Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 98 in window, 15618700 - 15618723, 24 bps 
B D                     Human  aagggataaggcaagtattactaa
B D                     Chimp  aagggataaggcaagtattactaa
B D                   Gorilla  aagggataaagcaagtattactaa
B D                 Orangutan  aagggataaagcaagtattactaa
B D                    Gibbon  aagggataaagcaagtattactaa
B D                    Rhesus  aagggataaggcaagtattactaa
B D       Crab-eating macaque  aagggataaggcaagtattactaa
B D                    Baboon  aagggataaggcaagtattactaa
B D              Green monkey  aagggataaggcaagtattactaa
B D                  Marmoset  aaaagataaggcaa-tattacgaa
B D           Squirrel monkey  aagggatgaggcaa-tattacgaa
B D                  Bushbaby  aaggagca--------------aa
           Chinese tree shrew  aagggctggtgtgagaatt-----
B D                  Squirrel  aaaggccattg-------------
       Lesser Egyptian jerboa  aaggattattt-------------
                 Prairie vole  aagggctcttt-------------
B D                     Mouse  aagaggcaatg-------------
B D                       Rat  aagaggcattg-------------
B D            Naked mole-rat  aaggattgttg-------------
B D                Guinea pig  aagcgttgttg-------------
                   Chinchilla  aagggttgttg-------------
             Brush-tailed rat  aagggatgatc-------------
B D                     Horse  ---------------tatt-----
B D          White rhinoceros  ---------------tatt-----
B D                       Cat  -----------------tt-----
B D                     Shrew  ---------------tata-----
              Star-nosed mole  ---------------tatt-----
B D                  Elephant  aa-acctattgtgagaat------
B D                    Tenrec  aaggcctattgtgccaat------
B D                      Pika  ========================
B D                    Rabbit  ========================
B D                  Hedgehog  ========================
B D                  Microbat  ------------------------
               Big brown bat  ------------------------
        David's myotis (bat)  ========================
              Golden hamster  ========================
B D           Chinese hamster  ========================
         Cape elephant shrew  ========================
B D                       Cow  ------------------------
B D                 Armadillo  ========================
            Tibetan antelope  ------------------------
B D                   Manatee  ========================
B D                     Sheep  ------------------------
               Domestic goat  ------------------------
              Bactrian camel  ------------------------
                Killer whale  ------------------------
B D                       Dog  ========================
            Black flying-fox  ========================
       Burton's mouthbreeder  ------------------------
B D              Nile tilapia  ------------------------
B D                   Ferret   ------------------------
              Pacific walrus  ------------------------
B D                     Panda  ------------------------
         Pundamilia nyererei  ------------------------
B D                   Megabat  ========================
B D                    Alpaca  ------------------------
  D             Scarlet macaw  ========================
B D                   Dolphin  ------------------------
B D                    Lizard  ========================
                 Zebra mbuna  ------------------------
                Weddell seal  ------------------------
  D                    Parrot  ========================
                    Aardvark  ========================
  D           Green seaturtle  ========================
         Princess of Burundi  ------------------------
  D  Chinese softshell turtle  ========================
            Cape golden mole  ------------------------
B D                Budgerigar  ========================
  D          Peregrine falcon  ========================
  D              Mallard duck  ========================
  D            Painted turtle  ========================
                 Spotted gar  ------------------------
B D                Coelacanth  ========================
B D           Tasmanian devil  ========================
B D                   Opossum  ========================
  D              Saker falcon  ========================
B D                    Turkey  ========================
  D       Collared flycatcher  ========================
B D                  Platypus  ========================
B D       Medium ground finch  ========================
  D    White-throated sparrow  ========================
B D                   Chicken  ========================
          Tibetan ground jay  ========================
B D             X. tropicalis  ========================
B D        American alligator  ========================
B D               Zebra finch  ========================
  D               Rock pigeon  ========================

Inserts between block 1 and 2 in window
B D                 Elephant 4bp

Alignment block 2 of 98 in window, 15618724 - 15618736, 13 bps 
B D                     Human  ttgtagttaga-----------gt
B D                     Chimp  ttgtagttaga-----------gt
B D                   Gorilla  ttgtagttaga-----------gt
B D                 Orangutan  ttgtagttaga-----------gt
B D                    Gibbon  ttgtagttaga-----------gt
B D                    Rhesus  ttgtagt--ga-----------gt
B D       Crab-eating macaque  ttgtagt--ga-----------gt
B D                    Baboon  ttgtagt--ga-----------gt
B D              Green monkey  ttgtagt--ga-----------gt
B D                  Marmoset  ttgtagtgaga-----------gt
B D           Squirrel monkey  ttgtagtgaga-----------gt
B D                  Bushbaby  tt-------ga-----------at
           Chinese tree shrew  ---------ga-----------at
B D                  Squirrel  -tgtgaattga-----------at
       Lesser Egyptian jerboa  -tgtgaattgaatgaaagaaatga
                 Prairie vole  -tgttaactgg-----------gt
B D                     Mouse  -agttgtcttg-----------aa
B D                       Rat  -agttgcctca-----------at
B D            Naked mole-rat  -ggtgaattga-----------at
B D                Guinea pig  -tgtgaattaa-----------at
                   Chinchilla  -tgtgaatcga-----------at
             Brush-tailed rat  -tatgactaaa-----------gt
B D                    Rabbit  ttattgtcaga-----------at
B D                    Alpaca  ----------------------tt
               Bactrian camel  ----------------------tt
B D                   Dolphin  ----------------------tt
                 Killer whale  ----------------------tt
             Tibetan antelope  ----------------------tt
B D                       Cow  ----------------------tt
B D                     Sheep  ----------------------tt
                Domestic goat  ----------------------tt
B D                     Horse  ---------ga-----------at
B D          White rhinoceros  ---------ga-----------at
B D                       Cat  ----------------------at
B D                     Shrew  ---------aa-----------tt
              Star-nosed mole  ---------ga-----------at
B D                      Pika  ========================
B D                    Tenrec  ------------------------
B D                  Hedgehog  ========================
B D                  Microbat  ------------------------
               Big brown bat  ------------------------
        David's myotis (bat)  ========================
              Golden hamster  ========================
B D           Chinese hamster  ========================
         Cape elephant shrew  ========================
B D                 Armadillo  ========================
B D                  Elephant  ========================
B D                   Manatee  ========================
B D                       Dog  ========================
            Black flying-fox  ========================
       Burton's mouthbreeder  ------------------------
B D              Nile tilapia  ------------------------
B D                   Ferret   ------------------------
              Pacific walrus  ------------------------
B D                     Panda  ------------------------
         Pundamilia nyererei  ------------------------
B D                   Megabat  ========================
  D             Scarlet macaw  ========================
B D                    Lizard  ========================
                 Zebra mbuna  ------------------------
                Weddell seal  ------------------------
  D                    Parrot  ========================
                    Aardvark  ========================
  D           Green seaturtle  ========================
         Princess of Burundi  ------------------------
  D  Chinese softshell turtle  ========================
            Cape golden mole  ------------------------
B D                Budgerigar  ========================
  D          Peregrine falcon  ========================
  D              Mallard duck  ========================
  D            Painted turtle  ========================
                 Spotted gar  ------------------------
B D                Coelacanth  ========================
B D           Tasmanian devil  ========================
B D                   Opossum  ========================
  D              Saker falcon  ========================
B D                    Turkey  ========================
  D       Collared flycatcher  ========================
B D                  Platypus  ========================
B D       Medium ground finch  ========================
  D    White-throated sparrow  ========================
B D                   Chicken  ========================
          Tibetan ground jay  ========================
B D             X. tropicalis  ========================
B D        American alligator  ========================
B D               Zebra finch  ========================
  D               Rock pigeon  ========================

Alignment block 3 of 98 in window, 15618737 - 15618740, 4 bps 
B D                     Human  -taaa
B D                     Chimp  -taaa
B D                   Gorilla  -taaa
B D                 Orangutan  -taaa
B D                    Gibbon  -taaa
B D                    Rhesus  -taaa
B D       Crab-eating macaque  -taaa
B D                    Baboon  -taaa
B D              Green monkey  -taaa
B D                  Marmoset  -taaa
B D           Squirrel monkey  -taaa
B D                  Bushbaby  -aaaa
           Chinese tree shrew  -gaaa
B D                  Squirrel  -gaaa
       Lesser Egyptian jerboa  -taaa
                 Prairie vole  -gaaa
B D                     Mouse  -aaaa
B D                       Rat  -aaaa
B D            Naked mole-rat  -gaaa
B D                Guinea pig  -g---
                   Chinchilla  -gaaa
             Brush-tailed rat  -g---
B D                    Rabbit  -ataa
B D                    Alpaca  -gaa-
               Bactrian camel  -gaa-
B D                   Dolphin  -gaa-
                 Killer whale  -gaa-
             Tibetan antelope  -gag-
B D                       Cow  -gaa-
B D                     Sheep  -gaa-
                Domestic goat  -gaa-
B D                     Horse  -gaa-
B D          White rhinoceros  -gaa-
B D                       Cat  -tga-
             Black flying-fox  ---a-
B D                   Megabat  ---a-
         David's myotis (bat)  ---a-
B D                     Shrew  -agt-
              Star-nosed mole  -gga-
B D                  Elephant  taaa-
          Cape elephant shrew  taac-
B D                    Tenrec  tgaa-
B D                      Pika  =====
B D                  Hedgehog  =====
B D                  Microbat  -----
               Big brown bat  -----
              Golden hamster  =====
B D           Chinese hamster  =====
B D                 Armadillo  =====
B D                   Manatee  =====
B D                       Dog  =====
       Burton's mouthbreeder  -----
B D              Nile tilapia  -----
B D                   Ferret   -----
              Pacific walrus  -----
B D                     Panda  -----
         Pundamilia nyererei  -----
  D             Scarlet macaw  =====
B D                    Lizard  =====
                 Zebra mbuna  -----
                Weddell seal  -----
  D                    Parrot  =====
                    Aardvark  =====
  D           Green seaturtle  =====
         Princess of Burundi  -----
  D  Chinese softshell turtle  =====
            Cape golden mole  -----
B D                Budgerigar  =====
  D          Peregrine falcon  =====
  D              Mallard duck  =====
  D            Painted turtle  =====
                 Spotted gar  -----
B D                Coelacanth  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
  D              Saker falcon  =====
B D                    Turkey  =====
  D       Collared flycatcher  =====
B D                  Platypus  =====
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
B D                   Chicken  =====
          Tibetan ground jay  =====
B D             X. tropicalis  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D               Rock pigeon  =====

Inserts between block 3 and 4 in window
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                    Shrew 2bp
             Star-nosed mole 2bp

Alignment block 4 of 98 in window, 15618741 - 15618750, 10 bps 
B D                     Human  tg----aaata---atg
B D                     Chimp  tg----aaata---atg
B D                   Gorilla  tg----aaata---atg
B D                 Orangutan  tg----aaata---atg
B D                    Gibbon  tg----aaata---atg
B D                    Rhesus  tg----aaata---atg
B D       Crab-eating macaque  tg----aaata---atg
B D                    Baboon  tg----aaata---atg
B D              Green monkey  tg----aaata---atg
B D                  Marmoset  tg----aaata---atg
B D           Squirrel monkey  tg----aaata---atg
B D                  Bushbaby  t-----aaata---aca
           Chinese tree shrew  t-----aaata---atg
B D                  Squirrel  t-----aaata---aca
       Lesser Egyptian jerboa  c-----aaagc---agt
                 Prairie vole  g-----aaata---agg
B D                     Mouse  c-----aaaac---aaa
B D                       Rat  c-----aagac---aag
B D            Naked mole-rat  t-----aaata---atg
B D                Guinea pig  ------aaata---atg
                   Chinchilla  t-----aaata---atg
             Brush-tailed rat  ------aaata---acg
B D                    Rabbit  tg----aaata---atg
B D                    Alpaca  ta----aaata---atg
               Bactrian camel  ta----aaata---atg
B D                   Dolphin  taaaataaata---atg
                 Killer whale  ta----aaata---atg
             Tibetan antelope  ta----aaata---atg
B D                       Cow  ta----aaata---atg
B D                     Sheep  ta----aaata---atg
                Domestic goat  ta----aaata---atg
B D                     Horse  -----taaata---agg
B D          White rhinoceros  -----taaata---atg
B D                       Cat  -----tgagta---atg
B D                   Ferret   -------aata---agg
B D                     Panda  -------aata---atg
               Pacific walrus  -------aata---atg
                 Weddell seal  -------aata---atg
             Black flying-fox  -----taaatc---atg
B D                   Megabat  -----taaatc---atg
         David's myotis (bat)  -----taaata---ata
B D                  Microbat  ---------------tg
B D                     Shrew  ------aaa--------
              Star-nosed mole  ------aaata---atg
B D                  Elephant  ----ataaata---atg
          Cape elephant shrew  ----caaaata---atg
B D                    Tenrec  ----tgaaacattcatg
B D                      Pika  =================
B D                  Hedgehog  =================
               Big brown bat  -----------------
              Golden hamster  =================
B D           Chinese hamster  =================
B D                 Armadillo  =================
B D                   Manatee  =================
B D                       Dog  =================
       Burton's mouthbreeder  -----------------
B D              Nile tilapia  -----------------
         Pundamilia nyererei  -----------------
  D             Scarlet macaw  =================
B D                    Lizard  =================
                 Zebra mbuna  -----------------
  D                    Parrot  =================
                    Aardvark  =================
  D           Green seaturtle  =================
         Princess of Burundi  -----------------
  D  Chinese softshell turtle  =================
            Cape golden mole  -----------------
B D                Budgerigar  =================
  D          Peregrine falcon  =================
  D              Mallard duck  =================
  D            Painted turtle  =================
                 Spotted gar  -----------------
B D                Coelacanth  =================
B D           Tasmanian devil  =================
B D                   Opossum  =================
  D              Saker falcon  =================
B D                    Turkey  =================
  D       Collared flycatcher  =================
B D                  Platypus  =================
B D       Medium ground finch  =================
  D    White-throated sparrow  =================
B D                   Chicken  =================
          Tibetan ground jay  =================
B D             X. tropicalis  =================
B D        American alligator  =================
B D               Zebra finch  =================
  D               Rock pigeon  =================

Inserts between block 4 and 5 in window
      Lesser Egyptian jerboa 182bp
B D                    Mouse 12bp
B D                      Rat 18bp

Alignment block 5 of 98 in window, 15618751 - 15618758, 8 bps 
B D                     Human  aaaaacag
B D                     Chimp  aaaaacag
B D                   Gorilla  aaaaacag
B D                 Orangutan  aaaaacag
B D                    Gibbon  aaaaacag
B D                    Rhesus  aaaaacag
B D       Crab-eating macaque  aaaaacag
B D                    Baboon  aaaaacag
B D              Green monkey  aaaaacag
B D                  Marmoset  aaaaacag
B D           Squirrel monkey  aaaaacag
B D                  Bushbaby  aaaaacag
           Chinese tree shrew  aaaaacag
B D                  Squirrel  aaaagcag
       Lesser Egyptian jerboa  aagaaaag
                 Prairie vole  aaaaacag
B D           Chinese hamster  aagaacag
               Golden hamster  aaggacag
B D                     Mouse  aag---ag
B D                       Rat  aagaacag
B D            Naked mole-rat  aaaaatgg
B D                Guinea pig  aaaaatgg
                   Chinchilla  aaaaatgg
             Brush-tailed rat  aaaaatgg
B D                    Rabbit  aaaaattg
B D                    Alpaca  agaagcaa
               Bactrian camel  agaagcaa
B D                   Dolphin  agaagcaa
                 Killer whale  agaagcaa
             Tibetan antelope  cgaagcag
B D                       Cow  tgaagcag
B D                     Sheep  tgaagcag
                Domestic goat  tgaagcag
B D                     Horse  aaaagaag
B D          White rhinoceros  aaaagcag
B D                       Cat  aaaagtag
B D                   Ferret   aaaagcac
B D                     Panda  aaaaacac
               Pacific walrus  aaaagcac
                 Weddell seal  aaaagcac
             Black flying-fox  aaaatcag
B D                   Megabat  aaaatcag
         David's myotis (bat)  -aaatcag
B D                  Microbat  -aaatcaa
B D                     Shrew  atcagaaa
              Star-nosed mole  aacagcag
B D                  Elephant  aaaaatag
          Cape elephant shrew  aaagtt--
B D                    Tenrec  aaaaacag
B D                      Pika  ========
B D                  Hedgehog  ========
               Big brown bat  --------
B D                 Armadillo  ========
B D                   Manatee  ========
B D                       Dog  ========
       Burton's mouthbreeder  --------
B D              Nile tilapia  --------
         Pundamilia nyererei  --------
  D             Scarlet macaw  ========
B D                    Lizard  ========
                 Zebra mbuna  --------
  D                    Parrot  ========
                    Aardvark  ========
  D           Green seaturtle  ========
         Princess of Burundi  --------
  D  Chinese softshell turtle  ========
            Cape golden mole  --------
B D                Budgerigar  ========
  D          Peregrine falcon  ========
  D              Mallard duck  ========
  D            Painted turtle  ========
                 Spotted gar  --------
B D                Coelacanth  ========
B D           Tasmanian devil  ========
B D                   Opossum  ========
  D              Saker falcon  ========
B D                    Turkey  ========
  D       Collared flycatcher  ========
B D                  Platypus  ========
B D       Medium ground finch  ========
  D    White-throated sparrow  ========
B D                   Chicken  ========
          Tibetan ground jay  ========
B D             X. tropicalis  ========
B D        American alligator  ========
B D               Zebra finch  ========
  D               Rock pigeon  ========

Inserts between block 5 and 6 in window
B D               Guinea pig 1bp
B D                    Shrew 2bp

Alignment block 6 of 98 in window, 15618759 - 15618763, 5 bps 
B D                     Human  taaga
B D                     Chimp  taaga
B D                   Gorilla  taaga
B D                 Orangutan  taaga
B D                    Gibbon  taaga
B D                    Rhesus  taaga
B D       Crab-eating macaque  taaga
B D                    Baboon  taaga
B D              Green monkey  taaga
B D                  Marmoset  taaga
B D           Squirrel monkey  taaga
B D                  Bushbaby  taaga
           Chinese tree shrew  aaaaa
B D                  Squirrel  caaaa
       Lesser Egyptian jerboa  aaaga
                 Prairie vole  taaaa
B D           Chinese hamster  taaaa
               Golden hamster  taaaa
B D                     Mouse  taaac
B D                       Rat  taaac
B D            Naked mole-rat  tg-aa
B D                Guinea pig  taaaa
                   Chinchilla  tgaaa
             Brush-tailed rat  tgaaa
B D                    Rabbit  taaa-
B D                    Alpaca  taaaa
               Bactrian camel  taaaa
B D                   Dolphin  taaaa
                 Killer whale  taaaa
             Tibetan antelope  taaaa
B D                       Cow  taaaa
B D                     Sheep  taaaa
                Domestic goat  taaaa
B D                     Horse  taaaa
B D          White rhinoceros  taaaa
B D                       Cat  taaaa
B D                   Ferret   taaaa
B D                     Panda  taaaa
               Pacific walrus  taaaa
                 Weddell seal  taaaa
             Black flying-fox  taaaa
B D                   Megabat  taaaa
         David's myotis (bat)  taaaa
B D                  Microbat  taaaa
B D                  Hedgehog  taaaa
B D                     Shrew  taaaa
              Star-nosed mole  taaaa
B D                  Elephant  taaaa
          Cape elephant shrew  tcaaa
B D                    Tenrec  tgaaa
B D                      Pika  =====
               Big brown bat  -----
B D                 Armadillo  =====
B D                   Manatee  =====
B D                       Dog  =====
       Burton's mouthbreeder  -----
B D              Nile tilapia  -----
         Pundamilia nyererei  -----
  D             Scarlet macaw  =====
B D                    Lizard  =====
                 Zebra mbuna  -----
  D                    Parrot  =====
                    Aardvark  =====
  D           Green seaturtle  =====
         Princess of Burundi  -----
  D  Chinese softshell turtle  =====
            Cape golden mole  -----
B D                Budgerigar  =====
  D          Peregrine falcon  =====
  D              Mallard duck  =====
  D            Painted turtle  =====
                 Spotted gar  -----
B D                Coelacanth  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
  D              Saker falcon  =====
B D                    Turkey  =====
  D       Collared flycatcher  =====
B D                  Platypus  =====
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
B D                   Chicken  =====
          Tibetan ground jay  =====
B D             X. tropicalis  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D               Rock pigeon  =====

Inserts between block 6 and 7 in window
      Lesser Egyptian jerboa 12bp
                Prairie vole 2364bp
            Black flying-fox 9bp
B D                  Megabat 3bp

Alignment block 7 of 98 in window, 15618764 - 15618793, 30 bps 
B D                     Human  attaatg-aa------ta--a--------------aat-----ga-gacct-gt----gaaca-------
B D                     Chimp  attaatg-aa------ta--a--------------aat-----ga-ggcct-gt----gaaca-------
B D                   Gorilla  attaatg-aa------ta--a--------------aat-----ga-gacct-gt----gaaca-------
B D                 Orangutan  attaatg-aa------ta--a--------------aat-----ga-gacct-gt----gaacacaa-ttt
B D                    Gibbon  attaatg-aa------ta--a--------------aat-----ga-gacct-gt----gaacacaa-ttt
B D                    Rhesus  attaatg-aa------ca--a--------------aat-----aa-gacct-gt----gaacacaatttt
B D       Crab-eating macaque  attaatg-aa------ca--a--------------aat-----aa-gacct-gt----gaacacaatttt
B D                    Baboon  attaatg-aa------ta--a--------------aat-----aa-gacct-gt----gaacacaatttt
B D              Green monkey  attaatg-aa------ta--a--------------aat-----aa-gacct-gt----gaacacaatttt
B D                  Marmoset  attaatg-aa------ta--a--------------aat-----ga-gacct-gt----cagtataatttt
B D           Squirrel monkey  attaatg-aa------ta--a--------------aat-----ga-cacct-gt----gaacataatttt
B D                  Bushbaby  acaagtg-ac------ta--a--------------aat-----ga-gatct-gt----ga----------
           Chinese tree shrew  aatggtg-aa------ta--a--------------aat-----aa-gaact-gt----gaattaaaatgt
B D                  Squirrel  ----atg--a------tt--a--------------aat-----aa-gaatg-at----ggatcaagtttt
       Lesser Egyptian jerboa  ttgaata-aaatttccta--a--------------atg-----ga-aattt-at----aaattaaatttt
B D           Chinese hamster  ctgagtg-aa------ta--g--------------aat-----aa-gacca-gc----gaataacatttt
               Golden hamster  ctgagtg-aa------ta--a--------------aat-----aa-gacta-gc----gaataacatttt
B D                     Mouse  ctgagtg-aa------ta--a--------------aat-----aa-gacca-at----aaatgacatttt
B D                       Rat  ccaaatgaaa------aa--a--------------aat-----aa-gacca-at----aaatgacatttt
B D            Naked mole-rat  --------aa------tagta--------------aac-----ga-gatct-gt----aaat-acatttt
B D                Guinea pig  --------aa------tagca--------------aat-----ga-ggtct-gt----gaataaaatgtt
                   Chinchilla  --------aa------tacta--------------aat-----ga-gatct-gt----gaat-aaatttt
             Brush-tailed rat  --------aa------cagta--------------aactaacaga-gatgt-gt----ggat-aaatctt
B D                    Rabbit  attagta-aa------ga--a--------------gct-----gt-tctct-gt----aaattataattt
B D                    Alpaca  attagtg-aa------ta--a--------------aat-----ga-acctt-gt----gactaa------
               Bactrian camel  attagtg-aa------ta--a--------------aat-----ga-acctt-gt----gactga------
B D                   Dolphin  attcatg-aa------ta--a--------------aat-----gg-acctt-gt----gaataa------
                 Killer whale  attcatg-aa------ta--a--------------aat-----gg-acctt-gt----gaataa------
             Tibetan antelope  attcatg-aa------tg--a--------------aat-----ta-acctt-gt----gaataa------
B D                       Cow  attcatg-aa------tg--a--------------aat-----ta-acctt-gt----gaataa------
B D                     Sheep  attcatg-aa------tg--a--------------aat-----ta-acctt-gt----gaataa------
                Domestic goat  attcatg-aa------tg--a--------------aat-----ta-acctt-gt----gaataa------
B D                     Horse  attagtg-aa------aa--a--------------aaa-----aagaacct-gt----gaataa------
B D          White rhinoceros  attagtg-aa------aa--a--------------aat-----ga-accct-gt----gaataa------
B D                       Cat  attagtt-aa------ta--a--------------aat-----ga-atcct-gt----gaataa------
B D                   Ferret   atcagtt-aa------ca--a--------------aat-----ga-atcct-gt----gcataa------
B D                     Panda  attagtg-ag------ta--a--------------aat-----ga-atcct-gc----gaataa------
               Pacific walrus  attagtt-aa------ta--a--------------aat-----ga-atcct-gg----gaataa------
                 Weddell seal  attagtt-aa------ta--a--------------aat-----ga-aacct-gt----gaataa------
             Black flying-fox  aatagtg-aa------tg--a--------------aat-----ga-atcct-gt----gaataa------
B D                   Megabat  aatagtg-aa------tg--a--------------aat-----ga-accct-gt----gaataa------
         David's myotis (bat)  attaccg-aa------ta--a--------------aat-----ga-accat-atgattcaacat------
B D                  Microbat  at-------a------ta--t--------------taa-----aa-acta--------aaataa------
B D                  Hedgehog  atgagtg-aa------ga--c--------------aat-----ga-gccctcct----agataa------
B D                     Shrew  aatagtg-ac------aa--a--------------aat-----aa-atact-gt----ctaaag------
              Star-nosed mole  tttagtgaat------aa--a--------------aat-----ga-acctt-gt----ggataa------
B D                  Elephant  -aaaaaa-aa------aa--aataggaaagag---aac-----at-gttct-gc----gagtaa------
          Cape elephant shrew  -gcactt-tg------tg--atttggggaatgataaac-----aa-accct-gt----ggataa------
B D                    Tenrec  -a-acaa-aa------ca--a--------------aac-----aa-accc--------------------
B D                      Pika  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
                Prairie vole  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
B D                       Dog  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
                 Zebra mbuna  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================
                    Aardvark  ======================================================================
  D           Green seaturtle  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Mallard duck  ======================================================================
  D            Painted turtle  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Turkey  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                  Platypus  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D               Rock pigeon  ======================================================================

                        Human  ----------a
                        Chimp  ----------a
                      Gorilla  ----------a
                    Orangutan  tatgttattta
                       Gibbon  tatgttattta
                       Rhesus  tatgt------
          Crab-eating macaque  tatgt------
                       Baboon  tatgttattta
                 Green monkey  tatgttattta
                     Marmoset  tacataattaa
              Squirrel monkey  tacataattga
                     Bushbaby  -----------
           Chinese tree shrew  tatatcattta
                     Squirrel  tataaa----a
       Lesser Egyptian jerboa  -atactacttc
              Chinese hamster  tatatgctgta
               Golden hamster  tagatgattta
                        Mouse  caagtgattta
                          Rat  tatatgattta
               Naked mole-rat  ta-attatttc
                   Guinea pig  ta-attatttt
                   Chinchilla  ta-actatttt
             Brush-tailed rat  -----tatttt
                       Rabbit  ta-----ttta
                       Alpaca  -----------
               Bactrian camel  -----------
                      Dolphin  -----------
                 Killer whale  -----------
             Tibetan antelope  -----------
                          Cow  -----------
                        Sheep  -----------
                Domestic goat  -----------
                        Horse  -----------
             White rhinoceros  -----------
                          Cat  -----------
                      Ferret   -----------
                        Panda  -----------
               Pacific walrus  -----------
                 Weddell seal  -----------
             Black flying-fox  -----------
                      Megabat  -----------
         David's myotis (bat)  -----------
                     Microbat  -----------
                     Hedgehog  -----------
                        Shrew  -----------
              Star-nosed mole  -----------
                     Elephant  -----------
          Cape elephant shrew  -----------
                       Tenrec  -----------
                         Pika  ===========
                Big brown bat  -----------
                 Prairie vole  ===========
                    Armadillo  ===========
                      Manatee  ===========
                          Dog  ===========
        Burton's mouthbreeder  -----------
                 Nile tilapia  -----------
          Pundamilia nyererei  -----------
                Scarlet macaw  ===========
                       Lizard  ===========
                  Zebra mbuna  -----------
                       Parrot  ===========
                     Aardvark  ===========
              Green seaturtle  ===========
          Princess of Burundi  -----------
     Chinese softshell turtle  ===========
             Cape golden mole  -----------
                   Budgerigar  ===========
             Peregrine falcon  ===========
                 Mallard duck  ===========
               Painted turtle  ===========
                  Spotted gar  -----------
                   Coelacanth  ===========
              Tasmanian devil  ===========
                      Opossum  ===========
                 Saker falcon  ===========
                       Turkey  ===========
          Collared flycatcher  ===========
                     Platypus  ===========
          Medium ground finch  ===========
       White-throated sparrow  ===========
                      Chicken  ===========
           Tibetan ground jay  ===========
                X. tropicalis  ===========
           American alligator  ===========
                  Zebra finch  ===========
                  Rock pigeon  ===========

Inserts between block 7 and 8 in window
B D                   Alpaca 15bp
              Bactrian camel 15bp
B D                  Dolphin 17bp
                Killer whale 17bp
            Tibetan antelope 17bp
B D                      Cow 17bp
B D                    Sheep 17bp
               Domestic goat 17bp
B D                    Horse 17bp
B D         White rhinoceros 17bp
B D                      Cat 17bp
B D                  Ferret  17bp
B D                    Panda 16bp
              Pacific walrus 17bp
                Weddell seal 17bp
            Black flying-fox 17bp
B D                  Megabat 17bp
        David's myotis (bat) 8bp
B D                 Microbat 8bp
B D                 Hedgehog 22bp
B D                    Shrew 18bp
             Star-nosed mole 17bp
B D                 Elephant 18bp
         Cape elephant shrew 21bp

Alignment block 8 of 98 in window, 15618794 - 15618831, 38 bps 
B D                     Human  tacaaagtaa-tattg---aaact-----a--ctcaagtccaca--------------------aact-a
B D                     Chimp  tacaaagtaa-tattg---aaact-----a--ctcaagtccaca--------------------aact-a
B D                   Gorilla  tacaaagtaa-tattg---aaact-----a--ctcgagtccaca--------------------aact-a
B D                 Orangutan  tacaaagtaa-tatag---aaact-----a--ttcgagtccaca--------------------aact-a
B D                    Gibbon  tacaaagtaa-tattg---aaact-----a--ctcgagtccaca--------------------aact-a
B D                    Rhesus  -----------tattg---aaact-----a--ctcgagtccaca--------------------aact-a
B D       Crab-eating macaque  -----------tattg---aaact-----a--ctcgagtccaca--------------------aact-a
B D                    Baboon  tacaaagtaa-tattg---aaact-----a--ctcgagtccaca--------------------aact-a
B D              Green monkey  tacaaagtaa-tattg---aaact-----a--ctcgagtctaca--------------------aact-a
B D                  Marmoset  tac--agtga-tattg---aaact-----a--ctcgagtccaca--------------------aaat-a
B D           Squirrel monkey  tac--agtga-tattg---aaatt-----a--ctcgagtccaca--------------------aaat-a
           Chinese tree shrew  taagacatga-tatta---agact-----a--cttgatacaaca--------------------a-----
B D                  Squirrel  taaaaaatga-tagtg---aaactgctcaa--cttgaatccata--------------------aaac-a
       Lesser Egyptian jerboa  ta-aaagtta-cattg---aaactgctcaa--cttgaatccata--------------------aagt-g
B D           Chinese hamster  ta-aaagtga-catgg---aaactgcccaa--tttgaatccact--------------------aagc-a
               Golden hamster  tagaaagtga-catgg---aaactgcccaa--tttgaatccaca--------------------aagc-a
B D                     Mouse  taaaaactga-catgg---aaacttcccaa--cacaaatccaca--------------------aagc-a
B D                       Rat  taagacgtga-catgg---aaacttcccaa--ctcaaatccaca--------------------aaga-a
B D            Naked mole-rat  tatgaagtga-tattg---aatttattcaa--cttgaagccata--------------------aaat-a
B D                Guinea pig  tataaagtga-tattg---ag----tttag--cttcaatccaca--------------------aaat-a
                   Chinchilla  tataaagtga-tattg---agtttatttag--cttaaatccaca--------------------aaat-a
             Brush-tailed rat  tataaagtga-tattg---agtttatttaa--cttaaactcaca--------------------aaat-a
B D                    Rabbit  ttgaaattaa-cattt---taaatgctcaa--tttgaggtcata--------------------aaga-a
B D                    Alpaca  gataaaatga-tatta---aaacaatttaa--cttgagttcaca--------------------aaga--
               Bactrian camel  gataaaatga-tatta---aaacaatttaa--cttgagtccaca--------------------aaga--
B D                   Dolphin  gaaaaagtgt-tattg---aaactattcaa--cttgagtccaca--------------------aaga--
                 Killer whale  gaaaaagtgt-tattg---aaactattcaa--cttgagtccaca--------------------aaga--
             Tibetan antelope  taaaaagtag-tatta---aa--------a--ctcgagttcaca--------------------aaga--
B D                       Cow  taaaaagtag-tatta---aaact-----a--ctcgagttcaca--------------------aaga--
B D                     Sheep  taaaaagtag-tatta---aa--------a--ctcgagttcaca--------------------aaga--
                Domestic goat  taaaaagtag-tatta---aa--------a--ctcgagttcaca--------------------gaga--
B D                     Horse  taaaaagtga-tattg---aaactattcaa--cttgagtccaca--------------------aagg--
B D          White rhinoceros  taaaaagtga-tattg---aaactactcaa--cttgagtccaca--------------------aaga--
B D                       Cat  taagaagtga-tattg---aaaaaactcaa--cttgtattcacaaagaaaagaaaagaaaagaaaaga--
B D                       Dog  ttaaaagtga-tattgaaaaaaaaacttaa--ctggtgtgcaca--------------------------
B D                   Ferret   taaaaagtga-tattg---aaaaacctcaa--tttgtgttcgct--------------------------
B D                     Panda  tgaaaagtga-tattg-gaaaaaacttc-a--cttgcgttcacc--------------------------
               Pacific walrus  taaaaagtga-tattg-aaaaaaacctcaa--cttgtgttcacc--------------------aaga--
                 Weddell seal  taaaaagtga-tattg-aaaaaaacctcaa--cttgcattcacc--------------------aaga--
             Black flying-fox  taagaagtga-tattg-----------aaa--cttcagtccaca--------------------aaga--
B D                   Megabat  taagaagtga-tattg-----------aaa--cttcagtccacg--------------------aaga--
         David's myotis (bat)  ----aagtgaccacca-----------caagtctagaaacca----------------------------
B D                  Microbat  ----ttgagactact------------caa--cttgaggcca----------------------------
B D                  Hedgehog  taaa---tga-tactg---aaattattcaa--catgcgtccact--------------------gaaag-
B D                     Shrew  taagaa-taa-tattg---aaattacccaa--tat-cattta----------------------------
              Star-nosed mole  taaaaagtga-tattg---aaactactcaa--cttacacccaca--------------------aagaa-
B D                  Elephant  aaaaaagtga-tactg---atactactcaa--cttgagtccaca--------------------------
          Cape elephant shrew  aaaaaagtaa-tgctg---gcacttcttaa--catgaggcctca--------------------------
B D                    Tenrec  ---------------------------------------ccctg--------------------------
B D                      Pika  ======================================================================
               Big brown bat  ----------------------------------------------------------------------
                Prairie vole  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
B D                  Bushbaby  ----------------------------------------------------------------------
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
                 Zebra mbuna  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================
                    Aardvark  ======================================================================
  D           Green seaturtle  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Mallard duck  ======================================================================
  D            Painted turtle  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Turkey  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                  Platypus  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D               Rock pigeon  ======================================================================

Inserts between block 8 and 9 in window
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
B D                 Microbat 4bp

Alignment block 9 of 98 in window, 15618832 - 15618864, 33 bps 
B D                     Human  aagg--a-----------aaaaaaagatttatttaggaaac--at---att
B D                     Chimp  aagg--a-----------aaaaaaagatttatttaggaaac--at---att
B D                   Gorilla  aagg--------------aaaaaaagatttatttaggaaac--at---att
B D                 Orangutan  aagcaaa-----------aaaaaaagatttattttggaaac--at---att
B D                    Gibbon  aagg--a-----------aaaaaaagatttatttaggaaac--at---att
B D                    Rhesus  cagg--a-----------aaaaaaagatttatttaggaaaa--at---att
B D       Crab-eating macaque  cagg--a-----------aaaaaaagatttatttaggaaaa--at---att
B D                    Baboon  cagg--a-----------aaaaaaagatttatttaggaaaa--at---att
B D              Green monkey  cagg--a-----------aaaaaaagatttatttaggaaaa--at---att
B D                  Marmoset  aagg--a-----------aaaaaa-tatctatttagaaaaaatat---att
B D           Squirrel monkey  aagg--a-----------aaaaag--atctatttaataaaa--at---att
B D                  Bushbaby  ------a-----------aaaaaaatatct----------c--at---ag-
           Chinese tree shrew  ------g-----------gaaaaatgatttatttagggaaa--at---ac-
B D                  Squirrel  atga--a-----------aaaga---atttattaagggata--atatc---
       Lesser Egyptian jerboa  aaga--a-----------aatgag--atttattta----------------
B D           Chinese hamster  aaga--a-----------aatggg-tgcctgtttaaggaaa--gt------
               Golden hamster  aaga--a-----------agaggg-tacctgtttaaggaaa--gt------
B D                     Mouse  aaac--a-----------agggag-ggcttatttaaggaaa--tc------
B D                       Rat  aaac--a-----------aggaag-ggtttatttaagga------------
B D            Naked mole-rat  aaga--a-----------aaaagt--acttatttagggaaa--at---act
B D                Guinea pig  aaga--a-----------aaaggt--acttatttagcagaa--ac---act
                   Chinchilla  aaga--a-----------aaaagt--acgtatttagggaaa--at---act
             Brush-tailed rat  agga--a-----------aaaagt--acttatttagggaaa--at---aat
B D                    Rabbit  ggaa--t-----------aaaagc--atttacttaaggaaa--at---att
B D                    Alpaca  --aa--g-----------aacaaaagatttattgagggaaa--a----tat
               Bactrian camel  --aa--g-----------aa-aaaaaatttattgagggaaa--a----tat
B D                   Dolphin  --aa--g-----------aaaaaaagactgatttagggaaa--ct---att
                 Killer whale  --aa--g-----------aaaaaaagactgatttagggaaa--ct---att
             Tibetan antelope  --aa--g-----------aaaacagcatttgtttagggaaa--aa---ttt
B D                       Cow  --aa--g-----------aaaacaggatttgtttagggaaa--aa---ttt
B D                     Sheep  --aa--g-----------aaaacagcatttgtttagggaaa--aa---ttt
                Domestic goat  --aa--g-----------aaaacagcatttgtttagggaaa--aa---ttt
B D                     Horse  aatg--a-----------aaaaaaagatttatttagggaaa--at---att
B D          White rhinoceros  aaag--------------aaaaaaagatttatttagggaaa--gt---att
B D                       Cat  aaag--a-----------aaagaaaaatttacttagggaaa--at---att
B D                       Dog  -aag--a-----------aaaggaagatctacttaaagaaa--at---att
B D                   Ferret   -aag--a-----------aaagaaagatttacttagggaaa--at---att
B D                     Panda  -aag--a-----------aaagaaagatttactcagggaaa--at---att
               Pacific walrus  aaag--a-----------aaagaaagatttacttagggaaa--ac---att
                 Weddell seal  aaag--a-----------aaagaaagatttacttagggaaa--ac---att
             Black flying-fox  -aag--a-----------aaaaaa----ttatttagggaaa--at---att
B D                   Megabat  -aag--a-----------aaaaaa----ttatttagggaaa--at---att
         David's myotis (bat)  gagg--a-----------ataaaagggttcatttaagggaa--ct---att
B D                  Microbat  gagg--a-----------ataaaagggttcatttaagggaa--ct---att
B D                  Hedgehog  -ggg--ggaaagactttaaagaaaatgttt-cactgcttgg--ac---aaa
B D                     Shrew  ------------------aacaaaacattt-tactcaatgg--at---taa
              Star-nosed mole  -aag--g-----------aaaaaaagatttatattgagaaa--at---tct
B D                  Elephant  aaga--a-----------agaaaaggatttatttagggaaa--at---att
          Cape elephant shrew  aaga--a-----------ag----gagtttatttatagaaa--at---ctt
B D                    Tenrec  agga--a-----------tagaaagcatgcattccgaagaa--at---att
B D                      Pika  ===================================================
               Big brown bat  ---------------------------------------------------
                Prairie vole  ===================================================
B D                 Armadillo  ===================================================
B D                   Manatee  ===================================================
       Burton's mouthbreeder  ---------------------------------------------------
B D              Nile tilapia  ---------------------------------------------------
         Pundamilia nyererei  ---------------------------------------------------
  D             Scarlet macaw  ===================================================
B D                    Lizard  ===================================================
                 Zebra mbuna  ---------------------------------------------------
  D                    Parrot  ===================================================
                    Aardvark  ===================================================
  D           Green seaturtle  ===================================================
         Princess of Burundi  ---------------------------------------------------
  D  Chinese softshell turtle  ===================================================
            Cape golden mole  ---------------------------------------------------
B D                Budgerigar  ===================================================
  D          Peregrine falcon  ===================================================
  D              Mallard duck  ===================================================
  D            Painted turtle  ===================================================
                 Spotted gar  ---------------------------------------------------
B D                Coelacanth  ===================================================
B D           Tasmanian devil  ===================================================
B D                   Opossum  ===================================================
  D              Saker falcon  ===================================================
B D                    Turkey  ===================================================
  D       Collared flycatcher  ===================================================
B D                  Platypus  ===================================================
B D       Medium ground finch  ===================================================
  D    White-throated sparrow  ===================================================
B D                   Chicken  ===================================================
          Tibetan ground jay  ===================================================
B D             X. tropicalis  ===================================================
B D        American alligator  ===================================================
B D               Zebra finch  ===================================================
  D               Rock pigeon  ===================================================

Inserts between block 9 and 10 in window
B D          Chinese hamster 1bp
              Golden hamster 1835bp
B D                    Mouse 2bp

Alignment block 10 of 98 in window, 15618865 - 15618882, 18 bps 
B D                     Human  ttactt------tatat----ataa--ata
B D                     Chimp  ttactt------tatat----ataa--ata
B D                   Gorilla  ttactt------tatat----ataa--ata
B D                 Orangutan  ttactt------tatat----ataa--gta
B D                    Gibbon  ttactttatatatatat----ataa--ata
B D                    Rhesus  ttactt------tacat----ataaatata
B D       Crab-eating macaque  ttactt------tacat----ataa--ata
B D                    Baboon  ttactt------tacat----ataa--ata
B D              Green monkey  ttactt------tacat----ataa--ata
B D                  Marmoset  ttactt------catat----ataa--ata
B D           Squirrel monkey  ttactt------tatat----ataa--ata
           Chinese tree shrew  ttactg------tatgtgtggataa--atg
B D                  Squirrel  ttaata------tatgg----ataa--ata
       Lesser Egyptian jerboa  ttatta------tgtat----ataa--gta
B D           Chinese hamster  gtatta------tatgg----gtta--gta
B D                     Mouse  tgatgc------aataa----ctta--gtc
B D                       Rat  ------------aatgg----gtta--gtc
B D            Naked mole-rat  ttatta------tatga----ataa--ata
B D                Guinea pig  ttatta------gatga----gtaa--ata
                   Chinchilla  ttatta------gatga----gtaa--ctg
             Brush-tailed rat  ttatta------aatga----gtaa--ata
B D                    Rabbit  ttgcta------tgtga----atat--gta
B D                    Alpaca  ttacaa------tatgg----------ata
               Bactrian camel  ttacaa------tatgg----------ata
B D                   Dolphin  ttacaa------tacgg----------ata
                 Killer whale  ttacaa------tacag----------ata
             Tibetan antelope  ttacaa------tatgg----------ata
B D                       Cow  ttacaa------tatgg----------ata
B D                     Sheep  ttacaa------tatga----------ata
                Domestic goat  ttacaa------tatgg----------ata
B D                     Horse  ttactg------tatgg----ccaa--ata
B D          White rhinoceros  ttacta------tgtgg----ataa--ata
B D                       Cat  ttacaa------tatgg----ataa--gta
B D                       Dog  ttgcta------catga----ataa--ata
B D                   Ferret   tcactg------cgtgg----------ata
B D                     Panda  tcacta------tatgg----ataa--ata
               Pacific walrus  ttacta------catgg----ataa--ata
                 Weddell seal  ttacta------cgtgg----gtaa--ata
             Black flying-fox  gtacta------tatgg----ataa--ata
B D                   Megabat  gtacta------tatgg----ataa--ata
         David's myotis (bat)  ttacta------tagaa----ttat--ata
B D                  Microbat  ttacta------tataa----ttat--ata
B D                  Hedgehog  taa------------------------ata
B D                     Shrew  tga---------------------------
              Star-nosed mole  tgacag------tgtgg----atga--agc
B D                  Elephant  ttatta------tatgg----gtaa--ata
          Cape elephant shrew  gtcctg------tacac----atta--gca
B D                    Tenrec  ttgaat------tattt----ataa--a--
B D                      Pika  ==============================
               Big brown bat  ------------------------------
              Golden hamster  ==============================
                Prairie vole  ==============================
B D                 Armadillo  ==============================
B D                   Manatee  ==============================
       Burton's mouthbreeder  ------------------------------
B D              Nile tilapia  ------------------------------
         Pundamilia nyererei  ------------------------------
B D                  Bushbaby  ------------------------------
  D             Scarlet macaw  ==============================
B D                    Lizard  ==============================
                 Zebra mbuna  ------------------------------
  D                    Parrot  ==============================
                    Aardvark  ==============================
  D           Green seaturtle  ==============================
         Princess of Burundi  ------------------------------
  D  Chinese softshell turtle  ==============================
            Cape golden mole  ------------------------------
B D                Budgerigar  ==============================
  D          Peregrine falcon  ==============================
  D              Mallard duck  ==============================
  D            Painted turtle  ==============================
                 Spotted gar  ------------------------------
B D                Coelacanth  ==============================
B D           Tasmanian devil  ==============================
B D                   Opossum  ==============================
  D              Saker falcon  ==============================
B D                    Turkey  ==============================
  D       Collared flycatcher  ==============================
B D                  Platypus  ==============================
B D       Medium ground finch  ==============================
  D    White-throated sparrow  ==============================
B D                   Chicken  ==============================
          Tibetan ground jay  ==============================
B D             X. tropicalis  ==============================
B D        American alligator  ==============================
B D               Zebra finch  ==============================
  D               Rock pigeon  ==============================

Alignment block 11 of 98 in window, 15618883 - 15618890, 8 bps 
B D                     Human  ttcata----------------tc
B D                     Chimp  ttcata----------------tc
B D                   Gorilla  ttcata----------------tc
B D                 Orangutan  ttcata----------------tc
B D                    Gibbon  ttcata----------------tc
B D                    Rhesus  ttcata----------------tc
B D       Crab-eating macaque  ttcata----------------tc
B D                    Baboon  ttcata----------------tc
B D              Green monkey  ttcata----------------tc
B D                  Marmoset  ttcata----------------tc
B D           Squirrel monkey  ttcata----------------ta
           Chinese tree shrew  ttcata----------------tt
B D                  Squirrel  ttctta----------------ta
       Lesser Egyptian jerboa  ttcata----------------tc
                 Prairie vole  ttgata----------------tt
B D           Chinese hamster  ttcata----------------tc
               Golden hamster  ttgaga----------------tt
B D                     Mouse  ttcaca----------------tc
B D                       Rat  ttcata----------------tc
B D            Naked mole-rat  -ttata----------------tc
B D                Guinea pig  -ttata----------------tc
                   Chinchilla  -ttata----------------tc
             Brush-tailed rat  -ttata----------------tc
B D                    Rabbit  tttgca----------------tc
B D                    Alpaca  ttcata----------------tc
               Bactrian camel  ttcata----------------tc
B D                   Dolphin  ttcata----------------tc
                 Killer whale  ttcata----------------tc
             Tibetan antelope  tgcaaa----------------tc
B D                       Cow  tgcaaa----------------tc
B D                     Sheep  tgcaaa----------------tc
                Domestic goat  tgcaaa----------------tc
B D                     Horse  ttcata----------------tc
B D          White rhinoceros  ttcata----------------tc
B D                       Cat  ttcata----------------ta
B D                       Dog  ttcatt----------------ta
B D                   Ferret   ttcatt----------------tc
B D                     Panda  ttcatt----------------ta
               Pacific walrus  ttcatt----------------ga
                 Weddell seal  ttcatt----------------ga
             Black flying-fox  ttcata----------------tc
B D                   Megabat  ttcata----------------tc
         David's myotis (bat)  ttcata----------------tc
B D                  Microbat  ttcata----------------tc
B D                  Hedgehog  ttcata----------------ta
B D                     Shrew  -----a----------------tc
              Star-nosed mole  gtcaca----------------tt
B D                  Elephant  ttcatccatattcatcattcattc
          Cape elephant shrew  ----------------------tc
B D                      Pika  ========================
B D                    Tenrec  ------------------------
               Big brown bat  ------------------------
B D                 Armadillo  ========================
B D                   Manatee  ========================
       Burton's mouthbreeder  ------------------------
B D              Nile tilapia  ------------------------
         Pundamilia nyererei  ------------------------
B D                  Bushbaby  ------------------------
  D             Scarlet macaw  ========================
B D                    Lizard  ========================
                 Zebra mbuna  ------------------------
  D                    Parrot  ========================
                    Aardvark  ========================
  D           Green seaturtle  ========================
         Princess of Burundi  ------------------------
  D  Chinese softshell turtle  ========================
            Cape golden mole  ------------------------
B D                Budgerigar  ========================
  D          Peregrine falcon  ========================
  D              Mallard duck  ========================
  D            Painted turtle  ========================
                 Spotted gar  ------------------------
B D                Coelacanth  ========================
B D           Tasmanian devil  ========================
B D                   Opossum  ========================
  D              Saker falcon  ========================
B D                    Turkey  ========================
  D       Collared flycatcher  ========================
B D                  Platypus  ========================
B D       Medium ground finch  ========================
  D    White-throated sparrow  ========================
B D                   Chicken  ========================
          Tibetan ground jay  ========================
B D             X. tropicalis  ========================
B D        American alligator  ========================
B D               Zebra finch  ========================
  D               Rock pigeon  ========================

Inserts between block 11 and 12 in window
B D                   Alpaca 961bp

Alignment block 12 of 98 in window, 15618891 - 15618892, 2 bps 
B D                     Human  ct-
B D                     Chimp  ct-
B D                   Gorilla  ct-
B D                 Orangutan  ct-
B D                    Gibbon  ct-
B D                    Rhesus  ct-
B D       Crab-eating macaque  ct-
B D                    Baboon  ct-
B D              Green monkey  ct-
B D                  Marmoset  ct-
B D           Squirrel monkey  ct-
           Chinese tree shrew  ca-
B D                  Squirrel  ca-
       Lesser Egyptian jerboa  ca-
                 Prairie vole  ca-
B D           Chinese hamster  ca-
               Golden hamster  ca-
B D                     Mouse  ca-
B D                       Rat  ca-
B D            Naked mole-rat  ca-
B D                Guinea pig  ca-
                   Chinchilla  ca-
             Brush-tailed rat  ta-
B D                    Rabbit  ta-
               Bactrian camel  g--
B D                   Dolphin  t--
                 Killer whale  t--
             Tibetan antelope  t--
B D                       Cow  t--
B D                     Sheep  t--
                Domestic goat  t--
B D                     Horse  c--
B D          White rhinoceros  c--
B D                       Cat  c--
B D                       Dog  c--
B D                   Ferret   c--
B D                     Panda  c--
               Pacific walrus  c--
                 Weddell seal  c--
             Black flying-fox  c--
B D                   Megabat  c--
         David's myotis (bat)  t--
B D                  Microbat  t--
B D                  Hedgehog  c--
B D                     Shrew  t--
              Star-nosed mole  c--
B D                  Elephant  -ta
          Cape elephant shrew  -tt
B D                      Pika  ===
B D                    Tenrec  ---
               Big brown bat  ---
B D                 Armadillo  ===
B D                   Manatee  ===
       Burton's mouthbreeder  ---
B D              Nile tilapia  ---
         Pundamilia nyererei  ---
B D                    Alpaca  ===
B D                  Bushbaby  ---
  D             Scarlet macaw  ===
B D                    Lizard  ===
                 Zebra mbuna  ---
  D                    Parrot  ===
                    Aardvark  ===
  D           Green seaturtle  ===
         Princess of Burundi  ---
  D  Chinese softshell turtle  ===
            Cape golden mole  ---
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Mallard duck  ===
  D            Painted turtle  ===
                 Spotted gar  ---
B D                Coelacanth  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
  D              Saker falcon  ===
B D                    Turkey  ===
  D       Collared flycatcher  ===
B D                  Platypus  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D             X. tropicalis  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D               Rock pigeon  ===

Inserts between block 12 and 13 in window
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 1bp
B D         White rhinoceros 1bp
B D                      Cat 1bp
B D                      Dog 1bp
B D                  Ferret  1bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
        David's myotis (bat) 1bp
B D                 Microbat 1bp
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 13 of 98 in window, 15618893 - 15618932, 40 bps 
B D                     Human  caatgactaaaccttg-g----------------------aagttagata----------acctatccat
B D                     Chimp  caatgactaaaccttg-g----------------------aagttagata----------acctatccat
B D                   Gorilla  caatgactaaaccttg-g----------------------aagttagata----------acctatccac
B D                 Orangutan  caatgactaaaccttg-g----------------------aagttagata----------acctatccat
B D                    Gibbon  caatgactaaaccttg-g----------------------aagttagata----------acctatccat
B D                    Rhesus  caatgactaaaccttg-g----------------------aagttagata----------acctattctt
B D       Crab-eating macaque  caatgactaaaccttg-g----------------------aagttagata----------acctatcctt
B D                    Baboon  caatgactaaaccttg-g----------------------aagttagata----------acctatcctt
B D              Green monkey  caatgactaaaccttg-g----------------------aagttagata----------acctatcctt
B D                  Marmoset  caatgactaaaccttg-g----------------------aagctagata----------acccattgat
B D           Squirrel monkey  caatgactaaaccttg-g----------------------aagttagata----------acctatccat
           Chinese tree shrew  caaaaactaaatctta-g----------------------aagtaagata----------acttatccat
B D                  Squirrel  caatgact-aatctta-g--------------------------aaggta----------accttgccat
       Lesser Egyptian jerboa  caaaaactaaatctta-g----------------------gagtaggaaa----------acttctccat
                 Prairie vole  cagtgagtaaatctta-g----------------------gggtaagata----------agtcactgat
B D           Chinese hamster  caatgagtaaatcttgtt----------------------atataaattt----------atttat---t
               Golden hamster  caatgagtaaatcttttg----------------------gggtaaaata----------agtcaccaat
B D                     Mouse  caatgactaaatctta-g----------------------ggctaagatg----------agttcctgat
B D                       Rat  caatgactaaatctta-g----------------------gggtaagata----------agtccctgat
B D            Naked mole-rat  cactgacgagatccta-g----------------------gagtaagata----------acttctccat
B D                Guinea pig  cgctgagcaagtccta-g----------------------gaataaaata----------acttctccat
                   Chinchilla  tgctgaccaagtgcta-g----------------------gagtaaaata----------gctcctctat
             Brush-tailed rat  tgctgaccaagtccta-g----------------------gagtaaaata----------acttctccat
B D                    Rabbit  tgagggctgaatctca-g----------------------aaataagaca----------acctatccat
B D                    Alpaca  caatgactaaatctt-------------------------aa----gaca----------acctatctat
               Bactrian camel  caatgactaaatctt-------------------------aa----gaca----------acctatctat
B D                   Dolphin  caatgactaaatctt-------------------------aactaagata----------acctatctat
                 Killer whale  caatgactaaatctt-------------------------aactaagata----------acctatctat
             Tibetan antelope  caatgactaaagctt-------------------------aagcaggata----------acctatctat
B D                       Cow  caatgactaaatctt-------------------------aagcaggata----------acctatctat
B D                     Sheep  caatgactaaagctt-------------------------aagcaggata----------acctatctat
                Domestic goat  caatgactaaagctt-------------------------aagcaggata----------acctgtctat
B D                     Horse  taatgactgaatctta-g----------------------aagtaagact----------atctatctat
B D          White rhinoceros  taatgactaaatctta-g----------------------aagtaagata----------acctatctat
B D                       Cat  caatgaccaaatctta-g----------------------aagtaagata----------acctatgtct
B D                       Dog  caatgaccaaatctta-g----------------------aagtaagaca----------acctatctat
B D                   Ferret   cactgaccaaatctta-g----------------------aagtaagata----------acccagctat
B D                     Panda  caa-gaccaaatctta-g----------------------aagtaggata----------acctatctat
               Pacific walrus  caatgaccaaatctca-g----------------------aagtaagata----------acctatctat
                 Weddell seal  caatgaccaaatctta-g----------------------aagtaagaca----------acctatctat
             Black flying-fox  taatgactaaaaatct-taa--------------------aagtaagaca----------acatatccat
B D                   Megabat  taatgactaaaaatca-tag--------------------aaataagaca----------acatatccat
         David's myotis (bat)  taatggctgaatctca-gaattgtgccctacattacccacaagcaaagcatgaatagaataaatatccat
B D                  Microbat  taatggctgaatctca-gaactgtgccctacattacccacaagcaaagcatgaatagcataaatatccat
B D                  Hedgehog  caatgattaaatccta-a----------------------aa--agtata----------ac---tgtat
B D                     Shrew  caaagactcaatagta-g--------------------------aagata----------aaccacatat
              Star-nosed mole  cgatgactacatttta-g----------------------aagtaagata----------acctgcgtat
B D                  Elephant  ctatgactacatctta-g----------------------aagtagtata----------acctaaccat
          Cape elephant shrew  ctatgactgagactta-g----------------------aagtaacata----------acctactcac
B D                      Pika  ======================================================================
B D                    Tenrec  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
B D                  Bushbaby  ----------------------------------------------------------------------
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
                 Zebra mbuna  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================
                    Aardvark  ======================================================================
  D           Green seaturtle  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Mallard duck  ======================================================================
  D            Painted turtle  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Turkey  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                  Platypus  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D               Rock pigeon  ======================================================================

                        Human  ct----g
                        Chimp  ct----g
                      Gorilla  ct----g
                    Orangutan  ct----g
                       Gibbon  ct----g
                       Rhesus  ct----g
          Crab-eating macaque  ct----g
                       Baboon  ct----g
                 Green monkey  ct----g
                     Marmoset  ct----g
              Squirrel monkey  ct----g
           Chinese tree shrew  ct----g
                     Squirrel  ct-g---
       Lesser Egyptian jerboa  cta----
                 Prairie vole  tg-----
              Chinese hamster  tg-----
               Golden hamster  tg-----
                        Mouse  tg-----
                          Rat  gg-----
               Naked mole-rat  ct--g--
                   Guinea pig  ct--g--
                   Chinchilla  ct--g--
             Brush-tailed rat  ct--a--
                       Rabbit  ct---g-
                       Alpaca  ct----g
               Bactrian camel  ct----g
                      Dolphin  ct----g
                 Killer whale  ct----g
             Tibetan antelope  ct----g
                          Cow  ct----g
                        Sheep  ct----g
                Domestic goat  ct----g
                        Horse  cc----g
             White rhinoceros  ct----g
                          Cat  ct----g
                          Dog  ct----g
                      Ferret   ct----g
                        Panda  ct----g
               Pacific walrus  ct----g
                 Weddell seal  ct----g
             Black flying-fox  ct----g
                      Megabat  ct----g
         David's myotis (bat)  ct----a
                     Microbat  ct----a
                     Hedgehog  ct----g
                        Shrew  ct-----
              Star-nosed mole  ct----g
                     Elephant  ct----g
          Cape elephant shrew  gt----g
                         Pika  =======
                       Tenrec  -------
                Big brown bat  -------
                    Armadillo  =======
                      Manatee  =======
        Burton's mouthbreeder  -------
                 Nile tilapia  -------
          Pundamilia nyererei  -------
                     Bushbaby  -------
                Scarlet macaw  =======
                       Lizard  =======
                  Zebra mbuna  -------
                       Parrot  =======
                     Aardvark  =======
              Green seaturtle  =======
          Princess of Burundi  -------
     Chinese softshell turtle  =======
             Cape golden mole  -------
                   Budgerigar  =======
             Peregrine falcon  =======
                 Mallard duck  =======
               Painted turtle  =======
                  Spotted gar  -------
                   Coelacanth  =======
              Tasmanian devil  =======
                      Opossum  =======
                 Saker falcon  =======
                       Turkey  =======
          Collared flycatcher  =======
                     Platypus  =======
          Medium ground finch  =======
       White-throated sparrow  =======
                      Chicken  =======
           Tibetan ground jay  =======
                X. tropicalis  =======
           American alligator  =======
                  Zebra finch  =======
                  Rock pigeon  =======

Inserts between block 13 and 14 in window
B D          Chinese hamster 1431bp

Alignment block 14 of 98 in window, 15618933 - 15618941, 9 bps 
B D                     Human  gaaag--------acac
B D                     Chimp  gaaag--------acac
B D                   Gorilla  gaaag--------acac
B D                 Orangutan  gaaag--------acac
B D                    Gibbon  gaaag--------acac
B D                    Rhesus  gtaag--------acac
B D       Crab-eating macaque  gtaag--------acac
B D                    Baboon  gtaag--------acac
B D              Green monkey  gtaag--------acac
B D                  Marmoset  gaaag--------acac
B D           Squirrel monkey  gaaag--------acac
           Chinese tree shrew  gaaat--------tcac
B D                  Squirrel  gaaag--------atac
       Lesser Egyptian jerboa  gaaag--------atgc
                 Prairie vole  gaaag--------atag
               Golden hamster  gaaaa--------ttag
B D                     Mouse  gaaag--------atcg
B D                       Rat  gaaag--------atag
B D            Naked mole-rat  gaaag--------atac
B D                Guinea pig  gaaag--------atac
                   Chinchilla  gaaag--------atac
             Brush-tailed rat  gaaag--------attt
B D                    Rabbit  gaaag--------acac
B D                    Alpaca  gaaag--------aaac
               Bactrian camel  gaaag--------aaac
B D                   Dolphin  gaaag--------aaac
                 Killer whale  gaaag--------aaac
             Tibetan antelope  gaaag--------aaac
B D                       Cow  gaaag--------aaac
B D                     Sheep  gaaag--------aaac
                Domestic goat  gaaag--------aaac
B D                     Horse  gaaag--------aaac
B D          White rhinoceros  gaaac--------aaac
B D                       Cat  gagag--------aaat
B D                       Dog  gaaag--------aaat
B D                   Ferret   g-aag--------acac
B D                     Panda  gaaag--------aaat
               Pacific walrus  gaaag--------aaat
                 Weddell seal  gaaag--------aaat
             Black flying-fox  gaaag--------aagt
B D                   Megabat  gaaag--------aagt
         David's myotis (bat)  gaaagacacaaccacat
B D                  Microbat  gaaagacacaaccacat
B D                  Hedgehog  gaaag--------aaac
B D                     Shrew  gaaat--------aaac
              Star-nosed mole  gaaag--------aatc
B D                  Elephant  gaaag--------gca-
          Cape elephant shrew  gaaag--------atac
B D                      Pika  =================
B D                    Tenrec  -----------------
               Big brown bat  -----------------
B D           Chinese hamster  =================
B D                 Armadillo  =================
B D                   Manatee  =================
       Burton's mouthbreeder  -----------------
B D              Nile tilapia  -----------------
         Pundamilia nyererei  -----------------
B D                  Bushbaby  -----------------
  D             Scarlet macaw  =================
B D                    Lizard  =================
                 Zebra mbuna  -----------------
  D                    Parrot  =================
                    Aardvark  =================
  D           Green seaturtle  =================
         Princess of Burundi  -----------------
  D  Chinese softshell turtle  =================
            Cape golden mole  -----------------
B D                Budgerigar  =================
  D          Peregrine falcon  =================
  D              Mallard duck  =================
  D            Painted turtle  =================
                 Spotted gar  -----------------
B D                Coelacanth  =================
B D           Tasmanian devil  =================
B D                   Opossum  =================
  D              Saker falcon  =================
B D                    Turkey  =================
  D       Collared flycatcher  =================
B D                  Platypus  =================
B D       Medium ground finch  =================
  D    White-throated sparrow  =================
B D                   Chicken  =================
          Tibetan ground jay  =================
B D             X. tropicalis  =================
B D        American alligator  =================
B D               Zebra finch  =================
  D               Rock pigeon  =================

Inserts between block 14 and 15 in window
            Brush-tailed rat 2bp
B D                   Rabbit 3bp
         Cape elephant shrew 924bp

Alignment block 15 of 98 in window, 15618942 - 15618953, 12 bps 
B D                     Human  atagatctcgc---a
B D                     Chimp  atagatctcgc---a
B D                   Gorilla  atagatctcgc---a
B D                 Orangutan  atagatctcgc---a
B D                    Gibbon  atagatctcgc---a
B D                    Rhesus  atagatctcgc---a
B D       Crab-eating macaque  atagatctcgc---a
B D                    Baboon  atagatctcgc---a
B D              Green monkey  atagatctcgc---a
B D                  Marmoset  atagatctggc---a
B D           Squirrel monkey  atagatctggc---a
           Chinese tree shrew  atag-----------
B D                  Squirrel  agaaa----tc---a
       Lesser Egyptian jerboa  caagatctatc---a
                 Prairie vole  ggaggtctgtc---a
               Golden hamster  ggagatctgtc---a
B D                     Mouse  ggagatctgtc---a
B D                       Rat  ggagatacgtc---a
B D            Naked mole-rat  agaaatctgtc----
B D                Guinea pig  agaaatctgtc---a
                   Chinchilla  agaaatctgtt----
             Brush-tailed rat  aaaaatctgtt----
B D                    Rabbit  acacattcatctgta
B D                    Alpaca  --agatctggc---a
               Bactrian camel  --agatctggc---a
B D                   Dolphin  ataagtctgac---a
                 Killer whale  ataggtctgac---a
             Tibetan antelope  atagctctggg---a
B D                       Cow  atagctctggg---a
B D                     Sheep  atagctctggg---a
                Domestic goat  atagctctggg---a
B D                     Horse  --agatctggc---a
B D          White rhinoceros  atagatttggc---a
B D                       Cat  acagatctggc---a
B D                       Dog  atagatctggc---a
B D                   Ferret   acagatctggc---a
B D                     Panda  acagatctggc---a
               Pacific walrus  acagatctggc---a
                 Weddell seal  acagatctggc---a
             Black flying-fox  atagatctgac---a
B D                   Megabat  atagatctggc---a
         David's myotis (bat)  gtagatctggt---a
B D                  Microbat  gtagatctggt---a
B D                  Hedgehog  ----atctggc---a
B D                     Shrew  atagatctg-c---t
              Star-nosed mole  atagatcagtc---a
B D                  Elephant  -tcaatgtggc---a
B D                      Pika  ===============
B D                    Tenrec  ---------------
               Big brown bat  ---------------
B D           Chinese hamster  ===============
         Cape elephant shrew  ===============
B D                 Armadillo  ===============
B D                   Manatee  ===============
       Burton's mouthbreeder  ---------------
B D              Nile tilapia  ---------------
         Pundamilia nyererei  ---------------
B D                  Bushbaby  ---------------
  D             Scarlet macaw  ===============
B D                    Lizard  ===============
                 Zebra mbuna  ---------------
  D                    Parrot  ===============
                    Aardvark  ===============
  D           Green seaturtle  ===============
         Princess of Burundi  ---------------
  D  Chinese softshell turtle  ===============
            Cape golden mole  ---------------
B D                Budgerigar  ===============
  D          Peregrine falcon  ===============
  D              Mallard duck  ===============
  D            Painted turtle  ===============
                 Spotted gar  ---------------
B D                Coelacanth  ===============
B D           Tasmanian devil  ===============
B D                   Opossum  ===============
  D              Saker falcon  ===============
B D                    Turkey  ===============
  D       Collared flycatcher  ===============
B D                  Platypus  ===============
B D       Medium ground finch  ===============
  D    White-throated sparrow  ===============
B D                   Chicken  ===============
          Tibetan ground jay  ===============
B D             X. tropicalis  ===============
B D        American alligator  ===============
B D               Zebra finch  ===============
  D               Rock pigeon  ===============

Alignment block 16 of 98 in window, 15618954 - 15618959, 6 bps 
B D                     Human  ggaagg-
B D                     Chimp  ggaagg-
B D                   Gorilla  ggaagg-
B D                 Orangutan  gaaggg-
B D                    Gibbon  ggaagg-
B D                    Rhesus  ggaagg-
B D       Crab-eating macaque  ggaagg-
B D                    Baboon  ggaagg-
B D              Green monkey  ggaagg-
B D                  Marmoset  ggaaga-
B D           Squirrel monkey  ggaaga-
           Chinese tree shrew  -ggagg-
B D                  Squirrel  gaaagg-
       Lesser Egyptian jerboa  gagagg-
                 Prairie vole  gaaaga-
               Golden hamster  gaaagg-
B D                     Mouse  gaaagg-
B D                       Rat  gaaagg-
B D            Naked mole-rat  -agaga-
B D                Guinea pig  gaaaga-
             Brush-tailed rat  --gaga-
B D                    Rabbit  gggaga-
B D                    Alpaca  gggagg-
               Bactrian camel  gggagg-
B D                   Dolphin  ggaagg-
                 Killer whale  gggagg-
             Tibetan antelope  tggagg-
B D                       Cow  gggagg-
B D                     Sheep  tggagg-
                Domestic goat  tggagg-
B D                     Horse  gagagg-
B D          White rhinoceros  ggaagg-
B D                       Cat  gggagg-
B D                       Dog  gggagg-
B D                   Ferret   gggagg-
B D                     Panda  gggaag-
               Pacific walrus  gggagg-
                 Weddell seal  gggagg-
             Black flying-fox  gggaaa-
B D                   Megabat  gggaaa-
         David's myotis (bat)  gggaga-
B D                  Microbat  gggaga-
B D                  Hedgehog  gggaga-
B D                     Shrew  gggaaa-
              Star-nosed mole  gagagc-
B D                  Elephant  -ggaagg
                     Aardvark  -ggaaa-
B D                      Pika  =======
B D                    Tenrec  -------
               Big brown bat  -------
B D           Chinese hamster  =======
         Cape elephant shrew  =======
                  Chinchilla  -------
B D                 Armadillo  =======
B D                   Manatee  =======
       Burton's mouthbreeder  -------
B D              Nile tilapia  -------
         Pundamilia nyererei  -------
B D                  Bushbaby  -------
  D             Scarlet macaw  =======
B D                    Lizard  =======
                 Zebra mbuna  -------
  D                    Parrot  =======
  D           Green seaturtle  =======
         Princess of Burundi  -------
  D  Chinese softshell turtle  =======
            Cape golden mole  -------
B D                Budgerigar  =======
  D          Peregrine falcon  =======
  D              Mallard duck  =======
  D            Painted turtle  =======
                 Spotted gar  -------
B D                Coelacanth  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
  D              Saker falcon  =======
B D                    Turkey  =======
  D       Collared flycatcher  =======
B D                  Platypus  =======
B D       Medium ground finch  =======
  D    White-throated sparrow  =======
B D                   Chicken  =======
          Tibetan ground jay  =======
B D             X. tropicalis  =======
B D        American alligator  =======
B D               Zebra finch  =======
  D               Rock pigeon  =======

Alignment block 17 of 98 in window, 15618960 - 15618962, 3 bps 
B D                     Human  tgg
B D                     Chimp  tgg
B D                   Gorilla  tgg
B D                 Orangutan  tgg
B D                    Gibbon  tgg
B D                    Rhesus  tgg
B D       Crab-eating macaque  tgg
B D                    Baboon  tgg
B D              Green monkey  tgg
B D                  Marmoset  cgg
B D           Squirrel monkey  tgg
           Chinese tree shrew  tgg
B D                  Squirrel  tgg
                 Prairie vole  tgg
               Golden hamster  tgg
B D                     Mouse  tgg
B D                       Rat  tgg
B D            Naked mole-rat  gag
B D                Guinea pig  gag
                   Chinchilla  aga
             Brush-tailed rat  aag
B D                    Rabbit  taa
B D                    Alpaca  gca
               Bactrian camel  gga
B D                   Dolphin  tgg
                 Killer whale  tgg
             Tibetan antelope  tga
B D                       Cow  tga
B D                     Sheep  tga
                Domestic goat  tga
B D                     Horse  tgg
B D          White rhinoceros  tgg
B D                       Cat  tag
B D                       Dog  agg
B D                   Ferret   tgg
B D                     Panda  tgg
               Pacific walrus  tgg
                 Weddell seal  tgg
             Black flying-fox  tgg
B D                   Megabat  tgg
         David's myotis (bat)  cag
B D                  Microbat  tag
B D                  Hedgehog  tgg
B D                     Shrew  gtg
              Star-nosed mole  gac
B D                  Elephant  tgg
          Cape elephant shrew  tga
                     Aardvark  tgg
B D                      Pika  ===
B D                    Tenrec  ---
               Big brown bat  ---
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ---
B D                 Armadillo  ===
B D                   Manatee  ===
       Burton's mouthbreeder  ---
B D              Nile tilapia  ---
         Pundamilia nyererei  ---
B D                  Bushbaby  ---
  D             Scarlet macaw  ===
B D                    Lizard  ===
                 Zebra mbuna  ---
  D                    Parrot  ===
  D           Green seaturtle  ===
         Princess of Burundi  ---
  D  Chinese softshell turtle  ===
            Cape golden mole  ---
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Mallard duck  ===
  D            Painted turtle  ===
                 Spotted gar  ---
B D                Coelacanth  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
  D              Saker falcon  ===
B D                    Turkey  ===
  D       Collared flycatcher  ===
B D                  Platypus  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D             X. tropicalis  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D               Rock pigeon  ===

Alignment block 18 of 98 in window, 15618963 - 15618971, 9 bps 
B D                     Human  tagaa-g---------------------------------------------------------------
B D                     Chimp  tagaa-g---------------------------------------------------------------
B D                   Gorilla  cagaa-g---------------------------------------------------------------
B D                 Orangutan  tagaagg---------------------------------------------------------------
B D                    Gibbon  tagaa-g---------------------------------------------------------------
B D                    Rhesus  tagaa-g---------------------------------------------------------------
B D       Crab-eating macaque  tagaa-g---------------------------------------------------------------
B D                    Baboon  tagaa-g---------------------------------------------------------------
B D              Green monkey  tagaa-g---------------------------------------------------------------
B D                  Marmoset  tagag-g---------------------------------------------------------------
B D           Squirrel monkey  tagaa-g---------------------------------------------------------------
           Chinese tree shrew  tagaa-g---------------------------------------------------------------
B D                  Squirrel  tagaa-g---------------------------------------------------------------
                 Prairie vole  tagaa-----------------------------------------------------------------
               Golden hamster  tagaa-----------------------------------------------------------------
B D                     Mouse  aagaa-g---------------------------------------------------------------
B D                       Rat  cagaa-g---------------------------------------------------------------
B D            Naked mole-rat  tagat-a---------------------------------------------------------------
B D                Guinea pig  tagat-g---------------------------------------------------------------
                   Chinchilla  gagat-g---------------------------------------------------------------
             Brush-tailed rat  tagac-g---------------------------------------------------------------
B D                    Rabbit  tggga-g---------------------------------------------------------------
B D                    Alpaca  tgaaa-g---------------------------------------------------------------
               Bactrian camel  tgaat-g---------------------------------------------------------------
B D                   Dolphin  tgaaa-g---------------------------------------------------------------
                 Killer whale  tgaaa-g---------------------------------------------------------------
             Tibetan antelope  tgaaa-c---------------------------------------------------------------
B D                       Cow  tgaaa-g---------------------------------------------------------------
B D                     Sheep  tgaaa-g---------------------------------------------------------------
                Domestic goat  tgaaa-g---------------------------------------------------------------
B D                     Horse  tgaaa-g---------------------------------------------------------------
B D          White rhinoceros  ggaaa-g---------------------------------------------------------------
B D                       Cat  tgaga-g---------------------------------------------------------------
B D                       Dog  tgaaa-a---------------------------------------------------------------
B D                   Ferret   tgaaa-g---------------------------------------------------------------
B D                     Panda  tgaaa-g---------------------------------------------------------------
               Pacific walrus  taaaa-g---------------------------------------------------------------
                 Weddell seal  taaaa-g---------------------------------------------------------------
             Black flying-fox  tgaaa-g---------------------------------------------------------------
B D                   Megabat  tgaat-acatagatatacgtaaggcacttatttggattctcacttatttggatacgtatatctatgtatt
         David's myotis (bat)  tgggt-a---------------------------------------------------------------
B D                  Microbat  tgggt-a---------------------------------------------------------------
B D                  Hedgehog  tgaat-g---------------------------------------------------------------
B D                     Shrew  tgagg-a---------------------------------------------------------------
              Star-nosed mole  tgaaa-a---------------------------------------------------------------
B D                  Elephant  cggaa-g---------------------------------------------------------------
          Cape elephant shrew  tagag-a---------------------------------------------------------------
B D                      Pika  ======================================================================
B D                    Tenrec  ----------------------------------------------------------------------
               Big brown bat  ----------------------------------------------------------------------
B D           Chinese hamster  ======================================================================
      Lesser Egyptian jerboa  ----------------------------------------------------------------------
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
B D                  Bushbaby  ----------------------------------------------------------------------
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
                 Zebra mbuna  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================
                    Aardvark  ----------------------------------------------------------------------
  D           Green seaturtle  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
            Cape golden mole  ----------------------------------------------------------------------
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Mallard duck  ======================================================================
  D            Painted turtle  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Turkey  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                  Platypus  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D               Rock pigeon  ======================================================================

                        Human  ---------------------gga
                        Chimp  ---------------------gga
                      Gorilla  ---------------------gga
                    Orangutan  ---------------------gga
                       Gibbon  ---------------------gga
                       Rhesus  ---------------------gga
          Crab-eating macaque  ---------------------gga
                       Baboon  ---------------------gga
                 Green monkey  ---------------------gga
                     Marmoset  ---------------------aga
              Squirrel monkey  ---------------------gga
           Chinese tree shrew  ---------------------gag
                     Squirrel  ---------------------gga
                 Prairie vole  ------------------------
               Golden hamster  ------------------------
                        Mouse  ---------------------gga
                          Rat  ---------------------gga
               Naked mole-rat  ---------------------aaa
                   Guinea pig  ---------------------gga
                   Chinchilla  ---------------------gga
             Brush-tailed rat  ---------------------gga
                       Rabbit  ---------------------gga
                       Alpaca  ---------------------gga
               Bactrian camel  ---------------------gga
                      Dolphin  ---------------------gga
                 Killer whale  ---------------------gga
             Tibetan antelope  ---------------------gaa
                          Cow  ---------------------gaa
                        Sheep  ---------------------gaa
                Domestic goat  ---------------------gaa
                        Horse  ---------------------gga
             White rhinoceros  ---------------------aga
                          Cat  ---------------------gga
                          Dog  ---------------------gga
                      Ferret   ---------------------gga
                        Panda  ---------------------gga
               Pacific walrus  ---------------------gga
                 Weddell seal  ---------------------gga
             Black flying-fox  ---------------------gga
                      Megabat  ccaagattctctatgtatcttgga
         David's myotis (bat)  ------------------------
                     Microbat  ------------------------
                     Hedgehog  ---------------------gaa
                        Shrew  ---------------------tat
              Star-nosed mole  ---------------------gga
                     Elephant  ------------------------
          Cape elephant shrew  ------------------------
                         Pika  ========================
                       Tenrec  ------------------------
                Big brown bat  ------------------------
              Chinese hamster  ========================
       Lesser Egyptian jerboa  ------------------------
                    Armadillo  ========================
                      Manatee  ========================
        Burton's mouthbreeder  ------------------------
                 Nile tilapia  ------------------------
          Pundamilia nyererei  ------------------------
                     Bushbaby  ------------------------
                Scarlet macaw  ========================
                       Lizard  ========================
                  Zebra mbuna  ------------------------
                       Parrot  ========================
                     Aardvark  ------------------------
              Green seaturtle  ========================
          Princess of Burundi  ------------------------
     Chinese softshell turtle  ========================
             Cape golden mole  ------------------------
                   Budgerigar  ========================
             Peregrine falcon  ========================
                 Mallard duck  ========================
               Painted turtle  ========================
                  Spotted gar  ------------------------
                   Coelacanth  ========================
              Tasmanian devil  ========================
                      Opossum  ========================
                 Saker falcon  ========================
                       Turkey  ========================
          Collared flycatcher  ========================
                     Platypus  ========================
          Medium ground finch  ========================
       White-throated sparrow  ========================
                      Chicken  ========================
           Tibetan ground jay  ========================
                X. tropicalis  ========================
           American alligator  ========================
                  Zebra finch  ========================
                  Rock pigeon  ========================

Alignment block 19 of 98 in window, 15618972 - 15618972, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  g
B D           Squirrel monkey  a
           Chinese tree shrew  a
B D                  Squirrel  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  g
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  a
B D                   Megabat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  a
          Cape elephant shrew  a
             Cape golden mole  a
B D                      Pika  =
B D                    Tenrec  -
B D                  Microbat  -
               Big brown bat  -
        David's myotis (bat)  -
              Golden hamster  -
B D           Chinese hamster  =
                Prairie vole  -
      Lesser Egyptian jerboa  -
B D                 Armadillo  =
B D                   Manatee  =
B D                     Sheep  -
       Burton's mouthbreeder  -
B D              Nile tilapia  -
         Pundamilia nyererei  -
B D                  Bushbaby  -
  D             Scarlet macaw  =
B D                    Lizard  =
                 Zebra mbuna  -
  D                    Parrot  =
                    Aardvark  -
  D           Green seaturtle  =
         Princess of Burundi  -
  D  Chinese softshell turtle  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Mallard duck  =
  D            Painted turtle  =
                 Spotted gar  -
B D                Coelacanth  =
B D           Tasmanian devil  =
B D                   Opossum  =
  D              Saker falcon  =
B D                    Turkey  =
  D       Collared flycatcher  =
B D                  Platypus  =
B D       Medium ground finch  =
  D    White-throated sparrow  =
B D                   Chicken  =
          Tibetan ground jay  =
B D             X. tropicalis  =
B D        American alligator  =
B D               Zebra finch  =
  D               Rock pigeon  =

Inserts between block 19 and 20 in window
B D                 Hedgehog 1bp
B D                    Shrew 1bp
             Star-nosed mole 1bp

Alignment block 20 of 98 in window, 15618973 - 15618978, 6 bps 
B D                     Human  tacgta
B D                     Chimp  tacgta
B D                   Gorilla  tacgta
B D                 Orangutan  tacgta
B D                    Gibbon  tacgta
B D                    Rhesus  taggta
B D       Crab-eating macaque  taggta
B D                    Baboon  taggta
B D              Green monkey  taggta
B D                  Marmoset  tacata
B D           Squirrel monkey  tacaga
           Chinese tree shrew  tatata
B D                  Squirrel  tacata
                 Prairie vole  ---aca
               Golden hamster  ---aca
B D                     Mouse  tgcaca
B D                       Rat  tgcaca
B D            Naked mole-rat  tacata
B D                Guinea pig  tacata
                   Chinchilla  tacata
             Brush-tailed rat  tacata
B D                    Rabbit  --cata
B D                    Alpaca  tacata
               Bactrian camel  tacata
B D                   Dolphin  tacata
                 Killer whale  tacaca
             Tibetan antelope  t--aga
B D                       Cow  tacaga
B D                     Sheep  ---aga
                Domestic goat  t--aga
B D                     Horse  tacata
B D          White rhinoceros  tatata
B D                       Cat  tataga
B D                       Dog  tgcata
B D                   Ferret   tacata
B D                     Panda  tacaca
               Pacific walrus  tacata
                 Weddell seal  tacata
             Black flying-fox  tagata
B D                   Megabat  tacata
B D                  Hedgehog  aatgta
B D                     Shrew  tgtgta
              Star-nosed mole  ta---a
B D                  Elephant  tatata
          Cape elephant shrew  tatagg
             Cape golden mole  tatata
                     Aardvark  tgtgta
B D                      Pika  ======
B D                    Tenrec  ------
B D                  Microbat  ------
               Big brown bat  ------
        David's myotis (bat)  ------
B D           Chinese hamster  ======
      Lesser Egyptian jerboa  ------
B D                 Armadillo  ======
B D                   Manatee  ======
       Burton's mouthbreeder  ------
B D              Nile tilapia  ------
         Pundamilia nyererei  ------
B D                  Bushbaby  ------
  D             Scarlet macaw  ======
B D                    Lizard  ======
                 Zebra mbuna  ------
  D                    Parrot  ======
  D           Green seaturtle  ======
         Princess of Burundi  ------
  D  Chinese softshell turtle  ======
B D                Budgerigar  ======
  D          Peregrine falcon  ======
  D              Mallard duck  ======
  D            Painted turtle  ======
                 Spotted gar  ------
B D                Coelacanth  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
  D              Saker falcon  ======
B D                    Turkey  ======
  D       Collared flycatcher  ======
B D                  Platypus  ======
B D       Medium ground finch  ======
  D    White-throated sparrow  ======
B D                   Chicken  ======
          Tibetan ground jay  ======
B D             X. tropicalis  ======
B D        American alligator  ======
B D               Zebra finch  ======
  D               Rock pigeon  ======

Alignment block 21 of 98 in window, 15618979 - 15618979, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                 Orangutan  -g
B D                    Gibbon  -g
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -g
B D           Squirrel monkey  -g
           Chinese tree shrew  -g
B D                  Squirrel  -g
                 Prairie vole  -g
               Golden hamster  -c
B D                     Mouse  -a
B D                       Rat  -g
B D            Naked mole-rat  -a
B D                Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  -a
B D                    Rabbit  -g
B D                    Alpaca  -g
               Bactrian camel  -g
B D                   Dolphin  -g
                 Killer whale  -g
             Tibetan antelope  -g
B D                       Cow  -g
B D                     Sheep  -g
                Domestic goat  -g
B D                     Horse  -g
B D          White rhinoceros  -g
B D                       Cat  -g
B D                       Dog  -c
B D                   Ferret   -g
B D                     Panda  -g
               Pacific walrus  -g
                 Weddell seal  -g
             Black flying-fox  -g
B D                   Megabat  -g
                Big brown bat  -g
         David's myotis (bat)  -g
B D                  Microbat  -g
B D                  Hedgehog  -g
B D                     Shrew  -c
              Star-nosed mole  -c
B D                  Elephant  t-
          Cape elephant shrew  t-
             Cape golden mole  t-
                     Aardvark  t-
B D                      Pika  ==
B D                    Tenrec  --
B D           Chinese hamster  ==
      Lesser Egyptian jerboa  --
B D                 Armadillo  ==
B D                   Manatee  ==
       Burton's mouthbreeder  --
B D              Nile tilapia  --
         Pundamilia nyererei  --
B D                  Bushbaby  --
  D             Scarlet macaw  ==
B D                    Lizard  ==
                 Zebra mbuna  --
  D                    Parrot  ==
  D           Green seaturtle  ==
         Princess of Burundi  --
  D  Chinese softshell turtle  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Mallard duck  ==
  D            Painted turtle  ==
                 Spotted gar  --
B D                Coelacanth  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
  D              Saker falcon  ==
B D                    Turkey  ==
  D       Collared flycatcher  ==
B D                  Platypus  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D             X. tropicalis  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D               Rock pigeon  ==

Inserts between block 21 and 22 in window
            Black flying-fox 2bp
B D                  Megabat 2bp
               Big brown bat 2bp
B D                    Shrew 6bp
             Star-nosed mole 4bp

Alignment block 22 of 98 in window, 15618980 - 15618989, 10 bps 
B D                     Human  atttatcagg
B D                     Chimp  atttatcagg
B D                   Gorilla  atttatcagg
B D                 Orangutan  atatatcagg
B D                    Gibbon  atatatcagg
B D                    Rhesus  atatatcagg
B D       Crab-eating macaque  atatatcagg
B D                    Baboon  atatatcagg
B D              Green monkey  atatatcagg
B D                  Marmoset  atatataagg
B D           Squirrel monkey  atatataagg
           Chinese tree shrew  gtataaaaga
B D                  Squirrel  at-----gag
                 Prairie vole  at-----cgg
               Golden hamster  at-----agg
B D                     Mouse  at-----agg
B D                       Rat  ct-----agg
B D            Naked mole-rat  at-----agg
B D                Guinea pig  at-----agg
                   Chinchilla  at-----agg
             Brush-tailed rat  at-----aga
B D                    Rabbit  ata----aag
B D                    Alpaca  atatgaaagg
               Bactrian camel  atatgaaagg
B D                   Dolphin  atatttaagg
                 Killer whale  atatttaagg
             Tibetan antelope  atatgtaagg
B D                       Cow  atatgtaagg
B D                     Sheep  atatgtaagg
                Domestic goat  atatgtaagg
B D                     Horse  atgtgtaagg
B D          White rhinoceros  acatgcaagg
B D                       Cat  atatgtaagg
B D                       Dog  atatgtaaag
B D                   Ferret   atatgtgagg
B D                     Panda  atatgtgagg
               Pacific walrus  atatgtgagg
                 Weddell seal  atatgtgagg
             Black flying-fox  atatgtaagg
B D                   Megabat  atacgtaagg
                Big brown bat  atatctaagg
         David's myotis (bat)  atatgtaagg
B D                  Microbat  atatgtaagg
B D                  Hedgehog  atctctaaag
B D                     Shrew  atatgta---
              Star-nosed mole  atatgtaagg
B D                  Elephant  acatataaag
          Cape elephant shrew  ggaggtgtgt
             Cape golden mole  acctgtgtgt
                     Aardvark  gtatatgcat
B D                      Pika  ==========
B D                    Tenrec  ----------
B D           Chinese hamster  ==========
      Lesser Egyptian jerboa  ----------
B D                 Armadillo  ==========
B D                   Manatee  ==========
       Burton's mouthbreeder  ----------
B D              Nile tilapia  ----------
         Pundamilia nyererei  ----------
B D                  Bushbaby  ----------
  D             Scarlet macaw  ==========
B D                    Lizard  ==========
                 Zebra mbuna  ----------
  D                    Parrot  ==========
  D           Green seaturtle  ==========
         Princess of Burundi  ----------
  D  Chinese softshell turtle  ==========
B D                Budgerigar  ==========
  D          Peregrine falcon  ==========
  D              Mallard duck  ==========
  D            Painted turtle  ==========
                 Spotted gar  ----------
B D                Coelacanth  ==========
B D           Tasmanian devil  ==========
B D                   Opossum  ==========
  D              Saker falcon  ==========
B D                    Turkey  ==========
  D       Collared flycatcher  ==========
B D                  Platypus  ==========
B D       Medium ground finch  ==========
  D    White-throated sparrow  ==========
B D                   Chicken  ==========
          Tibetan ground jay  ==========
B D             X. tropicalis  ==========
B D        American alligator  ==========
B D               Zebra finch  ==========
  D               Rock pigeon  ==========

Inserts between block 22 and 23 in window
B D                 Elephant 115bp
         Cape elephant shrew 2bp

Alignment block 23 of 98 in window, 15618990 - 15619007, 18 bps 
B D                     Human  tatctatttgaattctta
B D                     Chimp  tatctatttgaattctta
B D                   Gorilla  tatctatttgaattctta
B D                 Orangutan  tatctatttgaattctta
B D                    Gibbon  tatctattttaattctta
B D                    Rhesus  tatctatttgaattctta
B D       Crab-eating macaque  tatctatttgaattctta
B D                    Baboon  tatctatttgaattctta
B D              Green monkey  tatctatttgaattctta
B D                  Marmoset  tatctatttgaattctca
B D           Squirrel monkey  tgtctatttgaattctca
           Chinese tree shrew  tgtctatttaaaatttca
B D                  Squirrel  tatctatttggtttctca
                 Prairie vole  aatctatttcgcttctca
               Golden hamster  aatctatttcacttctca
B D                     Mouse  aacctacctcatttctta
B D                       Rat  aatctatttcacttctta
B D            Naked mole-rat  tacccatttgaattctca
B D                Guinea pig  tatctatttgaattctca
                   Chinchilla  tatctatttgaattctca
             Brush-tailed rat  tatctattttaattctca
B D                    Rabbit  tacctatttgaattttca
B D                    Alpaca  catctgtttggattttca
               Bactrian camel  catctgtttggattttca
B D                   Dolphin  catctatctgcacttgca
                 Killer whale  catctatctggactcgca
             Tibetan antelope  catctatttggattctca
B D                       Cow  cttctatttggattctca
B D                     Sheep  catctatttggattctca
                Domestic goat  catctatttggattctca
B D                     Horse  catgtatttggattctcg
B D          White rhinoceros  cttctatttggattctca
B D                       Cat  catctatttggattctct
B D                       Dog  catc-atttggattctca
B D                   Ferret   catctattgggattctca
B D                     Panda  tatctatttggattctca
               Pacific walrus  catctatttggattctca
                 Weddell seal  catctatttggattctca
             Black flying-fox  cacttatttggattctca
B D                   Megabat  cacttatctggattctca
                Big brown bat  cacctatttggattccca
         David's myotis (bat)  cacctatttggattccca
B D                  Microbat  cacctatttggattccca
B D                  Hedgehog  catgtctttggattttca
B D                     Shrew  -attcccaaggcac----
              Star-nosed mole  catctttttggcac--aa
          Cape elephant shrew  taactatttgaatttcta
             Cape golden mole  gatctactttaatttcca
B D                    Tenrec  -----agaattatttcca
                     Aardvark  tatctaactgaa-ttcca
B D                      Pika  ==================
B D           Chinese hamster  ==================
      Lesser Egyptian jerboa  ------------------
B D                 Armadillo  ==================
B D                  Elephant  ==================
B D                   Manatee  ==================
       Burton's mouthbreeder  ------------------
B D              Nile tilapia  ------------------
         Pundamilia nyererei  ------------------
B D                  Bushbaby  ------------------
  D             Scarlet macaw  ==================
B D                    Lizard  ==================
                 Zebra mbuna  ------------------
  D                    Parrot  ==================
  D           Green seaturtle  ==================
         Princess of Burundi  ------------------
  D  Chinese softshell turtle  ==================
B D                Budgerigar  ==================
  D          Peregrine falcon  ==================
  D              Mallard duck  ==================
  D            Painted turtle  ==================
                 Spotted gar  ------------------
B D                Coelacanth  ==================
B D           Tasmanian devil  ==================
B D                   Opossum  ==================
  D              Saker falcon  ==================
B D                    Turkey  ==================
  D       Collared flycatcher  ==================
B D                  Platypus  ==================
B D       Medium ground finch  ==================
  D    White-throated sparrow  ==================
B D                   Chicken  ==================
          Tibetan ground jay  ==================
B D             X. tropicalis  ==================
B D        American alligator  ==================
B D               Zebra finch  ==================
  D               Rock pigeon  ==================

Alignment block 24 of 98 in window, 15619008 - 15619010, 3 bps 
B D                     Human  gca
B D                     Chimp  gca
B D                   Gorilla  gca
B D                 Orangutan  gca
B D                    Gibbon  gca
B D                    Rhesus  gca
B D       Crab-eating macaque  gca
B D                    Baboon  gca
B D              Green monkey  gca
B D                  Marmoset  gca
B D           Squirrel monkey  gca
           Chinese tree shrew  aga
B D                  Squirrel  aca
                 Prairie vole  --a
               Golden hamster  --a
B D                     Mouse  --a
B D                       Rat  --a
B D            Naked mole-rat  --a
B D                Guinea pig  --a
                   Chinchilla  --g
             Brush-tailed rat  --a
B D                    Rabbit  --a
B D                    Alpaca  aca
               Bactrian camel  aca
B D                   Dolphin  aca
                 Killer whale  aca
             Tibetan antelope  aca
B D                       Cow  aca
B D                     Sheep  aca
                Domestic goat  aca
B D                     Horse  aca
B D          White rhinoceros  aca
B D                       Cat  gca
B D                       Dog  aca
B D                   Ferret   aca
B D                     Panda  aca
               Pacific walrus  aca
                 Weddell seal  aca
             Black flying-fox  ata
B D                   Megabat  ata
                Big brown bat  aga
         David's myotis (bat)  aca
B D                  Microbat  aca
B D                  Hedgehog  aca
              Star-nosed mole  aca
          Cape elephant shrew  ata
             Cape golden mole  gca
B D                    Tenrec  aca
                     Aardvark  aca
B D                      Pika  ===
B D                     Shrew  ---
B D           Chinese hamster  ===
      Lesser Egyptian jerboa  ---
B D                 Armadillo  ===
B D                  Elephant  ===
B D                   Manatee  ===
       Burton's mouthbreeder  ---
B D              Nile tilapia  ---
         Pundamilia nyererei  ---
B D                  Bushbaby  ---
  D             Scarlet macaw  ===
B D                    Lizard  ===
                 Zebra mbuna  ---
  D                    Parrot  ===
  D           Green seaturtle  ===
         Princess of Burundi  ---
  D  Chinese softshell turtle  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Mallard duck  ===
  D            Painted turtle  ===
                 Spotted gar  ---
B D                Coelacanth  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
  D              Saker falcon  ===
B D                    Turkey  ===
  D       Collared flycatcher  ===
B D                  Platypus  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D             X. tropicalis  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D               Rock pigeon  ===

Alignment block 25 of 98 in window, 15619011 - 15619048, 38 bps 
B D                     Human  c--aaa----gataaaaagaactat--gaaa-ctatg-aa--aaaaactg
B D                     Chimp  c--aaa----gataaaaagaactat--gaaa-ctatg-aa--aaaaactg
B D                   Gorilla  c--aaa----gataaaaagaactat--gaaa-ctatg-aa--aaaaactg
B D                 Orangutan  c--aaa----gataaaaagaactat--gaaa-ctatg-aa--aaaaactg
B D                    Gibbon  c--aaa----gataaaaagaactat--gaaa-ctatg-aa--aaaaactg
B D                    Rhesus  c--aaa----gataaaaagaactat--gaaa-ctatgaaa--aaaaactg
B D       Crab-eating macaque  c--aaa----gataaaaagaactat--gaaa-ctatgaaa--aaaaactg
B D                    Baboon  c--aaa----gataaaaagaactat--gaaa-ctatgaaa--aaaaactg
B D              Green monkey  c--aaa----gataaaaagaactat--gaaa-ctatg--a--aaaaactg
B D                  Marmoset  c--aaa----gataaaatgaactat--gaaa-ctatg-ag--aaaaactg
B D           Squirrel monkey  c--aaa----gataaaaaggactat--gaaa-ctacgaaa--aaaaactg
           Chinese tree shrew  c--aaa----gaaataaaaaactaa--aaaacccctgagg--aaaaactg
B D                  Squirrel  c--aga----aaaagaaagaacttt--gaaa-ctg---ag---aaaactg
       Lesser Egyptian jerboa  -------------aaagagaactat--gaga-cgcta-ag--aaaaactg
                 Prairie vole  t--gct----tgcaaaaaaaattac--aaaa-ctc---ag--aaaaactg
B D           Chinese hamster  -----------gcaaaaaaattaac--aaaa-ctc---ag--aaaaattg
               Golden hamster  t--gca----tgcaaaaaaaatcgc--aaaa-ctc---ag--aaaaactg
B D                     Mouse  t--gca----tgcaaaaa---ttac--acaa-ctc---ag--aaaaactg
B D                       Rat  t--gca----ggcaaaaa---ttat--gcaa-ctc---ag--aaaaagtg
B D            Naked mole-rat  t-agaa----agaataaagaactat--gaga-gtggaaaa--aaaaactg
B D                Guinea pig  taagaa----agaataaagaactat--gaga-gtg---ag--aaaaactg
                   Chinchilla  t-agaa----agaataaaaaactat--gaga-gtg---ag--aaaaactg
             Brush-tailed rat  t-agaa----agaagaaagaactat--caga-gta---ag--aaaaactg
B D                    Rabbit  --caaa----gcaaaaaagaactat--gaaa-cacca-ag--aaaaatga
B D                    Alpaca  --caaa----gtaaaaaagaactac--aaaa-ctctg-ag--aaaaattg
               Bactrian camel  --caaa----gtaaaaaagaactac--aaaa-ctctg-ag--aaaaattg
B D                   Dolphin  --caaa----gtaaaaatgaactat--aaaa-ctatg-ag--aaaaattg
                 Killer whale  --caaa----gtaaaaatgaactat--aaaa-ctatg-ag--aaaaattg
             Tibetan antelope  --caaa-----taaaaaagtactatacaaaa-ctctg-tg--aaaaattg
B D                       Cow  --ca---------aaaaattactatacaaaa-ctctg-cg--aaaaattg
B D                     Sheep  --caaa-----ttaaaaagtactatacaaaa-ctctg-cg--aaaaattg
                Domestic goat  --caaa-----taaaaaagtactatacaaaa-ctctg-cg--aaaaattg
B D                     Horse  --caaa----ggaaaaaagaactag--aaaa-ctctg-tg--aaaaactg
B D          White rhinoceros  --caaa----gaaaaaaagaactac--aaaa-ctctg--g--aaaaactg
B D                       Cat  --caaa----gaaag----aactat--gcaa-ctctg-ag--aaaaactt
B D                       Dog  --caaa----gaaag----aacctt--gaaa-cc----------------
B D                   Ferret   --caaa----gagagaacgaactat--gaaa-ct-----gagaaaaactg
B D                     Panda  --aaaa----gaaagaaaaaactat--gaaa-ctctg-ag-aaaaaactg
               Pacific walrus  --caaa----gaaag----aactat--gaaa-ctctg-agaaaaaaactg
                 Weddell seal  --caaa----gaaag----aactat--gaaa-ctctg-agaaaaaaactg
             Black flying-fox  --caaa----gaataaaagaactac--aaaa-ctatg-ag--aaagacta
B D                   Megabat  --caaa----gaataaaagaactac--aaaa-ctatg-ag--aaagacta
                Big brown bat  --caaa----gaaaaaaagaagtac--gaaa-ctatg-ag--gaaaactg
         David's myotis (bat)  --caaa----gcaaaaaagaactat--gaaa-ctatg-ag--gaaaactg
B D                  Microbat  --caaa----gcaaaaaagaactac--gaaa-ctatg-ag--gaaaactg
B D                  Hedgehog  --caaagtggggacaaaaggactac--aaaa-ccgag-ga--aacaacta
B D                     Shrew  -----------------tgaattct--agtt-c-----------------
              Star-nosed mole  --taaa--gaaaaaaaaagagcttc--agaa-c-----------------
          Cape elephant shrew  --caaa----gaaa-------tgac--g--------g-ag--aaaaactg
             Cape golden mole  --caaa----gaaatgaagaatgac--aaaa-ctgtg-at--aaaaatga
B D                    Tenrec  --caaa----gaaa---------ac--aaaa-ctctg-ag--aaaagctg
                     Aardvark  --caaa----gaaataaagaatgac--aaaa-ctcag-aa--aaa-----
B D                      Pika  ==================================================
B D                 Armadillo  ==================================================
B D                  Elephant  ==================================================
B D                   Manatee  ==================================================
       Burton's mouthbreeder  --------------------------------------------------
B D              Nile tilapia  --------------------------------------------------
         Pundamilia nyererei  --------------------------------------------------
B D                  Bushbaby  --------------------------------------------------
  D             Scarlet macaw  ==================================================
B D                    Lizard  ==================================================
                 Zebra mbuna  --------------------------------------------------
  D                    Parrot  ==================================================
  D           Green seaturtle  ==================================================
         Princess of Burundi  --------------------------------------------------
  D  Chinese softshell turtle  ==================================================
B D                Budgerigar  ==================================================
  D          Peregrine falcon  ==================================================
  D              Mallard duck  ==================================================
  D            Painted turtle  ==================================================
                 Spotted gar  --------------------------------------------------
B D                Coelacanth  ==================================================
B D           Tasmanian devil  ==================================================
B D                   Opossum  ==================================================
  D              Saker falcon  ==================================================
B D                    Turkey  ==================================================
  D       Collared flycatcher  ==================================================
B D                  Platypus  ==================================================
B D       Medium ground finch  ==================================================
  D    White-throated sparrow  ==================================================
B D                   Chicken  ==================================================
          Tibetan ground jay  ==================================================
B D             X. tropicalis  ==================================================
B D        American alligator  ==================================================
B D               Zebra finch  ==================================================
  D               Rock pigeon  ==================================================

Alignment block 26 of 98 in window, 15619049 - 15619106, 58 bps 
B D                     Human  ccaag-tacattgat-ttctaacccccc----------acaataccctcaacttcccacctctctcccca
B D                     Chimp  ccaag-tacattgat-ttctaacccccc----------acaataccctcaacttcccacctctctcccca
B D                   Gorilla  ccaag-tacattgat-ttctaagccccc----------acaataccctcaacttcccacctctctcccca
B D                 Orangutan  ccaag-tacattgat-ttctaacccccc----------acaataccctcaacttcccacctctttcccca
B D                    Gibbon  ccagg-tacgttgat-ttctaacccctc----------acaataccctcaacttcccacctctctcccca
B D                    Rhesus  ccaag-tacattgat-ttctaacatccc----------acaacaccctcaacttcccacctctctcccca
B D       Crab-eating macaque  ccaag-tacattgat-ttctaacatccc----------acaacaccctcaacttcccacctctctcccca
B D                    Baboon  ccaag-tacattgat-ttctaacatccc----------acaacaccctcaacttcccacctctctcccca
B D              Green monkey  ccaag-tacattgat-ttctaacccccc----------acaacaccctcaacttcccacctctctcccca
B D                  Marmoset  ccatg-tacattgat-atctaac-tccc----------acaatatgctcaacttcccacctgtttcccca
B D           Squirrel monkey  ccatg-tacattgat-ttctaac-cccc----------acaatatgctcaacttcccacctctttcccca
B D                  Bushbaby  ccaac-tacactgat-ttctcac--ccc----------ac-ataccctcaa--ttccaccccttccc---
           Chinese tree shrew  ccaag-gacactgatatttttagccacc----------acaacaccgtcagttccccacac---------
B D                  Squirrel  caaag-tatacagat-ttctagcccttc----------gtaacaccttcaattcctcagcc---gccccc
       Lesser Egyptian jerboa  ccaag-tccactgat-ttctaggcc-tc----------ataacacccttaatcctcc-cct---acccca
                 Prairie vole  ccaa--tac----at-ttctggcccttc----------ataagaccttcaattctcctcct---accctg
B D           Chinese hamster  ccaa--tacaatgat-tcctggcccttc----------at---------aatcctcctccc---acc--a
               Golden hamster  tcaa--tgcaatgat-ttctggcccttc----------ataaggccttcaatccccctccc---accttg
B D                     Mouse  ccaa--tacaatgat-ttctgacccgtc----------acaagaccttcaagcctccacct---gccctg
B D                       Rat  ccat--tgtgatgat-ttctggcccttc----------gcaagaccgtcaagcctccacct---gccctg
B D            Naked mole-rat  caaat-tacactgat-ttctagcccctc----------acaacacctttaatgccatac------tctta
B D                Guinea pig  gcaag-tacactgat-ttctagcccctc----------acaacacctttaa-gtcacag------tctta
                   Chinchilla  tcaaa-tttgctgat-ttctagcccctc----------ataacacctttaatgccacac------tctta
             Brush-tailed rat  ccaag-taagctgat-ttctagcccctt----------acaacacctttaatgctacac------tatca
B D                    Rabbit  ccaag-gacaccaat-ttttagatact-----------gtaacctcctcaatcctg---------ccctg
B D                    Alpaca  ccaag-tatactgat-ttccagc-ccct----------a-cacactcacaat-------------tctct
               Bactrian camel  ccaag-tatactgat-ttccagc-ccct----------a-cacactcacaat-------------tctct
B D                   Dolphin  ccagg-taccctgat-ttctagc-cccc------------cacaccctcaat-------------tctcc
                 Killer whale  ccacg-taccctgat-ttctagc-cccc------------cacaccctcaat-------------tctcc
             Tibetan antelope  ctagg-taccccaat-ttctagc-cccc------------cacaccctcaat-------------tctcc
B D                       Cow  ccagg-taccccaat-ttctagc-cccc------------cacaccctcaat-------------tctcc
B D                     Sheep  ctagg-taccccaat-ttctagc-cccc------------cacaccctcaat-------------tctcc
                Domestic goat  ctagg-taccccaat-ttctagc-cccc------------cacacccttaat-------------tctcc
B D                     Horse  ctaag-tacactggt-ttccaga-cccc----------acaacaccctcaa--------------ttctt
B D          White rhinoceros  ccaag-tacactaat-ttctagc-ccac----------acaacatgctcaa--------------tttta
B D                       Cat  ccaag-tacgctggt-ttctagc-cccc----------aaaacaccctca---------------ttcct
B D                       Dog  ----------ctgtt-ttctagc-cccc----------acaacacccttga--------------ttccc
B D                   Ferret   cccag-gacactggt-ttctagc-ccct----------acaacacccttga--------------ttccc
B D                     Panda  ccaag-tgcactggt-ttctagc-cccc----------acaacaccctcaat-------------ttccc
               Pacific walrus  ccaag-tacactggt-ttctagc-cccc----------acaacaccctcaa--------------ttccc
                 Weddell seal  ccaag-tacactggt-ttctagc-cccc----------acaacaccctcga--------------ttccc
             Black flying-fox  cgaag-tacactgat-ttctagc-ccac----------acaacaccctcaattcctgctct----ccccg
B D                   Megabat  caagg-tacactgat-ttctagc-ccac----------acaacaccctcaattcctgctct----ccccg
                Big brown bat  ccaagttactctaat-ttctagc-ccct----------acaata-cctcaatccc----------ctccc
         David's myotis (bat)  ccaaa-tactatgat-ttctagc-cctc----------acaaca-cctcaatccc----------cttcc
B D                  Microbat  ccaaa-tactctgat-ttctagc-cccc----------acaaca-cctcagtccc----------ctccc
B D                  Hedgehog  ccaag-tacacaggt-----------tc----------ctagctctcat-ag-------------caccc
B D                     Shrew  --------------------------tc----------atgacatcctcaat-------------tatct
              Star-nosed mole  ---------------------------c----------gtaacatcctc-at-------------ccccc
          Cape elephant shrew  ccaag-tctatggct-ttctagc-cccacaggatgcct--------------------------------
             Cape golden mole  ccaat-taggctgct-ttctagc-cccc------------------------------------------
B D                    Tenrec  ccagg-tacactact-ttgcagc-tcca------------------------------------------
                     Aardvark  ----------ctgct-ttgtatc-cct-------------------------------------------
B D                      Pika  ======================================================================
B D                 Armadillo  ======================================================================
B D                  Elephant  ======================================================================
B D                   Manatee  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
                 Zebra mbuna  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================
  D           Green seaturtle  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Mallard duck  ======================================================================
  D            Painted turtle  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Turkey  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                  Platypus  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D               Rock pigeon  ======================================================================

Alignment block 27 of 98 in window, 15619107 - 15619160, 54 bps 
B D                     Human  c--aa-a---------------ag---gact-------------cta---------gcataatccttggg
B D                     Chimp  c--aa-a---------------ag---gact-------------cta---------gcataatccttggg
B D                   Gorilla  c--aa-a---------------ag---gact-------------gta---------gcataatccttggg
B D                 Orangutan  c--aa-a---------------ag---gact-------------cta---------gcataatccttggg
B D                    Gibbon  c--aa-a---------------ag---gact-------------cta---------gcataatccttggg
B D                    Rhesus  c--aa-a---------------ag---gact-------------cca---------gcataatccttggg
B D       Crab-eating macaque  c--aa-a---------------ag---gact-------------cca---------gcataatccttggg
B D                    Baboon  c--aa-a---------------ag---gact-------------cca---------gcataatccttggg
B D              Green monkey  c--aa-a---------------ag---gact-------------cta---------gcataatccttggg
B D                  Marmoset  c--aa-a---------------ag---gact-------------cta---------gcataatgcttggg
B D           Squirrel monkey  c--aa-a---------------ag---gact-------------cta---------gcataatgcttggg
B D                  Bushbaby  ----a-a---------------aa---gact-------------gta---------atatcatcctctaa
           Chinese tree shrew  ----a-a---------------ag---gatt-------------cca---------gtataatccgtggg
B D                  Squirrel  a--aa----------------------aacc-------------ttg---------atataattctcaag
       Lesser Egyptian jerboa  c--aa-a---------------gaaagaactccggttgtttggcata---------ttatggtctt----
                 Prairie vole  c--ag-a---------------aacaaaact-------------gtg---------ttctagtcctcaaa
B D           Chinese hamster  c--agtt---------------agcaaaact-------------gtg---------ttctattcctcaac
               Golden hamster  c--ag-a---------------aacaaaact-------------gtg---------ttctattcctcaac
B D                     Mouse  c--ag-a---------------aactaaact-------------ctg---------ttctattcctcaac
B D                       Rat  t--ag-a---------------aacaaaact-------------gtc---------ttctagtcctcaac
B D            Naked mole-rat  c--aa-a---------------g----aact-------------ata---------ttttaatcctcagg
B D                Guinea pig  c--aa-a---------------g----aact-------------gta---------ttgtaaccctcggg
                   Chinchilla  c--aa-a--------------------agct-------------cta---------ttgtaatcctcggg
             Brush-tailed rat  c--aa-a---------------g----aact-------------cta---------ttgtaatcctcagg
B D                    Rabbit  a--ag-g--------------------gact-------------ctg---------gtataatcctcagg
B D                    Alpaca  c--cg-a---------------ag---gatt-------------cct---------g-ataatccttggg
               Bactrian camel  c--cg-a---------------ag---gatt-------------cct---------g-ataatccttggg
B D                   Dolphin  c-cca-a---------------ag---gact-------------cct---------gtataatccttcgg
                 Killer whale  c-cca-a---------------ag---gact-------------cct---------gtataatccttggg
             Tibetan antelope  t--aa-a---------------ga---gaca-------------cct---------gtataatcctttgg
B D                       Cow  t-----c---------------ga---gaca-------------cct---------gtataatcctttgg
B D                     Sheep  t--ga-a---------------ga---gaca-------------cct---------gtataatcctttgg
                Domestic goat  t--ga-a---------------ga---gaca-------------cct---------gtataatcatttgg
B D                     Horse  c-tca-a---------------ag---gact-------------cca---------gcataatcgctggg
B D          White rhinoceros  cacca-a---------------ag---gact-------------ctg---------gtataatccttgag
B D                       Cat  t--ca-a---------------ag---gact-------------cca---------gtataatccttggg
B D                       Dog  c--ca-a---------------ag---gact-------------cca---------gtattatccttggg
B D                   Ferret   c--ca-a---------------ag---ggct-------------cca---------gtattatctttgct
B D                     Panda  c--ca-a---------------ag---gact-------------cca---------gtattatctctggg
               Pacific walrus  g--ca-a---------------gg---ggct-------------cca---------gtattatctttggg
                 Weddell seal  c--ca-a---------------ag---ggct-------------cca---------gtattatcttcagg
             Black flying-fox  c--cg-a---------------ag---gagt-------------ctg---------gtataatccttgga
B D                   Megabat  c--ca-a---------------ag---gagt-------------ctg---------gtataatccttgga
                Big brown bat  c--tc-a---------------ag---gact-------------ctg---------gtaaaatccttggg
         David's myotis (bat)  c--cg-a---------------ag---gact-------------ctg---------gtataatccttggg
B D                  Microbat  c--cg-a---------------ag---gact-------------ctg---------gtataatccttggg
B D                  Hedgehog  a--ta-g---------------aa---catt-------------ctg---------gtagaatcttg--g
B D                     Shrew  a--ca-g---------------ag---ggtt-------------ctg----------gacaatccttggg
              Star-nosed mole  c--ca-accccaaccccaccccag---gact-------------ctg---------ctataatcctt---
B D                  Elephant  --------------------------------------------caaaagaagcctgtataatcttctgg
          Cape elephant shrew  --------------------------------------------------------ggataattttctgg
             Cape golden mole  ----------------------------------------------aaagatgtctgtatcatcctctag
B D                    Tenrec  ----------------------------------------------aaggacacctgtttaatcttctgg
                     Aardvark  --------------------------------------------------------gtataaacttctgg
B D                      Pika  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
                 Zebra mbuna  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================
  D           Green seaturtle  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Mallard duck  ======================================================================
  D            Painted turtle  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Turkey  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                  Platypus  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D               Rock pigeon  ======================================================================

                        Human  gaggtttt-g-taaat-tgtgttttgt--t---tg
                        Chimp  gaggtttt-g-taaat-tgtgttttgt--t---tg
                      Gorilla  gaggtttt-g-taaat-tgtgttttat--t---tg
                    Orangutan  gaggtttt-g-taaat-tgtgttttgt--t---tg
                       Gibbon  gaagtttt-g-taaat-tgtgttttgt--t---tg
                       Rhesus  gaggtttt-g-taaat-tgtgttttgt--t---ta
          Crab-eating macaque  gaggtttt-g-taaat-tgtgttttgt--t---ta
                       Baboon  gaggtttt-g-taaat-tgtgttttgt--t---ta
                 Green monkey  gaggtttt-g-taaat-tgtgttttgt--t---ta
                     Marmoset  gaggtttt-g-taaat-tgtgttttgt--t---tg
              Squirrel monkey  gaggtttt-g-taaat-tgtgttttgt--t---tg
                     Bushbaby  ggaatttt-g-tagat-ggcattttat--t---tg
           Chinese tree shrew  gaggtttt-g-taaat-gacacatcat--t---tg
                     Squirrel  gaggtttc-a-taagt-ggcattttat--t---tg
       Lesser Egyptian jerboa  ---gtctt-g-ttttg-agtctt---t--g---ta
                 Prairie vole  aatgtttc-c-caagc-actgtttaat--g---ga
              Chinese hamster  aaagtttc-c-tatgc-agtatttaat--g---ga
               Golden hamster  aaagtttc-c-tatgc-agtatttaat--g---ga
                        Mouse  caagtttc-c-gagga-agtatttagt--g---ga
                          Rat  caagtttc-c-tgtga-catatttagt--g---ga
               Naked mole-rat  gaggttcc-a-tacca-gccattttat--t---tg
                   Guinea pig  gaggtttc-a-tagcc-gacatt-tat--t---tg
                   Chinchilla  caggtttc-a-taaca-gatgttgtat--t---tg
             Brush-tailed rat  aaggtttc-a-taaca-gatattgtat--t---tg
                       Rabbit  gaggtttt-g-taaat-ggcatttatt--t---g-
                       Alpaca  gaagtttt-c-taggt-ggctttttt-------tc
               Bactrian camel  gaagtttt-c-taggt-ggctttttt-------tc
                      Dolphin  gaggtttt-a-taaat-ggcttccccc--cccacc
                 Killer whale  gaggtttt-a-taaat-ggcttttccc------cc
             Tibetan antelope  gaggtttt-c-taaat-ggcttttttc--c---cc
                          Cow  gaggtttt-c-taaat-ggcttttttc--c---cc
                        Sheep  gaggtttt-c-taaat-ggatttttta--c---cc
                Domestic goat  gaggtttt-c-taaat-ggcttttttc--c---cc
                        Horse  gaggtttt-c-taagt-ggcgttttat--t---tg
             White rhinoceros  gaggtttt-c-taaat-ggcatttaat--t---tg
                          Cat  gaggtttt-g-taaat-ggcattttat--t---tg
                          Dog  gaggtttt-g-taaatgggcattttat--t---tg
                      Ferret   gaggtttc-a-tcaat-agcattttat--t---tg
                        Panda  gaggtttt-g-tcaat-ggcattttat--t---tg
               Pacific walrus  agggtttt-g-tcaat-ggcattttat--t---tg
                 Weddell seal  ggggtttt-g-tcaaa-ggcattttat--t---tg
             Black flying-fox  gagatttt-g-taagt-agcattttat--t---tg
                      Megabat  gagatttt-g-taaat-agcattttat--t---tg
                Big brown bat  gaggtttt-g-taaat-gacattttat--t---tg
         David's myotis (bat)  gaggtttt-g-taaat-gacattttgc--t---tg
                     Microbat  gaggtttt-g-taaat-gacattttgt--t---tg
                     Hedgehog  gaggtttt-a-taaat-ggcacttttttgt---tg
                        Shrew  gagatttt-a-taaat-ggcatcatat--t---tg
              Star-nosed mole  gcgatttc-a-taaaa-ggcattttat--t---tg
                     Elephant  aaagtttt-g-taaat-ggcattttat--t-----
          Cape elephant shrew  ggagttttca-taaat-ggccttttat--t---tc
             Cape golden mole  gaagtttt-gttcagt-tgcatttgat--t---tg
                       Tenrec  aaagtttt-g-tcatt-ggaatgtgat--t---tg
                     Aardvark  gaagtttt-g-taaat-tgcattttat--t---tg
                         Pika  ===================================
                    Armadillo  ===================================
                      Manatee  ===================================
        Burton's mouthbreeder  -----------------------------------
                 Nile tilapia  -----------------------------------
          Pundamilia nyererei  -----------------------------------
                Scarlet macaw  ===================================
                       Lizard  ===================================
                  Zebra mbuna  -----------------------------------
                       Parrot  ===================================
              Green seaturtle  ===================================
          Princess of Burundi  -----------------------------------
     Chinese softshell turtle  ===================================
                   Budgerigar  ===================================
             Peregrine falcon  ===================================
                 Mallard duck  ===================================
               Painted turtle  ===================================
                  Spotted gar  -----------------------------------
                   Coelacanth  ===================================
              Tasmanian devil  ===================================
                      Opossum  ===================================
                 Saker falcon  ===================================
                       Turkey  ===================================
          Collared flycatcher  ===================================
                     Platypus  ===================================
          Medium ground finch  ===================================
       White-throated sparrow  ===================================
                      Chicken  ===================================
           Tibetan ground jay  ===================================
                X. tropicalis  ===================================
           American alligator  ===================================
                  Zebra finch  ===================================
                  Rock pigeon  ===================================

Inserts between block 27 and 28 in window
            Brush-tailed rat 899bp

Alignment block 28 of 98 in window, 15619161 - 15619251, 91 bps 
B D                     Human  ctg-atctattgaaatgtgctgtgtc-aaagcaatgcgttcaaaactgt-aacct--gaggctt---tct
B D                     Chimp  ctg-atctattgaaatgtgctgtgtc-aaagcaatgcgttcaaaactgt-aacct--gaggctt---tct
B D                   Gorilla  ctg-atctattgaaatgtgctgtgtc-aaagcaatgcgttcaaaactgt-aacct--gaggctt---tct
B D                 Orangutan  ctg-atctattgaaatgtgctgtgtc-aaagcaatgcgttcaaaactgt-aacct--gaggctt---tct
B D                    Gibbon  ctgtatctattgaaatgtgctgtgtc-aaagcaacgcattcaaaactgt-aacct--gaggctt---tct
B D                    Rhesus  ctg-atctattgaaatgtgctgtgtc-aaagcaatgtgttcaaaacagt-aacct--gaggctt---tct
B D       Crab-eating macaque  ctg-atctattgaaatgtgctgtgtc-aaagcaatgtgttcaaaacagt-aacct--gaggctt---tct
B D                    Baboon  ctg-atctattgaaatgtgctgtgtc-aaagcaatgtgttcaaaactgt-aacct--gaggctt---tct
B D              Green monkey  ctg-atctattgaaatgtgctgtgtc-aaagcaatgtgttcaaaactgt-aacct--gaggctt---tct
B D                  Marmoset  ctg-atctattgaaatgtgctgtgtc-aaagcaatgtgttcaaaactgt-aacct--gaggctt---tct
B D           Squirrel monkey  ctg-atctattgaaatgtgctgtgtc-aaagcaatgtgttcaaaactgt-aacct--gaggctt---tct
B D                  Bushbaby  ctg-atctattgaaatgtgctgtgtc-aaagcacagcatttaaaactat-aacct--aaggctt---tct
           Chinese tree shrew  ctg-atctcttggaatgtgctgcgt-----gtgctgcttttaaagctgt-aacat--gaggcta---gaa
B D                  Squirrel  ctg-atcttttggaatgcg-cttgtc-aaagcact-------------------------actt---tct
       Lesser Egyptian jerboa  ata-ggtgaagaaatagga-catgt------gact-------------------------cacc---cca
                 Prairie vole  ctg-gtttatgagaatgtt-catgtc-cagttact-------------------------ccct---cct
B D           Chinese hamster  cta-gtttagtagattgtc-catgtc-caatcatt-------------------------ccct---tct
               Golden hamster  cta-gcttaatataatgtt-catgtc-caatcatt-------------------------ccct---tct
B D                     Mouse  ctg-ctttactgga-------gtgtc-ccagcact-------------------------ccct---tct
B D                       Rat  ctg-ctttactggaatgta-cgtgtc-caagcact-------------------------ccct---tct
B D            Naked mole-rat  ctg-atctattggaatgtg-cttgtc-aaagcact-------------------------actt---tct
B D                Guinea pig  ctg-gcctgttggaatgtg-cttgtc-aaagcact-------------------------agtt---tca
                   Chinchilla  ctg-gcctgttggaatgtg-cttgtc-aaagcact-------------------------actt---tct
             Brush-tailed rat  ctg-gcctgtaggaatgtg-cttgtc-aaagcact-------------------------actt---tct
B D                    Rabbit  ctt-atctagtggaatgtgttgtgtc-aaaacaca-------------------------gtttaaaact
B D                    Alpaca  ctt-atctattggaacgtgctgtgtc-aaggcactacgtctgaaactgt-aatgt--gagtctt---tct
               Bactrian camel  ctt-atctattggaacgtgctgtgtc-aaggcactacgtctgaaactgt-aacgt--gagtctt---tct
B D                   Dolphin  ccg-atctattggaatgtgctgtgtc-aaagcactatatttgaaactgt-aacct--gaggctt---tcg
                 Killer whale  ccg-atctattggaatgtgctgtgtc-aaagcactatatttgaaactgt-aacct--gaggctt---tcg
             Tibetan antelope  ttg-atctattggattgtgctgtgtc-aaagcactgtatttgaaactgt-aacct--gaggttt---t--
B D                       Cow  ttg-atctattggaacgtgctgtgtt-aaagcactgtatttgaaactgt-aacct--gaggttt---t--
B D                     Sheep  ttg-atctattggattgtgctgtgtc-aaagcactgtatttgaaactgt-aacct--gaggttt---t--
                Domestic goat  ttg-atctattggattgtgctgtgtc-aaagcactgtatttgaaactgt-aacct--gaggttt---t--
B D                     Horse  ctg-atctattggaatgtgctgtgtc-aaagcactgcatttgaaactgt-aacct--gaggctt---tct
B D          White rhinoceros  ctg-gtctattggaatgtgctgtgtc-aacgcactgcatttgaaactgc-aacct--gcggctt---tca
B D                       Cat  cca-ctctattggaatgtgctgtgtc-aaagcactacatttgaaactgt-gacct--gaggc-c---tct
B D                       Dog  cca-atctaccggaatgtgctgtgtc-aaagcactacatttgaaactgt-aacct--gaggctt---tct
B D                   Ferret   cca-atgtactggaaaggggtatgtc-aaagcactagagtagaaac--t-aacccgagaggatt---tct
B D                     Panda  ccg-atgtactggaatgtgctgggtc-aaagcactacagttgaaactgt-gacct--gaggctt---tct
               Pacific walrus  ccg-atctactggaatgtgctgtgtc-aaagcactacagttgaaactgt-aaccc--ggggctt---tct
                 Weddell seal  ccg-atctactagaatgtgctatgtc-aaagtactacagttgaaactgt-aaccc--ggggctt---tct
             Black flying-fox  ctg-atcgattggaatgtgc--tgtc-aaagcattatgtttgaaactat-aacct--gaggctt---tct
B D                   Megabat  ctg-atcgattggaatgtgc--tgtc-aaagcattatgtttgaaactat-aacct--gaggctt---tct
                Big brown bat  ctc-atctattggaatgtgctgtgtc-aaagcattatgtttgaaactataaacct--gaggttt---tct
         David's myotis (bat)  ctc-atctattggaatgtgctgtgtc-aaagcattatgtttgaaactataaaccg--gaggatt---tct
B D                  Microbat  ctc-atctattggaatgtgctgtgtc-aaagcattatgtttgaaactataaacct--gaggttt---tct
B D                  Hedgehog  ttg-atttactggaatatgatgagac-aaaggactgtatttgaagctac---cct--ggggctt---ttt
B D                     Shrew  ctg-acctattggaatgtgctatgtcaaaagcactatatttgaaactgt-aacct--tgggctt---tct
              Star-nosed mole  cta-atctcctggaatgtgctgtatc-aaagcattatacttg-aactgc-aacct--ggggctt---tct
B D                  Elephant  -tg-atctattggaatatgctttgta-aaagcactgggtttacaaatgt-aactg--gtagctc---tct
          Cape elephant shrew  ctg-ctctgctggcatgtgctatgtc-aaaggatccatttta-aagggt-acctg--g-ggctc---gtt
             Cape golden mole  ctg-atccactggaatatgctgtgtc-aaagccctccattta-aaatg-----------agc--------
B D                    Tenrec  ttg-atctatggaaataggctgtgtc-aaagccttgtgttca-aaatt-----------agc--------
                     Aardvark  cag-atcttttggaacatgctgtgtc-aaagcactgttcttacaattgt-aacgt--gaggctc---tct
B D                      Pika  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
                 Zebra mbuna  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================
  D           Green seaturtle  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Mallard duck  ======================================================================
  D            Painted turtle  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Turkey  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                  Platypus  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D               Rock pigeon  ======================================================================

                        Human  gcaatcattgcac--------------------tactaa---aatgaacctt
                        Chimp  gcaaccattgcac--------------------tactaa---aatgaacctt
                      Gorilla  gcaatcattgcac--------------------tactaa---aatgaacctt
                    Orangutan  gcaatcattgcac--------------------tactaa---aatgaacctt
                       Gibbon  gcaatcattgcac--------------------tactaa---aatgaacctt
                       Rhesus  gcaatcattgcac--------------------tactaa---aatgaacctt
          Crab-eating macaque  gcaatcattgcac--------------------tactaa---aatgaacctt
                       Baboon  gcaatcattgcac--------------------tactaa---agtgaacctt
                 Green monkey  gcaatcattgcac--------------------cactaa---aatgaacctt
                     Marmoset  gcaatcattgcac--------------------tactaa---aatgaacctt
              Squirrel monkey  gcaatcattgcac--------------------tactaa---aatgaacctt
                     Bushbaby  gcaatcattatgt--------------------tactaa---aatgaatctt
           Chinese tree shrew  gtgatcattgtac--------------------tattaa---aatgaacctt
                     Squirrel  gaagtcattatacta--------------------ttga---tataaacttt
       Lesser Egyptian jerboa  acatgcctaaaag-----------------------ccaagtcagaggctcc
                 Prairie vole  gcaactgtggtac-----------------------tta---cgtaagtctt
              Chinese hamster  gcaattgtggtac-----------------------tta---cataagcctt
               Golden hamster  gcaa-tgtggtac-----------------------tta---cataagcctt
                        Mouse  gcaatcatggtac-----------------------tta---cataagcctc
                          Rat  gcaatcatggcac-----------------------tta---cataagcctc
               Naked mole-rat  gccatcactgtactatttttttcatcattgtactattaa---cataaaccct
                   Guinea pig  accatcatcgtacga--ttttcccccattgtactactaa---tgtcaatcct
                   Chinchilla  gccatcattgaactacttttttccgcattgtgctattaa---cat-aatcct
             Brush-tailed rat  acctccattgtactattcttttcctcattgtattattaa---cataaatcct
                       Rabbit  gcaacc-tgaaac--tgtttgcagtcattgaaatactca---aatgagcctc
                       Alpaca  gtaatcactgttc--------------------tactaa---aatgaacctt
               Bactrian camel  gtaatcactgttc--------------------tactaa---aatgaacctt
                      Dolphin  gcaatcactgtac--------------------tactaa---aatgaacctt
                 Killer whale  ccaatcactgtac--------------------tactaa---aatgaacctt
             Tibetan antelope  --------tgtac--------------------tactaa---aatgaacctt
                          Cow  --------cgtac--------------------tactaa---aatgaacctt
                        Sheep  --------tgtac--------------------tactaa---aatgaacctt
                Domestic goat  --------tgtac--------------------tactaa---aatgaacctt
                        Horse  gcaactattgtat--------------------tactaa---aatgaacctt
             White rhinoceros  gcaatcattgtac--------------------tactaa---aatgaacctt
                          Cat  gcagtcattgtac--------------------taccga---aatgaacctt
                          Dog  gtaattcttgta----------------------actga---aatgaacctt
                      Ferret   gcaatcactgtac--------------------tactga---aatgaaccct
                        Panda  gcaatcgttgtac--------------------tactga---aatgaacctt
               Pacific walrus  gcaatcattgcac--------------------taccga---aatgaacctt
                 Weddell seal  gcaatcattgcac--------------------taccga---aatgaacctt
             Black flying-fox  gcgatcattgtac--------------------aactaa---aatgaacctt
                      Megabat  gcgatcattgtac--------------------aactaa---aatgaacctt
                Big brown bat  gcaaccattgtac--------------------aattaa---aatgaacctt
         David's myotis (bat)  gcaatcattgtac--------------------aattaa---aatgaacctt
                     Microbat  gcaatcattgtac--------------------aattaa---aatgaacctt
                     Hedgehog  gcaatcattgcat--------------------gactga---aatgaacctt
                        Shrew  gcaatcattgtac--------------------tagtaa---aatgaacctt
              Star-nosed mole  gcaatcattgccg--------------------tactaa---catgaacctt
                     Elephant  gcaatcattgtac--------------------tactga---aatgaacctt
          Cape elephant shrew  gtacacacagtgg--------------------tactaa---agtgaacctt
             Cape golden mole  --actcattgtac--------------------tactga---aatgaacctt
                       Tenrec  --actcactgtac--------------------tactga---aatgaacctt
                     Aardvark  gcactcattgtat--------------------tactga---aacgaacctt
                         Pika  ====================================================
                    Armadillo  ====================================================
                      Manatee  ====================================================
        Burton's mouthbreeder  ----------------------------------------------------
                 Nile tilapia  ----------------------------------------------------
          Pundamilia nyererei  ----------------------------------------------------
                Scarlet macaw  ====================================================
                       Lizard  ====================================================
                  Zebra mbuna  ----------------------------------------------------
                       Parrot  ====================================================
              Green seaturtle  ====================================================
          Princess of Burundi  ----------------------------------------------------
     Chinese softshell turtle  ====================================================
                   Budgerigar  ====================================================
             Peregrine falcon  ====================================================
                 Mallard duck  ====================================================
               Painted turtle  ====================================================
                  Spotted gar  ----------------------------------------------------
                   Coelacanth  ====================================================
              Tasmanian devil  ====================================================
                      Opossum  ====================================================
                 Saker falcon  ====================================================
                       Turkey  ====================================================
          Collared flycatcher  ====================================================
                     Platypus  ====================================================
          Medium ground finch  ====================================================
       White-throated sparrow  ====================================================
                      Chicken  ====================================================
           Tibetan ground jay  ====================================================
                X. tropicalis  ====================================================
           American alligator  ====================================================
                  Zebra finch  ====================================================
                  Rock pigeon  ====================================================

Inserts between block 28 and 29 in window
B D                      Cow 493bp

Alignment block 29 of 98 in window, 15619252 - 15619256, 5 bps 
B D                     Human  ggtat
B D                     Chimp  ggtat
B D                   Gorilla  ggtat
B D                 Orangutan  ggtat
B D                    Gibbon  ggtat
B D                    Rhesus  ggtat
B D       Crab-eating macaque  ggtat
B D                    Baboon  ggtat
B D              Green monkey  ggtat
B D                  Marmoset  ggtat
B D           Squirrel monkey  gttat
B D                  Bushbaby  agtct
           Chinese tree shrew  ggtat
B D                  Squirrel  ggtat
       Lesser Egyptian jerboa  agtac
                 Prairie vole  gctag
B D           Chinese hamster  gctat
               Golden hamster  gctat
B D                     Mouse  actat
B D                       Rat  gctat
B D            Naked mole-rat  ggcat
B D                Guinea pig  gccat
                   Chinchilla  gccat
             Brush-tailed rat  gccat
B D                    Rabbit  tgtat
B D                    Alpaca  ggtat
               Bactrian camel  ggtat
B D                   Dolphin  ggtat
                 Killer whale  ggtat
             Tibetan antelope  ggtat
B D                     Sheep  ggtat
                Domestic goat  ggtat
B D                     Horse  ggtat
B D          White rhinoceros  ggtat
B D                       Cat  catct
B D                       Dog  ggtat
B D                   Ferret   ggtat
B D                     Panda  ggtat
               Pacific walrus  ggtat
                 Weddell seal  ggtat
             Black flying-fox  ggtat
B D                   Megabat  ggtat
                Big brown bat  ggcat
         David's myotis (bat)  ggtat
B D                  Microbat  ggtat
B D                  Hedgehog  -gcat
B D                     Shrew  -gtat
              Star-nosed mole  ggcat
B D                  Elephant  ggtat
          Cape elephant shrew  tgtat
             Cape golden mole  ggtat
B D                    Tenrec  ggcat
                     Aardvark  gatat
B D                      Pika  =====
B D                       Cow  =====
B D                 Armadillo  =====
B D                   Manatee  =====
       Burton's mouthbreeder  -----
B D              Nile tilapia  -----
         Pundamilia nyererei  -----
  D             Scarlet macaw  =====
B D                    Lizard  =====
                 Zebra mbuna  -----
  D                    Parrot  =====
  D           Green seaturtle  =====
         Princess of Burundi  -----
  D  Chinese softshell turtle  =====
B D                Budgerigar  =====
  D          Peregrine falcon  =====
  D              Mallard duck  =====
  D            Painted turtle  =====
                 Spotted gar  -----
B D                Coelacanth  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
  D              Saker falcon  =====
B D                    Turkey  =====
  D       Collared flycatcher  =====
B D                  Platypus  =====
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
B D                   Chicken  =====
          Tibetan ground jay  =====
B D             X. tropicalis  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D               Rock pigeon  =====

Alignment block 30 of 98 in window, 15619257 - 15619278, 22 bps 
B D                     Human  tc--cccctttatag----------------ctgtacaga
B D                     Chimp  tc--cccctttatag----------------ctgtacaga
B D                   Gorilla  tc--cccctttatag----------------ctgtacaga
B D                 Orangutan  tc--cccctttatag----------------ctgtacaga
B D                    Gibbon  tc--cccctttatag----------------ctgtgcaga
B D                    Rhesus  tc--cccctttatag----------------ctgtgcaga
B D       Crab-eating macaque  tc--cccctttatag----------------ctgtgcaga
B D                    Baboon  tc--cccctttatag----------------ctgtgcaga
B D              Green monkey  tc--cccctttatag----------------ctgtgcaga
B D                  Marmoset  tc--cccctttatag----------------ctgtgcaga
B D           Squirrel monkey  tc--cctctttatag----------------ctgtgcaga
B D                  Bushbaby  tt--cccctttatgg----------------cagcacaga
           Chinese tree shrew  tc--cccctttatag----------------ctgagcaaa
B D                  Squirrel  tc--ctccattatag----------------ctgtataga
       Lesser Egyptian jerboa  tcaatctaaatgtcatatagttatataccctctgaacaga
                 Prairie vole  tc--tcccactgtag----------------ctacataga
B D           Chinese hamster  tc--tcccat-----------------------------a
               Golden hamster  tc--tcccattgtag----------------ctacataga
B D                     Mouse  tc--tctcactgtac----------------ccgcacaaa
B D                       Rat  tc--tctcactgtaa----------------ctacacagg
B D            Naked mole-rat  tt--ccccattacag----------------ctatccaaa
B D                Guinea pig  tt--tcccattacag----------------ctgcccaaa
                   Chinchilla  tt--ccccattacag----------------ccgcccaaa
             Brush-tailed rat  tt--tctcattacag---------------------caaa
B D                    Rabbit  tc---cctatagtag----------------ctgtacaga
B D                    Alpaca  -t--cccctttatag----------------ctaagtaga
               Bactrian camel  -t--cccctttatag----------------ctaagtaga
B D                   Dolphin  -t--cccctttatag----------------ctaagcaga
                 Killer whale  -t--cccctttatag----------------ctaagcaga
             Tibetan antelope  -t--cccctttatag----------------ctaagcaga
B D                       Cow  tt--cccttttatag----------------ctaagcaga
B D                     Sheep  -t--cctctttatag----------------ctaagcaga
                Domestic goat  -t--ctcctttatag----------------ctaagcaga
B D                     Horse  -t-ccccctttatag----------------ctaagccaa
B D          White rhinoceros  -t--cccctttatag----------------ctaagcaga
B D                       Cat  -t--accctttatag----------------ctaagcaga
B D                       Dog  -t--cccctttatag----------------ctaatcaga
B D                   Ferret   -t--ccccttgatag----------------ctaagcaga
B D                     Panda  -t--ccccttcatag----------------ctaaacaga
               Pacific walrus  -t--cccctttatag----------------ctaagcaga
                 Weddell seal  -t--cccctttatag----------------ctaagcaga
             Black flying-fox  -t--cccctttatgg----------------ctaagcaga
B D                   Megabat  -t--cccctttatgg----------------ctaagcaga
                Big brown bat  -t--tccctttatgg----------------ctaagcaga
         David's myotis (bat)  -t--tccctttatgg----------------ctaagcaga
B D                  Microbat  -t--tccctttatgg----------------ctaagcaga
B D                  Hedgehog  -t--accctttatag----------------ctaagcaga
B D                     Shrew  -c--accatttataa----------------ctaagaaga
              Star-nosed mole  -t--gccctttatag----------------ctaagcaga
B D                  Elephant  -t--cccctttatag----------------ctaggcaga
          Cape elephant shrew  -t--cccttgtgcag----------------ctaggaagc
             Cape golden mole  -t--cccttctctag----------------caaggccaa
B D                    Tenrec  -t--cccctttatag----------------cgaggcaga
                     Aardvark  -t--cccctttatag----------------ctaggcatc
B D                      Pika  ========================================
B D                 Armadillo  ========================================
B D                   Manatee  ========================================
       Burton's mouthbreeder  ----------------------------------------
B D              Nile tilapia  ----------------------------------------
         Pundamilia nyererei  ----------------------------------------
  D             Scarlet macaw  ========================================
B D                    Lizard  ========================================
                 Zebra mbuna  ----------------------------------------
  D                    Parrot  ========================================
  D           Green seaturtle  ========================================
         Princess of Burundi  ----------------------------------------
  D  Chinese softshell turtle  ========================================
B D                Budgerigar  ========================================
  D          Peregrine falcon  ========================================
  D              Mallard duck  ========================================
  D            Painted turtle  ========================================
                 Spotted gar  ----------------------------------------
B D                Coelacanth  ========================================
B D           Tasmanian devil  ========================================
B D                   Opossum  ========================================
  D              Saker falcon  ========================================
B D                    Turkey  ========================================
  D       Collared flycatcher  ========================================
B D                  Platypus  ========================================
B D       Medium ground finch  ========================================
  D    White-throated sparrow  ========================================
B D                   Chicken  ========================================
          Tibetan ground jay  ========================================
B D             X. tropicalis  ========================================
B D        American alligator  ========================================
B D               Zebra finch  ========================================
  D               Rock pigeon  ========================================

Inserts between block 30 and 31 in window
B D                 Elephant 141bp
         Cape elephant shrew 3bp

Alignment block 31 of 98 in window, 15619279 - 15619428, 150 bps 
B D                     Human  tgataatctagtaaataaata---t--aatatgtgatgggaa-tttaat-aagggcctcgatcgctcttg
B D                     Chimp  tgataatctagtaaataaata---t--aatatgtgatgggaa-tttaat-aagggcctcgatcgctcttg
B D                   Gorilla  tgataatctagtaaataaata---t--aatatgtgatgggaa-tttaat-aagggcctcgatcgctcttg
B D                 Orangutan  tgataatctagtaaataaata---t--aatatgtgatgggaa-tttaat-aagggcctcgcttgctcttg
B D                    Gibbon  tgataatctagtaaataaata---t--aatatgtgatgggaa-tttaat-aagggcctcgatcgctattg
B D                    Rhesus  tgataatctagcaaacaaata---t--aatatgtgatgggaa-tttaat-aagggccttgatagctcttg
B D       Crab-eating macaque  tgataatctagcaaacaaata---t--aatatgtgatgggaa-tttaat-aagggccttgatagctcttg
B D                    Baboon  tgataatctagcaaataaata---t--aatatgtgatgggaa-tttaat-aagggccttgatagctcttg
B D              Green monkey  tgataatctagcaaacaaata---t--aatatgtgatgggaa-tttaat-aagggccttgatagctcttg
B D                  Marmoset  tgaaaatctagcaagcaaaca---t--aatgtgtgatgagaa-tttaat-ataagcctcggtcactcttg
B D           Squirrel monkey  tgataatcaagtaagcaaata---t--aacatgtgatgagaa-tttaat-ataagccttgatcactcttg
B D                  Bushbaby  tgatattctagcaagcaaaca---c--gatatgtgatgggaa-tttaat-atgagcctcaattactcttg
           Chinese tree shrew  tgataatctagtaagcaaaca---t--attttgtgatgagaa-tttaat-acaagcctcagtcacccttg
B D                  Squirrel  tgataatctagcaagcaaact---t--aat--gtgatgagaa-tttaaa-acaagtctcaatcactcttg
       Lesser Egyptian jerboa  tcataatatagcaagaaaaca---t--aatatgtgataggaa-tt--at-aaaagtaccaattactc--a
                 Prairie vole  ggataatccaataagcaagca---a--aatgggtgataggaa-ttaaat-gaaagccccagtcactc--a
B D           Chinese hamster  tgataacccagcaatcaaaca---a--aatgggtgat-ggaa-ttaaat-gaaagacccagtcactc--a
               Golden hamster  tgataactcagaaagcaaaca---a--aataggcgatgggaa-ttaaat-gaaagacacggtcactc--a
B D                     Mouse  tgataatccagcaagcaaac-------aatgtatgataggaa-ttaaagcgaaagccccagtcactc--a
B D                       Rat  tgataatccagcaagcaaac-------aatgtatgacaggaa-ttaaatcgaaagccccagtcactc--a
B D            Naked mole-rat  tgataatctagcaagaaagca---t--actatgtgatgagaa-tttaat-atgagtctcagtcactctta
B D                Guinea pig  tgataatctagcaagaaagca---c--agtacatgatgagaa-tttaat-atgaatctcagtcaccctta
                   Chinchilla  tggtaatctagcaagaaagca---c--ggtatgtaatcagaa-tttaat-atcagtctcaattcctccta
             Brush-tailed rat  ggataatctacaaaagaagca---t--agtatgtgaagagaa-tttaat-atcagtctcaaacactctta
B D                    Rabbit  tgatcatctagcaaggaaac-------attacatgatgggag-tttcat-atgagcttcaatcacccttg
B D                    Alpaca  tgataatctagcaagcaaatactat--aataagtgattagaa-tttaat-ataagcctcagccacccttg
               Bactrian camel  tgataatctagcaagcaaatactat--aataagtgatgagaa-tttaat-ataagcctcagccacccttg
B D                   Dolphin  tgataatctagcagacaaacactat--aatatatgatgagca-tttaat-atgagcttcagtcacccttg
                 Killer whale  tgataatctagcagacaaacactat--aatacatgatgagca-tttaat-atgagcttcagttacccttg
             Tibetan antelope  tgataatctagcaggt-aatactat--aatatgtgatgagaa-tttaat-atgagcctcagtcacccttg
B D                       Cow  tgataatccagcaggt-aatactat--aatatgtgatgagaa-tttaat-atgagcctcagtcacccctg
B D                     Sheep  tgataatctagcaggt-aatactat--aatatgtgatgagaa-tttaat-atgagcctcagtcacccttg
                Domestic goat  tgataatctagcaggt-aatactat--aatatgtgatgagaa-tttaat-atgagcctcagtcacccttg
B D                     Horse  tgataatctagcaagtaactactgc--aatatgtgatgggaa-tttaat-atgagcctcaatcatccttg
B D          White rhinoceros  tgataatctag-aagcaaatactat--aatatgtgctgggaa-tctaat-atgagcctcaatcacctttg
B D                       Cat  tgataatctagcaagcgaatactat--aatatgtgatgggaa-tctaat-aagagcctcggtcactcttg
B D                       Dog  tgataatctaggaagcaaatactat--aatatatgataggaa-tctaac-atgaacttcgatcagtcttg
B D                   Ferret   tgataatctagcaagtaaatactat--aatat--------------aac-atgagcctcagtcagccttg
B D                     Panda  tgataatctagcaagc-gatactgt--aatacgtgatgagaa-tttaac-ataagcctcgatcagccttg
               Pacific walrus  tgataacctagcaagtaaatactgt--aatatgtgatgggaa-ttcaac-atgagcctcgatcaggcttg
                 Weddell seal  tgataatctagcaagtaaatactat--aatatgtgatgggaa-ttcaac-atgagcctccatcagccttg
             Black flying-fox  tgataatctagcaagcaaatactat--aacatgtgatgagaa-tttaat-atgagcctcaatcacccttg
B D                   Megabat  tgataatctagcaagcaaatactat--agcatgtgatgagaa-tttaat-atgagcctcaatcacccttg
                Big brown bat  tgataatctagcaagcaaatactat--aacatgcaatgggaa--ttaac-atgagcctcaattaacctt-
         David's myotis (bat)  tgataatctagcaagcaaatactat--aacatgtaatgggaa--ttaag-atgggcctcaattaacctt-
B D                  Microbat  tgataatctagcaagcaaatactat--aacatgtaatgggaa--ttaac-atgagcctcaattaacctt-
B D                  Hedgehog  tgataatctaataagcaaatgcagg--aataaggggttataa-ctcagt-atgagccatagtca-acttg
B D                     Shrew  tgataatctagcaagcaaatactag--aatatgtgatagcaa-tttaat-atgagcccaagtcacccttg
              Star-nosed mole  tgataatctatgatcc-------------tatgtggtggtaattttaat-atgaacctcaataatccctg
B D                  Elephant  tgatgatctagcaaacaaatgttat--aatatgggataggag-tttaat-atgcacctcaatcatcctca
          Cape elephant shrew  tgataactttacaaacaattgttatagaatttgtgagaggaa-tttaat-atgagccgaaatcaccctca
             Cape golden mole  tgataacctagcaaaaacatgctat--actaagtgacaggaa-tttaat-ctgaatctcacgaaccttaa
B D                    Tenrec  tggtaatcta----------gttat--aatatatggcagaaa-ttcaat-ctaaggcacagtcacccttg
                     Aardvark  tgataatctagcaagcaaatgttat--aatatgtgccaagaa-tttaat-ataaaccttaatcacccttg
B D                      Pika  ======================================================================
B D                 Armadillo  ======================================================================
B D                   Manatee  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
  D             Scarlet macaw  ======================================================================
B D                    Lizard  ======================================================================
                 Zebra mbuna  ----------------------------------------------------------------------
  D                    Parrot  ======================================================================
  D           Green seaturtle  ======================================================================
         Princess of Burundi  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Mallard duck  ======================================================================
  D            Painted turtle  ======================================================================
                 Spotted gar  ----------------------------------------------------------------------
B D                Coelacanth  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
  D              Saker falcon  ======================================================================
B D                    Turkey  ======================================================================
  D       Collared flycatcher  ======================================================================
B D                  Platypus  ======================================================================
B D       Medium ground finch  ======================================================================
  D    White-throated sparrow  ======================================================================
B D                   Chicken  ======================================================================
          Tibetan ground jay  ======================================================================
B D             X. tropicalis  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
  D               Rock pigeon  ======================================================================

                        Human  ----caat-gatg-----gcagagac----attaaca-t--tgagaaacctctatcacttttgagcaagc
                        Chimp  ----caat-gatg-----gcagagac----attaaca-t--tgggaaacctctatcacttttgagcaagc
                      Gorilla  ----caat-gatg-----gcagagac----attaaca-t--tgggaaacctctatcacttttgagcaagc
                    Orangutan  ----caat-gatg-----gcagagac----attaaca-t--tgggaaacctctatcacttttgagcaagc
                       Gibbon  ----caat-gatg-----gcagagac----attaaca-t--tgggaaacctctgtcacttttgagcaagc
                       Rhesus  ----caat-gatg-----gcagagat----attaact-t--tggcaaacctctaccacttttgagcacgc
          Crab-eating macaque  ----caat-gatg-----gcagagat----attaact-t--tggcaaacctctaccacttttgagcacgc
                       Baboon  ----caat-gatg-----gcagagat----attaact-t--tggcaaacctctaccacttttgagcacgc
                 Green monkey  ----caat-gatg-----gcagagat----attaact-t--tggcaaacctctaccacttttgagcaagc
                     Marmoset  ----caac-gatg-----gcagagat----attaaca-t--tagcaaacctttaccacttttgagcaagc
              Squirrel monkey  ----caat-gacg-----gcagagat----attaaca-t--tggcaaacctttaccacttttgagcaagc
                     Bushbaby  ----gaat-gatg-----gcaaagat----attaaca-t--tggcaaacctctggcactttagaacaagc
           Chinese tree shrew  ----gaat-aatg-----gcaaagtt----attaaca-t--tggcaaatcgttgccatttttgagcaagc
                     Squirrel  ----gaat-gtta-----gcaaagat----attaaca-t--taacaaacttctgccacttttgagtcagc
       Lesser Egyptian jerboa  ----aaat-gatg-----tcaaagat----actaaca-t--tggcaaacttttgccacatttgaaccaac
                 Prairie vole  ----aaatggatg-----gcaaagtt----attaacatt--tggccaccttttgccacttttgagctagt
              Chinese hamster  ----aaat-gatg-----gaaaaggt----attgaca-t--tggccactttttgccacttttgagccagt
               Golden hamster  ----aact-gatg-----gcaaagtt----actaaca-t--tggccaccttttgacacttttgcggc---
                        Mouse  ----acat-gatg-----gcaagtgt----attaaca-c--tggccacc-tttgccatttttgagccagt
                          Rat  ----aaat-gatg-----gcaaacgtattaattaaca-t--tggccaccttttgccactttcgagtcagt
               Naked mole-rat  ----gaat-gatg-----gcaaaaac----attaaca-t--tggcaaatttctctgacgtttgagccagc
                   Guinea pig  ----gaag-gatg-----gcaaacac----attaaca-t--tggcaaatttctgtgacatttgattcagc
                   Chinchilla  ----gaat-catg-----gcaaagac----attaaca-c--tggcaaagttctgtgacatctgagccagc
             Brush-tailed rat  ----taat-aaca-----gcaaagac----attgaca-cattagcaaatttctgtgatacttgagccagc
                       Rabbit  ----gaat-aacg-----gcaaagat----atttaca-t--tggcaaacttctgccactttggag-cagc
                       Alpaca  ----gaat-gatg-----acaaagat----attaaca-t--tggcaagcctctgtgacttcggagcaaac
               Bactrian camel  ----gaat-gatg-----gcaaagat----attaaca-t--tggcaagcctctgtgactttggagcaaac
                      Dolphin  ----gaat-gatg-----gcaaagat----attagca-t--tggcaagcctccgttgctcttgagcaagc
                 Killer whale  ----gaat-gatg-----gcaaagat----actagca-t--tggcaagcctccgttgcttttgagcaagc
             Tibetan antelope  ----gaat-gatg-----gcaaagat----attaaca-t--tgacaagcctctgtcacttttgagcaagc
                          Cow  ----gaat-gatg-----gcaaagat----attaaca-t--tggcaagcctctgtcacttttgagcaagc
                        Sheep  ----gaat-gatg-----gcaaagat----attaaca-t--tgacaagcctctgtcacttttgagcaagc
                Domestic goat  ----gaat-gatg-----gcaaagat----attaaca-t--tgacaagcctctgtcacttttgagcaagc
                        Horse  ----aaag-gagg-----gcaaagat----actaaca-t--cggcaagcttctgtcacttttgagcaagt
             White rhinoceros  ----aaat-gagg-----acaaagat----actaaca-t--tggcaagcctctgtcacttttgagcaagt
                          Cat  ----gaat-gacg-----gc--agat----actaaca-t--tggcaaacctgtatcacttctgagcaagc
                          Dog  gaatgaat-gatg-----gc--ggat----actagca-t--tggcaaacctctgtcacttttgagcaagt
                      Ferret   ----gaat-gatg-----gc--agat----tctaaca-t--tgacaaacctctgtcacttttgagcaagt
                        Panda  ----gaag-gatg-----gc--aggt----actaaca-t--tggcaaacctctatcccttttgagcaagc
               Pacific walrus  ----gaat-gatg-----gc--agat----actaaca-t--tggcaaacctctgtcacttttgagcaagc
                 Weddell seal  ----gaat-gatg-----gc--agat----actaaca-t--tggcaaacctctgtcacttttgagcaagc
             Black flying-fox  ----gaag-gatg-----gcaaagat----attaaca-t--tgacaagcctctgtcactcctgagcaagc
                      Megabat  ----gaag-gatg-----gcaaagat----attaaca-t--tgacaagcctctgtcactcctgagcaagc
                Big brown bat  ----aaat-aatg-----gcaaagaa----attaaca-t--tggcaagcttctgtcacttttgagcaagc
         David's myotis (bat)  ----aaat-aatg-----gcaaagaa----attaaca-t--tgtcaagcttctgtcacttttgagcaagc
                     Microbat  ----aaat-aatg-----gcaaagaa----atgaaca-t--tggcaagcttatgtcacttttgagcaagc
                     Hedgehog  ----gaac-gttgactatgcaaagat----attaaca-c--tgggaaac--ctgacacttttggacaagt
                        Shrew  ----gaat-gata-----gcaaagat----attgaca-t--tggcaaacctctgtcactcttcagcaacc
              Star-nosed mole  ----gagt-gagg-----gcagagat----actaatt-t--tggccaacctctggcactgttgagaagct
                     Elephant  ----gaat-gatg-----gcaaaggt----attaaca-t--tagcaaacttctgacgcctttgagcaa--
          Cape elephant shrew  ----gaat-gaca-----gccaaggt----attaaca-t-------------------cttggaggaa--
             Cape golden mole  ----gaat-aatg-----gcaaaggt----ataa-ca-t--cagcaaccttctgacacatttgaacaa--
                       Tenrec  ----ggac-gatg-----gcaaaggt----atta--a-t--cagcaaacttctggtatctttgagcaa--
                     Aardvark  ----gaat-gatg-----gcaaagga----gttaaca-t--tggcaaacttctgaca-cttttaacag--
                         Pika  ======================================================================
                    Armadillo  ======================================================================
                      Manatee  ======================================================================
        Burton's mouthbreeder  ----------------------------------------------------------------------
                 Nile tilapia  ----------------------------------------------------------------------
          Pundamilia nyererei  ----------------------------------------------------------------------
                Scarlet macaw  ======================================================================
                       Lizard  ======================================================================
                  Zebra mbuna  ----------------------------------------------------------------------
                       Parrot  ======================================================================
              Green seaturtle  ======================================================================
          Princess of Burundi  ----------------------------------------------------------------------
     Chinese softshell turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Mallard duck  ======================================================================
               Painted turtle  ======================================================================
                  Spotted gar  ----------------------------------------------------------------------
                   Coelacanth  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
                 Saker falcon  ======================================================================
                       Turkey  ======================================================================
          Collared flycatcher  ======================================================================
                     Platypus  ======================================================================
          Medium ground finch  ======================================================================
       White-throated sparrow  ======================================================================
                      Chicken  ======================================================================
           Tibetan ground jay  ======================================================================
                X. tropicalis  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                  Rock pigeon  ======================================================================

                        Human  agatttt-----agttcttaca-----ttcattggtttaaat--tt
                        Chimp  agatttt-----agttcttaca-----ttcattggtttaaat--tt
                      Gorilla  agattat-----agttcttaca-----ttcattggtttaaat--tt
                    Orangutan  aaatttt-----agttcttaca-----ttcattggtttaaat--tt
                       Gibbon  agatgtt-----agttcttaca-----ttcattggtttaaat--tt
                       Rhesus  agatttt-----agttcttata-----ttcattggtttaaat--tt
          Crab-eating macaque  agatttt-----agttcttata-----ttcattggtttaaat--tt
                       Baboon  agatttt-----agttcttata-----ttcattggtttaaat--tt
                 Green monkey  agatttt-----agttcttata-----ttcattggtttaaat--tt
                     Marmoset  agatttc-----agttcttaca------tcattggtttaaat--tt
              Squirrel monkey  agatttt-----agttcctaca-----ttcattggtttaaat--tt
                     Bushbaby  agatttttagtaagaactaaaatctgcttcattggcttacat--tt
           Chinese tree shrew  agatttt-----agtcattata-----ttcattcattttatttatt
                     Squirrel  agatttt-----a-gtcttaca-----tatattcattgaagt--tt
       Lesser Egyptian jerboa  agactac-----aggtcctcca-----ttcattggcttaaac--tt
                 Prairie vole  ggattct-----aggtcctcta-----ctcattggcttaaat--tt
              Chinese hamster  agaatct-----aggccctcta-----ttcattcatttaaaa--tt
               Golden hamster  ----cct-----aggtcctcta-----ctcattggtttaaat--tt
                        Mouse  agattct-----aggtcctcta-----ctcattggtttaaat--tt
                          Rat  agattct-----aagtcctcta-----ctcattggtttaaat--tt
               Naked mole-rat  agatttt-----agttcttata-----ttcattactttcaat--tt
                   Guinea pig  agatttt-----agtgcttacg-----ttctttactttcaat--tt
                   Chinchilla  agatttt-----agttcttaca-----ttctttactttcaat--tt
             Brush-tailed rat  agatttt-----agttcttaca-----ttcttcacttt--------
                       Rabbit  agatttt-----agttcttaca-----ttcattagtttaaat--ta
                       Alpaca  agatttt-----agttcctgca-----tttatcggtttaaat--t-
               Bactrian camel  agatttt-----agttcctgca-----tttattggtttaaat--t-
                      Dolphin  agatttt-----agttcttgca-----ttcataggtttaaat--tt
                 Killer whale  agatttt-----agttcttgca-----ttcataggtttgaat--tt
             Tibetan antelope  agacttt-----agttcttgca-----tttatagatttaaat--tt
                          Cow  agatttt-----agttcttgca-----tttatagatttaaat--tt
                        Sheep  agatttt-----agttcttgca-----tttatagatttaaat--tt
                Domestic goat  agatttt-----agttcttgca-----tttatagatttaaat--tt
                        Horse  aggtttt-----agttcttatg-----tccattggtttaaat--tt
             White rhinoceros  agatttt-----agttcttacg-----ttcattggtttaaat--tt
                          Cat  agatttt-----agttcttatg-----ttcattgatttaaat--tt
                          Dog  agatttt-----agttcttacg-----ttcattgatttaaat--tc
                      Ferret   agattgt-----agtttttacg-----ttcattgatttaaat--tc
                        Panda  agatttt-----aattcttacg-----ttcattgatttacat--tc
               Pacific walrus  agatttt-----ggttcttacg-----ttcattgatttaaat--tc
                 Weddell seal  agatttt-----agttcttacg-----ttcattgatttaaat--tc
             Black flying-fox  agatttt-----agttcttata-----ttcatcagtttaaat--tt
                      Megabat  agatttt-----agttcttata-----ttcattagtttaaat--gt
                Big brown bat  agatttg-----agttcttata-----ttcattaatttaaat--tt
         David's myotis (bat)  agatttg-----agttcttata-----ttcattaatttaaat--tt
                     Microbat  agatttg-----agttcttata-----ttcattaatttaaat--tt
                     Hedgehog  aaatttt-----agttcttaca-----tccattggtttatat--tt
                        Shrew  -gatttt-----agtttttaga-----tttatgggttcaaat--tt
              Star-nosed mole  -gatttt-----agttcttctt-----tttaatggtttgaat--gt
                     Elephant  -gatttt-----agttcttata-----ttcactggtttcaat--ct
          Cape elephant shrew  -agattt-----ggtttttgta-----ttccttggttgaaa-----
             Cape golden mole  -gatttt-----agctcttata-----ttcattggcttaaat--ct
                       Tenrec  -gatttt-----agttgttcta-----ttcatgggcttcaac--ct
                     Aardvark  -gatctt-----agttcttgta-----ttcttcagtttaaat--ct
                         Pika  ==============================================
                    Armadillo  ==============================================
                      Manatee  ==============================================
        Burton's mouthbreeder  ----------------------------------------------
                 Nile tilapia  ----------------------------------------------
          Pundamilia nyererei  ----------------------------------------------
                Scarlet macaw  ==============================================
                       Lizard  ==============================================
                  Zebra mbuna  ----------------------------------------------
                       Parrot  ==============================================
              Green seaturtle  ==============================================
          Princess of Burundi  ----------------------------------------------
     Chinese softshell turtle  ==============================================
                   Budgerigar  ==============================================
             Peregrine falcon  ==============================================
                 Mallard duck  ==============================================
               Painted turtle  ==============================================
                  Spotted gar  ----------------------------------------------
                   Coelacanth  ==============================================
              Tasmanian devil  ==============================================
                      Opossum  ==============================================
                 Saker falcon  ==============================================
                       Turkey  ==============================================
          Collared flycatcher  ==============================================
                     Platypus  ==============================================
          Medium ground finch  ==============================================
       White-throated sparrow  ==============================================
                      Chicken  ==============================================
           Tibetan ground jay  ==============================================
                X. tropicalis  ==============================================
           American alligator  ==============================================
                  Zebra finch  ==============================================
                  Rock pigeon  ==============================================

Inserts between block 31 and 32 in window
            Brush-tailed rat 428bp

Alignment block 32 of 98 in window, 15619429 - 15619439, 11 bps 
B D                     Human  cctttagc---tct
B D                     Chimp  cctttagc---tct
B D                   Gorilla  tctttagc---tct
B D                 Orangutan  tctttagc---tct
B D                    Gibbon  tctttagc---tct
B D                    Rhesus  tctttagc---tct
B D       Crab-eating macaque  tctttagc---tct
B D                    Baboon  tctttagc---tct
B D              Green monkey  tctttagc---tct
B D                  Marmoset  tctttagc---tct
B D           Squirrel monkey  tctttagc---tct
B D                  Bushbaby  tctttagc---tct
           Chinese tree shrew  atttttac---tct
B D                  Squirrel  tctttagt---tct
       Lesser Egyptian jerboa  tctttggc---tct
                 Prairie vole  catttagctgttgt
B D           Chinese hamster  tatttagctgttgt
               Golden hamster  tatttagctgttgt
B D                     Mouse  c-tttagc---tgt
B D                       Rat  c-tttagc---tat
B D            Naked mole-rat  tctttagc---tct
B D                Guinea pig  ------gc---tt-
                   Chinchilla  tccttagc---tct
             Brush-tailed rat  cttttagc---tct
B D                    Rabbit  gcttcggc---tgt
B D                    Alpaca  --tttagt---cct
               Bactrian camel  --tttagt---cct
B D                   Dolphin  tctttagg---tcc
                 Killer whale  tctttagg---tcc
             Tibetan antelope  tctttagt---tct
B D                       Cow  actttagt---tct
B D                     Sheep  tctttagt---tct
                Domestic goat  tctttagt---tct
B D                     Horse  tccttagt---tct
B D          White rhinoceros  tctttagt---tct
B D                       Cat  tctttagc---tct
B D                       Dog  tctttagt---tct
B D                   Ferret   tctttagt---tct
B D                     Panda  tctttagt---tct
               Pacific walrus  tcttcagt---tct
                 Weddell seal  tcttcagt---tct
             Black flying-fox  tctctagt---tct
B D                   Megabat  tctttagt---tct
                Big brown bat  tctttagt---tct
         David's myotis (bat)  tctttagt---tct
B D                  Microbat  tctttagt---tct
B D                  Hedgehog  tctgtatt---tat
B D                     Shrew  cctgtagt---tct
              Star-nosed mole  gctttagt---tct
B D                  Elephant  tctttagc---tct
          Cape elephant shrew  tctttagc---tct
             Cape golden mole  tctttagc---tct
B D                    Tenrec  tctttgcc---tc-
                     Aardvark  tctttagc---tct
B D                      Pika  ==============
B D                 Armadillo  ==============
B D                   Manatee  ==============
       Burton's mouthbreeder  --------------
B D              Nile tilapia  --------------
         Pundamilia nyererei  --------------
  D             Scarlet macaw  ==============
B D                    Lizard  ==============
                 Zebra mbuna  --------------
  D                    Parrot  ==============
  D           Green seaturtle  ==============
         Princess of Burundi  --------------
  D  Chinese softshell turtle  ==============
B D                Budgerigar  ==============
  D          Peregrine falcon  ==============
  D              Mallard duck  ==============
  D            Painted turtle  ==============
                 Spotted gar  --------------
B D                Coelacanth  ==============
B D           Tasmanian devil  ==============
B D                   Opossum  ==============
  D              Saker falcon  ==============
B D                    Turkey  ==============