-cttttt-a
B D           Squirrel monkey  tcca---acgtt-------tagaa----gcaa--tc-----t-atgttt-a
B D                  Bushbaby  tcaa---atgtt-------tagaa----gtaa--ac-----t-cttttg-c
           Chinese tree shrew  tcaa---atat------------a----gtaa--tg--------ttttc-c
B D                  Squirrel  ctg----gtgctgtagcggtagaa----ggga--tcgctttt-tt---t-c
       Lesser Egyptian jerboa  ttca---atgtc-------tagaa----gaga--ac-----t-tt---t-c
                 Prairie vole  tcga---atgtc-------cagaa----gaga--tc-----t-tt---t-c
B D           Chinese hamster  tcga---gtggt-------cagaa----gaga--cc-----t-tt---t-c
               Golden hamster  tcga---gtgtt-------cagaa----agga--tc-----t-tt---t-c
B D                     Mouse  tcga---atgtc-------tagaa----gaga--gc-----t-tt--ct-c
B D                       Rat  tcca---atgtc-------tagaa----gaga--gc-----t-tt--ct-c
B D            Naked mole-rat  tcaa---atgtc-------tagaa----gaga--tc-----t-tt--tt-c
B D                Guinea pig  tcaa---atgtc-------tagaa----gtga--tc-----t-ttt-tc-c
                   Chinchilla  tcaa---atgtc-------tacaa----atga--tc-----t-ttt-tt-c
             Brush-tailed rat  tcaa---aagtc-------tagaa----gtga--tc-----t-tttctt-c
B D                    Rabbit  tcaa---aagtc-------tggag----acca--tc-----t-ctt-ttac
B D                      Pika  tcaa---atggc----------------------tc-----t-ctt-tt-c
B D                       Pig  tcaa----tgtc-------tagaa----gtag--tg-----t-gttttc-c
B D                    Alpaca  tcaa---ctgtc-------tagaa----gtag--tg-----t-cttttc-c
               Bactrian camel  tcaa---ctgtc-------tagaa----gta----g-----a-cttttc-c
B D                   Dolphin  tcaa----tgtc-------tacaa----gtag--ta-----c-cgtttc-c
                 Killer whale  tcaa----tgtc-------tacaa----gtag--ta-----c-cgtttc-c
             Tibetan antelope  tcaa----tgtc-------tagaa----gtag--tg-----c-tgtttc-c
B D                       Cow  tcaa----tgtc-------tagaa----gtag--tg-----c-cgtttt-c
B D                     Sheep  tcaa----tgtc-------tagaa----gtag--tg-----c-cgtttc-c
                Domestic goat  tcaa----tgtc-------tagaa----gtag--tg-----c-cgtttc-c
B D                     Horse  ccaa---acgtc-------tag-a----gtac--tg-----c-ctttt--c
B D          White rhinoceros  ccaa---atgtc-------tagaa----gtag--tg-----c-ctttta-c
B D                       Cat  -tga---atgtg-------ta-aa----gtag--tg-----c-ccttct-c
B D                       Dog  -tga-----gtc-------tagaa----gttg--tg-----c-ccttct-c
B D                   Ferret   -tga---atgtc-------tagaa----gtag--tg-----c-cctttt-c
B D                     Panda  -tgg---atgtc-------tagaa----gtag--tg-----c-acttct-c
               Pacific walrus  -tga---atgtc-------tagaa----gtgg--tg-----c-ccttct-c
                 Weddell seal  -tga---atgtc-------tagaa----gtgg--tg-----c-cctgct-t
             Black flying-fox  tcaa---atgtc-------tataa----atag--tg-----cttttttt-c
B D                   Megabat  tcag---gagtc--------acaa----ggag--ag-----c-cttttt-c
                Big brown bat  tcaa---aatgt--------ctag----aaag--tg-----c-cttttt-c
         David's myotis (bat)  tcca---aatgc--------ctag----aaag--tg-----c-cttttt-c
B D                     Shrew  tca-----------------tcaa----g---------------ttttg-t
              Star-nosed mole  tcaa---ctgtc-------tacaa----gtag--ag-----c-cttttt-t
B D                  Elephant  tcaaataatgtc-------tagaa----gaag--tt-----t-ttttc---
          Cape elephant shrew  ---aagacagtt-------tagaa----tttg--tc-----t-ttttc---
B D                   Manatee  tcaaataatgtc-------tagaa----gtagtctc-----t-ttttc---
             Cape golden mole  ttaaataatgtc-------tagaa----ataa--tc-----t-ttccc---
B D                    Tenrec  tcaaataacacc-------ccata----gt-c--tc-----t-ttttc---
                     Aardvark  tcaaataatgtc-------tagaa----gtag--tc-----t-ctttc---
B D                 Armadillo  caaataaatgcc-------gttaa----gtag--tt-----t-tttcc---
B D           Tasmanian devil  tcat---aattg-------ta--------tta--ta-----t-cttta---
B D                 Zebrafish  ttta---atggt-------taaaatggggtta--tg-----g-ttttta--
B D                  Hedgehog  ===================================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ===================================================
  D          Peregrine falcon  ===================================================
  D              Saker falcon  ===================================================
B D                   Wallaby  ===================================================
  D               Rock pigeon  ===================================================
B D                Budgerigar  ===================================================
B D       Medium ground finch  ===================================================
  D           Green seaturtle  ===================================================
  D              Mallard duck  ===================================================
B D        American alligator  ===================================================
  D       Collared flycatcher  ===================================================
          Tibetan ground jay  ===================================================
B D             X. tropicalis  ===================================================
B D                  Platypus  ===================================================
B D                   Opossum  ===================================================
  D            Painted turtle  ===================================================
  D  Chinese softshell turtle  ===================================================

Inserts between block 2 and 3 in window
              Bactrian camel 10bp

Alignment block 3 of 177 in window, 36874996 - 36875000, 5 bps 
B D                     Human  tagaa
B D                     Chimp  tagaa
B D                   Gorilla  tagaa
B D                 Orangutan  tagaa
B D                    Gibbon  tagaa
B D                    Rhesus  tagaa
B D       Crab-eating macaque  tagaa
B D                    Baboon  tagaa
B D              Green monkey  tagaa
B D                  Marmoset  tagaa
B D           Squirrel monkey  tagaa
B D                  Bushbaby  ccgaa
           Chinese tree shrew  cggaa
B D                  Squirrel  cagaa
       Lesser Egyptian jerboa  ttgaa
                 Prairie vole  ctgac
B D           Chinese hamster  ctgac
               Golden hamster  ctgac
B D                     Mouse  ctgac
B D                       Rat  ctgac
B D            Naked mole-rat  gagaa
B D                Guinea pig  cacaa
                   Chinchilla  cagat
             Brush-tailed rat  caaaa
B D                    Rabbit  cagag
B D                      Pika  ccgag
B D                       Pig  tagaa
B D                    Alpaca  tagaa
B D                   Dolphin  tagaa
                 Killer whale  tagaa
             Tibetan antelope  tagaa
B D                       Cow  tagaa
B D                     Sheep  tagaa
                Domestic goat  tagaa
B D                     Horse  tagaa
B D          White rhinoceros  tagaa
B D                       Cat  tagaa
B D                       Dog  tagaa
B D                   Ferret   tagaa
B D                     Panda  tagaa
               Pacific walrus  tagaa
                 Weddell seal  tagaa
             Black flying-fox  tagaa
B D                   Megabat  tagat
                Big brown bat  tagaa
         David's myotis (bat)  tagaa
B D                     Shrew  ---aa
              Star-nosed mole  ---aa
B D                  Elephant  cagaa
          Cape elephant shrew  cagaa
B D                   Manatee  cagaa
             Cape golden mole  cagaa
B D                    Tenrec  cagaa
                     Aardvark  cagaa
B D                 Armadillo  agtaa
B D           Tasmanian devil  taagg
B D                 Zebrafish  tggta
B D                  Hedgehog  =====
B D                  Microbat  NNNNN
  D    White-throated sparrow  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                   Wallaby  =====
  D               Rock pigeon  =====
B D                Budgerigar  =====
B D       Medium ground finch  =====
  D           Green seaturtle  =====
              Bactrian camel  =====
  D              Mallard duck  =====
B D        American alligator  =====
  D       Collared flycatcher  =====
          Tibetan ground jay  =====
B D             X. tropicalis  =====
B D                  Platypus  =====
B D                   Opossum  =====
  D            Painted turtle  =====
  D  Chinese softshell turtle  =====

Inserts between block 3 and 4 in window
B D                   Alpaca 5bp
             Star-nosed mole 3bp

Alignment block 4 of 177 in window, 36875001 - 36875031, 31 bps 
B D                     Human  ttc--tgtaat---aaac----------------------------------------------------
B D                     Chimp  ttc--tgtaat---aaac----------------------------------------------------
B D                   Gorilla  ttc--tataat---aaac----------------------------------------------------
B D                 Orangutan  ttc--tgtaat---aaac----------------------------------------------------
B D                    Gibbon  ttc--tgtaat---aaac----------------------------------------------------
B D                    Rhesus  ttc--tgtaat---aaac----------------------------------------------------
B D       Crab-eating macaque  ttc--tgtaat---aaac----------------------------------------------------
B D                    Baboon  ttc--tgtaat---aaac----------------------------------------------------
B D              Green monkey  ttc--tgtaat---aaac----------------------------------------------------
B D                  Marmoset  ttc--tgttat---aaac----------------------------------------------------
B D           Squirrel monkey  ttc--tgttat---aaac----------------------------------------------------
B D                  Bushbaby  ctc--tgtgat---aagcttgca--ttttcccc-------------------------------tag---
           Chinese tree shrew  ctc--tctaat---acacgtgca--tttttctcct-a---g-gcattt-------tctcctccgcag---
B D                  Squirrel  ctc--tgtaat---aagcttccat-ttttctgcct-a---a-atattg-------tttcca---------
       Lesser Egyptian jerboa  ctt----ttat---aaatttgcat-atttcctcct-g---c-atgttt-------tttcta---------
                 Prairie vole  ctc----taat---aaacttacctccgttccgtct-a---t-att-tt-------tttctt---------
B D           Chinese hamster  ctc----taat---aaacttaccttggttccatct-a---t-aca-ta-------ttttta---------
               Golden hamster  ctc----taat---aaacttacctcggctccatt---------------------tttcta---------
B D                     Mouse  ctc----taat---aaccttatctcggttccatct-a---a-aca-tt-------tttcca---------
B D                       Rat  ctc----taat---aaacttacctcgattccatct-a---t-aca-tt-------tttcta---------
B D            Naked mole-rat  gtc--tgtagc---acacttgca-----------------------tt-------tttcca---------
B D                Guinea pig  ctc--tgcaac---aaacttgca-----------------------tt-------ttccca---------
                   Chinchilla  c-------aac---aaagttgca-----------------------tt-------tttcca---------
             Brush-tailed rat  ctc--gggaac---aaacttgca-----------------------tt-------tttcca---------
B D                    Rabbit  ctc--tataat---aaacgtgca--tcttcccact-a---g-ata-tt-------ttcccaca-------
B D                      Pika  ctc--tgcagt---aatcatgca--ttattccact-a---g-ata-tc-------ttcccacc-------
B D                       Pig  gtt--tgtaat---aaacttgca---tttttttcc-c---t-agtatt--------ttttg---------
B D                   Dolphin  ctt--tgtaat---aaacttgcat-tttttttccc-t---a-ggtttt-------tttttt---------
                 Killer whale  ctt--tgtaat---aaacttgcat-ttttttccct-a---g-gttttt-------tttttt---------
             Tibetan antelope  ctt--tgtaat---aaacttgca---cttttcccc-c---c-ggtttt-------cttttg---------
B D                       Cow  ctt--tgtaat---aaacttgct---ctttgcccc-c---a-ggtttt-------cttttg---------
B D                     Sheep  ctt--tgtaat---aaacttgca---ctttccccc-c---c-ggtttt-------cttttg---------
                Domestic goat  ctt--tgtaat---aaacttgca----ttttcccc-c---c-ggtttt-------cttttg---------
B D                     Horse  ctc--tgtaat---aaacttgca-----tttccct-a---g-gttttt---------ccag---------
B D          White rhinoceros  ctc--ggtaat---aagcttgaa--ttttttccct-a---gagttttt---------tcag---------
B D                       Cat  ctc--tgtaat---aaacttggt----tgttccct-a---g-attttt------ttttcag---------
B D                       Dog  ctc--tgtaat---aaactcggt----tttcccct-aattt-tttttt-------tttcag---------
B D                   Ferret   ctc--tgtaac---aaactcggt----tttcccac-a---t-tttttt------cccccag---------
B D                     Panda  ctc--tgtaat---aaactcgat----tttttcct-a---g-attttt-------tttca----------
               Pacific walrus  ctc--tgtaat---aaactcggt----ttttcccg-a---t-gttttt-------tttcag---------
                 Weddell seal  ttc--tgtgat---aaactcggt----ttttcccg-a---t-tttttt-------tttcag---------
             Black flying-fox  ctg--tgtaat---aaacttgca---tttttccat-a---t-tttttt------gt--------------
B D                   Megabat  ctc--cgtcct---aaacttgca--ttttttcctt-a---g-gttttt------ctcccag---------
                Big brown bat  ctc--tgtaat---aaacttgca---tttttcctt-a---t-tttttt------tttccag---------
         David's myotis (bat)  ctc--tgtaat---aaacttgca---tttttcctt-g---t-tttttt----------caa---------
B D                     Shrew  ----------------------------------t-a---t-acaga-----------------------
              Star-nosed mole  --c--gctaat---aaatttgct---tttccccct-a---t-aaaaga-----------tg---------
B D                  Elephant  --c--cctaat---aaacgtgca---gtttccctt-a---g-attttt-------ttt------------
          Cape elephant shrew  --c--attaat---aagcttgca---ttttacccc-a---g-atttttaaaaaaattt------------
B D                   Manatee  --c--cctaat---aaacttgca---ttttcccccta---g-atttct-------ttt------------
             Cape golden mole  --g--tcgaag---aaacttgca---tttcccctt-a---g-acttaa-------ttt------------
B D                    Tenrec  --c--tctaat---aaacttgca---ttttgcccc-a---a-gatttt-------gtt------------
                     Aardvark  --t--cctaat---aaatttgcg---gttttttcc-a---g-atttct-------tct------------
B D                 Armadillo  --taatgtaat---aaagttgca---ttattttat-----------------------------------
B D           Tasmanian devil  -------------------------------------------------------ttcttaaaataattt
B D                 Zebrafish  ttt--tgtagtggaaaccattcaaatattctgt-------------------------------------
B D                  Hedgehog  ======================================================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  -g-tgttttaaatcttttat
                        Chimp  -g-tgttttaaatcttttat
                      Gorilla  -g-ttttttaaatcttttat
                    Orangutan  -g-ttttttaaatcttttat
                       Gibbon  -g-ttttttaaatcttttat
                       Rhesus  -t-tttaaaaaatattttat
          Crab-eating macaque  -t-tttaaaaaatattttat
                       Baboon  -t-tttaaaaaatcttttat
                 Green monkey  -t-ttaaaaaaatcttttat
                     Marmoset  -t-tt----aaattttttat
              Squirrel monkey  -t-tt----aaagcttttat
                     Bushbaby  -t-ttttcacaatctttcat
           Chinese tree shrew  -g-ttttcacgatctttcct
                     Squirrel  -g-ttttcaccatctttcat
       Lesser Egyptian jerboa  -g-ttttcagcatctttcat
                 Prairie vole  -g-ttttcaccatct-----
              Chinese hamster  -g-tttttaccatctttcat
               Golden hamster  -g-ttctcaccgtctttcat
                        Mouse  -g-ttttcaccgtctttcat
                          Rat  -g-ttttcaccatctttcat
               Naked mole-rat  -g-ttttcaccaccttccac
                   Guinea pig  -g-gtttcaccaccttttat
                   Chinchilla  -g-ttttcaccacctttcat
             Brush-tailed rat  -g-tttcc-cctcctttcat
                       Rabbit  -g-ttttcgccatctttcat
                         Pika  -g-ttggcaccatctttca-
                          Pig  -t-tttcagaaatctttcat
                      Dolphin  -c-ccccataaatctttcat
                 Killer whale  -t-ccccacaaatctttcat
             Tibetan antelope  -t-tttcacacacctttcat
                          Cow  -t-tttcacacacctttcat
                        Sheep  -t-tttcacacacttttcat
                Domestic goat  -t-tttcacacacttttcat
                        Horse  -t-tttctc-aatctttca-
             White rhinoceros  -t-tttcgcaaatctttcat
                          Cat  -g-tttcacaaatctttcat
                          Dog  -t-tttcacatatctttcat
                      Ferret   -t-tttcacaaatctttcgt
                        Panda  -t-tttcac-aatctttcat
               Pacific walrus  -t-tttcacaaatctttaat
                 Weddell seal  -t-tttcacaaatctttaat
             Black flying-fox  ---tttcaca-atcttccat
                      Megabat  -tgtttcgaa-atctttggt
                Big brown bat  -t-ttccacctatctttcat
         David's myotis (bat)  -t-ttccacatatctttcat
                        Shrew  -----------------cac
              Star-nosed mole  -t-cttccc--atctttcac
                     Elephant  --------------------
          Cape elephant shrew  --------------------
                      Manatee  --------------------
             Cape golden mole  --------------------
                       Tenrec  --------------------
                     Aardvark  --------------------
                    Armadillo  --------------------
              Tasmanian devil  tt-atttttggatttttcat
                    Zebrafish  --------------------
                     Hedgehog  ====================
                     Microbat  NNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ====================
             Peregrine falcon  ====================
                 Saker falcon  ====================
                      Wallaby  ====================
                  Rock pigeon  ====================
                   Budgerigar  ====================
          Medium ground finch  ====================
              Green seaturtle  ====================
               Bactrian camel  ====================
                       Alpaca  ====================
                 Mallard duck  ====================
           American alligator  ====================
          Collared flycatcher  ====================
           Tibetan ground jay  ====================
                X. tropicalis  ====================
                     Platypus  ====================
                      Opossum  ====================
               Painted turtle  ====================
     Chinese softshell turtle  ====================

Inserts between block 4 and 5 in window
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                 Elephant 23bp
         Cape elephant shrew 14bp
B D                  Manatee 20bp
            Cape golden mole 18bp
B D                   Tenrec 18bp
                    Aardvark 16bp
B D          Tasmanian devil 8bp

Alignment block 5 of 177 in window, 36875032 - 36875088, 57 bps 
B D                     Human  aaa-----------------gct-ctctgtag--------ca--------ta------------------
B D                     Chimp  aaa-----------------gct-ctctgtag--------ca--------ta------------------
B D                   Gorilla  aaa-----------------gct-ctctgtag--------ca--------ta------------------
B D                 Orangutan  aaa-----------------gct-ctccgtag--------ca--------ta------------------
B D                    Gibbon  aaa-----------------gct-ctccgtag--------ca--------ta------------------
B D                    Rhesus  aaa-----------------gct-ctctgtag--------ca--------ta------------------
B D       Crab-eating macaque  aaa-----------------gct-ctctgtag--------ca--------ta------------------
B D                    Baboon  aaa-----------------gct-ctctgtag--------ca--------ta------------------
B D              Green monkey  aaa-----------------gct-ctctgtag--------ca--------ta------------------
B D                  Marmoset  aaa-----------------gct-ctctgtag--------ca--------tatatt--------------
B D           Squirrel monkey  aaa-----------------gct-ctctgaag--------catgtaag--tatacg--------------
B D                  Bushbaby  taa-----------------gtt-gt-tgtag--------ta--------ta------------------
           Chinese tree shrew  gaa-----------------gtt-ctctgcag--------tg--------tatgtgt-------------
B D                  Squirrel  aaa-----------------ctt-ctctacag--------cg--------t-------------------
       Lesser Egyptian jerboa  aaa----------------agtt-ctctgtag--------cg--------tata----------------
                 Prairie vole  --------------------gtt-cttttagg--------ta--------tata----------------
B D           Chinese hamster  aaa----------------agtt-cttgtagg--------ta--------tata----------------
               Golden hamster  aaa----------------agtt-cttgtagg--------ga--------ctta----------------
B D                     Mouse  aaa----------------agtt-ctgttagg--------ta--------ttga----------------
B D                       Rat  aaa----------------agtt-ctgttagg--------ta--------tata----------------
B D            Naked mole-rat  aaagttgtttgtggcatataaat-atgttagg--------ca--------tatc----------------
B D                Guinea pig  aaagttgtctgtggcatataaataatgttaga--------ca--------ttct----------------
                   Chinchilla  aaagctgtctatagcatataaat-atgttagg--------ca--------tact----------------
             Brush-tailed rat  gaagttg----tggcatataaac-atgttagg--------ca--------cact----------------
B D                    Rabbit  aaa----------------agtc-ctgtgtag--------tg--------tataaat-------------
B D                      Pika  aaa----------------agtg-ctgcataa--------ta--------tgtaaat-------------
B D                       Pig  aaa-----------------gtt-ctct------------------------------------------
B D                   Dolphin  aaa-----------------gtt-ctctgtag--------tg--------tg------------------
                 Killer whale  aaa-----------------gtt-ctctgtag--------tg--------tg------------------
             Tibetan antelope  aaa-----------------gtt-ctctgtag--------ca--------ta------------------
B D                       Cow  aaa-----------------gtt-ctctgtag--------ca--------ta------------------
B D                     Sheep  aaa-----------------gtt-ctctgtag--------ca--------ta------------------
                Domestic goat  aaa-----------------gtt-ctctgtag--------ca--------ta------------------
B D                     Horse  aaa-----------------ggt-ctctgtag--------cacagaagcctg------------------
B D          White rhinoceros  aaa-----------------gtt-ctctgtag--------cacctatg--ta------------------
B D                       Cat  aaa-----------------gtt-atctgtag--------ca--------tg------------------
B D                       Dog  agg-----------------gtt-ctctgtag--------ca--------tc------------------
B D                   Ferret   aag-----------------att-ttctgtgg--------ca--------tg------------------
B D                     Panda  aag-----------------gtt-ctctgtag--------ca--------ta------------------
               Pacific walrus  aag-----------------gtt-ctctgtag--------ca--------tg------------------
                 Weddell seal  aag-----------------gtt-ctctgtag--------ca--------ta------------------
             Black flying-fox  aaa-----------------gtt-atctgtaa--------ca--------ta------------------
B D                   Megabat  aag-----------------gtc--tctgtgg--------ca--------tg------------------
                Big brown bat  aaa-----------------gtt-acctgtag--------ca--------tt------------------
         David's myotis (bat)  aaa-----------------gtt-atctgtag--------ca--------tt------------------
B D                     Shrew  aaa---------------------------aa--------ta--------ta------------------
              Star-nosed mole  aaa-----------------gtt-ctccataa--------ca--------ta------------------
B D                  Elephant  aaa-----------------ttt-ctctgtag--------ca--------aa------------------
          Cape elephant shrew  aaa-----------------ttt-ctccgtaggaaaaaaaaa--------aa------------------
B D                   Manatee  aaa-----------------ttt-ctctgtag--------ca--------aa------------------
             Cape golden mole  aaa-----------------ttt-ctccacag--------ca--------aa------------------
B D                    Tenrec  aaa-----------------ttt-ctctgtac--------ct--------aa------------------
                     Aardvark  aaa-----------------ttt-ctctgtaa--------ca--------aa------------------
B D           Tasmanian devil  gag-----------------gct-ttccatag--------tt--------ttctcctgtgaatattgagt
B D                 Zebrafish  -------------------gatg-gtttctat--------ta--------ta------------------
B D                  Hedgehog  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ----------taagt--------ac----------------------at----------------at---
                        Chimp  ----------taagt--------ac----------------------at----------------at---
                      Gorilla  ----------taagt--------ac----------------------at----------------at---
                    Orangutan  ----------taagt--------ac----------------------at----------------at---
                       Gibbon  ----------taagt--------ac----------------------at----------------at---
                       Rhesus  ----------taagt--------ac----------------------at----------------at---
          Crab-eating macaque  ----------taagt--------ac----------------------at----------------at---
                       Baboon  ----------taagt--------ac----------------------at----------------at---
                 Green monkey  ----------taagt--------ac----------------------at----------------at---
                     Marmoset  ----------taagt--------ac----------------------at----------------at---
              Squirrel monkey  ----------taagt--------ac----------------------at----------------at---
                     Bushbaby  ----------taagt--------atatgttaagtatgcataaaatagat----------------at---
           Chinese tree shrew  ----------ttatt--------at----------------------at----------------gt---
                     Squirrel  -----------aagt--------ac----------------------tt----------------at---
       Lesser Egyptian jerboa  ----------aataa--------at----------------------gt----------------gt---
                 Prairie vole  ----------taagc--------tc----------------------gt----------------at---
              Chinese hamster  ----------taaac--------tc----------------------at----------------at---
               Golden hamster  ----------aaaac--------tc----------------------at----------------at---
                        Mouse  ----------taaac--------tc----------------------at----------------ag---
                          Rat  ----------taagc--------tc----------------------at----------------at---
               Naked mole-rat  ----------taagt--------ac----------------------ac----------------at---
                   Guinea pig  ----------taagc--------at----------------------at----------------at---
                   Chinchilla  ----------taagc--------ac----------------------at----------------at---
             Brush-tailed rat  ----------ccagc--------ac----------------------at----------------ac---
                       Rabbit  ----atatattaagt--------at----------------------at----------------at---
                         Pika  ----acatattaaga--------at----------------------ac----------------aa---
                          Pig  --------------c--------ac----------------------at----------------accca
                      Dolphin  ----------taagt--------at----------------------at----------------acata
                 Killer whale  ----------taagt--------at----------------------at----------------acata
             Tibetan antelope  ----------taagt--------at----------------------at----------------ataca
                          Cow  ----------taagt--------at----------------------at----------------ataca
                        Sheep  ----------taagt--------at----------------------at----------------ataca
                Domestic goat  ----------taagt--------at----------------------at----------------ataca
                        Horse  ----------tatat--------gt----------------------at----------------atat-
             White rhinoceros  ----------tatat--------gt----------------------at----------------atat-
                          Cat  ----------taagt--------gt----------------------at----------------ctat-
                          Dog  ----------taagt--------gc----------------------at----------------acat-
                      Ferret   ----------tgagt--------gc----------------------at----------------atat-
                        Panda  ----------taagt--------gt----------------------at----------------atat-
               Pacific walrus  ----------taagt--------gt----------------------at----------------atat-
                 Weddell seal  ----------taagt--------gt----------------------at----------------atat-
             Black flying-fox  ----------taagtatataaacgt----------------------at----------------atat-
                      Megabat  ----------tgagtccgcagacac----------------------at----------------gtgc-
                Big brown bat  ----------taagtacatataatt----------------------at----------------atat-
         David's myotis (bat)  ----------taagtacatataatt----------------------at----------------atat-
                        Shrew  ----------tg-----------g----------------------------------------------
              Star-nosed mole  ----------ta-----------at----------------------at---------------------
                     Elephant  ----------aataa--------gt----------------------gt---------------aat---
          Cape elephant shrew  ----------aatag--------gc----------------------ctattaaaggagaaatgaat---
                      Manatee  ----------aacaa--------gt----------------------ct---------------agt---
             Cape golden mole  ----------ataag--------ta----------------------tt----------------tt---
                       Tenrec  ----------agtaa--------ga----------------------tt----------------at---
                     Aardvark  ----------aataa--------gt----------------------gt----------------at---
              Tasmanian devil  gaatatttaataggt--------at----------------------atcatctaataaaaactagt---
                    Zebrafish  ----------ttgtt--------tt----------------------tc----------------at---
                     Hedgehog  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  --taa---------ag--------a------------------cagaaatggggg-ag-catc-------
                        Chimp  --taa---------ag--------a------------------cagaaatggggg-ag-catc-------
                      Gorilla  --taa---------ag--------a------------------cagaaatgcggg-cg-catc-------
                    Orangutan  --taa---------ag--------a------------------cagaaatggggg-ag-catc-------
                       Gibbon  --taa---------ag--------a------------------cagaaatggggg-ag-catc-------
                       Rhesus  --taa---------ag--------a------------------cagaaatggggg-ag-tgtc-------
          Crab-eating macaque  --taa---------ag--------a------------------cagaaatggggg-ag-tgtc-------
                       Baboon  --taa---------ag--------a------------------cagaaatggggg-ag-tgtc-------
                 Green monkey  --taa---------ag--------a------------------cagaaatggggg-ag-tgtc-------
                     Marmoset  --caa---------ag--------a------------------cagaagag-ggg-ag-cgtc-------
              Squirrel monkey  --caa---------ag--------a------------------cagaaatg-ggg-ag-cgtc-------
                     Bushbaby  --taa---------agcataaagta------------------cagaaaca---g-ag-tgtc-------
           Chinese tree shrew  --gga---------at--------a-g---g----------ttcgggaatgggtg-ag------------
                     Squirrel  --tac---------ag-----gata-ga--a----------cgcagaaataaggg-gg------------
       Lesser Egyptian jerboa  --taggtatgtgtcat-----ggta-ga--g----------attaaagg---------------------
                 Prairie vole  --taa---------ag-----ggta-ga--g----------ttcagaaataaggg-ag------------
              Chinese hamster  --taa-------------------c-cc--g----------gtccgggagcgggg-aa------------
               Golden hamster  --taa-------------------a-ga--g----------ttcagaaatgaggg-aa------------
                        Mouse  --taa---------ag-----ggta-ga--g----------ttcagaagtgaggg-ag------------
                          Rat  --taa---------ag-----ggta-ga--g----------tttagaaatgtcag-ag------------
               Naked mole-rat  --taa---------ag-----gata-ga--g----------ttcagaaac-ggag-ag------------
                   Guinea pig  --taa---------ag-----aacaaga--g----------ttcagaggc-ggag-ag------------
                   Chinchilla  --taa---------aa-----agac----------------ttcagaaac---ag-ag------------
             Brush-tailed rat  --tga---------ag-----gata----------------gttagaaatgggag-gg------------
                       Rabbit  --taa---------aa-----ggta-gc--a----------ttcagaaatgggg----------------
                         Pika  --tga---------ag-----ggca-gt--a----------ttcagaaatgggga-gg------------
                          Pig  tgtaa---------gg-----gaca-ga--g----------atgggaagttagtg-tg-tgtgg------
                      Dolphin  tgtaa---------gg-----gaca-ga--g----------ttcagaaactggtg-tattgtgt------
                 Killer whale  tgtaa---------gg-----gaca-ga--g----------ttcagaaactggtg-tattgtgt------
             Tibetan antelope  cgtaa---------gg-----aata-ga--g----------ttcagaaacgggtg-ta-tgtgt------
                          Cow  cgtaa---------ga-----aata-ga--g----------ttcagaaacgggtg-ta-tgtgt------
                        Sheep  cgtaa---------gg-----aata-ga--g----------ttcagaaacgggtg-ta-tgtgt------
                Domestic goat  cgtaa---------gg-----aata-ga--g----------ttcagaaacgggtg-ta-tgtgt------
                        Horse  --taa---------gg-----gaga-ga--g----------ttaggaaattggtg-tg-tg---------
             White rhinoceros  --taa---------gg-----gtta-ga--g----------ttcagaaactggtg-tg-tg---------
                          Cat  --aaa---------gg-----gcca-ga--g----------tacagaaattggtg-tg-tgtgcatgtgg
                          Dog  --taa---------gg-----gcta-ga--g----------ttcagaaattgctg-ag-gt---gggggc
                      Ferret   --taa---------gg-----tcta-ga--g----------ttcagaaattgctg-tg-gc---------
                        Panda  --taa---------ag-----gcta-ga--g----------ttcagaaatggctg-tg-gg----ggtgc
               Pacific walrus  --taa---------ga-----gcta-aa--g----------ttcagaaattgctg-tg-ggggagggtgc
                 Weddell seal  --taa---------ga-----gcca-ga--g----------ttcagaaattgctg-tg-gg---------
             Black flying-fox  --taa-------------------a-ga--a----------ttcagaaattggtg-tg-tg--------t
                      Megabat  --taa---------gg-----gacg-ga--g----------ctcagaaactggtg-tg------------
                Big brown bat  --taa---------gg-----aaca-aa--g----------ttcagaaattgggggtg------------
         David's myotis (bat)  --taa---------gg-----aaca-ga--g----------ttcagaaa-------tg------------
                        Shrew  ------------------------a-ca--g----------ttcagaaattaatg-gg-gt---------
              Star-nosed mole  --tgg---------gg-----gcta-gc--g----------ttcagaaattagtg-tt-gg---------
                     Elephant  --aaa---------gg-----gaga-gg--gga--------gttaaagg---------------------
          Cape elephant shrew  --aaa---------ag-----aaga-aa--gga--------gccaaaga---------------------
                      Manatee  --aaa---------gg-----aaaa-ga--gga--------gttaaagg---------------------
             Cape golden mole  --aaa---------gg-----gaag-ga--ggaagg-----gctaaaag---------------------
                       Tenrec  --taa---------cg-----gaag-ga--gca--------gttgaaag---------------------
                     Aardvark  --taa---------ag-----aaag-gg--ggggggttggtgtttaaag---------------------
              Tasmanian devil  --tca---------at-----gtca-ga--a----------ttttcagattatca-ag------------
                    Zebrafish  --tag---------aa-----actt-gacta----------tgctagaataacag---------------
                     Hedgehog  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  -aagg
                        Chimp  -aagg
                      Gorilla  -aagg
                    Orangutan  -aagg
                       Gibbon  -aagg
                       Rhesus  -aagg
          Crab-eating macaque  -aagg
                       Baboon  -aagg
                 Green monkey  -aagg
                     Marmoset  -aagg
              Squirrel monkey  -gagg
                     Bushbaby  -agag
           Chinese tree shrew  --atg
                     Squirrel  -aagg
       Lesser Egyptian jerboa  -----
                 Prairie vole  -gagg
              Chinese hamster  -c---
               Golden hamster  -aag-
                        Mouse  -ggga
                          Rat  -g---
               Naked mole-rat  -gaga
                   Guinea pig  -gaga
                   Chinchilla  -gtga
             Brush-tailed rat  -gaga
                       Rabbit  ---gg
                         Pika  -gagg
                          Pig  -cggg
                      Dolphin  --ggg
                 Killer whale  --ggg
             Tibetan antelope  -gggg
                          Cow  -gggg
                        Sheep  -gggg
                Domestic goat  -gggg
                        Horse  -gggg
             White rhinoceros  -ggag
                          Cat  ggggt
                          Dog  aaggg
                      Ferret   -aggg
                        Panda  aggga
               Pacific walrus  -gggg
                 Weddell seal  -gggg
             Black flying-fox  cgggg
                      Megabat  -gggg
                Big brown bat  -gggg
         David's myotis (bat)  -gggg
                        Shrew  -gggg
              Star-nosed mole  -aagg
                     Elephant  -----
          Cape elephant shrew  -----
                      Manatee  -----
             Cape golden mole  -----
                       Tenrec  -----
                     Aardvark  -----
              Tasmanian devil  -----
                    Zebrafish  -----
                     Hedgehog  =====
                    Armadillo  -----
                     Microbat  NNNNN
       White-throated sparrow  =====
             Peregrine falcon  =====
                 Saker falcon  =====
                      Wallaby  =====
                  Rock pigeon  =====
                   Budgerigar  =====
          Medium ground finch  =====
              Green seaturtle  =====
               Bactrian camel  =====
                       Alpaca  =====
                 Mallard duck  =====
           American alligator  =====
          Collared flycatcher  =====
           Tibetan ground jay  =====
                X. tropicalis  =====
                     Platypus  =====
                      Opossum  =====
               Painted turtle  =====
     Chinese softshell turtle  =====

Inserts between block 5 and 6 in window
B D                 Squirrel 9bp
                Prairie vole 37bp
B D                    Mouse 4bp
B D           Naked mole-rat 2bp
B D               Guinea pig 2bp
                  Chinchilla 2bp
            Brush-tailed rat 2bp
B D                   Rabbit 9bp
B D                     Pika 9bp
B D                      Pig 15bp
B D                  Dolphin 11bp
                Killer whale 11bp
            Tibetan antelope 11bp
B D                      Cow 11bp
B D                    Sheep 11bp
               Domestic goat 11bp
B D                    Horse 10bp
B D         White rhinoceros 7bp
B D                      Cat 11bp
B D                      Dog 11bp
B D                  Ferret  11bp
B D                    Panda 11bp
              Pacific walrus 11bp
                Weddell seal 11bp
            Black flying-fox 11bp
B D                  Megabat 11bp
               Big brown bat 29bp
        David's myotis (bat) 29bp
B D                    Shrew 15bp
             Star-nosed mole 18bp

Alignment block 6 of 177 in window, 36875089 - 36875102, 14 bps 
B D                     Human  cccttataatcg-ca
B D                     Chimp  cccttataatcgtca
B D                   Gorilla  cccttataatcgtca
B D                 Orangutan  cccttataatcgtca
B D                    Gibbon  cccttataatcgtca
B D                    Rhesus  cccttataatcgtca
B D       Crab-eating macaque  cccttataatcgtca
B D                    Baboon  cccttataatcgtca
B D              Green monkey  cccttataatcgtca
B D                  Marmoset  cccttataatcgtca
B D           Squirrel monkey  cccttataatcgtca
B D                  Bushbaby  cccttataaccgtca
           Chinese tree shrew  ccc----aa--ggcg
       Lesser Egyptian jerboa  ---gtggagttcaga
B D           Chinese hamster  -------gtcccagt
               Golden hamster  -------gtgtcaga
B D                     Mouse  -----------ctga
B D                    Rabbit  -------acttcaga
B D                      Pika  -------accttaga
B D                       Pig  cccttataattg---
B D                   Dolphin  cgcttacaatcgtca
                 Killer whale  cccttacaatcgtca
             Tibetan antelope  cccttacaatcgtcg
B D                       Cow  cccttataatcatcg
B D                     Sheep  cccttataatcgtcg
                Domestic goat  cccttataatcgtcg
B D                     Horse  cctttataattacca
B D          White rhinoceros  ccattataatcatca
B D                       Cat  cccttataattgtca
B D                       Dog  cccttaaaatggtca
B D                   Ferret   cccttataattgtca
B D                     Panda  cccttataattgcca
               Pacific walrus  cccttataattgtca
                 Weddell seal  cccttataagtgtca
             Black flying-fox  ccctt----------
B D                   Megabat  ccctc----------
                Big brown bat  ctcct----------
         David's myotis (bat)  ctcat----------
B D                     Shrew  tccttacaatggtca
              Star-nosed mole  tctttataatcatca
B D                  Elephant  tccttataacca---
          Cape elephant shrew  ccttgttaagca---
B D                   Manatee  tcattataacca---
             Cape golden mole  cccttaaaaccatca
B D                    Tenrec  gtccttatataa---
                     Aardvark  -ccttataaccgtca
B D           Tasmanian devil  --------ataacca
B D                 Zebrafish  -gcttaaagctggca
B D                  Hedgehog  ===============
B D                  Squirrel  ===============
                Prairie vole  ===============
B D                       Rat  ---------------
B D                Guinea pig  ===============
            Brush-tailed rat  ===============
B D                 Armadillo  ---------------
B D            Naked mole-rat  ===============
                  Chinchilla  ===============
B D                  Microbat  NNNNNNNNNNNNNNN
  D    White-throated sparrow  ===============
  D          Peregrine falcon  ===============
  D              Saker falcon  ===============
B D                   Wallaby  ===============
  D               Rock pigeon  ===============
B D                Budgerigar  ===============
B D       Medium ground finch  ===============
  D           Green seaturtle  ===============
              Bactrian camel  ===============
B D                    Alpaca  ===============
  D              Mallard duck  ===============
B D        American alligator  ===============
  D       Collared flycatcher  ===============
          Tibetan ground jay  ===============
B D             X. tropicalis  ===============
B D                  Platypus  ===============
B D                   Opossum  ===============
  D            Painted turtle  ===============
  D  Chinese softshell turtle  ===============

Inserts between block 6 and 7 in window
B D                Zebrafish 6179bp

Alignment block 7 of 177 in window, 36875103 - 36875139, 37 bps 
B D                     Human  ttcattcc---ttaacc-ac-------------atac-tacg-cat-ctact------------------
B D                     Chimp  ttcattcc---ttaacc-ac-------------atac-tacg-cat-ctact------------------
B D                   Gorilla  ttcattca---ttaacc-ac-------------atac-tacg-cat-ctact------------------
B D                 Orangutan  ttcattca---ttaacc-ac-------------atac-tacg-cat-ctact------------------
B D                    Gibbon  ttcattca---ttaacc-ac-------------atac-tacg-cat-ctact------------------
B D                    Rhesus  ttcattca---ttaacc-ac-------------acac-tacg-cat-ctaca------------------
B D       Crab-eating macaque  ttcattca---ttaacc-ac-------------acac-tacg-cat-ctaca------------------
B D                    Baboon  ttcattca---ttaacc-ac-------------acac-tacg-cat-ctaca------------------
B D              Green monkey  ttcattca---ttaacc-ac-------------ataa-tacg-cat-ctaca------------------
B D                  Marmoset  ttcattca---ttaacc-aa-------------atac-tacg-cat-ttact------------------
B D           Squirrel monkey  ttcattca---ttaacc-aa-------------atac-tacg-cat-ctact------------------
B D                  Bushbaby  ttcgttca---ttatcc-aa-------------atat-taag-aat-ctact------------------
           Chinese tree shrew  ctcatgcg---ctaagc-aa-------------acat-aaag-cac-ctact------------------
B D                  Squirrel  -----------------------------------------g-cat-ctatc------------------
       Lesser Egyptian jerboa  ------------------aa-------------tgac-g-gg-aac-gggca------------------
B D           Chinese hamster  ----------------------------------------ga-aac-aaaca------------------
               Golden hamster  ----------------------------------------gt-tat-ccaca------------------
B D                     Mouse  ----------------------------------------gc-cat-ccaca------------------
B D                       Rat  -------------------------------------------cat-tcaca------------------
B D            Naked mole-rat  -------------------g-------------tgtc-acga-cat-ctat-------------------
B D                Guinea pig  -------------------g-------------tgcc-acaa-cac-ctacc------------------
                   Chinchilla  -------------------g-------------tgtc-acca-cac-ctacc------------------
             Brush-tailed rat  -------------------g-------------tgtc-caga-cac-caacc------------------
B D                    Rabbit  attctctc---tcacgt-at-------------taac-caag-tat-taaga------------------
B D                      Pika  atcctctt---tcactt-ag-------------gaac-caaa-tat-tcaga------------------
B D                       Pig  -tcattca---ttaacc-aa-------------atat-taag-cat-ctact------------------
B D                   Dolphin  ttcattca---ttaacc-aa-------------atat-taag-cat-ctgct------------------
                 Killer whale  ttcattca---ttaacc-aa-------------atat-taag-cat-ctgct------------------
             Tibetan antelope  ttctttca---ttaacc-ag-------------ctat-taag-caa-atact------------------
B D                       Cow  ttcattca---ttaacc-ag-------------ctat-taag-caa-atac-------------------
B D                     Sheep  ttcattca---ttatcc-ag-------------ctat-taag-caa-atact------------------
                Domestic goat  ttcattca---ttaacc-ag-------------ctat-taag-caa-atact------------------
B D                     Horse  ttcactca---ttaatc-aa-------------atat-taagacat-ccact------------------
B D          White rhinoceros  ttcattca---ttaacc-aa-------------atat-taag-cat-ctact------------------
B D                       Cat  tttattca---ttaacc-aa-------------atat-taag-cat-ctact------------------
B D                       Dog  tttattca---ttaacc-aa-------------atat-taag-cat-ccact------------------
B D                   Ferret   cttattca---ttaacc-aa-------------atat-taag-cat-ccact------------------
B D                     Panda  tttattca---ttaacc-aa-------------atat-taag-cat-ccact------------------
               Pacific walrus  tttattca---ttaacc-aa-------------atat-taag-cat-ccact------------------
                 Weddell seal  tttattca---ttaacc-aa-------------atac-taag-cat-ccact------------------
             Black flying-fox  -ataatta------acc-aa-------------atat-taag-cat-ata--------------------
B D                   Megabat  -atcctcaggacccact-ga-------------acacgtgaa-cac-cga--------------------
                Big brown bat  -tcattca---ttaacc-aa-------------atac-taag-cac-ct---------------------
         David's myotis (bat)  -tcattca---ttcacc-aa-------------atac-taag-cat-ct---------------------
B D                     Shrew  ttcattcg---tcatta-a--------------ctat-taag-cat-caat-------------------
              Star-nosed mole  ttcattca---ttaatc-aaatgttgtaactttctat-taag-aacacaatt------------------
B D                  Elephant  -tcattaa---ttcatc-aa-------------ttat-taag-cat-ccact------------------
          Cape elephant shrew  ------aa---tcc---------------------at-taag-cag-ctacc------------------
B D                   Manatee  -tcattaa---tttatctaa-------------gtat-taag-cat-ctacc------------------
             Cape golden mole  ttcagtca---ttaacc-aa-------------atac-taag-cat-ctacctctaccgtggtgggttaa
B D                    Tenrec  --caacga---tttatt-aa-------------ctat-taag-cac-ttatc----------------at
                     Aardvark  ttcattca---ttaacc-aa-------------acat-taag-cat-ctacc------------------
B D           Tasmanian devil  cttacttt---ttaaca-aa-------------atgt-ta---cat-atatt------------------
B D                  Hedgehog  ======================================================================
                Prairie vole  ======================================================================
B D                 Armadillo  ----------------------------------------------------------------------
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  ---g--t-------------------------g-------------------------------------
                        Chimp  ---g--t-------------------------g-------------------------------------
                      Gorilla  ---g--t-------------------------g-------------------------------------
                    Orangutan  ---g--t-------------------------g-------------------------------------
                       Gibbon  ---g--t-------------------------g-------------------------------------
                       Rhesus  ---g--t-------------------------g-------------------------------------
          Crab-eating macaque  ---g--t-------------------------g-------------------------------------
                       Baboon  ---g--t-------------------------g-------------------------------------
                 Green monkey  ---g--t-------------------------g-------------------------------------
                     Marmoset  ---g--t-------------------------g-------------------------------------
              Squirrel monkey  ---g--t-------------------------g-------------------------------------
                     Bushbaby  ---g--t-------------------------g-------------------------------------
           Chinese tree shrew  ---a--t-------------------------a-------------------------------------
                     Squirrel  ---g--t-------------------------g-------------------------------------
       Lesser Egyptian jerboa  ---g--t-------------------------g-------------------------------------
              Chinese hamster  ---a--c-------------------------c-------------------------------------
               Golden hamster  ---g--t-------------------------g-------------------------------------
                        Mouse  ---g--c-------------------------g-------------------------------------
                          Rat  ---g--t-------------------------g-------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ---t--t-------------------------a-------------------------------------
                   Chinchilla  ---t--t-------------------------a-------------------------------------
             Brush-tailed rat  ---t--t-------------------------a-------------------------------------
                       Rabbit  ---g--c---------------------------------------------------------------
                         Pika  ---a--tctactaattggcatttactttaggaa-------------------------------------
                          Pig  ---g--t-------------------------g-------------------------------------
                      Dolphin  ---g--t-------------------------g-------------------------------------
                 Killer whale  ---g--t-------------------------g-------------------------------------
             Tibetan antelope  ---g--t-------------------------g-------------------------------------
                          Cow  ------t-------------------------g-------------------------------------
                        Sheep  ---g--t-------------------------g-------------------------------------
                Domestic goat  ---g--t-------------------------g-------------------------------------
                        Horse  -gtg------------------------------------------------------------------
             White rhinoceros  -gtg------------------------------------------------------------------
                          Cat  -g-g--t-------------------------g-------------------------------------
                          Dog  -gtgtat-------------------------a-------------------------------------
                      Ferret   -gtg--t-------------------------a-------------------------------------
                        Panda  -gtg--t-------------------------c-------------------------------------
               Pacific walrus  -gtg--t-------------------------a-------------------------------------
                 Weddell seal  -gtg--t-------------------------a-------------------------------------
             Black flying-fox  ---g--t-------------------------g-------------------------------------
                      Megabat  ---g--c-------------------------g-------------------------------------
                Big brown bat  ---g--t-------------------------g-------------------------------------
         David's myotis (bat)  ---g--t-------------------------g-------------------------------------
                        Shrew  ------t-------------------------g-------------------------------------
              Star-nosed mole  ---c--t-------------------------g-------------------------------------
                     Elephant  ---g--t-------------------------g-------------------------------------
          Cape elephant shrew  ---g--c-------------------------g-------------------------------------
                      Manatee  ---a--t-------------------------g-------------------------------------
             Cape golden mole  tgcg--c-------------------------aggattgcaaggtcggtttgaaccgtaaggtcggaggt
                       Tenrec  tgag--c-------------------------a-------------------------------------
                     Aardvark  ---a--c-------------------------g-------------------------------------
              Tasmanian devil  ---a--t-------------------------g-------------------------------------
                     Hedgehog  ======================================================================
                 Prairie vole  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ----------------------------------------------------------------------
                        Chimp  ----------------------------------------------------------------------
                      Gorilla  ----------------------------------------------------------------------
                    Orangutan  ----------------------------------------------------------------------
                       Gibbon  ----------------------------------------------------------------------
                       Rhesus  ----------------------------------------------------------------------
          Crab-eating macaque  ----------------------------------------------------------------------
                       Baboon  ----------------------------------------------------------------------
                 Green monkey  ----------------------------------------------------------------------
                     Marmoset  ----------------------------------------------------------------------
              Squirrel monkey  ----------------------------------------------------------------------
                     Bushbaby  ----------------------------------------------------------------------
           Chinese tree shrew  ----------------------------------------------------------------------
                     Squirrel  ----------------------------------------------------------------------
       Lesser Egyptian jerboa  ----------------------------------------------------------------------
              Chinese hamster  ----------------------------------------------------------------------
               Golden hamster  ----------------------------------------------------------------------
                        Mouse  ----------------------------------------------------------------------
                          Rat  ----------------------------------------------------------------------
               Naked mole-rat  ----------------------------------------------------------------------
                   Guinea pig  ----------------------------------------------------------------------
                   Chinchilla  ----------------------------------------------------------------------
             Brush-tailed rat  ----------------------------------------------------------------------
                       Rabbit  ----------------------------------------------------------------------
                         Pika  ----------------------------------------------------------------------
                          Pig  ----------------------------------------------------------------------
                      Dolphin  ----------------------------------------------------------------------
                 Killer whale  ----------------------------------------------------------------------
             Tibetan antelope  ----------------------------------------------------------------------
                          Cow  ----------------------------------------------------------------------
                        Sheep  ----------------------------------------------------------------------
                Domestic goat  ----------------------------------------------------------------------
                        Horse  ----------------------------------------------------------------------
             White rhinoceros  ----------------------------------------------------------------------
                          Cat  ----------------------------------------------------------------------
                          Dog  ----------------------------------------------------------------------
                      Ferret   ----------------------------------------------------------------------
                        Panda  ----------------------------------------------------------------------
               Pacific walrus  ----------------------------------------------------------------------
                 Weddell seal  ----------------------------------------------------------------------
             Black flying-fox  ----------------------------------------------------------------------
                      Megabat  ----------------------------------------------------------------------
                Big brown bat  ----------------------------------------------------------------------
         David's myotis (bat)  ----------------------------------------------------------------------
                        Shrew  ----------------------------------------------------------------------
              Star-nosed mole  ----------------------------------------------------------------------
                     Elephant  ----------------------------------------------------------------------
          Cape elephant shrew  ----------------------------------------------------------------------
                      Manatee  ----------------------------------------------------------------------
             Cape golden mole  tcaagctcaccagctgcgcctcagaaaccctatacagagtcgctatgggtcggagccgactcgagggtac
                       Tenrec  ----------------------------------------------------------------------
                     Aardvark  ----------------------------------------------------------------------
              Tasmanian devil  ----------------------------------------------------------------------
                     Hedgehog  ======================================================================
                 Prairie vole  ======================================================================
                    Armadillo  ----------------------------------------------------------------------
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ----------------------------t--------------g
                        Chimp  ----------------------------t--------------g
                      Gorilla  ----------------------------t--------------g
                    Orangutan  ----------------------------t--------------g
                       Gibbon  ----------------------------t--------------g
                       Rhesus  ----------------------------t--------------g
          Crab-eating macaque  ----------------------------t--------------g
                       Baboon  ----------------------------t--------------g
                 Green monkey  ----------------------------t--------------g
                     Marmoset  ----------------------------t--------------g
              Squirrel monkey  ----------------------------t--------------g
                     Bushbaby  ----------------------------t--------------g
           Chinese tree shrew  ----------------------------a--------------g
                     Squirrel  ----------------------------t--------------g
       Lesser Egyptian jerboa  ----------------------------t--------------g
              Chinese hamster  ----------------------------ccccttcttccccctg
               Golden hamster  ----------------------------c--------------g
                        Mouse  ----------------------------c--------------g
                          Rat  ----------------------------c--------------g
               Naked mole-rat  --------------------------------------------
                   Guinea pig  ----------------------------t--------------g
                   Chinchilla  ----------------------------t--------------g
             Brush-tailed rat  ----------------------------t--------------g
                       Rabbit  ----------------------------t--------------g
                         Pika  ----------------------------c--------------g
                          Pig  ----------------------------t--------------g
                      Dolphin  ----------------------------t--------------g
                 Killer whale  ----------------------------t--------------g
             Tibetan antelope  ----------------------------t--------------g
                          Cow  ----------------------------t--------------g
                        Sheep  ----------------------------t--------------g
                Domestic goat  ----------------------------t--------------g
                        Horse  ----------------------------t--------------c
             White rhinoceros  ----------------------------t--------------g
                          Cat  ----------------------------t--------------g
                          Dog  ----------------------------t--------------g
                      Ferret   ----------------------------t--------------g
                        Panda  ----------------------------t--------------g
               Pacific walrus  ----------------------------t--------------g
                 Weddell seal  ----------------------------t--------------g
             Black flying-fox  ----------------------------c--------------g
                      Megabat  ----------------------------c---------------
                Big brown bat  ----------------------------t--------------g
         David's myotis (bat)  ----------------------------t--------------g
                        Shrew  ----------------------------t--------------a
              Star-nosed mole  ----------------------------t--------------g
                     Elephant  -----------------------tgtcat--------------g
          Cape elephant shrew  --------------------------------------------
                      Manatee  -----------------------tgtcag--------------g
             Cape golden mole  ttaacaccaccaacaacaccgcttgtcag--------------g
                       Tenrec  ----------------------------g--------------g
                     Aardvark  -------------------------tctg--------------g
              Tasmanian devil  ----------------------------t--------------t
                     Hedgehog  ============================================
                 Prairie vole  ============================================
                    Armadillo  --------------------------------------------
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ============================================
             Peregrine falcon  ============================================
                 Saker falcon  ============================================
                      Wallaby  ============================================
                  Rock pigeon  ============================================
                   Budgerigar  ============================================
          Medium ground finch  ============================================
              Green seaturtle  ============================================
               Bactrian camel  ============================================
                       Alpaca  ============================================
                 Mallard duck  ============================================
           American alligator  ============================================
          Collared flycatcher  ============================================
           Tibetan ground jay  ============================================
                    Zebrafish  ============================================
                X. tropicalis  ============================================
                     Platypus  ============================================
                      Opossum  ============================================
               Painted turtle  ============================================
     Chinese softshell turtle  ============================================

Inserts between block 7 and 8 in window
B D                  Megabat 7bp
B D                 Elephant 2bp
B D                  Manatee 2bp
            Cape golden mole 2bp
B D                   Tenrec 2bp
                    Aardvark 2bp

Alignment block 8 of 177 in window, 36875140 - 36875143, 4 bps 
B D                     Human  gc---a-------------------------------------t
B D                     Chimp  gc---a-------------------------------------t
B D                   Gorilla  gc---a-------------------------------------t
B D                 Orangutan  gc---a-------------------------------------t
B D                    Gibbon  gc---a-------------------------------------t
B D                    Rhesus  gc---a-------------------------------------t
B D       Crab-eating macaque  gc---a-------------------------------------t
B D                    Baboon  gc---a-------------------------------------t
B D              Green monkey  gc---a-------------------------------------t
B D                  Marmoset  gc---a-------------------------------------t
B D           Squirrel monkey  ac---a-------------------------------------t
B D                  Bushbaby  acatta-------------------------------------t
           Chinese tree shrew  gc---a-------------------------------------t
B D                  Squirrel  gc---a-------------tcattctggcctctga---------
       Lesser Egyptian jerboa  gg---aagctctctactgt-------------------------
B D           Chinese hamster  tg---a--------------------------------------
               Golden hamster  cg---a--------------------------------------
B D                     Mouse  ct---a--------------------------------------
B D                       Rat  cg---a--------------------------------------
B D                Guinea pig  gc---a-----------------------------ctatt----
                   Chinchilla  gt---a-----------------------------ttgttctag
             Brush-tailed rat  gc---a--------------------------------------
B D                    Rabbit  g-------------------------------------------
B D                      Pika  g-------------------------------------------
B D                       Pig  tg---t-------------------------------------a
B D                   Dolphin  tc---a-------------------------------------g
                 Killer whale  tc---a-------------------------------------g
             Tibetan antelope  tc---a-------------------------------------g
B D                       Cow  tc---a-------------------------------------g
B D                     Sheep  tc---a-------------------------------------g
                Domestic goat  tc---a-------------------------------------g
B D                     Horse  tc---a-------------------------------------g
B D          White rhinoceros  tc---a-------------------------------------g
B D                       Cat  tc---a-------------------------------------g
B D                       Dog  tc---a-------------------------------------g
B D                   Ferret   tc---a-------------------------------------g
B D                     Panda  tc---a-------------------------------------g
               Pacific walrus  tc---a-------------------------------------g
                 Weddell seal  tc---a-------------------------------------g
             Black flying-fox  tc---t-------------------------------------g
                Big brown bat  tc---c-------------------------------------g
         David's myotis (bat)  cc---c-------------------------------------g
B D                     Shrew  tc---a-------------------------------------g
              Star-nosed mole  gc---g-------------------------------------c
B D                  Elephant  -------------------------------------------t
B D                   Manatee  -------------------------------------------t
             Cape golden mole  -------------------------------------------t
B D                    Tenrec  -------------------------------------------t
                     Aardvark  -------------------------------------------t
B D           Tasmanian devil  --tcaa--------------------------------------
B D                  Hedgehog  ============================================
         Cape elephant shrew  --------------------------------------------
                Prairie vole  ============================================
B D                 Armadillo  --------------------------------------------
B D            Naked mole-rat  --------------------------------------------
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ============================================
  D          Peregrine falcon  ============================================
  D              Saker falcon  ============================================
B D                   Wallaby  ============================================
  D               Rock pigeon  ============================================
B D                Budgerigar  ============================================
B D       Medium ground finch  ============================================
  D           Green seaturtle  ============================================
              Bactrian camel  ============================================
B D                    Alpaca  ============================================
  D              Mallard duck  ============================================
B D        American alligator  ============================================
  D       Collared flycatcher  ============================================
          Tibetan ground jay  ============================================
B D                 Zebrafish  ============================================
B D             X. tropicalis  ============================================
B D                  Platypus  ============================================
B D                   Megabat  ============================================
B D                   Opossum  ============================================
  D            Painted turtle  ============================================
  D  Chinese softshell turtle  ============================================

Inserts between block 8 and 9 in window
B D          Chinese hamster 6bp
              Golden hamster 5bp
B D                    Mouse 5bp
B D                      Rat 5bp
B D                      Pig 9bp
B D                  Dolphin 9bp
                Killer whale 9bp
            Tibetan antelope 9bp
B D                      Cow 9bp
B D                    Sheep 9bp
               Domestic goat 9bp
B D                    Horse 9bp
B D         White rhinoceros 9bp
B D                      Cat 7bp
B D                      Dog 10bp
B D                  Ferret  29bp
B D                    Panda 7bp
              Pacific walrus 7bp
                Weddell seal 7bp
            Black flying-fox 4bp
               Big brown bat 7bp
        David's myotis (bat) 7bp
B D                    Shrew 7bp
             Star-nosed mole 7bp
B D                 Elephant 3bp
B D                  Manatee 3bp
            Cape golden mole 3bp
B D                   Tenrec 3bp
                    Aardvark 3bp

Alignment block 9 of 177 in window, 36875144 - 36875155, 12 bps 
B D                     Human  tctaggcgg--------------------ggg
B D                     Chimp  tctaggcgg--------------------ggg
B D                   Gorilla  tctaggcgg--------------------ggg
B D                 Orangutan  tctaggcgg--------------------ggg
B D                    Gibbon  tctaggcgg--------------------ggg
B D                    Rhesus  tctaggcgc--------------------tgg
B D       Crab-eating macaque  tctaggcgc--------------------tgg
B D                    Baboon  tctaggcgc--------------------tgg
B D              Green monkey  tctaggcgc--------------------tgg
B D                  Marmoset  tccaggagc--------------------tgg
B D           Squirrel monkey  tccaggagc--------------------tgg
B D                  Bushbaby  tctaggcgc--------------------tgg
           Chinese tree shrew  tataggcac--------------------tga
B D            Naked mole-rat  ----gcggc--------------------tgg
B D                Guinea pig  -ctaggcgc--------------------tgg
                   Chinchilla  cctagccgc--------------------tgg
             Brush-tailed rat  -ctagcggc--------------------agg
B D                       Pig  tctccctaa-----------------------
B D                   Dolphin  tctccacaa-----------------------
                 Killer whale  tctccacaa-----------------------
             Tibetan antelope  tctacacaa-----------------------
B D                       Cow  tctacacaa-----------------------
B D                     Sheep  tctacacaa-----------------------
                Domestic goat  tctacacaa-----------------------
B D                     Horse  cctcctcaa-----------------------
B D          White rhinoceros  tctccacaa-----------------------
B D                       Cat  tctagacatcattttctccacaa---------
B D                       Dog  tctagacat-----------------------
B D                     Panda  tctagacat-----------------------
               Pacific walrus  tctagacac-----------------------
                 Weddell seal  tctagacac-----------------------
             Black flying-fox  tttaggcat--------------tat------
                Big brown bat  tctagccat--------------ctt------
         David's myotis (bat)  tctcgccac--------------att------
B D                     Shrew  tttaggctc-----------------tgg---
              Star-nosed mole  tctggacac-----------------tat---
B D                  Elephant  tctaggcca--------------------tgg
B D                   Manatee  tctaggcca--------------------tgg
             Cape golden mole  tctaagcca--------------------tga
B D                    Tenrec  tctaggccc--------------------tgg
                     Aardvark  tctagacca--------------------tgg
B D                 Armadillo  ------gcg--------------------ttg
B D           Tasmanian devil  tcaaaacag--------------------gta
B D                  Hedgehog  ================================
      Lesser Egyptian jerboa  --------------------------------
         Cape elephant shrew  --------------------------------
B D                      Pika  --------------------------------
B D                  Squirrel  --------------------------------
              Golden hamster  ================================
                Prairie vole  ================================
B D                       Rat  ================================
B D                     Mouse  ================================
B D           Chinese hamster  ================================
B D                   Ferret   ================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                    Rabbit  --------------------------------
  D    White-throated sparrow  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
B D                   Wallaby  ================================
  D               Rock pigeon  ================================
B D                Budgerigar  ================================
B D       Medium ground finch  ================================
  D           Green seaturtle  ================================
              Bactrian camel  ================================
B D                    Alpaca  ================================
  D              Mallard duck  ================================
B D        American alligator  ================================
  D       Collared flycatcher  ================================
          Tibetan ground jay  ================================
B D                 Zebrafish  ================================
B D             X. tropicalis  ================================
B D                  Platypus  ================================
B D                   Megabat  ================================
B D                   Opossum  ================================
  D            Painted turtle  ================================
  D  Chinese softshell turtle  ================================

Inserts between block 9 and 10 in window
B D                      Dog 15bp
B D                    Panda 14bp
              Pacific walrus 13bp
                Weddell seal 14bp
            Black flying-fox 7bp
               Big brown bat 245bp
        David's myotis (bat) 6bp

Alignment block 10 of 177 in window, 36875156 - 36875159, 4 bps 
B D                     Human  cc-gt
B D                     Chimp  cc-gt
B D                   Gorilla  cc-gt
B D                 Orangutan  cc-gt
B D                    Gibbon  cc-gt
B D                    Rhesus  cc-gt
B D       Crab-eating macaque  cc-gt
B D                    Baboon  cc-gt
B D              Green monkey  cc-gt
B D                  Marmoset  cc-ac
B D           Squirrel monkey  cc-ac
B D                  Bushbaby  ac-gt
           Chinese tree shrew  ac-at
B D                  Squirrel  ac-at
       Lesser Egyptian jerboa  ac-ct
                 Prairie vole  ac-at
B D           Chinese hamster  ga-ac
               Golden hamster  ac-at
B D            Naked mole-rat  ac-aa
B D                Guinea pig  ac---
                   Chinchilla  ac-ag
             Brush-tailed rat  ac-ag
B D                    Rabbit  tcatt
B D                      Pika  tc-ct
             Black flying-fox  ac-aa
B D                   Megabat  ac-aa
                Big brown bat  cc-ac
         David's myotis (bat)  ac-ac
B D                     Shrew  at-aa
              Star-nosed mole  gc-aa
B D                  Elephant  ---ac
B D                   Manatee  ---ac
             Cape golden mole  ---gc
B D                    Tenrec  ---ac
                     Aardvark  ---cc
B D                 Armadillo  ---ac
B D           Tasmanian devil  ----t
B D                  Hedgehog  =====
         Cape elephant shrew  -----
B D                       Rat  =====
B D                     Mouse  =====
               Domestic goat  -----
B D                       Cow  -----
B D                     Sheep  -----
            Tibetan antelope  -----
B D                   Ferret   =====
B D          White rhinoceros  -----
B D                     Horse  -----
                Killer whale  -----
B D                       Dog  =====
              Pacific walrus  =====
B D                     Panda  =====
B D                       Cat  -----
B D                  Microbat  NNNNN
  D    White-throated sparrow  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
B D                   Wallaby  =====
  D               Rock pigeon  =====
B D                Budgerigar  =====
B D       Medium ground finch  =====
  D           Green seaturtle  =====
              Bactrian camel  =====
B D                    Alpaca  =====
  D              Mallard duck  =====
B D        American alligator  =====
  D       Collared flycatcher  =====
          Tibetan ground jay  =====
B D                 Zebrafish  =====
B D             X. tropicalis  =====
B D                  Platypus  =====
                Weddell seal  =====
B D                   Dolphin  -----
B D                   Opossum  =====
  D            Painted turtle  =====
B D                       Pig  -----
  D  Chinese softshell turtle  =====

Inserts between block 10 and 11 in window
B D                 Elephant 2bp
B D                  Manatee 2bp
            Cape golden mole 2bp
B D                   Tenrec 1bp
                    Aardvark 4bp
B D                Armadillo 2bp

Alignment block 11 of 177 in window, 36875160 - 36875188, 29 bps 
B D                     Human  aacacc-a--gt--------gca-g-a-aaaacacaac---ctctt
B D                     Chimp  aacacc-a--gt--------gca-g-a-aaaacacaac---ctctt
B D                   Gorilla  aacacc-a--gt--------gaa-g-a-aaaacacaac---ctctt
B D                 Orangutan  aacacc-a--gt--------gca-g-a-aaaacacaac---ctctt
B D                    Gibbon  aacacc-a--gt--------gca-g-a-aaa--acaac---ctctt
B D                    Rhesus  aacacc-a--gt--------gca-g-a-aaaacacaac---ctctt
B D       Crab-eating macaque  aacacc-a--gt--------gca-g-a-aaaacacaac---ctctt
B D                    Baboon  aacacc-a--gt--------gca-g-a-aaaacacaac---ctctt
B D              Green monkey  aacacc-a--gt--------gca-g-a-aaaacacaac---ctctt
B D                  Marmoset  aacacc-a--gt--------aca-g-a-aaaacacaac---ctctt
B D           Squirrel monkey  aacacc-a--gt--------gca-g-a-aaaacacaac---ctctt
B D                  Bushbaby  aacacc-a--gc--------aaa-t-acaaaaccaaac---ctctt
           Chinese tree shrew  aacacc-g--gt--------gga-g-a-aaaataaaac---ctctt
B D                  Squirrel  aatacc-a--gc--------gga-g-a-aaaataaaac---ctccc
       Lesser Egyptian jerboa  gatacc-g--gt--------ggc-c-a-aaagcccaat---ttctc
                 Prairie vole  aacacc-a--gc--------gaa-g-g-aaagctaaac---ttc--
B D           Chinese hamster  accagcga--ag--------gaa-g-g-aaagctaaac---ttc--
               Golden hamster  aacagt-a--gc--------aaa-g-a-aaagctcaac---ttc--
B D                     Mouse  aacacc-t--gc--------gaa-g-g-aaagttaaac---ttc--
B D                       Rat  agcacc-t--gc--------gaa-g-g-gaagctaaac---ttc--
B D            Naked mole-rat  aacgcc-a--gt--------gga-c-a-aaaaccaaac---ctttt
B D                Guinea pig  -acacc-a--gt--------aaa-c-a-aaaaccaaac---ctttt
                   Chinchilla  aacacc-a--g-------------c-a-gaaaaaaacccaaccttt
             Brush-tailed rat  aacacc-a--gt--------aga-c-a-gaaaggaacc---ctttt
B D                    Rabbit  aacagc-a--gt--------gga-g-a-aaaactaatc--------
B D                      Pika  aacacc-t--gtag------gga-a-a-aaaaaaaatc--------
B D                       Pig  aacatc-a--gt--------gga-g-a-aaaacaaaac---ctcat
B D                   Dolphin  aacaac-a--gt--------ggagg-a-aaaaaaaaaa---c-ctc
                 Killer whale  aacaac-a--gt--------gga-g-a-aaaaaaaaaa---c-ctc
             Tibetan antelope  aactcc-a--gtttggggc-ggc-g-a-cgggggagga---c-ctt
B D                       Cow  aacacc-a--gtttggggcgggc-c-g-gggaggagaa---c-ctc
B D                     Sheep  aactcc-a--gtttggggc-ggc-g-a-ggggggagga---c-ctt
                Domestic goat  aactcc-a--gtttggggc-ggc-g-a-ggggggagga---c-ctt
B D                     Horse  aacacc-a--cc--------gga-g-a-aacacagaac---ctctt
B D          White rhinoceros  aacacc-a--gt--------gga-g-a-gaaacaaaac---ctgtt
B D                       Cat  aacacc-a--gt--------gga-g-a-aaaacaaaac---ttctt
B D                       Dog  aatacc-a--gt--------gga-g-a-aaaacaaaac---ttctt
B D                   Ferret   aagacc-a--gt--------gaa-gaa-aaaacaaaac---ttctc
B D                     Panda  aatccc-a--gt--------gga-g-a-aaaacaaaac---ttctt
               Pacific walrus  aacacc-a--gt--------gga-g-a-agaacaaaac---ttcct
                 Weddell seal  aacacc-a--gt--------gga-g-a-agaacaaaac---ttcct
             Black flying-fox  aacacg-a--gt--------gga-g-a-aacacaaaac---ctctt
B D                   Megabat  aacacc-g--gc--------ggg-a-a-ggggcaaa-----ctctt
                Big brown bat  aacacc-a--gc--------gga-g-g-aagacaaaac---ctctc
         David's myotis (bat)  aacact-a--ga--------gga-g-g-aaaacaaaac---ctttc
B D                     Shrew  aacacc-a--ac--------tgg-c-g-tggg-ggaac---ctctt
              Star-nosed mole  aacagt-a--gc--------gaa-a-a-c----acaac---gtctt
B D                  Elephant  aacacc-c--gt--------gga-g-a-aaaa--aaac---cgctt
          Cape elephant shrew  ----------gt--------gga-g-a-aaaa--------------
B D                   Manatee  atcc------gt--------gga-g-a-aaaacaaaac---ctctt
             Cape golden mole  aacact-c--aa--------ggagg-a-aaaacaaaac---ttctg
B D                    Tenrec  aacatc-t--gt--------gga-g-a-aaaaggacac---ttctg
                     Aardvark  aacacc-c--gt--------ggagg-a-aaaacaaaat---ctctt
B D                 Armadillo  aacacc-atggt--------gga-g-a-aaaacaaaat---ctttt
B D           Tasmanian devil  -acaca-c--at--------gca---a-ataatgtaac---ctgtt
B D                  Hedgehog  ==============================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ==============================================
  D          Peregrine falcon  ==============================================
  D              Saker falcon  ==============================================
B D                   Wallaby  ==============================================
  D               Rock pigeon  ==============================================
B D                Budgerigar  ==============================================
B D       Medium ground finch  ==============================================
  D           Green seaturtle  ==============================================
              Bactrian camel  ==============================================
B D                    Alpaca  ==============================================
  D              Mallard duck  ==============================================
B D        American alligator  ==============================================
  D       Collared flycatcher  ==============================================
          Tibetan ground jay  ==============================================
B D                 Zebrafish  ==============================================
B D             X. tropicalis  ==============================================
B D                  Platypus  ==============================================
B D                   Opossum  ==============================================
  D            Painted turtle  ==============================================
  D  Chinese softshell turtle  ==============================================

Inserts between block 11 and 12 in window
B D          Tasmanian devil 2571bp

Alignment block 12 of 177 in window, 36875189 - 36875205, 17 bps 
B D                     Human  gtcctc-tt-agagctt---ac
B D                     Chimp  gtcctc-tt-agagctt---ac
B D                   Gorilla  ctcctc-tt-agagctt---ac
B D                 Orangutan  gtcctc-tt-agagctt---ac
B D                    Gibbon  gccctt-tt-agagctt---ac
B D                    Rhesus  gtcctc-tt-agagctt---ac
B D       Crab-eating macaque  gtcctc-tt-agagctt---ac
B D                    Baboon  gtcctc-tt-agagctt---ac
B D              Green monkey  gtcctc-tt-agagctt---ac
B D                  Marmoset  gtcctt-ttaagagctt---ac
B D           Squirrel monkey  gtcctc-tt-agagctt---ac
B D                  Bushbaby  gtcctc-ct-ggagctt---ac
           Chinese tree shrew  gtcttc-ca-ggagctt---ag
B D                  Squirrel  gtcctc-ct-ggagctt---aa
       Lesser Egyptian jerboa  gacctt-ct-gaagctt---at
                 Prairie vole  -atctt-ct-caagctg---cc
B D           Chinese hamster  -atcgc-tt-gaagctg---cc
               Golden hamster  -atcac-ct-gaagctg---cc
B D                     Mouse  -atttc-ct-gaagccc---tg
B D                       Rat  -atttc-ct-gaagccc---tg
B D            Naked mole-rat  gtcctc-tt-ggagctt---ac
B D                Guinea pig  gtcctc-ca-ggagctt---ac
                   Chinchilla  gtcctc-ct-ggagttt---ac
             Brush-tailed rat  gtcgtc-ct-ggaggtt---ac
B D                    Rabbit  --------t-ggagggt---ac
B D                      Pika  --------t-ggagaat---at
B D                       Pig  gccctc-ct-ggagttt---ac
B D                   Dolphin  gccctc-ct-agagctt---ac
                 Killer whale  gccctc-ct-agagtct---ac
             Tibetan antelope  gccctc-ct-ggagctt---ac
B D                       Cow  gccctc-cc-ggggctt---ac
B D                     Sheep  gccctc-ct-ggagctt---gc
                Domestic goat  gccctc-ct-ggagctt---ac
B D                     Horse  gccctc-ct-ggagctt---ac
B D          White rhinoceros  cccctc-ct-ggatctc---ac
B D                       Cat  gccctc-ct-ggagttt--aac
B D                       Dog  gcccta-ct-ggagctt--aac
B D                   Ferret   gccctc-ct-ggggctt--aac
B D                     Panda  gccctc-ct-ggagctt--aac
               Pacific walrus  gccctc-ct-ggagctt--aac
                 Weddell seal  gccctc-ct-ggagctt--aac
             Black flying-fox  gccctc-ct-ggagctt---ac
B D                   Megabat  gccctc-ct-------------
                Big brown bat  atcctc-gg-ggagctg---ac
         David's myotis (bat)  ctccgc-gg-ggagctc---ag
B D                     Shrew  gccctc-ca-gta---------
              Star-nosed mole  gccctc-ct-ggagctttt---
B D                  Elephant  gccctc-ct-ggagctt---cc
          Cape elephant shrew  -ctctcttt-aaagttt---ct
B D                   Manatee  gtcctc-ct-agagctt---cc
             Cape golden mole  gccctc-ct-ggagctt---cc
B D                    Tenrec  gccctc-tt-ggagcct---cc
                     Aardvark  gccctc-ct-ggagttt---cc
B D                 Armadillo  gctgtc-ct-ggagttt---at
B D                  Hedgehog  ======================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ======================
  D          Peregrine falcon  ======================
  D              Saker falcon  ======================
B D                   Wallaby  ======================
  D               Rock pigeon  ======================
B D                Budgerigar  ======================
B D       Medium ground finch  ======================
  D           Green seaturtle  ======================
              Bactrian camel  ======================
B D                    Alpaca  ======================
  D              Mallard duck  ======================
B D        American alligator  ======================
  D       Collared flycatcher  ======================
          Tibetan ground jay  ======================
B D                 Zebrafish  ======================
B D             X. tropicalis  ======================
B D                  Platypus  ======================
B D           Tasmanian devil  ======================
B D                   Opossum  ======================
  D            Painted turtle  ======================
  D  Chinese softshell turtle  ======================

Inserts between block 12 and 13 in window
B D                 Squirrel 1bp
B D                    Mouse 1bp
B D                      Rat 1bp
B D                      Pig 33bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 7bp
B D                    Sheep 3bp
               Domestic goat 3bp

Alignment block 13 of 177 in window, 36875206 - 36875320, 115 bps 
B D                     Human  attgcactgggg--a-aggaga------------gata----ag----aagataa----acaagtatgga
B D                     Chimp  attgcactgggg--a-aggaga------------gata----ag----aagataa----acaagtatgga
B D                   Gorilla  attgcactgggg--a-aggaga------------gata----ag----aagataa----acaagtatgga
B D                 Orangutan  attgcactgggg--a-aggaga------------gata----ag----aagataa----acaagtaggga
B D                    Gibbon  attgcactgggg--a-aggaga------------gat-----------aagataa----acaagtacgga
B D                    Rhesus  attcccctgggg--a-aggaga------------ga-------g----aagataa----acaagtatgga
B D       Crab-eating macaque  attcccctgggg--a-aggaga------------ga-------g----aagataa----acaagtatgga
B D                    Baboon  attcccctgggg--a-aggaga------------ga-------g----aagataa----acaagtatgga
B D              Green monkey  attcccctgggg--a-aggaga------------ga-------g----aagataa----acaagtatgga
B D                  Marmoset  attccactaggg--a-aggaga------------gata----ag----aagataa----acatgtacgaa
B D           Squirrel monkey  atttcactaggg--a-aggaga------------gata----tc----aacataa----acatgtacgga
B D                  Bushbaby  attctactggtc--a-aagggt------------tata--------------------------------
           Chinese tree shrew  agtccacgggga--a-agaa-----------------------t----aagatta----acaagtacg-a
B D                  Squirrel  catctaccgggg--a-aagaga------------ataa---gac----aagcaa----------------
       Lesser Egyptian jerboa  ggtgtactggga--a-agggaataagataaacaagaaa---gat----aaggtac---------------
                 Prairie vole  gggctactgggc--a-aagagt--------------aa---ggc----aagact----------------
B D           Chinese hamster  gggctactgagc--a-aagagt----------aagaaa---ggc----aatactc---------------
               Golden hamster  -ggctaccgagc--a-aagagt----------aagtaa---ggc----aagact----------------
B D                     Mouse  aggctactggggaaa-aagagc--------------ca---gac----gagata----------------
B D                       Rat  aggctactgggg--a-aagagt--------------aa---gac----aagata----------------
B D            Naked mole-rat  attctactcggg--a-aggaga------------gaaa---gataaacaagaaag----a----------
B D                Guinea pig  attgtacggggc--a-aggaga------------gagg---gag----aagatat---------------
                   Chinchilla  attctactgggg--a-aggaga------------aaag---gat----aagaaag---------------
             Brush-tailed rat  attctgctacgg--a-aggaga------------aaag---gat----aagaaag----a----------
B D                    Rabbit  gttccaataggg--a-aagagg------------aaat---aag----aaaaacc----agtaaga----
B D                      Pika  gttcaaccagag--g-aagagg------------aaat---aat----aattttt----tttaaaa--gc
B D                   Dolphin  attctattg-gt--t-aaaaca------------gata----ac----gagataa----acatgtaag-a
                 Killer whale  attctattg-gt--t-aaaaca------------gata----ac----gagataa----acatgtaag-a
             Tibetan antelope  attctatcg-gt-------aca------------gat-----------gagataa----acaagcatg-a
B D                       Cow  attctatcg-gt--a-caaaca------------gat-----------gagataa----acaagcatg-a
B D                     Sheep  attctatcg-gt-------aca------------gat-----------gagataa----acaagcatg-a
                Domestic goat  attctatcg-gt-------aca------------gat-----------gagataa----acaagcatg-a
B D                     Horse  attctaccgggg--g-aaaaca------------gata----at----aagctaa----acgtgtaag-a
B D          White rhinoceros  attctactaggg--a-aaaaca------------gata----at----aagataa----acatgtaag-a
B D                       Cat  attctactgggg--a-aaaaca------------ggta----at----aagataa----acacgtaag-a
B D                       Dog  gtc---ccgaat--a-aaaaca------------ga-------t----aagataa----acgcgtgag-a
B D                   Ferret   attctacagggc--g-aaaaca------------gata----ct----aagatca----acacgtaag-a
B D                     Panda  attctaccgggg--gaaaaaca------------ggta----at----aagatcc----acacgtaag-a
               Pacific walrus  attctactgggg--g-aaaaca--------------ta----gt----aagatca----acacataag-a
                 Weddell seal  attctactgggg--g-aaaaca------------ggta----gt----aagatca----acacgtaag-a
             Black flying-fox  attctactgggg--a-gaaaca------------gat-----------aaaataa----aaatgtaag-c
B D                   Megabat  ----------gg--g-gaaata------------gaa-----------aaaaata----aactgtgag-a
                Big brown bat  gctccgttg-gg--g-aaaaca------------gat-------------gataa----gcctgcacg-a
         David's myotis (bat)  gctctgttg-gg--g-aaaact------------gat-------------gataa----ccctgcac---
B D                     Shrew  --------------g-aaaatt---------------------------agataa----atatatgac-g
              Star-nosed mole  attctactgggg--g-aaaact------------ggt-----------aagctaa----acatttaag-a
B D                  Elephant  attccactaggg--c-aggaca------------aataacaaat----aagataa----ataagtaaa-a
          Cape elephant shrew  gttctgctaggg--g-aagacg------------a--aataaat----agagaaaggccaccagggat-t
B D                   Manatee  att----taggg--a-aggaca------------gataacaaat----aagataa----ataattaaa-a
             Cape golden mole  atta-----gga--g-aaggca------------gatactagat----aagataa----ataagtaaa-a
B D                    Tenrec  attc------------catcca------------gataataaat----gcgataa----atcaggaag-a
                     Aardvark  actccactaggg--a-aag----------------------------------aa---------------
B D                 Armadillo  attctactgggg--g-aaag-a------------aataataaac----aagataa----ataagtaaa-t
B D                  Hedgehog  ======================================================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  tatgtag-actg----------tcca-aaggataaa-atga-gaa--gg--------gggct-agg----
                        Chimp  tatgtag-actg----------tcca-aaggataaa-atga-gaa--gg--------gggct-agg----
                      Gorilla  tatgtag-actg----------tcca-aaggataaa-atga-gaa--gg--------gggct-agg----
                    Orangutan  tatgtag-actg----------tcca-aaggataaa-atga-gaa--gg--------gggct-agg----
                       Gibbon  tatgtgg-actg----------tcca-aaggataaa-atga-gaa--gg--------gggct-agg----
                       Rhesus  tatgtag-actg----------tcca-aaggataaa-atga-gaa--gg--------gggct-agg----
          Crab-eating macaque  tatgtag-actg----------tcca-aaggataaa-atga-gaa--gg--------gggct-agg----
                       Baboon  tatgtag-actg----------tcca-aaggataaa-atga-gaa--gg--------gggct-agg----
                 Green monkey  tatgtag-actg----------tcca-aaggataaa-atga-gaa--gg--------gggct-agg----
                     Marmoset  tatgtag-attg----------tcca-aaggataaa-atga-taa--gg--------gggct-agg----
              Squirrel monkey  tatgtag-attg----------tcca-aaagaaaaa-atga-gaa--cg--------gagct-agt----
                     Bushbaby  --------actg----------acta-aaggataga-atgaggaa--gg--------gggcc-tgg----
           Chinese tree shrew  tatgtag-acta----------tctagaaggataaa-ctga-aaa--ag--------gga-t-aga----
                     Squirrel  ------g-aaagatccgtagtatccg-aaggataaa-gcga-gaa--ag--------gaggcaggg----
       Lesser Egyptian jerboa  ------a-atat----------cccc-aggaaaaaa-atta-aaa--gg--------cagcc-tgc----
                 Prairie vole  ------g-aaag----------cccg-gatgacaga-ataa-gaa--gg--------aagcc--gc----
              Chinese hamster  ------a-aaag----------tccg-gtcgacaga-atga-gaa--cg--------aagcc--gc----
               Golden hamster  ------g-aaag----------cccg-gacgatgga-gtga-gaa--cg--------aagcc--gc----
                        Mouse  ------g-aaag----------cccg-gaggaaaaa-atga-gaa--cg--------acgcc--gc----
                          Rat  ------g-aaag----------ccct-gaggataaa-ataa-gaa--gg--------aagcc--ac----
               Naked mole-rat  tacgtgg-aatg----------tcca-agggataaa-atga-gaa--gg--------gaacc-agg----
                   Guinea pig  ---gtgg-aatg----------tcca-aaggataaa-ataa-gca--gg--------gagcc-tgg----
                   Chinchilla  ---gtgg-aata----------tcca-agggataaa-c-----------------------c-agg----
             Brush-tailed rat  tatgcgg-aata----------tcca-agggataaa-atga-gaa--ag--------aaagc-agg----
                       Rabbit  taggtag-aacg----------tccg-aagaataaa-atga-gaa--ag--------gggcc-aga----
                         Pika  catgaag-aatg----------tccg-aaggataaa-atga-gaa--ag--------gggtt-a------
                      Dolphin  tatgtag-aacg----------cctg-aaggataaaaatgg-ggaa-aa--------ggtac-cgg----
                 Killer whale  tatgtag-aacg----------cctg-aagaataaaaatgg-ggaa-aa--------ggtac-cgg----
             Tibetan antelope  taagtag-aatg----------cctg-caggataaaaatga-gg---ag--------ggaat-cgg----
                          Cow  taagtag-aatg----------cctg-cgggacaaaaatga-cg---ag--------ggaat-cgg----
                        Sheep  taagtag-aatg----------cctg-caggataaaaatga-gg---ag--------ggaat-cgg----
                Domestic goat  taagtag-aatg----------cctg-caggataaaaatga-gg---ag--------ggaat-cgg----
                        Horse  tatgcag-aatg----------cctg-aaggatacataaga-aaaa-gg--------gggac-agg----
             White rhinoceros  tatgtag-aatg----------cctg-aa-gatacatatgg-gaaa-gg--------gggac-aga----
                          Cat  tctgtag-aatg----------cctg-aaggataaa-gtgg-gaaa-gg--------gggac-agg----
                          Dog  tatgcaa-aagg----------cctc-caggataaa-gtgg-gcaa-gg--------ggggc-agg----
                      Ferret   tacgtaa-aatg----------cctg-aaggataaa-atgg-gaaa-gg--------gggac-agg----
                        Panda  tatgtaa-aatg----------cctg-aacgataaa-gtgg-gaaa-gg--------gggac-agg----
               Pacific walrus  tctataa-aacg----------cctg-aaggataaa-gtgg-gaaa-gg--------gggac-agg----
                 Weddell seal  tctgtaa-aatg----------cctg-aaggataaa-gtgg-gaaa-gg--------gggac-agg----
             Black flying-fox  tatatagaaatg----------cctg-aagggtaaa-atgg-gaaa-gg--------gggac-agg----
                      Megabat  cactcag--gcg----------cctg-gaggacaca-ctgg-gaaacgg--------gggac-a------
                Big brown bat  taaggag-aatg----------ccgg-gaggataaa-gtgg-ggga-gg--------gggac-agg----
         David's myotis (bat)  -aaggag-cagg----------cctg-caggataaa-atgg-ggga-gg--------gggac-agg----
                        Shrew  ggtgtcg-tatg----------cttg-aaggataaa-atgg-gaaa-agtagcgaggtgg----------
              Star-nosed mole  tgtgtac-ccta----------cctg-accga-gga-atgg-ggaa-ag-agggatggggat-aga----
                     Elephant  tatatag-aatg----------tctg-aaggataaa-atga-gaaa-gg--------aagat-aga----
          Cape elephant shrew  ttttttt-tttc----------tttt-aaaga----------------g--------atgtt-ccg----
                      Manatee  tatatag-aatg----------cctg-aaggataaa-acga-gaaa-gg--------gagac-aggcaac
             Cape golden mole  tatacag-aatg----------cctg-aaggatcaa-atgg-aaaa-gg--------gagac-agg----
                       Tenrec  tgtatag-aatg----------tctg-gcagtttaa-a----ataa-gg--------gatac-agg----
                     Aardvark  ---------------------------aaggataaa-acga-aaaa--g--------gagac-tgg----
                    Armadillo  tttgtag-catg----------tctg-aagg-----------gaat-gg--------gagac-aga----
                     Hedgehog  ======================================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  --gaact------ttc-------------------------------agttt--a----aa---a---gt
                        Chimp  --gaact------ttc-------------------------------agttt--a----aa---a---gt
                      Gorilla  --gaact------ttc-------------------------------agttt--a----aa---a---gt
                    Orangutan  --gaact------ttc-------------------------------agttt--a----aa---a---gt
                       Gibbon  --gaact------ttc-------------------------------agttt--a----aa---a---gc
                       Rhesus  --g----------ctc-------------------------------agttt--a----aa---a---gt
          Crab-eating macaque  --g----------ctc-------------------------------agttt--a----aa---a---gt
                       Baboon  --g----------ctc-------------------------------agttt--a----aa---a---gt
                 Green monkey  --g----------ctc-------------------------------agttt--a----aa---a---gt
                     Marmoset  --gaacc------tgc-------------------------------agttt--a----aa---a---gt
              Squirrel monkey  --gaacc------tgc-------------------------------agttt--a----aa---a---gt
                     Bushbaby  --aaacc------tgc-------------------------------cgttt-aa----aa---a---gt
           Chinese tree shrew  --gaact------tgc-------------------------------tgttt--a----aa---aacggt
                     Squirrel  --aaagc------tgc-------------------------------ccttt--a----aac--c---at
       Lesser Egyptian jerboa  --aaatt------cgc-------------------------------agtga--c----aac--a---gt
                 Prairie vole  --caacc------tgg-------------------------------aaggt--a----aaca-a---gg
              Chinese hamster  --taacc------tgg--------------------------------gggt--a----aat--a---ga
               Golden hamster  --caacc------tgg--------------------------------gggt--a----aat--a---ga
                        Mouse  --caaca------tgg-------------------------------aaggt--a----aac--a---ga
                          Rat  --caacc------ggg-------------------------------aaggt--a----aac--a---ga
               Naked mole-rat  --gaatt------tgc-------------------------------agttt--a----aat--t---gt
                   Guinea pig  --ggctt------tgc-------------------------------acttt--a----aat--t---gt
                   Chinchilla  --gaatt------tgc-------------------------------agttt--a----aat--g---gt
             Brush-tailed rat  --gaatt------tgc-------------------------------agttt--a----aat--t---gt
                       Rabbit  --gaact------tgg-------------------------------gagtt--c----aca--a---ag
                         Pika  ----------------------------------------------------------------------
                      Dolphin  --gaact------agc-------------------------------agttt--a----aag--a---gt
                 Killer whale  --gaact------agc-------------------------------agttt--a----aag--a---gt
             Tibetan antelope  --gaagg------tcc-------------------------------agttt--a----aag--a---ga
                          Cow  --gaacg------tcc-------------------------------agttt--a----aag--a---ga
                        Sheep  --gaacg------tcc-------------------------------agttt--a----aag--a---ga
                Domestic goat  --gaacg------tcc-------------------------------agttt--a----aag--a---ga
                        Horse  --gaact------tgc-------------------------------agttt--a----aag--a---gt
             White rhinoceros  --gaact------tgc-------------------------------agttt--a----aag--a---gt
                          Cat  --ggcct------cgc-------------------------------agttt--c----cag--a---gc
                          Dog  --gaccc------tgc-------------------------------agttt--c----ggggcg--tgg
                      Ferret   --gaaca------tgc-------------------------------agttt--c----gag--a--ggg
                        Panda  --gaact------tgc-------------------------------agttt--c----ggg--g--ggg
               Pacific walrus  --gaaca------tgc-------------------------------agttt--c----aag--a--ggg
                 Weddell seal  --gaaca------tgc-------------------------------agttt--c----aag--a--ggg
             Black flying-fox  --gggaacttacttac-------------------------------agtttaaa----aag--a---gt
                      Megabat  -------------tgc-------------------------------agttc--------ag--g---gc
                Big brown bat  --gaaat------cgc-------------------------------agttt--a----acc--g---gg
         David's myotis (bat)  --ggcct------ggc-------------------------------aggtt--c----acc--g---ga
                        Shrew  -----ct------tgt-------------------------------agttt---------g--a---gt
              Star-nosed mole  --gaact------tgc-------------------------------agttc--a----agg--a---gt
                     Elephant  --gaact------tcc-------------------------------agttt--t---aaag--a---gt
          Cape elephant shrew  --gaaac------cct-------------------------------tgaag--t---gaca--a---tt
                      Manatee  tttaact------ttc-------------------------------agttt--t-aagaag--a---gt
             Cape golden mole  --gagct------ttc-------------------------------agttt--t---atag--c---gc
                       Tenrec  --gaatt------ttctaaattaaagagacatttttttaatttaaaaagttt--t-aaaaag--a---ga
                     Aardvark  --gaact------tgc-------------------------------agttt--t--aaaaa--a---ac
                    Armadillo  --agact------ttc-------------------------------aatta--aaaaaaaa--a---aa
                     Hedgehog  ======================================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
               Bactrian camel  ======================================================================
                       Alpaca  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
                          Pig  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  agcc-g----cg----gaagc
                        Chimp  agcc-g----cg----gaagc
                      Gorilla  agcc-g----cg----gaagc
                    Orangutan  agcc-g----cg----gaagc
                       Gibbon  agcc-g----cc----gaagc
                       Rhesus  ggcc-g----cg----gaagc
          Crab-eating macaque  ggcc-g----cg----gaagc
                       Baboon  ggcc-g----cg----gaagc
                 Green monkey  ggcc-g----cg----gaagc
                     Marmoset  ggcc-g----ca----gaagc
              Squirrel monkey  ggcc-g----ca----gaagc
                     Bushbaby  ggcc-g----cg----gaagc
           Chinese tree shrew  aggt-a----ca----gagca
                     Squirrel  ggcc-c----cg----g----
       Lesser Egyptian jerboa  ggcc-c----tg----gaagc
                 Prairie vole  agcg-g----tg----gaggc
              Chinese hamster  agct-a----tg----gcggc
               Golden hamster  ggcg-a----tg----gaggc
                        Mouse  agtg-c----tg----gaggc
                          Rat  agcg-c----tg----gaggc
               Naked mole-rat  ggcc-g----tg----gaaac
                   Guinea pig  ggcc-a----t-----taaac
                   Chinchilla  agcc-a----tgcaaagaaac
             Brush-tailed rat  ggct-a----tggaaagaaac
                       Rabbit  agcg-gccaccg----gaagc
                         Pika  ----------tg----gaagc
                      Dolphin  ggcc-a----cg----gagcc
                 Killer whale  ggcc-a----cg----gagcc
             Tibetan antelope  ggcc-a----ca----gagcc
                          Cow  agcc-a----ca----gagcc
                        Sheep  ggcc-a----ca----gagcc
                Domestic goat  ggcc-a----ca----gaacc
                        Horse  ggcc-a----cg----gaagc
             White rhinoceros  ggcc-a----cg----gaagc
                          Cat  ggcc-a----cg----gaggc
                          Dog  gggc-a----ct----gaagc
                      Ferret   ggcc-a----tg----gaagt
                        Panda  ga-------------------
               Pacific walrus  ggcc-a----cg----aaagc
                 Weddell seal  ggcc-a----cg----gaagc
             Black flying-fox  ggcc-a----cg----taagc
                      Megabat  ggtc-a----cg----gaagc
                Big brown bat  ggcc-g----cg----gaagc
         David's myotis (bat)  ggcc-g----cg----gaagc
                        Shrew  gaccca----aa----gaagc
              Star-nosed mole  ggccgg----cg----gaagc
                     Elephant  ggtc-c----ca----gatgc
          Cape elephant shrew  gagc-a----aa----a----
                      Manatee  ggtc-c----cg----gacgc
             Cape golden mole  agtc-c----ca----gacag
                       Tenrec  ggtc-c----cg----gaccc
                     Aardvark  ggtc-t----cg----gacgt
                    Armadillo  ggtc-a----tg----ggaag
                     Hedgehog  =====================
                     Microbat  NNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  =====================
             Peregrine falcon  =====================
                 Saker falcon  =====================
                      Wallaby  =====================
                  Rock pigeon  =====================
                   Budgerigar  =====================
          Medium ground finch  =====================
              Green seaturtle  =====================
               Bactrian camel  =====================
                       Alpaca  =====================
                 Mallard duck  =====================
           American alligator  =====================
          Collared flycatcher  =====================
           Tibetan ground jay  =====================
                    Zebrafish  =====================
                X. tropicalis  =====================
                     Platypus  =====================
              Tasmanian devil  =====================
                      Opossum  =====================
               Painted turtle  =====================
                          Pig  =====================
     Chinese softshell turtle  =====================

Inserts between block 13 and 14 in window
               Big brown bat 1bp
        David's myotis (bat) 144bp

Alignment block 14 of 177 in window, 36875321 - 36875350, 30 bps 
B D                     Human  --accga-gtgacac--gagcaaaatcc--tgaaggt
B D                     Chimp  --accga-gtgacac--gagcaaaatcc--tgaaggt
B D                   Gorilla  --accga-gtgacac--gagcaaaatcc--tgaaggt
B D                 Orangutan  --accga-gtgacac--gagcaaaatcc--tgaaggt
B D                    Gibbon  --accga-gtgacac--gagcaaaatcc--tgaaggt
B D                    Rhesus  --actga-gtgacacttgggcaaaatcc--tgaaggt
B D       Crab-eating macaque  --actga-gtgacacttgggcaaaatcc--tgaaggt
B D                    Baboon  --actga-gtgacacttgagcaaaatcc--tgaaggt
B D              Green monkey  --accga-gtgacacttgagcaaaatcc--tgaaggt
B D                  Marmoset  --acaga-gtgacacttgagcaaaaccc--tgaaggt
B D           Squirrel monkey  --acaga-gtgacacttgtgcaaaaccc--tgaaggt
B D                  Bushbaby  --accgaggtgacacttgactaaaatct--tgaaggt
           Chinese tree shrew  --cccag-gtgacacctgagcaaaatcc--tgaaggt
B D                  Squirrel  ------agatgacatttgaacggaaccc--tgaagat
       Lesser Egyptian jerboa  --accgaggtgacactggagcgcagccc--tgaagct
                 Prairie vole  --a-ccaggtggcacccgagcgaaaccc--tgaagac
B D           Chinese hamster  --acccagggggcatttgaacaaaaccc--tgaagac
               Golden hamster  --acccagggggcatctgaaccaaaccc--tgaagac
B D                     Mouse  --accagggtgaca-tggggcaaaaccc--tgatgac
B D                       Rat  --acccaggtgacatttgagcaaaaccc--tgaagat
B D            Naked mole-rat  --actcacctgacatttgaagaaaactctataaacat
B D                Guinea pig  --accaatatgacattcgagcaaaactgctgaaagat
                   Chinchilla  --accgacctcacatttgagcaaaactccagaaagat
             Brush-tailed rat  --accgagcagacaaatgagcaaaactc--------t
B D                    Rabbit  --actgacagggcatttgaacagcacgc--cgaaggt
B D                      Pika  --actaac---gcatttgaacaaaacac--tggaagt
B D                   Dolphin  ---ccgaggacacagttgcgcaaaatcc--tgaaggt
                 Killer whale  ---ccgaggacacagttgcgcaaaatcc--tgaaggt
             Tibetan antelope  ---ccgaggagacagccgagcaaaaccc--tga----
B D                       Cow  ---ccgaggagacagccgagcaaaaccc--tgaaagt
B D                     Sheep  ---ccgaggagacagccgagcaaaaccc--tgaaagt
                Domestic goat  ---ccgaggagacagccgagcaaaaccc--tgaaagt
B D                     Horse  --cccgaggtgacatctgagcaaaatcc--tgcaggc
B D          White rhinoceros  --cccgaggtgacatgtgagcaaaatcc--tgaaggt
B D                       Cat  --cccgagatgacatctgagcaaaatcc--tgaaggc
B D                       Dog  --cccgaggtgacacctgaaccaaaccc--tgaaggt
B D                   Ferret   --cccgaggtgacatcagagcaaaatcc--tgaaggt
B D                     Panda  ---gcgaggtgacgtccgagaagaatcc--tgaaggt
               Pacific walrus  --cccgaggtgacatctgagcaaaaaaa--aaaaggt
                 Weddell seal  --cccgaggtgacatctgagcaaaaaaa--aaaaggt
             Black flying-fox  --cccgaggtgacagttcagcaaaatct--tgcaggt
B D                   Megabat  --ccc-aggtgccc-ctgagcaaggtcc--tgtggat
                Big brown bat  --ccc-aggtgccagtacagcgaacacc--tgcaggg
B D                     Shrew  --taagaagtgacatttgagcaaaatcc--agcaggt
              Star-nosed mole  --cccgaggtgacatttgagcagaagcc--tgaaggt
B D                  Elephant  ccccagaagtgacatgtgagcaaaatcc--tgaaggt
          Cape elephant shrew  ctctgcaaatg---tgggagc----ttc--ggatgtt
B D                   Manatee  cctctgagttgccatttgagcaaaatcc--tgaag-t
             Cape golden mole  cccctgaggtgacaattgagcacaatcc--tttagaa
B D                    Tenrec  tccccgaggtgac-tttgagcaaagtaa--ggaagat
                     Aardvark  ctctgagga-----tttaagcagaatca--tcaaggt
B D                 Armadillo  ccct-aaagtgacatttgagcaaaaccc--acaa---
B D                  Hedgehog  =====================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  =====================================
  D    White-throated sparrow  =====================================
  D          Peregrine falcon  =====================================
  D              Saker falcon  =====================================
B D                   Wallaby  =====================================
  D               Rock pigeon  =====================================
B D                Budgerigar  =====================================
B D       Medium ground finch  =====================================
  D           Green seaturtle  =====================================
              Bactrian camel  =====================================
B D                    Alpaca  =====================================
  D              Mallard duck  =====================================
B D        American alligator  =====================================
  D       Collared flycatcher  =====================================
          Tibetan ground jay  =====================================
B D                 Zebrafish  =====================================
B D             X. tropicalis  =====================================
B D                  Platypus  =====================================
B D           Tasmanian devil  =====================================
B D                   Opossum  =====================================
  D            Painted turtle  =====================================
B D                       Pig  =====================================
  D  Chinese softshell turtle  =====================================

Alignment block 15 of 177 in window, 36875351 - 36875386, 36 bps 
B D                     Human  ga-agg---ag-caagccctg-----------tggacga----cgctc----------------------
B D                     Chimp  ga-agg---ag-caagccctg-----------tggacga----cgctc----------------------
B D                   Gorilla  ga-agg---ag-caagcccta-----------tggacga----cgctc----------------------
B D                 Orangutan  ga-agg---ag-caagcccta-----------tg---ga----cactc----------------------
B D                    Gibbon  ga-agg---ag-ccagcccta-----------tg---ga----cgctc----------------------
B D                    Rhesus  ga-agg---ag-caagcccta-----------tg---ga----cgctc----------------------
B D       Crab-eating macaque  ga-agg---ag-caagcccta-----------tg---ga----cgctc----------------------
B D                    Baboon  ga-agg---ag-caagcccta-----------tg---ga----cgctc----------------------
B D              Green monkey  ga-agg---ag-caagcccta-----------tg---ga----cgctc----------------------
B D                  Marmoset  ga-aga---ag-caagcccta-----------cg---gg----cgctc----------------------
B D           Squirrel monkey  ga-aga---ag-caagcccta-----------cg---gg----cgctc----------------------
B D                  Bushbaby  ga-agg--------agccccg-----------tg---ga----ggcgt----------------------
           Chinese tree shrew  -------------aagccctg-----------ta---ga----tactt----------------------
B D                  Squirrel  ga-gag------c----cctc-----------tg---ga----tgctt----------------------
       Lesser Egyptian jerboa  ag-gca----g-caagccctgtagagagaacccg---gc----cgacc----------------------
                 Prairie vole  gg-aga------caacttcaa-----------cg---ga----cgctc----------------------
B D           Chinese hamster  gg-ggc------caacttcta-----------ag---ga----tagtc----------------------
               Golden hamster  cg-ggc------caacctcta-----------cg---ga----tggtg----------------------
B D                     Mouse  ga-gggcgccgccaagtccca-----------gg---gg----cactc----------------------
B D                       Rat  aa-gggcgccg-caagtccta-----------tg---gt----cac------------------------
B D            Naked mole-rat  gc-ggc---ag-agagcccta-----------tg---aa----tactt----------------------
B D                Guinea pig  ga-ggg---ag-agagcccta-----------tg---aa----tactt----------------------
                   Chinchilla  ga-ggg---cg-agagcccta-----------cc---aa----tactt----------------------
             Brush-tailed rat  ca-ggc---ag-cacgctttg-----------c-----a----tgctg----------------------
B D                    Rabbit  ga-aga---gg-caagccccg-----------tg---gt----gaact----------------------
B D                      Pika  ga-ggg---ac-caaacccca-----------gg---ga----aaact----------------------
B D                   Dolphin  ga-ggc---ag-caaactctg-----------tg---g-----tcctt----------------------
                 Killer whale  ga-ggc---ag-caaactctg-----------tg---g-----tcctt----------------------
             Tibetan antelope  aa-aag---ag--aaactctg-----------tg---g-----cactc----------------------
B D                       Cow  aa-gag---ag--aaactctg-----------tg---g-----cactc----------------------
B D                     Sheep  aa-gag---ag--aaactctg-----------tg---g-----cactc----------------------
                Domestic goat  aa-gag---ag--aaactctg-----------tg---g-----cactc----------------------
B D                     Horse  gagggg---gg-caagcctta-----------tg---ga----tactt----------------------
B D          White rhinoceros  ga-ggg---ag-caaggccta-----------tg---ga----tactt----------------------
B D                       Cat  ga-ggg---ag-caagcccta-----------tg---ta----tactt----------------------
B D                       Dog  ga-ggg---ag-caagccctg-----------cg---ga----ttcttg---------------------
B D                   Ferret   ga-ggg---ag-caagcccta-----------tg---ga----ttctt----------------------
B D                     Panda  ga-ggg---ag-caagcccta-----------tg---ga----ttctt----------------------
               Pacific walrus  ga-ggg---ag-caagcccta-----------tg---ga----ttcttgggggaaagaggctggcacggg
                 Weddell seal  ga-ggg---ag-caagcccta-----------tg---ga----ttctt----------------------
             Black flying-fox  ga-gga---ag-caagcccta-----------tg---ga----tactt----------------------
B D                   Megabat  ga-gga---ag-caagcccta-----------tg---ga----tactt----------------------
                Big brown bat  gg-ggg---cg-ccagcgccg------------g---ga----aaccg----------------------
B D                     Shrew  ga-gga---ct-cgggctc-g-----------gg---ga----tcctc----------------------
              Star-nosed mole  ga-ggg---cg-taagccg-g-----------tg---ga----tattt----------------------
B D                  Elephant  ga-ggg---ag-caagcccta-----------tg---ga----tgctt----------------------
          Cape elephant shrew  tg-ggg---ag-agaggctgg-----------ca---ga-------------------------------
B D                   Manatee  ga-ggg---ag-caagcccta-----------tg---ga----tgcct----------------------
             Cape golden mole  ga-ggg---ag-caagccctg-----------ca---ga-------------------------------
B D                    Tenrec  gg-ggc---gg-caagccctg-----------ca---ga-------------------------------
                     Aardvark  ga-ggg---ag-caagctcta-----------tg---aatgaatgttt----------------------
B D                 Armadillo  -a-ggg---ag-caagcatta-----------tg---ga----tactg----------------------
B D                  Hedgehog  ======================================================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
              Bactrian camel  ======================================================================
B D                    Alpaca  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
B D                       Pig  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  -----------------agggaaga------------------------------
                        Chimp  -----------------agggaaga------------------------------
                      Gorilla  -----------------agggaaga------------------------------
                    Orangutan  -----------------agggaaga------------------------------
                       Gibbon  -----------------agggaaga------------------------------
                       Rhesus  -----------------agggaaga------------------------------
          Crab-eating macaque  -----------------agggaaga------------------------------
                       Baboon  -----------------aggggaga------------------------------
                 Green monkey  -----------------agggaaga------------------------------
                     Marmoset  -----------------agggaaga------------------------------
              Squirrel monkey  -----------------agggaaga------------------------------
                     Bushbaby  -----------------gggaaaag------------------------------
           Chinese tree shrew  -----------------ggggaaag------------------------------
                     Squirrel  -----------------gggaaagt------------------------------
       Lesser Egyptian jerboa  -----------------agaggagg------------------------------
                 Prairie vole  -----------------tggggaaa------------------------------
              Chinese hamster  -----------------tgaggtga------------------------------
               Golden hamster  -----------------tgaggtga------------------------------
                        Mouse  -----------------tggggaag------------------------------
                          Rat  -------------------------------------------------------
               Naked mole-rat  -----------------ggggaagg------------------------------
                   Guinea pig  -----------------gggaaagg------------------------------
                   Chinchilla  -----------------ggggaagg------------------------------
             Brush-tailed rat  -----------------ggggaagg------------------------------
                       Rabbit  -----------------gggggaag------------------------------
                         Pika  -----------------aag----g------------------------------
                      Dolphin  -----------------ggggaaag------------------------------
                 Killer whale  ----------------gggggaaag------------------------------
             Tibetan antelope  -----------------gtggaagg------------------------------
                          Cow  -----------------ggggaagg------------------------------
                        Sheep  -----------------gtggaagg------------------------------
                Domestic goat  -----------------gtggaagg------------------------------
                        Horse  -----------------ggggaaag------------------------------
             White rhinoceros  -----------------ggggaaag------------------------------
                          Cat  ----------------gggggaacg------------------------------
                          Dog  ----------------gggggaaag------------------------------
                      Ferret   ----------------gggcaaaag------------------------------
                        Panda  ----------------ggggaaaag------------------------------
               Pacific walrus  ggaaagaggctggcacgggggaaag------------------------------
                 Weddell seal  ----------------gggggaaag------------------------------
             Black flying-fox  -----------------ggggaaag------------------------------
                      Megabat  -----------------ggggaaag------------------------------
                Big brown bat  -----------------gggggc--------------------------------
                        Shrew  -----------------tcggaaag------------------------------
              Star-nosed mole  -----------------gtggaaag------------------------------
                     Elephant  ---------------ggggagaaagcctggcagaa--ggacgaacaaggacagag
          Cape elephant shrew  ----------------ggggggagcccgggcaggggtggccgcgcagggatgggg
                      Manatee  ---------------ggagaaagagcctggcagac--gaacgagcaagggcagag
             Cape golden mole  ------------------------------------------------------g
                       Tenrec  ------------------------------------------------------g
                     Aardvark  ---------------aggggaagagcctgacagag--ggacgagcaagggcacac
                    Armadillo  ---------------gaggggaaagtgtggcagag--ggaatagcaagggcagag
                     Hedgehog  =======================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  =======================================================
       White-throated sparrow  =======================================================
             Peregrine falcon  =======================================================
                 Saker falcon  =======================================================
                      Wallaby  =======================================================
                  Rock pigeon  =======================================================
                   Budgerigar  =======================================================
          Medium ground finch  =======================================================
              Green seaturtle  =======================================================
               Bactrian camel  =======================================================
                       Alpaca  =======================================================
                 Mallard duck  =======================================================
           American alligator  =======================================================
          Collared flycatcher  =======================================================
           Tibetan ground jay  =======================================================
                    Zebrafish  =======================================================
                X. tropicalis  =======================================================
                     Platypus  =======================================================
              Tasmanian devil  =======================================================
                      Opossum  =======================================================
               Painted turtle  =======================================================
                          Pig  =======================================================
     Chinese softshell turtle  =======================================================

Inserts between block 15 and 16 in window
B D                      Rat 2bp
B D                  Dolphin 30bp
                Killer whale 30bp
            Tibetan antelope 24bp
B D                      Cow 24bp
B D                    Sheep 24bp
               Domestic goat 24bp
B D                    Horse 12bp
B D         White rhinoceros 12bp
B D                      Cat 30bp
B D                      Dog 30bp
B D                  Ferret  30bp
B D                    Panda 30bp
              Pacific walrus 30bp
                Weddell seal 30bp
            Black flying-fox 30bp
B D                  Megabat 30bp
               Big brown bat 18bp
B D                    Shrew 2bp
             Star-nosed mole 2bp

Alignment block 16 of 177 in window, 36875387 - 36875387, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
B D                  Squirrel  g
       Lesser Egyptian jerboa  a
                 Prairie vole  g
B D           Chinese hamster  g
               Golden hamster  g
B D                     Mouse  g
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                      Pika  a
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
B D                     Shrew  g
B D                  Elephant  g
          Cape elephant shrew  g
B D                   Manatee  g
             Cape golden mole  g
B D                    Tenrec  g
                     Aardvark  g
B D                 Armadillo  a
B D                  Hedgehog  =
             Star-nosed mole  =
B D                       Rat  =
          Chinese tree shrew  -
B D                  Microbat  N
        David's myotis (bat)  =
  D    White-throated sparrow  =
  D          Peregrine falcon  =
  D              Saker falcon  =
B D                   Wallaby  =
  D               Rock pigeon  =
B D                Budgerigar  =
B D       Medium ground finch  =
  D           Green seaturtle  =
  D              Mallard duck  =
B D        American alligator  =
  D       Collared flycatcher  =
          Tibetan ground jay  =
B D                 Zebrafish  =
B D             X. tropicalis  =
B D                  Platypus  =
B D           Tasmanian devil  =
B D                   Opossum  =
  D            Painted turtle  =
B D                       Pig  =
  D  Chinese softshell turtle  =

Inserts between block 16 and 17 in window
B D                   Rhesus 17bp
B D             Green monkey 17bp
B D                 Marmoset 28bp
B D          Squirrel monkey 28bp
B D                 Bushbaby 29bp
B D                 Squirrel 2bp
      Lesser Egyptian jerboa 25bp
                Prairie vole 25bp
B D          Chinese hamster 23bp
              Golden hamster 9bp
B D                    Mouse 27bp
B D           Naked mole-rat 26bp
B D               Guinea pig 11bp
                  Chinchilla 11bp
            Brush-tailed rat 11bp
B D                   Rabbit 11bp
B D                     Pika 11bp

Alignment block 17 of 177 in window, 36875388 - 36875404, 17 bps 
B D                     Human  t-cctact---c----------g-caaggatg
B D                     Chimp  t-cctact---c----------g-caaggatg
B D                   Gorilla  t-cctact---c----------g-caaggatg
B D                 Orangutan  t-cctact---c----------g-caaggatg
B D                    Gibbon  t-cctact---c----------g-caaagatg
B D       Crab-eating macaque  --cctggc---a----------g-agggaacg
B D                    Baboon  --cctggc---a----------g-agggaacg
B D                  Marmoset  t-cctaca---c----------g-caaggata
B D           Squirrel monkey  t-cctcat---c----------g-caaggatg
B D                  Bushbaby  t-cctact---t----------t-ta--gacg
           Chinese tree shrew  --cctggc---g----------g-agggaata
B D                  Squirrel  ----cccc---c----------g-cagagaca
       Lesser Egyptian jerboa  -------------------------gaggagg
                 Prairie vole  t-tctgtt---t----------g-caaggatg
B D           Chinese hamster  t-tctatt---t----------g-caaggatg
               Golden hamster  t-tctatt---t----------g-caaggatg
B D                     Mouse  t-tctatt---t----------g-cacggata
B D                       Rat  t-tctatt---t----------g-cacggata
B D            Naked mole-rat  c-cctctt---t----------g-caaatatg
                   Chinchilla  c-cct---------------------------
B D                    Alpaca  t-ccggct---g----------g-caaggctg
               Bactrian camel  t-ccggct---g----------g-caaggctg
B D                   Dolphin  t-cctgcc---t----------g-caaggcgg
                 Killer whale  t-cctgca---t----------g-caaggcgg
             Tibetan antelope  c-cctgct---g----------g-ctccgcaa
B D                       Cow  c-cctgct---g----------g-ctccgcga
B D                     Sheep  c-cctgct---g----------g-ctccgcaa
                Domestic goat  c-cctgct---g----------g-ctccgcaa
B D                     Horse  t-cctgct---g----------g-caaggatg
B D          White rhinoceros  t-cctgac---t----------g-caaggatg
B D                       Cat  t-cctgct---g----------g-caaggggg
B D                       Dog  t-cccgct---c----------g-caggagtg
B D                   Ferret   t-ccagct---c----------g-caagaatg
B D                     Panda  t-cctgct---t----------g-caagaatg
               Pacific walrus  t-cctgct---c----------gccaagaatg
                 Weddell seal  t-cctgct---c----------g-caagaatg
             Black flying-fox  t-cc---t---t----------a-caaggatg
B D                   Megabat  t-cc---t---t----------a-caaggatg
                Big brown bat  t-cc-----------------------gcggg
B D                     Shrew  t-cctgcc---t----------g-caaggatg
              Star-nosed mole  --cccgtcagag----------g-ttaggatc
B D                  Elephant  t-cgtgct---a----------g-catgggtg
          Cape elephant shrew  tgcgaggc---aggggtccgagg-tataagcg
B D                   Manatee  t-cgtgct---t----------g-cagggatg
             Cape golden mole  t-cgcgct---c----------g-caggggtg
B D                    Tenrec  t-cgcact---a----------g-cggtggcg
                     Aardvark  t-tgtgcc---g----------c-caggcctg
B D                 Armadillo  t-cctgct---t----------g-caaggatg
B D                  Hedgehog  ================================
B D                      Pika  ================================
B D                Guinea pig  ================================
            Brush-tailed rat  ================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  ================================
B D                    Rabbit  ================================
  D    White-throated sparrow  ================================
  D          Peregrine falcon  ================================
  D              Saker falcon  ================================
B D                   Wallaby  ================================
  D               Rock pigeon  ================================
B D                Budgerigar  ================================
B D       Medium ground finch  ================================
  D           Green seaturtle  ================================
  D              Mallard duck  ================================
B D        American alligator  ================================
  D       Collared flycatcher  ================================
          Tibetan ground jay  ================================
B D                 Zebrafish  ================================
B D             X. tropicalis  ================================
B D                  Platypus  ================================
B D           Tasmanian devil  ================================
B D                    Rhesus  ================================
B D                   Opossum  ================================
  D            Painted turtle  ================================
B D                       Pig  ================================
  D  Chinese softshell turtle  ================================
B D              Green monkey  ================================

Inserts between block 17 and 18 in window
B D      Crab-eating macaque 1bp
B D                   Baboon 1bp
          Chinese tree shrew 1bp

Alignment block 18 of 177 in window, 36875405 - 36875414, 10 bps 
B D                     Human  cc-a----ggg-cag-g-----------------------------------
B D                     Chimp  cc-a----ggg-cag-g-----------------------------------
B D                   Gorilla  cc-a----ggg-cag-g-----------------------------------
B D                 Orangutan  cc-a----ggg-cag-g-----------------------------------
B D                    Gibbon  cc-a----agg-cag-g-----------------------------------
B D                    Rhesus  cg-a----ggg-cag-g-----------------------------------
B D       Crab-eating macaque  cg-a----ggg-cag-g-----------------------------------
B D                    Baboon  cg-a----ggg-cag-g-----------------------------------
B D              Green monkey  cg-a----ggg-cag-g-----------------------------------
B D                  Marmoset  cc-a----ggg-cag-g-----------------------------------
B D           Squirrel monkey  cc-a----ggg-cag-g-----------------------------------
B D                  Bushbaby  tc-a----ggg-cag-g-----------------------------------
           Chinese tree shrew  ca-a----tgg-ccg-g-----------------------------------
B D                  Squirrel  ac-agcagagg-cac-a-----------------------------------
       Lesser Egyptian jerboa  ct-a------------------------------------------------
                 Prairie vole  cc------aat-cgg-g-----------------------------------
B D           Chinese hamster  tc-a----aat-cgg-g-----------------------------------
               Golden hamster  cc-a----aat-cgg-g-----------------------------------
B D                     Mouse  tc-a----agc-ccg-g-----------------------------------
B D                       Rat  cc-a----agt-ccc-g-----------------------------------
B D            Naked mole-rat  ct-a----ggg-tag-g-----------------------------------
                   Chinchilla  --------------g-a-----------------------------------
B D                    Rabbit  --------ggg-aga-a-----------------------------------
B D                      Pika  --------gga-aga-a-----------------------------------
B D                    Alpaca  cc-a----gtg-cag-------------------------------------
               Bactrian camel  cc-a----gtg-cag-------------------------------------
B D                   Dolphin  cc-g----aggaagc-------------------------------------
                 Killer whale  cc-g----aggaagc-------------------------------------
             Tibetan antelope  cc-g----agg-cga-------------------------------------
B D                       Cow  cc-g----agg-cgg-------------------------------------
B D                     Sheep  cc-g----agg-cga-------------------------------------
                Domestic goat  cc-a----agg-cga-------------------------------------
B D                     Horse  cc-a----ggg-cagc------------------------------------
B D          White rhinoceros  cc-a----ggg-cagc------------------------------------
B D                       Cat  tc-a----gag-cagc------------------------------------
B D                       Dog  tc-a----ggg-cagc------------------------------------
B D                   Ferret   ttaa----ggg-cagg------------------------------------
B D                     Panda  tc-a----ggg-cagc------------------------------------
               Pacific walrus  tc-a----ggg-cagc------------------------------------
                 Weddell seal  tc-a----ggg-cagc------------------------------------
             Black flying-fox  cc-a----ggg-caac------------------------------------
B D                   Megabat  cc-a----ggg-caac------------------------------------
                Big brown bat  cc-g----ggg-c---------------------------------------
B D                     Shrew  ca-c----ggg-cag-------------------------------------
              Star-nosed mole  cc-a----gag-ctg-------------------------------------
B D                  Elephant  cc-a----gag-cag--c-tgagggcagtgagctgagggagaacaggaggag
          Cape elephant shrew  ca-c----ggg-ta-----cgaggttag-aaatcggggaagacgggtaggcg
B D                   Manatee  cc-a----ggg-cag--c-tgagggcagccagcagagggagaacggcagcaa
             Cape golden mole  cc-g----gag-cgc--t-ggagggggg-----agggggaa-----------
B D                    Tenrec  c-----------------------------------gcggg-----------
                     Aardvark  ct-g----cag-cag----tgagggcagtaagcag-----------agggtg
B D                 Armadillo  ct-a----ggg-tag--ctggactgcaatgagcag-cagagaacagcaggag
B D                  Hedgehog  ====================================================
B D                Guinea pig  ====================================================
            Brush-tailed rat  ====================================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  ====================================================
  D    White-throated sparrow  ====================================================
  D          Peregrine falcon  ====================================================
  D              Saker falcon  ====================================================
B D                   Wallaby  ====================================================
  D               Rock pigeon  ====================================================
B D                Budgerigar  ====================================================
B D       Medium ground finch  ====================================================
  D           Green seaturtle  ====================================================
  D              Mallard duck  ====================================================
B D        American alligator  ====================================================
  D       Collared flycatcher  ====================================================
          Tibetan ground jay  ====================================================
B D                 Zebrafish  ====================================================
B D             X. tropicalis  ====================================================
B D                  Platypus  ====================================================
B D           Tasmanian devil  ====================================================
B D                   Opossum  ====================================================
  D            Painted turtle  ====================================================
B D                       Pig  ====================================================
  D  Chinese softshell turtle  ====================================================

Inserts between block 18 and 19 in window
B D                   Alpaca 4bp
              Bactrian camel 3bp
B D                  Dolphin 3bp
                Killer whale 3bp
            Tibetan antelope 3bp
B D                      Cow 3bp
B D                    Sheep 3bp
               Domestic goat 3bp

Alignment block 19 of 177 in window, 36875415 - 36875472, 58 bps 
B D                     Human  ccc-----gcc-ccc----------acc-------------------ctcaacg-gcgcgc-g-g----g
B D                     Chimp  ccc-----gcc-ccc----------acc-------------------ctcaacg-gcgcgc-g-g----g
B D                   Gorilla  ccc-----gcc-ccc----------acc-------------------ctcaacg-gcgcgcgg-g----g
B D                 Orangutan  ccc-----gcc-ccc----------acc-------------------cccaaca-gcgcgc-g-g----g
B D                    Gibbon  ccc-----gcc-ccc----------acc-------------------cccaaag-gcgcac-g-g----g
B D                    Rhesus  ccc-----gcc-ccc----------acc-------------------cccaaag-gcgcgc-g-g----g
B D       Crab-eating macaque  ccc-----gcc-ccc----------acc-------------------cccaaag-gcgcgc-g-g----g
B D                    Baboon  ccc-----gcc-ccc----------acc-------------------cccaaag-gcgcgc-g-g----g
B D              Green monkey  ccc-----gcc-ccc----------acc-------------------cccaaag-gcgcgc-g-g----g
B D                  Marmoset  ccc-----gcc-ccc----------acc-------------------ccccacg-gcgcgc-g-g----g
B D           Squirrel monkey  ccc-----gcc-ccc----------acc-------------------acccccg-gcgcgc-g-g----g
B D                  Bushbaby  tcc-----ttc-tcccgaccccgtaatg-------------------cccaatt-gtgcgc-a-g----g
           Chinese tree shrew  tat-----tgc-cct----------gcc-------------------ccc-acg-gggagc-a-gcagcg
B D                  Squirrel  cccccc--acc-cca----------g------------------------ggca--------g-g----c
       Lesser Egyptian jerboa  ctcctt--tcc-ccc----------aat--------------------cttgca--------g-a----g
                 Prairie vole  ttcctttcttc-ccc----------gtt-------------------ctttgtt--------t-g----a
B D           Chinese hamster  ttcctttcttt-ccc----------att-------------------ccttgaa--------g-g----a
               Golden hamster  ttccttt-tcc-ccc----------att-------------------ccttgaa--------g-g----a
B D                     Mouse  accttt--tcc-ccc----------a----------------------cttgca--------g-g----a
B D                       Rat  accttt--tcc-ccc----------a----------------------ctcgca--------g-g----a
B D            Naked mole-rat  tccctctcact-ctc----------acc-------------------tccagcg----ctc-c-a----g
B D                Guinea pig  -c-----cacc-ctc----------acc-------------------tccacca----ctc-c-g----g
                   Chinchilla  cccctcacccc-ctc----------acc--------------------ccctca----ccc-c-g----g
             Brush-tailed rat  -ccctcacccc-ttc----------acc-------------------accatca----ctc-c-g-----
B D                    Rabbit  ctcc----acc-tcc----------g-c-------------------cccaccg--------c-t----c
B D                      Pika  gacc----ctc-ccc----------atc-------------------cctacct--------g-c----c
B D                       Pig  ------------tcc----------cct-------------------ccccacc-gcgcgc-a-c----g
B D                    Alpaca  --------ccg-ccc----------tcg-------------------cgtcaca-gcgcgc-g-t----g
               Bactrian camel  --------cca-ccc----------tcg-------------------cgtcaca-gcgcgc-g-t----g
B D                   Dolphin  ------------ccc----------cgg-------------------ccccacc-gcgcgc-a-c----c
                 Killer whale  ------------ccc----------cgg-------------------ccccacc-gcgcgc-a-c----c
             Tibetan antelope  ------------ccc----------gcg-------------------ccccacc-gcgcgc-a-c----c
B D                       Cow  ------------ccc----------gcg-------------------ccccacc-gcgcgc-a-c----c
B D                     Sheep  ------------ccc----------gcg-------------------ccccacc-gcgcgc-a-g----c
                Domestic goat  ------------ccc----------gcg-------------------ccccacc-gcgcgc-a-g----c
B D                     Horse  --------ttc-ccc----------tca-------------------ccccatg-gcgcgc-a-c----c
B D          White rhinoceros  --------ttc-ccc----------tca-------------------ccccatt-gcgcgc-a-g----c
B D                       Cat  --------ctctccc----------cca-------------------ccccat---cgcgc-g-c----g
B D                       Dog  --------ttctccc----------cag-------------------ccgcg----cgcgc-g-c----g
B D                   Ferret   --------ttctccc----------cca-------------------ac-------cgcgc-g-c----a
B D                     Panda  --------ttctccc----------cca-------------------cc-------cgcgc-g-c----g
               Pacific walrus  --------ttctccc----------cca-------------------ac-------cgcgc-g-c----a
                 Weddell seal  --------ttctccc----------cca-------------------cc-------cgcgc-g-c----a
             Black flying-fox  --------gt--ctc----------cca-------------------tccaatc-gcacac-a-c----g
B D                   Megabat  --------gt--ctc----------cca-------------------tccaatc-gcacac-a-c----g
                Big brown bat  --------------c----------cca-------------------------------gc-g-c----a
B D                     Shrew  -----------------------------------------------------t-gggccc-c-c----a
              Star-nosed mole  -----------------------------------------------------c-tggccc-c-c----a
B D                  Elephant  ----------------ccccggtaggca-------------------ccccacg-gcgcgt-c-g----g
          Cape elephant shrew  ----------------cccaagcgggca-------------------cccagggcgcgcgc-c-a----g
B D                   Manatee  ----------------cacaggtaggca-------------------ccctatg-gcgcgc-g-g----g
             Cape golden mole  -----------------------gggca-------------------ccctagg-gcgcac-g-g----g
B D                    Tenrec  -----------------------aggca-------------------gccgcag-gcgtcc-gcg----c
                     Aardvark  ----------------agggcttgggcc-------------------caggtag-gcaccc-c-g----t
B D                 Armadillo  ----------------ccaagctaggcacacaaccctccagcccaccccccacc-gcgcgc-a-g----g
B D                  Hedgehog  ======================================================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  gactt-ctg--c---cgca--g---tcaaggcttt-----ggc--tc---a--
                        Chimp  gactt-ctg--c---cgca--g---tcaaggcttt-----ggc--tc---a--
                      Gorilla  gactt-ctg--c---cgca--g---tgaaggcttt-----ggc--tc---a--
                    Orangutan  gactt-ctg--c---cgcg--g---tcaaggcttt-----ggc--tc---a--
                       Gibbon  gactt-ctg--c---cgcg--g---tcaaggcttt-----ggc--tc---a--
                       Rhesus  gactt-ccg--c---cgcg--g---tcaaggattt-----ggc--tc---a--
          Crab-eating macaque  gactt-cag--c---cgcg--g---tcaaggattt-----ggc--tc---a--
                       Baboon  gactt-cag--c---cgcg--g---tcaaggattt-----ggc--tc---a--
                 Green monkey  gactt-cag--c---cgcg--g---tcaaggattt-----ggc--tc---a--
                     Marmoset  gagtt-ca-------------g---tcaaggcttt-----cga--tc---a--
              Squirrel monkey  gactt-cc-------------g---tcaaggcttt-----cgc--tc---a--
                     Bushbaby  gccgt-tag-ac---cgtg--g---tcaaggcttt-----ggctttt---a--
           Chinese tree shrew  cgttt-agg--t---ggcg--t---tgaaagcttt-----ggctttt---a--
                     Squirrel  ccctc-ccg-gc---ggag--g---tcaaggcttt-----ggcagtt---a--
       Lesser Egyptian jerboa  ctctt-gaaggc---ccag--g---tcaaggttta-----aac--ttgcca--
                 Prairie vole  ctcgt-tag---------------------cccct-----gac--tt---a--
              Chinese hamster  ctctt-tag---------------------gccct-----gat--tt---a--
               Golden hamster  ctctt-tag---------------------gccct-----gat--tt---a--
                        Mouse  ctcct-tgg-gc---cgaa--g---tcaccgccct-----gac--tt---a--
                          Rat  ctcct-tgg-gc---cgag--g---tcaccgccct-----gac--tta--a--
               Naked mole-rat  cgcct-ctg-gg---caat--g---tcaaggcttt-----agc--tt---t--
                   Guinea pig  ccact-gtg-tg---caat--g---tcaaggcttt-----ggc--tt---t--
                   Chinchilla  cccct-ctg-gg---caac--g---tcacggctct-----ggc--tt---t--
             Brush-tailed rat  -cccc-ccg-gc---caaa--g---tcaaggcttc-----ggg--tt---t--
                       Rabbit  cgcgt-tcg-----------------aggggcctt-----tcc--ct---c--
                         Pika  cgcgt--------------------------ccct-----agt--cc---t--
                          Pig  gcctt-ggg-gc---tgcg--g---tcaaagcttt-----ggc--tt---t--
                       Alpaca  gcctt-tag-gccg-cgcg--g---tcaaggcttt-----ggc--tt---t--
               Bactrian camel  gcctt-taa-aaggccgcg--g---tcagggcttt-----ggc--tt---t--
                      Dolphin  gcctt-tag-gc---cgcg--g---tcaaggcttt-----ggc--tt---t--
                 Killer whale  gcctt-tag-gc---cgcg--g---tcaaggcttt-----ggc--tt---t--
             Tibetan antelope  gcctt-cag-gc---cgtg--g---tcaaggcttc-----ggc--tt---t--
                          Cow  gcctt-cag-gc---cgtg--g---tcaaggcttc-----ggc--tc---t--
                        Sheep  gcctt-cag-gc---cgtg--g---tcaagacttc-----ggc--tt---t--
                Domestic goat  gcctt-cag-gc---cgtg--g---tcaaggcttc-----ggc--tt---t--
                        Horse  gtctg-tag-gc---cgcg--g---tcaaggcttt-----ggc--tt---t--
             White rhinoceros  ttctc-tag-gc---cgcg--g---tctaggattt-----ggc--tt---t--
                          Cat  gaatt-tag-gc---cacg--g---tcaagac--t-----gac--tt---t--
                          Dog  gtatt-tag-gc---cacg--g---tcaagacttt-----ggc--tt---t--
                      Ferret   gtatt-tag-gc---cacg--g---tcaagacttt-----ggc--tt---t--
                        Panda  gtact-tag-gc---cacg--g---tcaagacttt-----ggc--tt---t--
               Pacific walrus  gtatt-tag-gc---cacg--g---tcaagac--t-----agc--tt---t--
                 Weddell seal  gtatt-tag-gc---cacg--g---tcaagacttt-----ggc--tt---t--
             Black flying-fox  gcctc-ccccgc---cgcc--g---gcatggcttc-----ggc--tt---t--
                      Megabat  gcctc-ccccgc---cgcc--g---gcatggcttc-----ggc--tt---t--
                Big brown bat  gcttc-ccgcac---cgcc--c---gcgcggctg------ggc--tc---g--
                        Shrew  gccttgcgg-ac---cgtgcgc---ccagggccctgggaaggc--tt---t--
              Star-nosed mole  gccct-tgg-cc---cgta--------aagacttt-----ggc--tt---c--
                     Elephant  gactt-tag-gg---agcg--g---tcaaggcttt-----ggc--tt---tta
          Cape elephant shrew  gcctt-tcc-tc---cgct--gccctcggggtttt-----ggc--tt---tac
                      Manatee  gcctt-tag-gc---cgtg--g---tcaaggcttt-----agt--tt---tta
             Cape golden mole  acctt-cag-tc---cgct--g---tcaaagcttt-----ggt--tg---tca
                       Tenrec  gcccc-cag---------------------gctcg-----ggc--tc---cca
                     Aardvark  ggctc------g---cacg--g-cctataggcttt-----ggc--tt---tta
                    Armadillo  gcctt-tag-gc---cgcg--g---tcaaggcttt-----gcc--tt---tta
                     Hedgehog  =====================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  =====================================================
       White-throated sparrow  =====================================================
             Peregrine falcon  =====================================================
                 Saker falcon  =====================================================
                      Wallaby  =====================================================
                  Rock pigeon  =====================================================
                   Budgerigar  =====================================================
          Medium ground finch  =====================================================
              Green seaturtle  =====================================================
                 Mallard duck  =====================================================
           American alligator  =====================================================
          Collared flycatcher  =====================================================
           Tibetan ground jay  =====================================================
                    Zebrafish  =====================================================
                X. tropicalis  =====================================================
                     Platypus  =====================================================
              Tasmanian devil  =====================================================
                      Opossum  =====================================================
               Painted turtle  =====================================================
     Chinese softshell turtle  =====================================================

Inserts between block 19 and 20 in window
B D                      Pig 2bp
B D                   Alpaca 2bp
              Bactrian camel 2bp
B D                  Dolphin 2bp
                Killer whale 2bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Horse 2bp
B D         White rhinoceros 2bp
B D                      Cat 2bp
B D                      Dog 2bp
B D                  Ferret  2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
B D                    Shrew 4bp
             Star-nosed mole 4bp

Alignment block 20 of 177 in window, 36875473 - 36875715, 243 bps 
B D                     Human  ct-cccct-------caaga----cgggaagccatt-cgca--g-gg-cctagaga-aaaggag------
B D                     Chimp  ct-cccct-------caaga----cgggaagccatt-cgca--g-gg-cctagaga-aaaggag------
B D                   Gorilla  ct-cccct-------caaga----cgggaagccatt-cgca--g-gg-cctagaga-aaaggag------
B D                 Orangutan  ct-cccct-------caaga----cgggaagccatt-cgca--g-gg-cctagaga-aaaggag------
B D                    Gibbon  ct-cccct-------aaaga----ggggaagccatt-cgca--g-gg-cctagaga-aaaggaa------
B D                    Rhesus  ct-cccct-------caaga----agggaagccatt-cgca--g-gg-cctaaaga-aaaggag------
B D       Crab-eating macaque  ct-cccct-------caagc----agggaagccatt-cgca--g-gg-cctaaaga-aaaggag------
B D                    Baboon  ct-cccct-------caaga----agggaagccatt-cgca--g-gg-cctaaaga-aaaggag------
B D              Green monkey  ct-cccct-------caaga----agggaagccatt-cgcg--g-gg-cctaaaga-aaaggag------
B D                  Marmoset  tt-cccct-------caaga----cgggaagccg-t-cgca--g-gg-cctagagc-aaaggag------
B D           Squirrel monkey  ct-cccct-------caaga----cgggaagccg-t-cgca--g-gg-cccagagc-agaggaa------
B D                  Bushbaby  ct-cccct-------gatca----tgggaggcca-c-taca--g-gg-tctcccac-aaaggag------
           Chinese tree shrew  ct-cccct-------cagga----taggaagtca-t-tgca--g-aa-tctggagc-aagggag------
B D                  Squirrel  gg-catcc--gcggacgaga----aggaaagcca-c-cgca--g-tg-actaaggc-aaaggag------
       Lesser Egyptian jerboa  ct-ccctc---cggtccctg-------------------ca--g-gg-tctggaggtgaaggaa-----g
                 Prairie vole  ct-cc---------------------------------aca--g-gg-tcaggagg-gcagtaa------
B D           Chinese hamster  ct-c-----------------------------------ca--g-cg-tctggaga-gcaggaa------
               Golden hamster  ct-c-----------------------------------ca--g-gg-tctggaga-gcaggaa------
B D                     Mouse  ct-ccctc---tggtcgcga--------tagtca---tcta--g-tg-tcaggagt-gcagaaa------
B D                       Rat  ct-acctc---tggtcgcga--------tagtca---tcta--g-tg-tctggaga-gcaggaa------
B D            Naked mole-rat  tg-cccctttccgacctcca----caggaaactg-t-agca--g-gg-actacagc-aaa----------
B D                Guinea pig  cc-ctctactcaggtaacga----cagaaaccca-t-ggca--g-gg-tttgcagc-aaagaca------
                   Chinchilla  ta--cccactcgggtcgcga----taggaaccca-a-ggca--g-gg-tcctcagc-aaaggag------
             Brush-tailed rat  ta-ccccacttgggtcgccg----taggaaccca-a-ggcc--g-gg-tctgcagc-a------------
B D                    Rabbit  ct-ct----------------------------------cg--a-ga-tgccg----------g------
B D                      Pika  ca-gt----------------------------------ca--a-gg-cttagagt-agaggag------
B D                       Pig  ct-ctcag-------ctaga----tgccgagcaa-t-tgca--g-gg-cctagagt-aaaagag------
B D                    Alpaca  ct-ctcag-------ctaga----tgcaaggcaa-t-tgca--a-ag-tctagagt-aaaggag------
               Bactrian camel  ct-ctcag-------ctaga----tgcaaggcaa-t-tgca--a-ag-tctagagt-aa---ag------
B D                   Dolphin  ct-cccag-------ct-----------aaacaa-t-ggca--g-gg-tctagagt-caaggag------
                 Killer whale  ct-cccag-------ct-----------aaacaa-t-ggca--g-gg-tctagagt-caaggag------
             Tibetan antelope  ct-cccgg-------ct-----------aagcaa-a-tgcc--g-gcttccagaga-cgtg---------
B D                       Cow  ct-cccgg-------ct-----------aagcaa-a-tgcc--g-gc-tcgagaga-cgtg---------
B D                     Sheep  ct-cccgg-------ct-----------aagcaa-a-tgcc--g-gc-tcgagaga-cgcg---------
                Domestic goat  ct-cccgg-------ct-----------aagcaa-a-tgcc--g-gc-tcgagaga-cgcg---------
B D                     Horse  ct-ctcag-------ctagg----tgcaaagcca-c-tgca--g------cagagt-aaaggag------
B D          White rhinoceros  ct-ctcag-------ctagc----tgcaaagtc-----------------tagagt-aaaggag------
B D                       Cat  cg-ctgag-------ctaga----tgcaatgcca-t-tgcg--g-gg-tctagagg-aaaggag------
B D                       Dog  ct-ctccg-------ctagagagctgccaggcca-c-cgcatgg-ag-ggaagagg-aaaggag------
B D                   Ferret   ct-ctcgg-------ctaga----tgcgatgcca-t-taca--g-gg-tctcgagt-aaacgag-----t
B D                     Panda  ct-ctcgg-------ccaga----tgc-atgcca-t-tgca--g-ga-tctagagt-aaaggag------
               Pacific walrus  ct-ctcgg-------ctaga----tgcaatgcca-t-tgca--g-gg-tctagagt-aaaggag------
                 Weddell seal  ct-ctcgg-------ctaga----tgcaatgcca-t-tgca--g-gg-tctagagt-aaaggag------
             Black flying-fox  ct-ctcag-------ccaga----agcaaagcca-t-tgca--g-ag-tctagagt-aaaggaa------
B D                   Megabat  ct-ctcag-------ccaga----cgcaaagcca-t-tgca--g-ag-tctagagt-aaaggaa------
                Big brown bat  ct-ctccg-------ctgga----tgcagagcca-g-ggga--g-gg-tcttggg---------------
         David's myotis (bat)  ct-ccccg-------ccgga----tgcccagcca-c-gggc--g-gg-cctcggg---------------
B D                     Shrew  gt-ctcag-------cgcca----gggaaagccc-t-cgca--g-ga-cctggagc-agagagggatatc
              Star-nosed mole  ct-ctcag-------ctaga----tgcaaaacc----cgta--t-ac-tctagaat-aacgggg------
B D                  Elephant  ct-cccag-------agaga----tgagaagcca-t-tgca--g-gg-tctagagc-agaagag------
          Cape elephant shrew  ct-cc----------agaga----cgagaagcca-tcccca--a-gg-aatggggc-agaaacc------
B D                   Manatee  tt-cccag-------cgaga----tgggaagcca-c-tgca--g-gg-tctagagc-agaagaa------
             Cape golden mole  tt-gccag-------cgagt----ggcggaggca-c-tgca--gaag-tctaaagc-agaagag------
B D                    Tenrec  ---gcgat-------cgaga----tgggaagcca-t-tgca--g-gg-tctctagc-ag--ttg------
                     Aardvark  ctgcccga-------caaga----tgggaaacca-a-tgca--a-gg-tccacagc-agaagag------
B D                 Armadillo  ct-cccag-------caaga----tgggacgcca-c-tgca--g-tt-tctacagc-agaggaa------
B D                  Hedgehog  ======================================================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  tgacaggat--c----ttgg-----ccccct--gagtg----------g---------------------
                        Chimp  tgacaggat--c----ttgg-----ccccct--gagtg----------g---------------------
                      Gorilla  tgacaggat--a----ttgg-----ccccct--gagtg----------g---------------------
                    Orangutan  tgacaggat--c----ttgg-----ccccct--gggtg----------g---------------------
                       Gibbon  tgacaggat--c----ttgg-----ccccct--gagtg----------g---------------------
                       Rhesus  tgacaggat--c----ttgg-----ccccc------cc----------g---------------------
          Crab-eating macaque  tgacaggat--c----ttgg-----ccccc------cc----------g---------------------
                       Baboon  tgacaggat--c----ttgg-----ccccc------cc----------g---------------------
                 Green monkey  tgacaggat--c----ttgg-----ccccc------cc----------g---------------------
                     Marmoset  tgacgggat--c----ttgg-----ccccct--cagtg----------g---------------------
              Squirrel monkey  tgacgggat--c----ttgg-----ccccct--gagtg----------g---------------------
                     Bushbaby  ggataacac--c----ttgg-----taactc--aagtg----------a--------------------t
           Chinese tree shrew  tgacaagatccc----ttgt-----cctccg--ggtta----------t---------------------
                     Squirrel  cgg-aagat--c----tcag-----tcccct--ccttg----------a---------------------
       Lesser Egyptian jerboa  tgacaagaa--g----ttaa----ttccctc--gataa----------a---------------------
                 Prairie vole  agacaaaat--c----ttaatacctcgcctc--cagcg----------a---------------------
              Chinese hamster  agataaaat--c----ttaacatcttgcccc--cagtg----------a---------------------
               Golden hamster  tgataaaat--c----ttaacaccttgcccc--cagtg----------a---------------------
                        Mouse  tgacaaaat--c---tttaacacctcacccc--cagtg----------a---------------------
                          Rat  tgacaaaat--c---tttaacacttaacccc--cagtg----------a---------------------
               Naked mole-rat  -----------------------------------atg----------a---------------------
                   Guinea pig  tgacaaggt--c----ttag-----tacctt--cggtg----------a---------------------
                   Chinchilla  tgacaaggt--c----ttcg-----cccctt--cggtg----------a---------------------
             Brush-tailed rat  ----aaggt--c----tcgg-----cccctt--cggag----------a---------------------
                       Rabbit  cgacaagac--c----tgag-----tcccc---gagtg----------c---------------------
                         Pika  tgactagac--c----ttag-----tgccctggggggg----------a---------------------
                          Pig  cgacaagat--ccgatttaa-----tccttt--gagag----------a---------------------
                       Alpaca  tgacaagat--ctgccttag-----tccttt--tagtg----------a---------------------
               Bactrian camel  tgacaagat--ctgccttag-----tccttt--tagtg----------a---------------------
                      Dolphin  tgacaagat--ctgatttag-----tccttc--gagtg----------a---------------------
                 Killer whale  tgacaagat--ctgatttag-----tccttc--gagtg----------a---------------------
             Tibetan antelope  ---taagat--ctgatttag-----tccttg--tagcg----------a---------------------
                          Cow  ---taagat--ctgatttag-----tccttg--tagcg----------a---------------------
                        Sheep  ---taagat--ctgatttag-----tccttg--tagcg----------a---------------------
                Domestic goat  ---taagat--ctgatttag-----tccttg--tagcg----------a---------------------
                        Horse  taacaaggt--ctgattgag-----tccctc--gagtg----------a---------------------
             White rhinoceros  tgacaaggt--ctgatttag-----tccctc--gtgtg----------a---------------------
                          Cat  taacaagaa--ctgatttag-----tctccc--gagtg----------a---------------------
                          Dog  tcacaagac--ctgacctag-----tctctc--gagtg----------a---------------------
                      Ferret   taacaagac--ccgattcag-----tctctc--gagtg----------a---------------------
                        Panda  taac---at--ttgatttag-----tctctc--gagtg----------a---------------------
               Pacific walrus  taacaagat--ctgatttag-----tctctc--cagtg----------a---------------------
                 Weddell seal  taacaagat--ctgatttag-----tttctc--gagtg----------a---------------------
             Black flying-fox  tgactagat--ctgatttag-----tccctc--gagtg----------a---------------------
                      Megabat  tgactagat--ctgatttag-----tccctc--gagtg----------a---------------------
                Big brown bat  -gacaagac--ctgatctag-----tccctc--cagtg----------atgatgatgatgatgatgatga
         David's myotis (bat)  -gacgggat--ccgatccgg-----tcccgc--cagcg----------g-------gtttttttctcttt
                        Shrew  cgacacg-----------ag-----tgccct--aagtg----------a---------------------
              Star-nosed mole  cgacacgat--cagatttaa-----tctctc--gagag----------a---------------------
                     Elephant  tgacaaggt--gcgacttag-----ttcccc--aagtg----------t---------------------
          Cape elephant shrew  tgacaag----------tag--------ccc--gacac----------t---------------------
                      Manatee  tgaaaagat--acaactcag-----tccctc--cagtg----------t---------------------
             Cape golden mole  tgacaagag--gcgacttaa-----ttcccc--gagtg----------t---------------------
                       Tenrec  tgacaagat--cctacttag-----atcccc--aggggcgggcttcttt---------------------
                     Aardvark  tgacaaaat--gagaaatag-----ttcccc--gggca----------t---------------------
                    Armadillo  tgaaaaggt--gtgacttag-----------------a--------------------------------
                     Hedgehog  ======================================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  -cctg-----------------aggca----------aaag--gaata-------------atc--t---
                        Chimp  -cctg-----------------aggca----------aaag--gaata-------------atc--t---
                      Gorilla  -cctg-----------------aggca----------aaag--gagta-------------atc--t---
                    Orangutan  -cctg-----------------aggca----------aaag--gaata-------------atc--t---
                       Gibbon  -cctg-----------------aggca----------aaag--gtata-------------atc--t---
                       Rhesus  -cccc-----------------agaca----------aaag--gaata-------------atc--t---
          Crab-eating macaque  -cccc-----------------agaca----------aaag--gaata-------------atc--t---
                       Baboon  -cccc-----------------agaca----------aaag--gaata-------------atc--t---
                 Green monkey  -cccc-----------------agaca----------aaag--gaata-------------atc--t---
                     Marmoset  -cctg-----------------aggca----------aaag--aaatg-------------atc--t---
              Squirrel monkey  -cctg-----------------aggca----------aaag--gaatg-------------atc--t---
                     Bushbaby  ttttg-----------------tggca----------aaag--caata-------------atttgt---
           Chinese tree shrew  -ttgc-----------------cagga----------ctaa--gaata-------------acctgt---
                     Squirrel  -cttc-----------------ggagg----------caaa--ggcta-------------acg--t---
       Lesser Egyptian jerboa  -attc-----------------gaaag----------aata-cgg---------------------t---
                 Prairie vole  -cttc-----------------taaaa----------aaca--gaaaa-------------acc--t---
              Chinese hamster  -tttc-----------------tgaaa----------agaa---aata-------------gcc--t---
               Golden hamster  -ttcc-----------------taaaa----------agaaaagaata-------------gcc--t---
                        Mouse  -cttc-----------------taaag----------caaa-agaata-------------acc--t---
                          Rat  -cttc-----------------taaag----------caaa-cgaata-------------acc--t---
               Naked mole-rat  -tttc-----------------tgagg----------caag-gg-ata-------------acc--tgaa
                   Guinea pig  -cttc-----------------tgagg----------caaa-ggaata-------------tcc--t---
                   Chinchilla  -tttc-----------------tgggg----------caag-ggaata-------------aca--t---
             Brush-tailed rat  -tttc-----------------cgggg----------caag-ggaata-------------acc--t---
                       Rabbit  -tttt-----------------tagat----------aaaa-ggaatg-------------acc--t---
                         Pika  -ggtt-----------------cggat----------caaa-ggaatc-------------acc--t---
                          Pig  -tttt-----------------tgagg----------cagaaggaata-------------acc--t---
                       Alpaca  -tttt-----------------tgaaa----------caaaagttata-------------tcc--t---
               Bactrian camel  -tttt-----------------tgaag----------caaaagttata-------------tcc--t---
                      Dolphin  ---tg-----------------tgagg----------caaaaggaata-------------acc--t---
                 Killer whale  ---tg-----------------tgagg----------caaaaggaata-------------acc--t---
             Tibetan antelope  -tctc-----------------tgaag----------caaaaggaatg-------------gcc--c---
                          Cow  -tctc-----------------tgagg----------caaaaggaatg-------------gcc--c---
                        Sheep  -tctc-----------------tgaag----------caaaaggaatg-------------gcc--c---
                Domestic goat  -tctc-----------------tgaag----------caaaaggaatg-------------gcc--c---
                        Horse  -tttt-----------------tgagg----------caaaaggaata-------------acc--t---
             White rhinoceros  -attt-----------------tgagg----------caaaaagaata-------------acc--t---
                          Cat  -tttt-----------------tgagg----------caaatggaata-------------acc--c---
                          Dog  -tttc-----------------cgagg----------ccaatggaaac-------------acc--g---
                      Ferret   -tttt-----------------tgagg----------caaatggaata-------------acc--t---
                        Panda  -tttt-----------------tga-g----------caaacggaata-------------acc--t---
               Pacific walrus  -tttt-----------------tgagg----------caaatggaata-------------acc--t---
                 Weddell seal  -tttt-----------------tgagg----------caaatggaata-------------acc--t---
             Black flying-fox  -tttt-----------------taagg----------caaacgg--------------------------
                      Megabat  -tttt-----------------gaagg----------caaacgg--------------------------
                Big brown bat  ttatt-----------------tgagg----------caaaagg--------------------------
         David's myotis (bat)  ttttt-----------------ggagg----------caaaagg--------------------------
                        Shrew  -ttgt-----------------tgagg----------ccaaacaaaaaaacaaaaccaaatacc--t---
              Star-nosed mole  -cctt-----------------cgagg----------ccgaaga-----------------acc--t---
                     Elephant  -tttt-----------------tgagg----------caaaaagaata-------------acc--t---
          Cape elephant shrew  -tctt-----------------taaaaaaggaaatttaaaaaagaatc-------------atc--t---
                      Manatee  -tttt-----------------tgagg----------caaaaagaata-------------acc--t---
             Cape golden mole  -cttt-----------------caggg----------ccaacagatgc-------------acc--t---
                       Tenrec  -ctttttctcccctccaccgcccgagg----------caacccgatga-------------act--t---
                     Aardvark  -tttcttttcctttctttt---tgagg----------caaaaagta-a-------------gcc--t---
                    Armadillo  ----------------------tcaga-------------------------------------------
                     Hedgehog  ======================================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ------aagcaa--gtt-ttcctacttac-----------tttt--agcg---cac---------tgg-t
                        Chimp  ------aagcaa--gtt-ttcctacttac-----------tttt--agcg---cac---------tgg-t
                      Gorilla  ------aagcaa--gtt-ttcctacttac-----------tttt--agcg---cac---------tgg-t
                    Orangutan  ------aagcaa--gtt-ttcctacttac-----------tttt--agcg---cac---------tgg-t
                       Gibbon  ------aagcaa--gtt-ttcctacttac-----------tttt--agcg---cac---------tgg-t
                       Rhesus  ------aagcaa--gtt-ttcctacttac------------ttt--agcg---cac---------tgg-t
          Crab-eating macaque  ------aagcaa--gtt-ttcctacttac------------ttt--agcg---cac---------tgg-t
                       Baboon  ------aagcaa--gtt-ttcctacttac------------ttt--agcg---cac---------tgg-t
                 Green monkey  ------aagcaa--gtt-ttcctacttac------------ttc--agcg---cac---------tgg-t
                     Marmoset  ------aagcaa--gtt-ttcctaattac-----------tttt--agcc---cac---------tgg-t
              Squirrel monkey  ------aagcaa--gtt-ttcctaattac-----------tttt--agcc---cac---------tgg-t
                     Bushbaby  ------agccta--gtt-tcctcacttaa-----------tttt--agcg---cat---------cgg-t
           Chinese tree shrew  ------aggcac--gtt-tccccaccaac-----------ttac--agcg---cat---------tgg-t
                     Squirrel  -g--t-aggcaa--gct-tccccgact----------------t--tagg---cgt---------gtt-g
       Lesser Egyptian jerboa  -g--c-cggcaa--gtt-ttcccacac---------------------------at---------cgg-c
                 Prairie vole  -g--t-aggtga--gct-gccccacatcc-----------ttct--acca---cat---------ctg-t
              Chinese hamster  -g--t-aggtga--tct-gtcccatagac-----------ttct--agca---ctt---------ctg-t
               Golden hamster  -g--t-aggtga--gct-gtcccatatag-----------ttct--agga---cat---------ttg-t
                        Mouse  -g--t-aggcga--gct-gtcctatac---------------------------at---------cag-t
                          Rat  -g--t-aggcga--gct-gtcccatac-------------ttct--tgca---tat---------ctg-t
               Naked mole-rat  ag--c-aggcaa--gtt-ttcccatac-------------ttgc--ggcg---cac---------tgg-t
                   Guinea pig  -g--t-aggcaa--gtt-tttccatag-------------tttt--agca---cgt---------tgt-t
                   Chinchilla  -g--t-aggcaa--gtt-ttcccatag-------------tttt--agca---cac---------tgg-t
             Brush-tailed rat  ----t-cgccaa--gtc-ttcccccag-------------gttt--agca---cac---------tga-c
                       Rabbit  -c--c-aggcaa--atc-ttcccat-----ttgttttctttctt--agcg---cac---------t-g-t
                         Pika  -g--t-aggcaa--gtt-ttcccacccccacctttttttttttt--agcg---cac---------tag-t
                          Pig  -g--t-aggcaa--att-ttcctattta------------ctttt-ggcg---taa---------tgg-t
                       Alpaca  -g--t-agtcat--att-ttcctgtttac-----------ttttt-agcg---tat---------tgg-t
               Bactrian camel  -g--t-agtcat--att-ttcctgtttac-----------ttttt-agcg---tat---------tgg-t
                      Dolphin  -g--tggggaaa--att-ttcctattta------------------agcg---tac---------cgg-t
                 Killer whale  -g--tggggaaa--att-ttcctattta------------------agcg---tac---------cgg-t
             Tibetan antelope  -g--c-gggcaa--atc-tgcctctttaa-----------ctttc-agcg---tac---------tgg-t
                          Cow  -g--c-gggcaa--att-tgcctgtttaa-----------ctttc-agcgtactac---------tgg-t
                        Sheep  -g--c-gggcaa--att-tgcctgtttaa-----------ctttc-agcg---tac---------tgg-t
                Domestic goat  -g--c-gggcaa--att-tgcctgtttaa-----------ctttc-agcg---tac---------tgg-t
                        Horse  -g--t-aaacaa--gtt-ttcccatttac-----------tttt--agcg---tat---------tgg-t
             White rhinoceros  -g--t-aggcaa--gtt-ttcccatttac-----------cttt--agcg---tat---------tgg-t
                          Cat  -a--g-aggcag--aat-ttcc------c-----------ttta--agcg---tac---------tgg-a
                          Dog  -g--a-gtgcaa--atc-aacccgttcac-----------tttttcagca---cac---------tgg-a
                      Ferret   -g--a-gtgcaa--attccccccatttac------------ttt--agcg---tat---------tgg-a
                        Panda  -g--a-gcgcaa--att-ttcccatttac-----------tttt--agcg---tat---------tag-a
               Pacific walrus  -g--a-gtgcaa--att-ttcccatttac-----------tttt--agtg---tat---------tgg-a
                 Weddell seal  -g--a-gtgcaa--gtt-ttcccatttac-----------tttt--agcg---tat---------tgg-a
             Black flying-fox  ---------caa--att-ttcccacttac-----------ttttt-agcg---tgt---------cgg-t
                      Megabat  ---------caa--att-ttcccacttac-----------ttttt-agcg---tgt---------tgg-t
                Big brown bat  -----------------------aataac-----------ctgta-ggca---gaa---------tgt-c
         David's myotis (bat)  -----------------------aataac-----------ctgca-ggca---aaa---------tgtcc
                        Shrew  -g--g-aggcaa--aat-ttcccatttac-----------tttt--cacg---tat---------cga-t
              Star-nosed mole  -g--t-agacaa--acg-ttcccatttac-----------tttt--cgcg---tgg---------tgg-g
                     Elephant  -g--t-agacaa--gtt-ttcccatttac-----------tttt--agtg---cac---------tca-t
          Cape elephant shrew  -gtat-agacaaacacg-ttcccattctc-----------tttc--agcg---caagggggggcgggg-t
                      Manatee  -g--t-agacaa--ctt-ttctcatttgc-----------tttt--agcg---cag---------tgg-t
             Cape golden mole  -g--c-agacaa--gtt-ttctccttt-------------------------------------------
                       Tenrec  -g--t-at-caa--gtt-tcctcctttac-----------tttg--ggcg---ccg---------tgg-t
                     Aardvark  -g--t-agacaa--gtt-ttctcatttac-----------tttt--agcg---cag---------tga-t
                    Armadillo  --------acag--------ctcatttac-----------tgtt--agca---ctg---------tga-t
                     Hedgehog  ======================================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  acac--acaca--aat-aca----caatac--aa-----------------tt-----------------
                        Chimp  acac--acaca--aat-aca----caatac--aa-----------------tt-----------------
                      Gorilla  acac--ataca--aat-aca----caatac--aa-----------------tt-----------------
                    Orangutan  acac--acaca--aat-aca----caatac--aa-----------------tt-----------------
                       Gibbon  ac------ata--aat-aca----caatac--aa-----------------tt-----------------
                       Rhesus  acac--acaca--aat-aca----caatac--aa-----------------tt-----------------
          Crab-eating macaque  acac--acaca--aat-aca----caatac--aa-----------------tt-----------------
                       Baboon  acac--acaca--aat-aca----caatac--aa-----------------tt-----------------
                 Green monkey  acac--acaca--aat-aca----caatac--aa-----------------tt-----------------
                     Marmoset  acac--acaca--aat---------aatac--aa-----------------tt-----------------
              Squirrel monkey  acac--acaca--aat---------aatac--ga-----------------gt-----------------
                     Bushbaby  acat--ataca--aaa-cca----caatac--aa-----------------ttaacgt-t----------
           Chinese tree shrew  ctga--aaaca--caa-gaa----acattctgaa-----------------tt-----------------
                     Squirrel  acat--ctata--aac-a-----------c--aa-----------------ttaac-t-tg-------ac
       Lesser Egyptian jerboa  acat--gcaaa--aat-a---------cac--ga-----------------tt-----------------
                 Prairie vole  acac--atacg--aat-a----------aa--at-----------------ttgaagt-tg-------ac
              Chinese hamster  acac--acaca--aaa-at-----ataaac--gt-----------------ctgacgc-tg-------ac
               Golden hamster  acac--acaca--cac-ac-----acacac--acacacacacacacacacactgatgc-tg-------ac
                        Mouse  gcat--agaca--agc-a---------aac--ga-----------------ttaacgc-tg-------ac
                          Rat  gcat--ataca--agt-a---------aac--ga-----------------ttaacgc-tg-------ac
               Naked mole-rat  atacatgcaca--tac-a------caatac--aa-----------------ttaaggt-tg-------ac
                   Guinea pig  ctac--gcata--cgc-g------cgatac--aa-----------------ttaaaat-tg---------
                   Chinchilla  acac--gcata--tgc-a------cagtac--aa-----------------ttaaggc-tg---------
             Brush-tailed rat  acgg--gcata--cgc-a------caatac--aa-----------------ttaaggg-cg---------
                       Rabbit  acat--acaca--aat-aca----cgatac--cg-----------------ttaacgt-tg-------ac
                         Pika  acag--acaca--aat-gcc----c---cc--ag-----------------ttaacgt-tg-------at
                          Pig  acac--ataca--aat-acataaacaatat--aa-----------------tttacgtacg-------ac
                       Alpaca  acat--acaca--gat-acataaacaatat--aa-----------------ttaatgtaca-------at
               Bactrian camel  acat--acaca--gat-acataaacaatat--aa-----------------ttaatgtaca-------at
                      Dolphin  acat--atgca--------------tatat--aa-----------------ttaacatacc-------at
                 Killer whale  acat--atgca--------------tatat--aa-----------------ttaacatacc-------at
             Tibetan antelope  acac--agaca--------------aatac--ag-----------------ttcacataca-------ac
                          Cow  acac--agaca--------------aatac--ag-----------------ttcacataca-------ac
                        Sheep  acac--agaca--------------aatac--ag-----------------ttcacataca-------ac
                Domestic goat  acac--agaca--------------aatac--ag-----------------ttcacataca-------ac
                        Horse  acat--ttaca--aat-acataaacaat----------------------------gtata-------at
             White rhinoceros  acat--ataca--gat-acataaacaatac--aa-----------------ttaacgtata-------at
                          Cat  acat--ataca--aat-acataagcaat------------------------tcacgtata-------at
                          Dog  aaac--gtgca--gat-acacagacaatgc--ga-----------------ttacccaatg-------at
                      Ferret   aaac--acacacgaat-acataaacaatac--aa-----------------ttcacgtata-------ac
                        Panda  aaac--atacaggaat-acgtaaacaatac--aa-----------------ttaacgtata-------at
               Pacific walrus  aaac--atacacgaat-acgtaaccaat------------------------taacgtata-------at
                 Weddell seal  aaac--atacacgaat-acgtaaccaatac--aa------------------taacgtata-------at
             Black flying-fox  tcat--atatg--aacaacataaacaattc--ta-----------------ttaacatgta-------a-
                      Megabat  tcat--atacg--aacaacataaacaattc--ta-----------------ttaacatgta-------a-
                Big brown bat  ccat--ttaca--atgaacgttatcat------------------------------taaa-------a-
         David's myotis (bat)  ccct--ttgca--atcaacgttatgac---------------------------------a-------a-
                        Shrew  gcat--atatg--agt-acataaaccatac--ag-----------------ccaacgtata-------at
              Star-nosed mole  ccag--agcca--cat-ccgtacataata-----------------------caaaataca-------ct
                     Elephant  atat--ataca--aa----a----acatac--aa-----------------ttaacgtata-------gt
          Cape elephant shrew  gtag--gtaca--agc-aca----acatac--ca-----------------ttaacgt------------
                      Manatee  atat--ataca--aat-acatac-acatac--ca-----------------ttaacgtata-------gt
             Cape golden mole  ---t--agcaa--ta---------acgtag----------------------taaagtcta---------
                       Tenrec  gtat--agata--ta----c----acacag--at-----------------ctaatgtatatgcaatagt
                     Aardvark  atac--ataca--aat-acataa-acgtac--aa-----------------ttaacgtcta-------gt
                    Armadillo  atat--ataaa--tac-ata------atac--aa-----------------ttaacgtaca-------gt
                     Hedgehog  ======================================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ---------------------cat---a--t-aa-----cacg-----aatttcgtcc---c-ggttgag
                        Chimp  ---------------------cat---a--t-aa-----cacg-----aatttcgtcc---c-ggttgag
                      Gorilla  ---------------------cat---a--t-aa-----cacg-----aatttcatcc---c-ggttgag
                    Orangutan  ---------------------cat---a--t-aa-----cacg-----aatttcgtcc---c-ggttgag
                       Gibbon  ---------------------cat---a--t-aa-----cacg-----aatttcgtcc---c-ggttgag
                       Rhesus  ---------------------cat---a--t-aa-----caag-----aatttcgtcc---c-ggttgaa
          Crab-eating macaque  ---------------------cat---a--t-aa-----caag-----aatttcgtcc---c-ggttgaa
                       Baboon  ---------------------cat---a--t-aa-----caag-----aatttcgtcc---c-ggttgaa
                 Green monkey  ---------------------cat---a--t-aa-----caag-----aatttcgtcc---c-ggttgaa
                     Marmoset  ---------------------cat---a--c-aa-----catg-----aatttcgtcc---c-ggttgag
              Squirrel monkey  ---------------------cat---a--c-aa-----catg-----aatttcgtcc---c-ggtcgaa
                     Bushbaby  --aactgaattcagcaaataaaac---a--t-aa-----caca-----aacttcgtcc---c-gtttgag
           Chinese tree shrew  ---------------------aaa---a--t-at-----aaca-----aatttcgttc---c-gcttgag
                     Squirrel  ttaaccggattc---------gct---g--a-ga----tgaca-----aatttcgtcc--------tgtt
       Lesser Egyptian jerboa  --aagtgaatgc---------att---g--a-aa----tagca-----cgtttcctcctcct-ggttgag
                 Prairie vole  --aacttaattc---------att---t--a-aaaaaatagta-----cgtttcctcc--------tgag
              Chinese hamster  --aacgtgattc---------att---t--a-aa-----atca-----tgttacc---------------
               Golden hamster  --aaactgattc---------att---t--a-aa-----agca-----tgtttcc---------------
                        Mouse  --aacttatttt---------att---taaa-aaaatataata-----tggttcctcc--------tgag
                          Rat  --aacttacttt---------att------a-aaaaaatagca-----tggttcctcc--------tcag
               Naked mole-rat  ttaacagaattc---------act---a--a-aa--aaccaca-----aatttcggcc---t-gtttgaa
                   Guinea pig  ---------------------act---a--a-aa--ggacaca-----aatttcggct---t-gtttgaa
                   Chinchilla  ---------------------act---a--a-aa--gaacaca-----aacttcggcc---t-gtctgaa
             Brush-tailed rat  ---------------------act---a--g-ag--gaacaca-----aacgacggcc---t-gttggaa
                       Rabbit  ttag-tgagctc---------att---a--g-gac---aaaac-----aattccaccc---c-atttgag
                         Pika  tt-----aactc---------ttt---a--c-aatgtgaaaca-----aatttcatca---c-atttgag
                          Pig  tcaacgaaatgcagaaa----agt---a--t-ac-----caca-----aattccgtcc---t-atttgag
                       Alpaca  tcaaggaaattcatgaa----aat---a--c-aa-----caca-----aatttcattc---c-gtttgag
               Bactrian camel  tcaaggaaattcatgaa----aat---a--c-aa-----caca-----aatttcattc---c-gtttgcg
                      Dolphin  ttaagtaaactcatgaa----aat---a--t-aa-----caca-----gatttcgtcc---c-gtttgag
                 Killer whale  ttaagtaaactcatgaa----aat---a--t-aa-----caca-----gatttcgtcc---c-gtttgag
             Tibetan antelope  ttaagtaaactcacgat----aat---a--t-aa-----caca-----aatttcgtcc---c-atttgaa
                          Cow  ttaagtaaactcatgat----aat---a--t-aa-----caca-----aatttcgtcc---c-atttgaa
                        Sheep  ttaagtaaactcacgat----aat---a--t-aa-----caca-----aatttcgtcc---c-atttgaa
                Domestic goat  ttaagtaaactcacgat----aat---a--t-aa-----caca-----aatttcgtcc---c-atttgaa
                        Horse  ttaaataaactcacgaa----aat---a--a-aa-----caca-----aatttcgtcc---c-gtttgag
             White rhinoceros  ttaactaaattcatg------------a--a-aa-----caca-----aatttcctcc---c-gtttgag
                          Cat  ----ctaaattcattaa----aac---a--g-aa-----caca-----aatttcgtcc---cggcctgag
                          Dog  ----ccagagccatgaa----acc---g--cgaa-----cacc-----aaattcgtcc---c-gctggag
                      Ferret   ----ctaaattcatgaa----act---a--g-aa-----caca-----catctcgtcc---c-gcttgca
                        Panda  ----ctaaactaatgaa----aat---a--t-aa-----taca-----agtttcgtcc---c-gcttgag
               Pacific walrus  ----ctaaattcatgag----act---g--t-aa-----caca-----aatttcgtcc---c-ggttgaa
                 Weddell seal  ----ctaaactcatgaa----att---g--t-aa-----caca-----aatttcgtcc---c-gcttgaa
             Black flying-fox  ----ctaaattt-tgaa----aat---a--t-aa-----gata-----aatatcgtcc---c-gtttgag
                      Megabat  ----ctaaattt-tgaa----aat---a--t-aa-----gata-----aatatcgtcc---c-gtttgag
                Big brown bat  ----ccaagttcatgaa----aac---a--g-aa-----caca-----aataccgccc---c-gtttcgt
         David's myotis (bat)  ----ctaagctcatgca----aac---g--t-ca-----cgca-----aataccgccc---c-gttcggt
                        Shrew  ttaactatattcagggg----aa----g--a-aa-----taca-----aatcgtgacc---c-gtttcaa
              Star-nosed mole  tcca----attccggag----cg----a--c-aa-----caca-----catttcatcc---c-gtctgag
                     Elephant  ttaactacattc---------act---a--a-aa-----tata--------------a---c-g-ttgag
          Cape elephant shrew  -----tgctcac---------act---a--a-aa-------------------------------ctgct
                      Manatee  ttaactatattc---------att---a--a-aa-----tata--------------c---c-g-ctaag
             Cape golden mole  --------cgtc---------att---a--g-aa-----ttta--------------c---c-gtttgag
                       Tenrec  ttagct--cgtc---------gttcaaa--t-aa-----tata--------------c---c-gttggcg
                     Aardvark  ttaact--attc---------att---a--a-aa-----tata--------------c---c-gtttgac
                    Armadillo  tgaactacatac---------gtt---a--a-aa-----tataacacacattttg-cc---c-gcttaag
                     Hedgehog  ======================================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  taaa----attccgcttacctac-----t-g------cacttt------------tt---------acc-
                        Chimp  taaa----attccgcttacctac-----t-g------cacttt------------tt---------acc-
                      Gorilla  taggttgcattccgcttacctac-----t-g------cacttt------------tt---------acc-
                    Orangutan  taaa----attccccttacctac-----t-g------cacttt------------tt---------acc-
                       Gibbon  taaa----atttcgcttacctac-----t-g------cacttt------------tt---------acc-
                       Rhesus  taaa----aatccgcttacctac-----t-g------cacttt------------tt---------acc-
          Crab-eating macaque  taaa----aatccgcttacctac-----t-g------cacttt------------tt---------acc-
                       Baboon  taaa----aatccgcttacctac-----t-g------cacttt------------tt---------acc-
                 Green monkey  taaa----aatccgcttacctac-----t-g------cacttt------------tt---------acc-
                     Marmoset  taaa----aatccgcttacctac-----t-g------cacttt------------tt---------aacc
              Squirrel monkey  taaa----aatccgcttacctac-----t-g------cacttt------------tt---------aacc
                     Bushbaby  taaa----a-tccgcttacctac-----t-g------cacttt------------tt---------acc-
           Chinese tree shrew  taaa----a-gctgcttacctac-----t-g------cacttt------------tt---------acc-
                     Squirrel  taaa----a-cccgcttacctac-----t-g------cacttt------------tt---------acc-
       Lesser Egyptian jerboa  tgaa----a-tccgcttacctac-----t-g------catcttaaaaaaataataaa---------acc-
                 Prairie vole  taga----a-tcctcttacctac-----tgg------tacttt------------tt---------acc-
              Chinese hamster  ----------ttcgcttacctac-----tag------cacctt------------tt---------acc-
               Golden hamster  ----------tccgcttacctac-----tgg------cacctt------------tt---------acc-
                        Mouse  taaa----a-tgtgcttacctac-----tgg------cacttt------------tt---------acc-
                          Rat  taaa----a-tctgcttacctac-----tgg------cacttt------------tt---------acc-
               Naked mole-rat  taaa----g-tctgcttacctac-----t-g------cacttt------------tt---------acc-
                   Guinea pig  taaa----a-tctgcttacctac-----t-a------cacatt------------tt---------acc-
                   Chinchilla  tata----a-cctgcttacttac-----t-g------cacctt------------tt---------acc-
             Brush-tailed rat  gaga----a-tctgcttacctag-----t-g------cacctt------------tt---------acc-
                       Rabbit  taaa----a-ttcgcttacctac-----c-g------cacctt------------tt---------acc-
                         Pika  taaa----a-ttcgcttacctac-----t-g------cacttt------------tt-----tttaacc-
                          Pig  taaa----a-ttctcttaccta------t-g------cacttt------------tt---------acc-
                       Alpaca  taaa----a-cccgcttacctac-----t-g------cat-tt------------tt-------taacc-
               Bactrian camel  taaa----a-cccgcttacctac-----t-g------cat-tt------------tt-------taacc-
                      Dolphin  taaa----a-ttagcttaccta------t-g------cacttt------------tt---------acc-
                 Killer whale  taaa----a-ttagcttaccta------t-g------cacttt------------tt---------acc-
             Tibetan antelope  taaa----a-tccgcttaccta------g-g------cac-tt------------tt---------acc-
                          Cow  taaa----a-tccgcttaccta------g-g------cac-tt------------tt---------acc-
                        Sheep  taaa----a-tccgcttaccta------g-g------cac-tt------------tt---------acc-
                Domestic goat  taaa----a-tccgcttaccta------g-g------cac-tt------------tt---------acc-
                        Horse  taaa----a-ttcgcttacctac-----t-g------cacttc------------tt---------aca-
             White rhinoceros  taaa----a-ttcgcttacctac-----t-g------cacttc------------tt---------aca-
                          Cat  taaa----a-ttcgcttacctac-----t-g------cacttt------------ct---------act-
                          Dog  taaa----a-ttcgcttacctac-----t-g------cacttt------------tt---------acc-
                      Ferret   taaa----a-ttcgcttacctac-----t-g------ca--tt------------tt---------aaa-
                        Panda  taaa----a-ttcgcttacctac-----t-g------cacttt------------tt---------acc-
               Pacific walrus  taaa----a-ttcgcttacctac-----a-g------cacttt------------tt---------acc-
                 Weddell seal  taaa----a-ttcgcttacctac-----a-g------cacttt------------tt---------acc-
             Black flying-fox  aaac----a-ttcgctta----------------------------------------------------
                      Megabat  aaac----a-ttcgctta----------------------------------------------------
                Big brown bat  -gaa----a-ttcgcttacctac-----tgg------ccctct------------gt---------acc-
         David's myotis (bat)  agaa----a-gtcgcttacctac-----tcg------cattct------------tc---------acc-
                        Shrew  tcaa----a-ttcgcttacctat-----a-g------tttttt------------tttttttttgaagc-
              Star-nosed mole  taaa----a-tccgcttacctac-----t-g------cacgtt------------tt---------acc-
                     Elephant  taaa----a-tccgcttacctac-----t-g------ta-ttt------------tt---------acc-
          Cape elephant shrew  taac----a-cccgcttacctacgaccgt-a------ca-ttt------------ga---------ccc-
                      Manatee  taaa----a-cccacttacctac-----t-g------tacttt------------tt---------acc-
             Cape golden mole  taaa----a-cccgcttacctac-----a-g------tccttt------------tt---------acc-
                       Tenrec  tggg----a-cccgctcacctac-----t-gtatttttttttt------------tt---------acc-
                     Aardvark  taaa----a-cccgattacccac-----t-g------tacttt------------tt---------acc-
                    Armadillo  taaa----a-tccgcttacctac-----t-g------gacttt------------tg---------acc-
                     Hedgehog  ======================================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  --gaa----aat-agc------------ccc-t-ttt---taat-----------ttaca----------
                        Chimp  --gaa----aat-agc------------ccc-t-ttt---taat-----------ttaca----------
                      Gorilla  --gaa----aat-agc------------ccc-t-ttt---taat-----------ttaca----------
                    Orangutan  --gaa----aat-agc------------ccc-t-ttt---taat-----------ttaca----------
                       Gibbon  --gaa----aat-agc------------ccc-t-ttt---taat-----------ttaca----------
                       Rhesus  --gaa----aat-agc------------ccc-c-ttt---taat-----------ttaca----------
          Crab-eating macaque  --gaa----aat-agc------------ccc-c-ttt---taat-----------ttaca----------
                       Baboon  --gaa----aat-agc------------ccc-c-ttt---taat-----------ttaca----------
                 Green monkey  --gaa----aat-agc------------ccc-c-ttt---taat-----------ttaca----------
                     Marmoset  tgaag----aat-agc------------ccc-c-ttt---taat-----------ttaca----------
              Squirrel monkey  tgaag----aat-agc------------ccc-c-ttt---taat-----------ttaca----------
                     Bushbaby  tgaag----aaa-agc------------ccc-c-ttt---caat-----------ttaca----------
           Chinese tree shrew  tgaag----aat-agt------------ccc-c-ttt---taat-----------ttacataaataatct
                     Squirrel  tgaat----ag-----------------ccc-c-ttt---tcat-----------ctaca----------
       Lesser Egyptian jerboa  tgtag----aa--agc------------acg-c-ttt---aaat-----------ttata----------
                 Prairie vole  tgaag----aacagcc------------ccc-t----------t-----------ttaca----------
              Chinese hamster  tgatg----aacagcc------------ccc-t-ttt---aaat-----------ttata----------
               Golden hamster  tgaag----aattgcc------------ccctt-ttt---aaat-----------ttata----------
                        Mouse  tgaag----aattagc------------ccc-c-tta---caat-----------ttata----------
                          Rat  tgaag----aataagc------------ccc-c-taa---caat-----------ttata----------
               Naked mole-rat  tgaag----aac-agc------------ccc-c-ttt---tcat-----------ttaca----------
                   Guinea pig  ttaag----gat-agg------------ccc-c-ttc---tcgt-----------ttaca----------
                   Chinchilla  tgtag----ga--agc------------ccc-c-ttc---tcat-----------ttaca----------
             Brush-tailed rat  tgaag----ga--tag------------cac-c-ttc---tcgt-----------ttaca----------
                       Rabbit  tgaag----aat-agc------------ccc-c-ttt---tgat-----------ttaca----------
                         Pika  tggag----aat-agc------------cct-t-tttaaaaaat-----------ctaca----------
                          Pig  tgaag----aat-agc------------ccc-c-ttg---taat-----------ttaca----------
                       Alpaca  tgaag----aat-agc------------ccc-c-ttt---taat-----------ttaca----------
               Bactrian camel  tgaag----aat-agc------------ccc-c-ttt---taat-----------ttaca----------
                      Dolphin  tgaag----aat-agc------------ccc-c-ttt---taat-----------gtaca----------
                 Killer whale  tgaag----aat-agc------------ccc-c-ttt---taat-----------gtaca----------
             Tibetan antelope  tgaag----aat-agc------------acc-c-tct---atat-----------ttaca----------
                          Cow  cgaag----aat-agc------------acc-c-tct---aaat-----------ttaca----------
                        Sheep  tgaag----aat-agc------------acc-c-tct---atat-----------ttaca----------
                Domestic goat  tgaag----aat-agc------------acc-c-tct---atat-----------ttaca----------
                        Horse  tgaag----act-agc------------ccc-c-ttt---taat-----------ttaca----------
             White rhinoceros  tgaag----aat-agc------------ccc-c-ttt---taat-----------ttaca----------
                          Cat  tgaac----gaa-agc------------tcc-c-cct---taat-----------ttaca----------
                          Dog  tgaac----aaa-agc----ccccccccccc-a-ctt---taat-----------tt-ta----------
                      Ferret   agaac----aaa-acgtccccccccccccgc-c-ctt---taat-----------ttcca----------
                        Panda  tgaac----aaa-agc-------ccccaccc-c-ctt---taat-----------ttaca----------
               Pacific walrus  tgaac----aaa-agc------------ccc-c-ctt---cagt-----------ttaca----------
                 Weddell seal  tgaac----aaa-agc------------gcc-c-ctt---cagt-----------ttaca----------
             Black flying-fox  -----------------------------cc-c-ttt---caat-----------ttacc----------
                      Megabat  -----------------------------cc-c-ttt---caat-----------ttgcc----------
                Big brown bat  tgaag----cac-agc------------ccc-c-tgt---taac-----------gtgca----------
         David's myotis (bat)  cgaag----aat-agc------------ccc-c-ttg---taat-----------tcgca----------
                        Shrew  taaagagcaaac-agc------------gcc-c-ccc---tcct--------------------------
              Star-nosed mole  tgaagaacaaac-agc------------ccc-c-tct---tattaatttacaaag---------------
                     Elephant  ggaag----aag-agc------------ccc-c-ttt---cagt-----------ttaca----------
          Cape elephant shrew  tcaac----agg-agc------------ccc-ctttt---ccat-----------ttaca----------
                      Manatee  ---ag----aag-agc------------ccc-c-ttt---tcat-----------ttaca----------
             Cape golden mole  ggaag----agg-act------------ccc-c-ttt---caat-----------ttaca----------
                       Tenrec  ggaag----agg-aat------------ctc-c-ttt---ccat-----------ttaca----------
                     Aardvark  cgaag----aag-agt------------ccc-c-ttt---caat-----------ttaca----------
                    Armadillo  ttaag----aag-agt------------ccc-c-ttc---taat-----------ttaca----------
                     Hedgehog  ======================================================================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
       White-throated sparrow  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
                      Wallaby  ======================================================================
                  Rock pigeon  ======================================================================
                   Budgerigar  ======================================================================
          Medium ground finch  ======================================================================
              Green seaturtle  ======================================================================
                 Mallard duck  ======================================================================
           American alligator  ======================================================================
          Collared flycatcher  ======================================================================
           Tibetan ground jay  ======================================================================
                    Zebrafish  ======================================================================
                X. tropicalis  ======================================================================
                     Platypus  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
               Painted turtle  ======================================================================
     Chinese softshell turtle  ======================================================================

                        Human  ----c----a-------a
                        Chimp  ----c----a-------a
                      Gorilla  ----c----a-------a
                    Orangutan  ----c----a-------a
                       Gibbon  ----c----a-------a
                       Rhesus  ----a----a-------a
          Crab-eating macaque  ----a----a-------a
                       Baboon  ----a----a-------a
                 Green monkey  ----a----a-------a
                     Marmoset  ----c----a-------a
              Squirrel monkey  ----c----a-------a
                     Bushbaby  ----c----a-------a
           Chinese tree shrew  gaaca----a-------a
                     Squirrel  ----c----a-------a
       Lesser Egyptian jerboa  ----c----a-------a
                 Prairie vole  ----a----a-------a
              Chinese hamster  ----c----a-------a
               Golden hamster  ----c----a-------a
                        Mouse  ----c----a-------a
                          Rat  ----c----a-------a
               Naked mole-rat  ----c----a-------a
                   Guinea pig  ----t----a-------g
                   Chinchilla  ----c----a-------a
             Brush-tailed rat  ----c----a-------a
                       Rabbit  ----c----a-------a
                         Pika  ----c----a-------a
                          Pig  ----t----t-------a
                       Alpaca  ----g----a-------a
               Bactrian camel  ----g-------------
                      Dolphin  ----g----a-------a
                 Killer whale  ----g----a-------a
             Tibetan antelope  ----g----aagtaaata
                          Cow  ----g----a-------a
                        Sheep  ----g----aagtaaata
                Domestic goat  ----g----aagtaaata
                        Horse  ----caagta-------a
             White rhinoceros  ----caagta-------a
                          Cat  ----c----a-------a
                          Dog  ----c----g-------a
                      Ferret   ----c----c-------a
                        Panda  ----c----c-------a
               Pacific walrus  ----c-------------
                 Weddell seal  ----c----t-------a
             Black flying-fox  ----c----a-------a
                      Megabat  ----c----a-------a
                Big brown bat  ----c----a-------a
         David's myotis (bat)  ----c----a-------a
                        Shrew  ------------------
              Star-nosed mole  ------------------
                     Elephant  ----c----a-------a
          Cape elephant shrew  ----c----a-------a
                      Manatee  ----c----a-------a
             Cape golden mole  ----a----a-------t
                       Tenrec  ----c----a-------a
                     Aardvark  ----c----a-------a
                    Armadillo  ----c----a-------t
                     Hedgehog  ==================
                     Microbat  NNNNNNNNNNNNNNNNNN
       White-throated sparrow  ==================
             Peregrine falcon  ==================
                 Saker falcon  ==================
                      Wallaby  ==================
                  Rock pigeon  ==================
                   Budgerigar  ==================
          Medium ground finch  ==================
              Green seaturtle  ==================
                 Mallard duck  ==================
           American alligator  ==================
          Collared flycatcher  ==================
           Tibetan ground jay  ==================
                    Zebrafish  ==================
                X. tropicalis  ==================
                     Platypus  ==================
              Tasmanian devil  ==================
                      Opossum  ==================
               Painted turtle  ==================
     Chinese softshell turtle  ==================

Inserts between block 20 and 21 in window
B D                      Pig 4bp
B D                   Alpaca 4bp
              Bactrian camel 1bp
B D                  Dolphin 4bp
                Killer whale 4bp
            Tibetan antelope 4bp
B D                      Cow 4bp
B D                    Sheep 4bp
               Domestic goat 4bp
            Black flying-fox 4bp
B D                  Megabat 4bp
               Big brown bat 1225bp
        David's myotis (bat) 4bp
             Star-nosed mole 3bp

Alignment block 21 of 177 in window, 36875716 - 36875737, 22 bps 
B D                     Human  ac-t-----------------------------------------------------t-aat------ag
B D                     Chimp  ac-t-----------------------------------------------------t-aat------ag
B D                   Gorilla  ac-t-----------------------------------------------------t-aat------ag
B D                 Orangutan  ac-t-----------------------------------------------------t-aat------ag
B D                    Gibbon  ac-t-----------------------------------------------------t-aat------aa
B D                    Rhesus  ac-t-----------------------------------------------------t-aat------ag
B D       Crab-eating macaque  ac-t-----------------------------------------------------t-aat------ag
B D                    Baboon  ac-t-----------------------------------------------------t-aat------ag
B D              Green monkey  ac-t-----------------------------------------------------t-aat------ag
B D                  Marmoset  at-t-----------------------------------------------------t-aat------ag
B D           Squirrel monkey  at-t-----------------------------------------------------t-aat------ag
B D                  Bushbaby  at-t-----------------------------------------------------taaaa------ag
           Chinese tree shrew  ac-t-----------------------------------------------------t-aat------ag
B D                  Squirrel  at-a-----------------------------------------------------a-aca--gaacag
       Lesser Egyptian jerboa  ac-t--------------------------------------------------------------acag
                 Prairie vole  ag-a-----------------------------------------------------a-aaa--atagag
B D           Chinese hamster  a--------------------------------------------------------a-aaa--atagag
               Golden hamster  aa-g-----------------------------------------------------a-gag--agagag
B D                     Mouse  aa-ac-----------------------------------aaacaaacaaacaagc-a-agc--aaacag
B D                       Rat  aa-gagagagagagagagagagagagagagagagagagagagagagagagagagag-a-gag--agagag
B D            Naked mole-rat  a--------------------------------------------------------t-aaa--ctttag
B D                Guinea pig  a--------------------------------------------------------t-aaa--ctttag
                   Chinchilla  a--------------------------------------------------------t-aaa--ccttag
             Brush-tailed rat  a--------------------------------------------------------t-aac--ctttag
B D                    Rabbit  c--------------------------------------------------------a-aac-tttacag
B D                      Pika  g--------------------------------------------------------a-aacttttacat
B D                       Pig  acgt-----------------------------------------------------t-aat------ag
B D                    Alpaca  ac-t-----------------------------------------------------t-aat------gg
               Bactrian camel  ac-t-----------------------------------------------------t-aaa------gg
B D                   Dolphin  ac-t-----------------------------------------------------t-aat------ag
                 Killer whale  ac-t-----------------------------------------------------t-aat------ag
             Tibetan antelope  ac-t-----------------------------------------------------t-aat------ag
B D                       Cow  ac-t-----------------------------------------------------t-aat------ag
B D                     Sheep  ac-t-----------------------------------------------------t-aat------ag
                Domestic goat  ac-t-----------------------------------------------------t-aat------ag
B D                     Horse  ac-g-----------------------------------------------------t-aac--------
B D          White rhinoceros  at-g-----------------------------------------------------t-aac------ag
B D                       Cat  ac-g-----------------------------------------------------t-aac------ag
B D                       Dog  ac-t-----------------------------------------------------t-cgg------aa
B D                   Ferret   ac-t-----------------------------------------------------c-aac------ag
B D                     Panda  ac-t-----------------------------------------------------t-aac------ag
               Pacific walrus  ---------------------------------------------------------t-aac------ag
                 Weddell seal  ac-t-----------------------------------------------------t-aac------ag
             Black flying-fox  ac-t-----------------------------------------------------t-aat------gg
B D                   Megabat  ac-t-----------------------------------------------------t-aat------gg
         David's myotis (bat)  ac-t-----------------------------------------------------t-aa--------a
B D                     Shrew  cc-c-----------------------------------------------------c-aac------ac
              Star-nosed mole  ac-t-----------------------------------------------------c-aac------ag
B D                  Elephant  --------------------------------------------------a------t-aat------ag
          Cape elephant shrew  --------------------------------------------------acattctt-aag------ag
B D                   Manatee  --------------------------------------------------ataaactt-aat------ag
             Cape golden mole  --------------------------------------------------gaaact-t-aag------ac
B D                    Tenrec  --------------------------------------------------gtacac-t-taa------ag
                     Aardvark  --------------------------------------------------ct-----t-aat------tg
B D                 Armadillo  --------------------------------------------------ctaaactt-aac------ag
B D                  Hedgehog  ======================================================================
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
               Big brown bat  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  agaacggt---ggaac--------
                        Chimp  agaactgt---ggaac--------
                      Gorilla  agaactgt---ggaac--------
                    Orangutan  agaactgt---ggaac--------
                       Gibbon  agaactgt---gtaac--------
                       Rhesus  agaactgt---ggaac--------
          Crab-eating macaque  agaactgt---ggaac--------
                       Baboon  agaactgt---ggaac--------
                 Green monkey  agaactgt---ggaac--------
                     Marmoset  agaactgt---ggaac--------
              Squirrel monkey  agatctgt---ggaac--------
                     Bushbaby  agaagtgt---ggacc--------
           Chinese tree shrew  agaactga---gaaac--------
                     Squirrel  agatctga---ggcac--------
       Lesser Egyptian jerboa  agccctgc---ggacc--------
                 Prairie vole  aaagctat---gtagc--------
              Chinese hamster  aaaactgt---gtagc--------
               Golden hamster  aaaactgt---gcagc--------
                        Mouse  aaaactgt---gtggc--------
                          Rat  agaacagt---gtggc--------
               Naked mole-rat  agaactgt---ggaac--------
                   Guinea pig  agacctgt---aaaac--------
                   Chinchilla  agaaccgg---gaacc--------
             Brush-tailed rat  agccccga---g-acc--------
                       Rabbit  agaactgg---gcaac--------
                         Pika  agaaccag---gatac--------
                          Pig  tgaactgcggaacgat--------
                       Alpaca  tgaacttt---ggaac--------
               Bactrian camel  tgaacttt---ggaac--------
                      Dolphin  tgacctgt---acggt--------
                 Killer whale  tgacctgt---acggt--------
             Tibetan antelope  tgaactgt---atgat--------
                          Cow  tgaactgt---atgac--------
                        Sheep  tgaactgt---atgat--------
                Domestic goat  tgaactgt---atgat--------
                        Horse  agaactgt---ggaac--------
             White rhinoceros  agaactgt---ggaac--------
                          Cat  aatgcgga---acgat--------
                          Dog  agatc-------------------
                      Ferret   agagctgc---gccca--------
                        Panda  agaactcg---gaaag--------
               Pacific walrus  agaactgc---gaaaa--------
                 Weddell seal  agaactgc---gaaaa--------
             Black flying-fox  agaaccgt---ggaac--------
                      Megabat  agaaccgt---ggaac--------
         David's myotis (bat)  agaaccgc---ggagc--------
                        Shrew  a----cgt---aagtt--------
              Star-nosed mole  agaaccgt---gggcc--------
                     Elephant  agcaattg---aaaaatgcggaac
          Cape elephant shrew  agc-ctag---aaaaatgcggaat
                      Manatee  accaatac---aaaaaggcggaac
             Cape golden mole  agcaattg---caaactgcggaag
                       Tenrec  agcta-ga---caaac-gcggaac
                     Aardvark  aggaatgg---aaaaa--------
                    Armadillo  atgaat-----------gttgaac
                     Hedgehog  ========================
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNN
                Big brown bat  ========================
       White-throated sparrow  ========================
             Peregrine falcon  ========================
                 Saker falcon  ========================
                      Wallaby  ========================
                  Rock pigeon  ========================
                   Budgerigar  ========================
          Medium ground finch  ========================
              Green seaturtle  ========================
                 Mallard duck  ========================
           American alligator  ========================
          Collared flycatcher  ========================
           Tibetan ground jay  ========================
                    Zebrafish  ========================
                X. tropicalis  ========================
                     Platypus  ========================
              Tasmanian devil  ========================
                      Opossum  ========================
               Painted turtle  ========================
     Chinese softshell turtle  ========================

Inserts between block 21 and 22 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 4bp
B D         White rhinoceros 4bp
B D                      Cat 1bp
B D                  Ferret  5bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 5bp
            Black flying-fox 4bp
B D                  Megabat 4bp
        David's myotis (bat) 157bp
             Star-nosed mole 4bp

Alignment block 22 of 177 in window, 36875738 - 36875739, 2 bps 
B D                     Human  aa
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                    Rhesus  ga
B D       Crab-eating macaque  ga
B D                    Baboon  ga
B D              Green monkey  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
           Chinese tree shrew  ga
B D                  Squirrel  ga
       Lesser Egyptian jerboa  ga
                 Prairie vole  ga
B D           Chinese hamster  ga
               Golden hamster  ga
B D                     Mouse  ga
B D                       Rat  ga
B D            Naked mole-rat  gc
B D                Guinea pig  ac
                   Chinchilla  ac
             Brush-tailed rat  gc
B D                    Rabbit  ga
B D                      Pika  ga
B D                  Elephant  ga
          Cape elephant shrew  ta
B D                   Manatee  ga
             Cape golden mole  ga
B D                    Tenrec  ga
B D                 Armadillo  ga
B D                  Hedgehog  ==
             Star-nosed mole  ==
B D                     Shrew  --
               Domestic goat  ==
B D                       Cow  ==
B D                     Sheep  ==
            Tibetan antelope  ==
            Black flying-fox  ==
B D                   Ferret   ==
B D          White rhinoceros  ==
B D                     Horse  ==
                Killer whale  ==
B D                       Dog  --
              Pacific walrus  ==
B D                     Panda  ==
B D                       Cat  ==
B D                  Microbat  NN
        David's myotis (bat)  ==
               Big brown bat  ==
  D    White-throated sparrow  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
B D                   Wallaby  ==
  D               Rock pigeon  ==
B D                Budgerigar  ==
B D       Medium ground finch  ==
  D           Green seaturtle  ==
              Bactrian camel  ==
B D                    Alpaca  ==
  D              Mallard duck  ==
B D        American alligator  ==
  D       Collared flycatcher  ==
          Tibetan ground jay  ==
B D                 Zebrafish  ==
B D             X. tropicalis  ==
B D                  Platypus  ==
B D           Tasmanian devil  ==
B D                   Megabat  ==
                Weddell seal  ==
B D                   Dolphin  ==
B D                   Opossum  ==
                    Aardvark  --
  D            Painted turtle  ==
B D                       Pig  ==
  D  Chinese softshell turtle  ==

Inserts between block 22 and 23 in window
B D                 Elephant 4bp
         Cape elephant shrew 5bp
B D                  Manatee 4bp
            Cape golden mole 2bp

Alignment block 23 of 177 in window, 36875740 - 36875793, 54 bps 
B D                     Human  tg-----------------gttact-tcttgtt-tt----acaatt-t--aaaaa--ctaca-a-ca-ac
B D                     Chimp  tg-----------------gttact-tcttgtt-tt----acaatt-t--aaaaa--ctaca-a-ca-ac
B D                   Gorilla  tg-----------------gtcact-tcttgtt-tt----acaatt-t--aaaaa--ctaca-a-ca-ac
B D                 Orangutan  tgg-a--------------gttatt-tcttgtt-tt----acaatt-t--aaaca--ctaca-a-ca-ac
B D                    Gibbon  tgg-a--------------gttact-tcttgtt-tt----acaatt-t--aagaa--ctaca-a-ca-ac
B D                    Rhesus  tgg-a--------------gtcact-tcttgtt-tt----acaatt-t--aaaaa--ctaca-a-ca-ag
B D       Crab-eating macaque  tgg-a--------------gtcact-tcttgtt-tt----acaatt-t--aaaaa--ctaca-a-ca-ag
B D                    Baboon  tgg-a--------------gtcact-tcttgtt-tt----acaatt-t--aaaaa--ctaca-a-ca-ag
B D              Green monkey  tgg-a--------------gttact-tcttgtt-tt----acaatt-t--aaaaa--ctaca-a-ca-ag
B D                  Marmoset  cgg-a--------------gttact-tcttgtt-tt----acaatt-t--aaaaa--ctaca-a-ca-gg
B D           Squirrel monkey  cgg-a--------------gttact-tcttgtt-tt----acaatt-t--aaaaa--ctaca-a-ca-ag
B D                  Bushbaby  cga-a--------------gttact-tcttgtt-ta----acag------aaaaa--ctaca-a-ca-ag
           Chinese tree shrew  tga-t--------------gttact-ccttgtt-tt----acaa-c-t--agcga--ctaca-g-ca-ag
B D                  Squirrel  tga-c--------------gttact-tcttgtt-tt----acaa-t-a--ag--a--cta-a-aacg-gg
       Lesser Egyptian jerboa  tgg-c--------------atgact-tcttgtt-tt----acaa-t-aggagaga--ctacg-agca-g-
                 Prairie vole  tgg-a--------------at---c-tcttgtc-tt----acaa-t-a--agaca--ctaca-gaca-gg
B D           Chinese hamster  tgg-a--------------at--tc-cctcgtt-tt----acag-t-a--agaca--ctaca-gaca-gg
               Golden hamster  tgg-a--------------at--cc-cctcgtt-tt----acag-t-a--agaca--ctaca-gaca-gg
B D                     Mouse  tga-a--------------atgccc-tccggtt-tt----acag-t-a--agaca--ctacc-atcg-gg
B D                       Rat  tga-a--------------atgacc-tcctgtt-tt----acag-t-a--agaca--ctacg-aacg-gg
B D            Naked mole-rat  tga-a--------------accact-ccttgct-tt----acag-t-g--agcga--ctaccaa--g-gg
B D                Guinea pig  gga-a--------------cccgct-ccttgtt-tt----acag-c-g--agcga--ctacc-a--g-gg
                   Chinchilla  tgc-a--------------accactccctcgtt-tt----acag-g-g--agcga--cta-c-a--g-gg
             Brush-tailed rat  tga-g--------------accactcccttgtt-tt----acat-t-g--agcta--ccacc-g--g-gg
B D                    Rabbit  tga-c--------------gttagt---tcgtt-ct----acag-t-g--aaaga--ctaca-gaaa-g-
B D                      Pika  tga-a--------------gtgact---tcgttatt----acag-taa--aaaga--ttaca-aaaa-aa
B D                       Pig  --a-a--------------gttaat-tcatgtg-tt----tcag-t-a--agaga--ccaca-a-ag-gg
B D                    Alpaca  --ata--------------gttatt-tca--cg-tt----tctg-t-a--agagg--ctaca-a-ga-ga
               Bactrian camel  --ata--------------gttatt-tca--cg-tt----tctg-t-a--agagg--ctaca-a-ga-gg
B D                   Dolphin  --a-a--------------gttatt-tcacgtg-tt----tcag-t-c--agaga--ctaca-g-ga-gg
                 Killer whale  --a-a--------------gttatt-tcacgtg-tt----tcag-t-c--agaga--ctaca-g-ga-gg
             Tibetan antelope  --a-a--------------gttatt-tcaggtg-tt----tcag-t-a--agaga--ctaca-g-aa-gg
B D                       Cow  --a-a--------------gttatt-tcaggtg-tt----tcag-t-a--agaga--ctaca-g-aa-gg
B D                     Sheep  --a-a--------------gttatt-tcaggtg-tt----tcag-t-a--agaga--ctaca-g-aa-gg
                Domestic goat  --a-a--------------gttatt-tcaggtg-tt----tcag-t-a--agaga--ctaca-g-aa-gg
B D                     Horse  --a-a--------------ggtatt-tcacgtg-tt----acag-t-a--agaga--ctac--a-aa-ag
B D          White rhinoceros  --a-a--------------gttatc-tcacgtg-tt----acag-t-a----aga--ctaca-a-aa-ag
B D                       Cat  --a-a--------------gtt---------tg-tt----acaa-c-a--gggga--ccac-----a-ag
B D                       Dog  --a-a--------------gtt---------cg-tt----acag-c-a--ggaga--acaca-g-gg-ag
B D                   Ferret   --a-a--------------gtt---------tg-tt----acaa-c-a--ggaga--ccacg-a-ga-ag
B D                     Panda  --t-a--------------gtt---------tg-tg----acaa-c-a--ggaga--ccaca-a-aa-ag
               Pacific walrus  --a-a--------------gtt---------tg-tt----acaa-c-a--gaaga--ccaca-a-ga-ag
                 Weddell seal  --a-a--------------gtt---------tg-tt----acaa-c-a--ggaga--ccac-----a-ag
             Black flying-fox  --a-a--------------gttatt-tcacggg-tt----acaa-t-a--agaga--ctaca-a-ga-ag
B D                   Megabat  --a-a--------------gttatt-tcacggg-tt----acaa-t-a--agaga--ctaca-a-ga-ag
B D                     Shrew  --t-c--------------agtacc-tcgcgcg-tt----acag-t-a--aga----ttaca-a-gc-cg
              Star-nosed mole  --g-c--------------gttatt-tcatggg-tt----acag-t-a--agagg--ctaca-a-gcatg
B D                  Elephant  -------------------gtcatt-tcacgtg-ttacgtacag-t-a--agagcctctaca-a-ca-ag
          Cape elephant shrew  -------------------gttaat-tcctgtg-tgac--atag-t-c--agagcctctcca--------
B D                   Manatee  -------------------gtcatt-tcatgta-ttacacacag-t-a--agaacctctact-a-ca-ag
             Cape golden mole  -----------------ccggtatt-tgatgtt-------acag-g-c--aaacc--------------g
                     Aardvark  -----tgcggaaagatgacgttatt-tcacgtg-ttacatacag-t-a--agaacctctacc-a-ca-ag
B D                 Armadillo  ---------------tgaagttatt-tca-----------ctgt-t-a--agaggctcgcca-a-ca-aa
B D                  Hedgehog  ======================================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  ======================================================================
               Big brown bat  ======================================================================
  D    White-throated sparrow  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
B D                   Wallaby  ======================================================================
  D               Rock pigeon  ======================================================================
B D                Budgerigar  ======================================================================
B D       Medium ground finch  ======================================================================
  D           Green seaturtle  ======================================================================
  D              Mallard duck  ======================================================================
B D        American alligator  ======================================================================
  D       Collared flycatcher  ======================================================================
          Tibetan ground jay  ======================================================================
B D                 Zebrafish  ======================================================================
B D             X. tropicalis  ======================================================================
B D                  Platypus  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D            Painted turtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================

                        Human  --------------catagtac-tgtacgt-----------------
                        Chimp  --------------catagtac-tgtacgt-----------------
                      Gorilla  --------------catagtac-tgtacgt-----------------
                    Orangutan  --------------catagtac-tgtacgt-----------------
                       Gibbon  --------------catagtac-tgtacac-----------------
                       Rhesus  --------------catagtac-tgtatgt-----------------
          Crab-eating macaque  --------------catagtac-tgtacgt-----------------
                       Baboon  --------------catagtac-tgtacgt-----------------
                 Green monkey  --------------catagtac-tgtacgt-----------------
                     Marmoset  --------------cacggtac-tgcacgt-----------------
              Squirrel monkey  --------------catggtac-tgcacgt-----------------
                     Bushbaby  --------------cttgg----------c-----------------
           Chinese tree shrew  --------------catggtac-tgtacgt-----------------
                     Squirrel  --------------tacggtag-ggtacgt-----------------
       Lesser Egyptian jerboa  -----------------------------------------------
                 Prairie vole  --------------cccggtac-tgtatgt-----------------
              Chinese hamster  --------------cccggtaa-tgtatgt-----------------
               Golden hamster  --------------cccggtat-tgtatgt-----------------
                        Mouse  --------------tacggtac-tgtattc-----------------
                          Rat  --------------cacggtac-tctgtgc-----------------
               Naked mole-rat  --------------cctgatac-agtacgc-----------------
                   Guinea pig  --------------cgtgatac-agcgcgc-----------------
                   Chinchilla  --------------cttgatac-agtacgt-----------------
             Brush-tailed rat  --------------cctggcac-ggtgcgg-----------------
                       Rabbit  --------------cacgatacttgtacgt-----------------
                         Pika  aaaacccaaaaacccacgatacgtggacgt-----------------
                          Pig  --------------cgcg------gtacac-----------------
                       Alpaca  --------------cacggtgc-ggtacac-----------------
               Bactrian camel  --------------cacggtgc-ggtacac-----------------
                      Dolphin  --------------cttggaac-tgtacac-----------------
                 Killer whale  --------------cttggaac-tgtacac-----------------
             Tibetan antelope  --------------ctcggtac-tgtacac-----------------
                          Cow  --------------ctcggtac-tgtacac-----------------
                        Sheep  --------------ctcggtac-tgtacac-----------------
                Domestic goat  --------------ctcggtac-tgtacac-----------------
                        Horse  --------------catggtac-tgcacac-----------------
             White rhinoceros  --------------catggtac-tgtacac-----------------
                          Cat  --------------catggcac-tctacac-----------------
                          Dog  --------------cccgggac-cgtccgc-----------------
                      Ferret   --------------catggcac-tggacac-----------------
                        Panda  --------------catggccc-tgtacac-----------------
               Pacific walrus  --------------catggcac-tgtacac-----------------
                 Weddell seal  --------------catggcac-tgtacac-----------------
             Black flying-fox  --------------catggcac-tctacac-----------------
                      Megabat  --------------catggaac-tctacac-----------------
                        Shrew  --------------cacggtca-tgtacac-----------------
              Star-nosed mole  --------------tac------tggacac-----------------
                     Elephant  --------------catggtac-tctgcataataattacaatgaacg
          Cape elephant shrew  --------------cctgttac-c-------------------ggca
                      Manatee  --------------catgatac-tctgtataacaattacagtgaacg
             Cape golden mole  --------------cgtcatac-tcggtgtaatcattaaag--aacg
                     Aardvark  --------------catggtac-tctgtat-atcagtacagggaacg
                    Armadillo  --------------cacggta-----gtagtataactacagtga---
                     Hedgehog  ===============================================
                       Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
         David's myotis (bat)  ===============================================
                Big brown bat  ===============================================
       White-throated sparrow  ===============================================
             Peregrine falcon  ===============================================
                 Saker falcon  ===============================================
                      Wallaby  ===============================================
                  Rock pigeon  ===============================================
                   Budgerigar  ===============================================
          Medium ground finch  ===============================================
              Green seaturtle  ===============================================
                 Mallard duck  ===============================================
           American alligator  ===============================================
          Collared flycatcher  ===============================================
           Tibetan ground jay  ===============================================
                    Zebrafish  ===============================================
                X. tropicalis  ===============================================
                     Platypus  ===============================================
              Tasmanian devil  ===============================================
                      Opossum  ===============================================
               Painted turtle  ===============================================
     Chinese softshell turtle  ===============================================

Alignment block 24 of 177 in window, 36875794 - 36875825, 32 bps 
B D                     Human  a----t-aatcacatattgtattccagccttgtcca---g
B D                     Chimp  a----t-aatcacatattgtattccagccttgtcca---g
B D                   Gorilla  a----t-aatcacattttgtattccagccttgtcca---g
B D                 Orangutan  a----t-aatcacattttgtattccagccttgtcca---g
B D                    Gibbon  a----t-aatcacattttgtattccagccttgtcca---g
B D                    Rhesus  a----t-aatcacattttgtattccagccttgtcca---g
B D       Crab-eating macaque  a----t-aatcacattttgtattccagccttgtcca---g
B D                    Baboon  a----t-aatcacattttgtattccagccttgtcca---g
B D              Green monkey  a----t-aatcacattttgtattccagccttgtcca---g
B D                  Marmoset  a----t--attacattttgtattccagccttgtcca---g
B D           Squirrel monkey  a----t-aatcacgttttgtattccagccttgtcca---g
B D                  Bushbaby  a----t-aatcacattttgtactccagtcttgtcca---g
           Chinese tree shrew  c----taaatcacgt-ttgtactccagccttctcct---g
B D                  Squirrel  a----t-aatcacaggttgtactccagcctcgtcca---g
       Lesser Egyptian jerboa  -----------------------------ttgtcca---g
                 Prairie vole  c----t-attcacattttgtactccagccttgtcca---g
B D           Chinese hamster  a----t-attcacattttgtactccagccttgtcca---g
               Golden hamster  a----t-attcacattttgtactccagccttgtcca---g
B D                     Mouse  g----t-attcacattttgtactccagccttgtcca---g
B D                       Rat  g----t-gttcacattttgtactccagccttgtcca---g
B D            Naked mole-rat  a----t-ca--tcagtttgtactccggcctcgtccg---g
B D                Guinea pig  a----t-ca--tcagtttgtgctccagcctcatcca---g
                   Chinchilla  a----t-c---tcagtttgtactccagcctggtccg---g
             Brush-tailed rat  a----c-c---acggttcgcactccagccgcgtcca---g
B D                    Rabbit  a----t-aatcacattgggtactccagccttgtccg---g
B D                      Pika  c----t-gatcacattttgtactccagccttgtccg---g
B D                       Pig  a----t-aatcgcat-ctgttctccagccttggccagtgg
B D                    Alpaca  a----c-aatcacat-ttgtactccagccttggcca---g
               Bactrian camel  a----t-aatcacat-ttgtactccagccttggcca---g
B D                   Dolphin  a----c-aatcacat-ttgtactccagccttggcca---g
                 Killer whale  a----c-aatcacat-ttgtactccagccttggcca---g
             Tibetan antelope  a----g-aatcgcat-ctgtactccagccttggtca---g
B D                       Cow  a----a-aatcgcat-ctgtactccagccttggtca---g
B D                     Sheep  a----g-aatcgcat-ctgtactccagccttggtca---g
                Domestic goat  a----g-aatcgcat-ctgtactccagccttggtca---g
B D                     Horse  a----c-gatcgcac-ttgtactccagccttggcca---g
B D          White rhinoceros  a----t-aatcgcac-ttgtgctccagccgtgtcca---g
B D                       Cat  a-------atcaca--ctgggctccagcctcgtgca---g
B D                       Dog  acgggc-gggcgcat-ccgtgctccagcctcgtgca---g
B D                   Ferret   a----c-aatcacat-ctgtgctccagcctcgtgca---g
B D                     Panda  a----c-aatcacat-ctgtgctccagcctattgcg---g
               Pacific walrus  a----c-aatcacat-ctgtgctccagcctcgtgca---g
                 Weddell seal  a----c-aatcacat-ctgtgctccagcctcgtgca---g
             Black flying-fox  atgatc-agtcccat-ttgtactccagcctcgtcca---g
B D                   Megabat  atgatc-agtcccat-ttgtactccagcctcgtcca---g
B D                     Shrew  a----c-aaccacat-ttgtcctccagccacgtcca---g
              Star-nosed mole  g----t-gatcacat-ttgtactccagcctggtcca---g
B D                  Elephant  a----a-aacatccttttatacttgaaccttgccca---a
          Cape elephant shrew  a----c-gacaaccttttctactcgagcccggccca---a
B D                   Manatee  a----a-aacatcactttatacttgagccttgtcca---a
             Cape golden mole  g----a-aacttcattctgtac---------accta---a
                     Aardvark  a----a-aaca---ttttatagttaagccttgccca---a
B D                 Armadillo  -------aatgtcattttatatcccagccttggcca---g
B D               Zebra finch  a----c-aattacttagttttgtcttagtttatcta---g
B D                  Hedgehog  ========================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  ========================================
               Big brown bat  ========================================
  D    White-throated sparrow  ========================================
  D          Peregrine falcon  ========================================
  D              Saker falcon  ========================================
B D                   Wallaby  ========================================
  D               Rock pigeon  ========================================
B D                Budgerigar  ========================================
B D       Medium ground finch  ========================================
  D           Green seaturtle  ========================================
  D              Mallard duck  ========================================
B D        American alligator  ========================================
  D       Collared flycatcher  ========================================
          Tibetan ground jay  ========================================
B D                 Zebrafish  ========================================
B D             X. tropicalis  ========================================
B D                  Platypus  ========================================
B D           Tasmanian devil  ========================================
B D                   Opossum  ========================================
  D            Painted turtle  ========================================
  D  Chinese softshell turtle  ========================================

Inserts between block 24 and 25 in window
B D                    Shrew 1359bp

Alignment block 25 of 177 in window, 36875826 - 36875868, 43 bps 
B D                     Human  cgcctcagttttccg-aacctaaagaggaaa------acgatg-tttgaaa--------
B D                     Chimp  cgcctcagttttccg-aacctaaagaggaaa------acgatg-tttgaaa--------
B D                   Gorilla  cgcctcagttttccg-aacctaaagaagaaa------acgatg-tttgaaa--------
B D                 Orangutan  cgcctcagtgttccg-aacctaaagaggaaa------acgatg-tttgaaa--------
B D                    Gibbon  cgcctcagtgttccg-aacctaaagaggaaa------acgatg-tttgaaa--------
B D                    Rhesus  cgcctcagtgttcca-aacctaaagaggaaa------acgatg-tttgaaa--------
B D       Crab-eating macaque  cgcctcagtgttcca-aacctaaagaggaaa------acgatg-tttgaaa--------
B D                    Baboon  cgcctcagtgttcca-aacctaaagaggaaa------acgatg-tttgaaa--------
B D              Green monkey  cgcctcagtgttcca-aacctaaagaggaaa------acgatg-tttgaaa--------
B D                  Marmoset  cgcctcagtgttcca-aacctaaagaggaaa------acgatg-tttgaaa--------
B D           Squirrel monkey  cgcctcagtgttcca-aaccgaaagaggaaa------acgatg-tttgaaa--------
B D                  Bushbaby  cgcctcagtgattcg-catacaaagaggaga------acgatg-tttgaaa--------
           Chinese tree shrew  tgcctcagtgttgca-aatacaaagaggaaa------acgatg-ttggaaa--------
B D                  Squirrel  tgcctcagtgctttc-----aacagaggaaa------acg----tccgaag--------
       Lesser Egyptian jerboa  ggtctcagtggtcca----------------------accacg-----gag--------
                 Prairie vole  tgc--ctgagtttca-aacataaagaggaaa------acgtcg-tctgaag--------
B D           Chinese hamster  ------------------cacaaagaggaaa------acgccg-ttggaag--------
               Golden hamster  ------------------cacaaagaggaaa------acgacg-ttggaag--------
B D                     Mouse  agcctctgagttttc-aacatacagaggaaa------acgatgttttgaag--------
B D                       Rat  agcctctgagttttcaaacataaagaagaaa------acgacgttttgaag--------
B D            Naked mole-rat  cgcctc---ggtttc-aatgca--gaggaa-------gctcag----------------
B D                Guinea pig  cgcctc---aatttc-aatgcg--gaggaa-------gcgcag----------------
                   Chinchilla  cgcctc---gactcc-aacgcccagaggga-------gcg-------------------
             Brush-tailed rat  ttcctc---gatttc-cacgcgccgagcaa-------gcgcgg----------------
B D                    Rabbit  tgcctcagtgtttcc-aacacaaggaagaaa------ccgacg-tcggaac--------
B D                      Pika  ggcttccgcgtgtcg-aaccgaaggaagaaa------atgccg-ctg------------
B D                       Pig  tacctcactgtttga-aacgcaaagaggaaa------acggtg-tctgaaa--------
B D                    Alpaca  cacat--cagtttca-gaggtaaagaggaaa------acgacg-tctgaaa--------
               Bactrian camel  cacat--cagtttca-gaggtaaagaggaaa------acgacg-tctgaaa--------
B D                   Dolphin  tacctcactgtttcg-aacgtaa--aggaaa------acgaag-tctgaaa--------
                 Killer whale  tacctcactgtttcg-aacgtaa--aggaaa------acgaag-tctgaaa--------
             Tibetan antelope  gacct--ctgtttcg-agcgtaaagaggaaa------acgatg-tctgaaa--------
B D                       Cow  gacct--ctgtttcg-agcgtaaagaggaaa------acgatg-tctgaaa--------
B D                     Sheep  gacct--ctgtttcg-agcgtaaagaggaaa------acgatg-tctgaaa--------
                Domestic goat  gacct--ctgtttcg-agcgtaaagaggaaa------acgatg-tctgaaa--------
B D                     Horse  tacctcactggttca-aatgg--agaggaaa------acgatg-tttgaga--------
B D          White rhinoceros  tacctcactggttca-aatgt--agaggaaa------acgatg-tttgaga--------
B D                       Cat  tacctcactgtttca-agtgtaaagaggaaa------acggcg-ttggaaa--------
B D                       Dog  caccgc---------------ggagaggaga------ccgacg-ctggaga--------
B D                   Ferret   tacctcactgtttca-cagggaaagaggaca------acgacg-ctggaaa--------
B D                     Panda  cacctcactgttaca-aatggaaagaggaaa------acgacg-ttggaaa--------
               Pacific walrus  tacctcactgtttca-aatagaaagaggaaa------acgacg-ttggaaa--------
                 Weddell seal  tacctcactgtttca-gatggaaagaggaaa------acgacg-ttggaaa--------
             Black flying-fox  gatctcactgtttca-actgaaaagaggaaa------gtgctg-tttgaaa--------
B D                   Megabat  gatctcactgtttca-actgtaaagaggaaa------atgctg-tttgaaa--------
              Star-nosed mole  gacctccctgtttca-aacgtacagaggaca------acgagg-ttcgaaa--------
B D                  Elephant  -------ccgtttca-aacatgaagaggaaa------acgatg-tttgcaa--------
          Cape elephant shrew  taccgagctgtctgg-aaggtgacgagaaat------atggag-cttggaa--------
B D                   Manatee  -------ccgtttca-aatgtgaacaggaaa------acgatg-tttgcaa--------
             Cape golden mole  -------gcgtagca-actgggaa-aggtag------gcgagg-tctgcag--------
                     Aardvark  tatatagccgtttca-agtgtgaagagaaaa------acgatg-ttcgcaa--------
B D                 Armadillo  tac----ctatttaa-aatgtaaagaggaaa------acgatg-tttgaaa--------
B D               Zebra finch  cgccctcatttcctg-gagatcaacaggaaaaataacaagaca-gagggaagtgtgtgc
B D                  Hedgehog  ===========================================================
B D                     Shrew  ===========================================================
B D                    Tenrec  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Microbat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
        David's myotis (bat)  ===========================================================
               Big brown bat  ===========================================================
  D    White-throated sparrow  ===========================================================
  D          Peregrine falcon  ===========================================================
  D              Saker falcon  ===========================================================
B D                   Wallaby  ===========================================================
  D               Rock pigeon  ===========================================================
B D                Budgerigar  ===========================================================
B D       Medium ground finch  ===========================================================
  D           Green seaturtle  ===========================================================
  D              Mallard duck  ===========================================================
B D        American alligator  ===========================================================
  D       Collared flycatcher  ===========================================================
          Tibetan ground jay  ===========================================================
B D                 Zebrafish  ===========================================================
B D             X. tropicalis  ===========================================================
B D                  Platypus  ===========================================================
B D           Tasmanian devil  ===========================================================
B D                   Opossum  ===========================================================
  D            Painted turtle  ===========================================================
  D  Chinese softshell turtle  ===========================================================

Alignment block 26 of 177 in window, 36875869 - 36875878, 10 bps 
B D                     Human  tcagctggcc
B D                     Chimp  tcagctggcc
B D                   Gorilla  tcagctggcc
B D                 Orangutan  tcagctggcc
B D                    Gibbon  tcagctggcc
B D                    Rhesus  ttagctggcc
B D       Crab-eating macaque  ttagctggcc
B D                    Baboon  ttagctggcc
B D              Green monkey  ttagctggcc
B D                  Marmoset  tcagctggct
B D           Squirrel monkey  tcagccggcc
B D                  Bushbaby  tctgctggct
           Chinese tree shrew  tctgtcggtc
B D                  Squirrel  t---------
       Lesser Egyptian jerboa  c---------
                 Prairie vole  t---------
B D           Chinese hamster  t---------
               Golden hamster  t---------
B D                     Mouse  t---------
B D                       Rat  t---------
B D                    Rabbit  tctgtc----
B D                       Pig  tcggctggcc
B D                    Alpaca  tcggctggcc
               Bactrian camel  tcggctggcc
B D                   Dolphin  tcgtctggcc
                 Killer whale  tcgtctggcc
             Tibetan antelope  tcggcgggcc
B D                       Cow  tcggcgggcc
B D                     Sheep  tcgg------
                Domestic goat  tcgg------
B D                     Horse  ccggccggcc
B D          White rhinoceros  tcggctggcc
B D                       Cat  gtggctggcc
B D                       Dog  acgggggggc
B D                   Ferret   ccggctggcc
B D                     Panda  ccggctggcc
               Pacific walrus  acggctggcc
                 Weddell seal  acggctggcc
             Black flying-fox  tcgcctggcc
B D                   Megabat  tcgcctggcc
              Star-nosed mole  cgggctggcc
B D                  Elephant  cctgctggcc
          Cape elephant shrew  gctg------
B D                   Manatee  cttgccggcc
             Cape golden mole  cctgctggcg
                     Aardvark  cctgctggct
B D                 Armadillo  cctgctggcc
B D               Zebra finch  actcctgg--
B D                    Turkey  tcacctggct
B D                  Hedgehog  ==========
B D                     Shrew  ==========
B D                      Pika  ----------
B D                Guinea pig  ----------
            Brush-tailed rat  ----------
B D            Naked mole-rat  ----------
                  Chinchilla  ----------
B D                    Tenrec  NNNNNNNNNN
B D                  Microbat  NNNNNNNNNN
        David's myotis (bat)  ==========
               Big brown bat  ==========
  D    White-throated sparrow  ==========
  D          Peregrine falcon  ==========
  D              Saker falcon  ==========
B D                   Wallaby  ==========
  D               Rock pigeon  ==========
B D                Budgerigar  ==========
B D       Medium ground finch  ==========
  D           Green seaturtle  ==========
  D              Mallard duck  ==========
B D        American alligator  ==========
  D       Collared flycatcher  ==========
          Tibetan ground jay  ==========
B D                 Zebrafish  ==========
B D             X. tropicalis  ==========
B D                  Platypus  ==========
B D           Tasmanian devil  ==========
B D                   Opossum  ==========
  D            Painted turtle  ==========
  D  Chinese softshell turtle  ==========

Alignment block 27 of 177 in window, 36875879 - 36875921, 43 bps 
B D                     Human  gca---------ggccc----gcgg-----------gtcgccc--------g---cagtcacc-ggtggc
B D                     Chimp  gca---------ggccc----gcgg-----------gtcgccc--------g---cagtcacc-ggtggc
B D                   Gorilla  gca---------ggccc----gcgg-----------gtcgccc--------g---cagtcacc-ggtggc
B D                 Orangutan  gca---------ggccc----gcgg-----------gtcgccc--------g---cagtcacc-ggtggc
B D                    Gibbon  gca---------ggccc----gcgg-----------gtcgccc--------g---cagtcacc-ggtggc
B D                    Rhesus  gca---------ggccc----gcgg-----------gtcgccc--------g---cagtcgcc-ggtggc
B D       Crab-eating macaque  gca---------ggccc----gcgg-----------gtcgccc--------g---cagtcgcc-ggtggc
B D                    Baboon  gca---------ggccc----gcgg-----------gtcgccc--------g---cagtcgcc-ggtggc
B D              Green monkey  gca---------ggccc----gcgg-----------gtcgccc--------g---cagtcgcc-ggtggc
B D                  Marmoset  gca---------gtccc----gccg-----------gtcgccc--------g---cagtcgcc-ggtggc
B D           Squirrel monkey  gca---------ggccc----gccg-----------gtcgccc--------g---ccagcgcc-ggtggc
B D                  Bushbaby  -cc---------ggccc----gcag-----------tctgcctccgtacagc---cagccgcc-ggc--c
           Chinese tree shrew  cca---------ggccc----gcca-----------g-caccc--------g------------------
B D                  Squirrel  -------------------------------------ccgccg--------g---ccccagcc-agc--c
       Lesser Egyptian jerboa  -------------------------------------gtggcg--------g-------cg---------
                 Prairie vole  -------------------------------------gcgccg--------g---tccccg---------
B D           Chinese hamster  -------------------------------------gcgccg--------g---tccccg---------
               Golden hamster  -------------------------------------gcgccg--------g---tccccg---------
B D                     Mouse  -------------------------------------gcgccg--------g---tgccgg---------
B D                       Rat  -------------------------------------gcgccg--------g---tctccg---------
B D            Naked mole-rat  ----------------------------------------cct--------g---cagtct---------
B D                Guinea pig  ----------------------------------------ccc--------g---cagtcg---------
             Brush-tailed rat  --------------------------------------ccccc--------g---cggcag---------
B D                    Rabbit  -------------------------------------gcccac--------cgtgcgcccg---------
B D                      Pika  -------------------------------------gccccg--------ggtccgcccc---------
B D                       Pig  cca---------ggccc----accc-----------gcggccc--------g---cattccgc-------
B D                    Alpaca  cca---------ggccc----accc-----------gcagccc--------g---cagtccac-------
               Bactrian camel  cca---------ggccc----accc-----------gcagccc--------g----------c-------
B D                   Dolphin  cca---------ggccc----cccc-----------gcggccc--------g---cactccgc-------
                 Killer whale  cca---------ggccc----cccc-----------gcggccc--------g---cactccgc-------
             Tibetan antelope  cc-----------------------------------cggccc--------g---cagtccgc-------
B D                       Cow  cc-----------------------------------aggccc--------g---cagtccgc-------
B D                     Sheep  cc-----------------------------------cggccc--------g---cagtccgc-------
                Domestic goat  cc-----------------------------------cggccc--------g---cagtccgc-------
B D                     Horse  cca---------ggccc----accc-----------gtcgccc--------c---cagtccgcgggtggc
B D          White rhinoceros  cca---------ggccc----accc-----------gtcgccc--------c---cagtccgcgggtggc
B D                       Dog  ccagggtcccccgcccc----ccctttcccggttccgtcgccc--------g---ccgtcgggcggtggg
B D                   Ferret   gca---------gcccc----cgcc--------ccggcagccc--------a---cggtcggcgggtggc
B D                     Panda  cca---------gaccc----cccc-----------gtcgccc--------a---cggtcggccggtggc
               Pacific walrus  cca---------gcgcc--