Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 38 in window, 42879800 - 42879812, 13 bps 
B D                     Human  ggttctggat-c-----tt
B D                     Chimp  ggttctggat-c-----tt
B D                   Gorilla  ggttctggat-c-----tt
B D                 Orangutan  ggttctggat-c-----tt
B D                    Gibbon  ggttctggat-c-----tt
B D                    Rhesus  ggttctggat-c-----tt
B D       Crab-eating macaque  ggttctggat-c-----tt
B D                    Baboon  ggttctggat-c-----tt
B D              Green monkey  ggttctggat-c-----tt
B D                  Marmoset  ------ggat-c-----tt
B D           Squirrel monkey  ggttctggat-c-----tt
B D                  Bushbaby  gcctgcagatcc-----tt
           Chinese tree shrew  gattctggat-c-----tg
B D            Naked mole-rat  ggtcctggga-c-----tt
B D                Guinea pig  agctttggga-c-----tt
                   Chinchilla  agctctgggt-c-----tt
             Brush-tailed rat  atctctggga-c-----tt
B D                       Pig  gggtctggat-c-----tt
B D                    Alpaca  ggttctgggt-c-----tc
               Bactrian camel  ggttctgggt-c-----tc
B D                   Dolphin  agttctggat-c-----tt
                 Killer whale  agttctggat-c-----tt
             Tibetan antelope  agttctggat-c-----tt
B D                       Cow  agttctggat-c-----tt
B D                     Sheep  agttctggat-c-----tt
                Domestic goat  agttctggat-c-----tt
B D                     Horse  agttctggat-c-----tt
B D          White rhinoceros  ggttctggat-c-----tt
B D                     Panda  gc-tctggat-c-----tt
               Pacific walrus  gcttctggat-c-----tt
                 Weddell seal  gcttctggat-c-----tt
             Black flying-fox  ggttctgggt-c-----tt
B D                   Megabat  ggttctggat-c-----tt
                Big brown bat  ggctctgaat-t-----ct
B D                  Microbat  ggctctgaat-t-----ct
          Cape elephant shrew  gtgtctggga-aattatt-
B D                   Manatee  ggttctggat-g-----t-
             Cape golden mole  ggttctagat-g-----t-
B D                 Armadillo  tttttc-----------c-
              Golden hamster  ===================
B D                    Tenrec  ===================
                Prairie vole  ===================
B D           Chinese hamster  ===================
B D                       Rat  ===================
B D                     Mouse  ===================
      Lesser Egyptian jerboa  ===================
                 Zebra mbuna  ===================
         Pundamilia nyererei  ===================
B D                    Lizard  ===================
B D              Nile tilapia  ===================
       Burton's mouthbreeder  ===================
B D               Stickleback  ===================
                    Aardvark  ===================
B D                   Wallaby  ===================
  D    White-throated sparrow  ===================
                 Spotted gar  ===================
B D                    Medaka  ===================
B D                 Zebrafish  ===================
  D           Green seaturtle  ===================
  D  Chinese softshell turtle  ===================
  D    Spiny softshell turtle  ===================
  D            Painted turtle  ===================
B D                Budgerigar  ===================
  D          Peregrine falcon  ===================
  D              Saker falcon  ===================
          Tibetan ground jay  ===================
  D               Rock pigeon  ===================
  D       Collared flycatcher  ===================
B D           Tasmanian devil  ===================
B D                   Opossum  ===================
B D              Atlantic cod  ===================
B D                    Turkey  ===================
B D                   Chicken  ===================
B D       Medium ground finch  ===================
B D                  Platypus  ===================
B D                  Elephant  ===================
B D                  Squirrel  ===================
        David's myotis (bat)  ===================
B D                       Dog  ===================
B D        American alligator  ===================
B D               Zebra finch  ===================
B D                   Ferret   ===================
B D                       Cat  ===================

Inserts between block 1 and 2 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp
               Big brown bat 6608bp
B D                 Microbat 6965bp

Alignment block 2 of 38 in window, 42879813 - 42879826, 14 bps 
B D                     Human  tttccgcg--gtagct
B D                     Chimp  tttccgcg--gtagct
B D                   Gorilla  tttccgcg--gtagct
B D                 Orangutan  tttccgcg--gtagct
B D                    Gibbon  tttccgct--gtagct
B D                    Rhesus  tttccgct--gtaact
B D       Crab-eating macaque  tttccgct--gtaact
B D                    Baboon  tttccgct--gtaact
B D              Green monkey  tttccgca--gtaact
B D                  Marmoset  tgtccgcc--gtagct
B D           Squirrel monkey  ttcccgcc--gtagct
B D                  Bushbaby  ttcccgct--gcacct
           Chinese tree shrew  ttctggcg--g-----
B D            Naked mole-rat  cgt----------gct
B D                Guinea pig  cgt----------gct
                   Chinchilla  cgt----------tct
             Brush-tailed rat  cgt----------tct
B D                       Pig  ctcg--------ggct
B D                    Alpaca  ctccgcct--gtggct
               Bactrian camel  ctcagcct--gtggct
B D                   Dolphin  ctcacgct--gtggcc
                 Killer whale  ctcacgct--gtggcc
             Tibetan antelope  ctcgcgct--gtggct
B D                       Cow  ctcgcgct--gtggct
B D                     Sheep  ctcgcgct--gtggct
                Domestic goat  ctcgcgct--gtggct
B D                     Horse  tgtccgct--gtagct
B D          White rhinoceros  tgtcctct--gtctct
B D                     Panda  tcaccgct--gcagct
               Pacific walrus  tctccgct--gcagct
                 Weddell seal  tctccgct--gcagct
             Black flying-fox  cccgtgct--gtacct
B D                   Megabat  cccctgct--gtacct
          Cape elephant shrew  tttcacct--atatct
B D                   Manatee  tgtcccct--gtatct
             Cape golden mole  tttcccct---tatct
B D                 Armadillo  tctccccgcggtatct
              Golden hamster  ================
B D                    Tenrec  ================
                Prairie vole  ================
B D           Chinese hamster  ================
B D                       Rat  ================
B D                     Mouse  ================
      Lesser Egyptian jerboa  ================
                 Zebra mbuna  ================
         Pundamilia nyererei  ================
B D                    Lizard  ================
B D              Nile tilapia  ================
       Burton's mouthbreeder  ================
B D               Stickleback  ================
                    Aardvark  ================
B D                   Wallaby  ================
  D    White-throated sparrow  ================
                 Spotted gar  ================
B D                    Medaka  ================
B D                 Zebrafish  ================
  D           Green seaturtle  ================
  D  Chinese softshell turtle  ================
  D    Spiny softshell turtle  ================
  D            Painted turtle  ================
B D                Budgerigar  ================
  D          Peregrine falcon  ================
  D              Saker falcon  ================
          Tibetan ground jay  ================
  D               Rock pigeon  ================
  D       Collared flycatcher  ================
B D           Tasmanian devil  ================
B D                   Opossum  ================
B D              Atlantic cod  ================
B D                    Turkey  ================
               Big brown bat  ================
B D                   Chicken  ================
B D       Medium ground finch  ================
B D                  Platypus  ================
B D                  Elephant  ================
B D                  Squirrel  ================
B D                  Microbat  ================
        David's myotis (bat)  ================
B D                       Dog  ================
B D        American alligator  ================
B D               Zebra finch  ================
B D                   Ferret   ================
B D                       Cat  ================

Inserts between block 2 and 3 in window
B D                      Pig 1bp
B D                   Alpaca 1bp
              Bactrian camel 1bp
B D                  Dolphin 1bp
                Killer whale 1bp
            Tibetan antelope 1bp
B D                      Cow 1bp
B D                    Sheep 1bp
               Domestic goat 1bp
B D                    Horse 3720bp
B D                    Panda 1bp
              Pacific walrus 1bp
                Weddell seal 1bp
            Black flying-fox 1bp
B D                  Megabat 1bp

Alignment block 3 of 38 in window, 42879827 - 42879884, 58 bps 
B D                     Human  ggagagacg-------------taggac-----ctgatgatggctactagatgcctggt--aaatgatcc
B D                     Chimp  ggagagacg-------------taggac-----c---tgatggctactagatgcctggt--aaatgatcc
B D                   Gorilla  ggagagacg-------------taggac-----c---tgatggctactagatgcctggt--aaatgatcc
B D                 Orangutan  ggagagacg-------------taggac-----c---tgatagctactagatgcctggt--aaatgatcc
B D                    Gibbon  ggagagacg-------------taggac-----c---cgatagctactagatgcctggt--aaatgatcc
B D                    Rhesus  ggaga--------------------gac-----c---tgatagctacttgatg-----------------
B D       Crab-eating macaque  ggaga--------------------gac-----c---tgatagctacttgatg-----------------
B D                    Baboon  ggaga--------------------gac-----c---tgatagctacttgatg-----------------
B D              Green monkey  ggaga--------------------gac-----c---tgatagctacttgatg-----------------
B D                  Marmoset  ggagagacg-------------taggac-----c---tgatagctacttgatggctggtaaaaatgatcc
B D           Squirrel monkey  ggagagacgt------------taggac-----c---tgatagctgcgtgatgcctggt--aaatgatcc
B D                  Bushbaby  ggcgcgccctg---------gacaaaac-----a---aaatacctacttggag-ccagt--aaatgttcc
           Chinese tree shrew  -------------------------aaa-----c---tgctatatacttggtgcctagt--aaatactac
B D            Naked mole-rat  gggca-----------------gagcac-----c---ccgtgcccacttggtg-ctgac--aaatg-tcc
B D                Guinea pig  gcaca-----------------gagcccccacgc---ccctacccacttggtg-ttgac--aaata-gcc
                   Chinchilla  ggaca-----------------gagcgc-----c---tcgtacccacttggtg-ttgac--cgata-tcc
             Brush-tailed rat  agaca-----------------gagcct-----c---tcgtacccacttggta-ttgac--aaata--cc
B D                       Pig  gttgacttg-------------accggc-----c---tcgaacctacttggtttttaat--aaatactcc
B D                    Alpaca  ggcgacttg-------------gct--c-----t---tagtaaatat--------------------tcc
               Bactrian camel  ggcgacttg-------------gct--c-----t---tagtaaatat--------------------tcc
B D                   Dolphin  ggcgacttg-------------gccggc-----c---tggtacctacttgg----------------tcc
                 Killer whale  ggcgacttg-------------gccggc-----c---tggtacctacttgg----------------tcc
             Tibetan antelope  ggcgacctg-------------gccggt-----c---tggtacctacttgg----------------tcc
B D                       Cow  ggcgacttg-------------gccggt-----c---tggtacctacttgg----------------tcc
B D                     Sheep  ggcgacctg-------------gccggt-----c---tggtacctacttgg----------------tcc
                Domestic goat  ggcgacctg-------------gccggt-----c---tggtacctacttgg----------------tcc
B D          White rhinoceros  -------tg-------------atacca-----ct--tggtacctacaaggttcttagc--aaatattcc
B D                     Panda  agcgacgtg-------------gtcctg-----c---tgatatatgctgggctcttagt--aagcgttcc
               Pacific walrus  ggcgacgtg-------------gtcctg-----c---tggtacctgctgggctcttagt--aagcgtttc
                 Weddell seal  ggcgacgtg-------------gtcctg-----c---tggtacctgctgggctcttagt--aagcgttcc
             Black flying-fox  ggccattcg-------------atctgc-----c---tggtgcctgacaggttctcagt--aaatatccc
B D                   Megabat  ggccattcg-------------atctgc-----c---tggtgcctgacaggttctcagt--aaatatccc
          Cape elephant shrew  ----------aggcaacttcagcaacgc-----t---tggtaccttctttgtgcttagt--aaatatctc
B D                   Manatee  ----------gctcgacttggacagcgc-----t---tgataacttcttgttgcttagt--aaatatttc
             Cape golden mole  ----------gcaggacttggacagtac-----t---tgatgccttattgctacttagt--aaatattcc
B D                 Armadillo  ----------gtcc--cttcgacagtac-----c---tggtacctacttggtgctaggt--aaaaatttc
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                    Lizard  ======================================================================
B D              Nile tilapia  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D               Stickleback  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                 Spotted gar  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
          Tibetan ground jay  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                  Platypus  ======================================================================
B D                  Elephant  ======================================================================
B D                  Squirrel  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
B D                     Horse  ======================================================================

                        Human  ttcaagaa
                        Chimp  ttcaagaa
                      Gorilla  ttcaagaa
                    Orangutan  ttcaagaa
                       Gibbon  ttcaagaa
                       Rhesus  --------
          Crab-eating macaque  --------
                       Baboon  --------
                 Green monkey  --------
                     Marmoset  ttcaagaa
              Squirrel monkey  ttcgggaa
                     Bushbaby  ttcaagaa
           Chinese tree shrew  ttcaagaa
               Naked mole-rat  ttcaagaa
                   Guinea pig  ttcaagaa
                   Chinchilla  ttcaagaa
             Brush-tailed rat  ttcaagaa
                          Pig  tccaagaa
                       Alpaca  ttcaagaa
               Bactrian camel  ttcaagaa
                      Dolphin  ttcaaaaa
                 Killer whale  ttcaaaaa
             Tibetan antelope  ttcaagaa
                          Cow  ttcaagaa
                        Sheep  ttcaagaa
                Domestic goat  ttcaagaa
             White rhinoceros  ttcacgaa
                        Panda  tgccagag
               Pacific walrus  tgcaagag
                 Weddell seal  tgcaagag
             Black flying-fox  ttcaagac
                      Megabat  ttcaagac
          Cape elephant shrew  ttcagaaa
                      Manatee  ttaaaaaa
             Cape golden mole  ttcaaaaa
                    Armadillo  ttgaaaaa
               Golden hamster  ========
                       Tenrec  ========
                 Prairie vole  ========
              Chinese hamster  ========
                          Rat  ========
                        Mouse  ========
       Lesser Egyptian jerboa  ========
                  Zebra mbuna  ========
          Pundamilia nyererei  ========
                       Lizard  ========
                 Nile tilapia  ========
        Burton's mouthbreeder  ========
                  Stickleback  ========
                     Aardvark  ========
                      Wallaby  ========
       White-throated sparrow  ========
                  Spotted gar  ========
                       Medaka  ========
                    Zebrafish  ========
              Green seaturtle  ========
     Chinese softshell turtle  ========
       Spiny softshell turtle  ========
               Painted turtle  ========
                   Budgerigar  ========
             Peregrine falcon  ========
                 Saker falcon  ========
           Tibetan ground jay  ========
                  Rock pigeon  ========
          Collared flycatcher  ========
              Tasmanian devil  ========
                      Opossum  ========
                 Atlantic cod  ========
                       Turkey  ========
                Big brown bat  ========
                      Chicken  ========
          Medium ground finch  ========
                     Platypus  ========
                     Elephant  ========
                     Squirrel  ========
                     Microbat  ========
         David's myotis (bat)  ========
                          Dog  ========
           American alligator  ========
                  Zebra finch  ========
                      Ferret   ========
                          Cat  ========
                        Horse  ========

Inserts between block 3 and 4 in window
B D         White rhinoceros 1279bp

Alignment block 4 of 38 in window, 42879885 - 42879887, 3 bps 
B D                     Human  gtg
B D                     Chimp  gtc
B D                   Gorilla  gtg
B D                 Orangutan  gtg
B D                    Gibbon  gtg
B D                  Marmoset  gtg
B D           Squirrel monkey  gtg
B D                  Bushbaby  ata
           Chinese tree shrew  atg
B D            Naked mole-rat  atg
B D                Guinea pig  atg
                   Chinchilla  atg
             Brush-tailed rat  gtg
B D                       Pig  acg
B D                    Alpaca  acg
               Bactrian camel  acg
B D                   Dolphin  gtg
                 Killer whale  gtg
             Tibetan antelope  ctg
B D                       Cow  ctg
B D                     Sheep  ctg
                Domestic goat  ctg
B D                     Panda  gtg
               Pacific walrus  gtg
                 Weddell seal  gtg
             Black flying-fox  acg
B D                   Megabat  acg
          Cape elephant shrew  atg
B D                   Manatee  atg
             Cape golden mole  gtg
B D                 Armadillo  agg
              Golden hamster  ===
B D                    Tenrec  ===
                Prairie vole  ===
B D           Chinese hamster  ===
B D                       Rat  ===
B D                     Mouse  ===
      Lesser Egyptian jerboa  ===
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
B D                    Lizard  ===
B D              Nile tilapia  ===
       Burton's mouthbreeder  ===
B D               Stickleback  ===
                    Aardvark  ===
B D                    Baboon  ---
B D                   Wallaby  ===
  D    White-throated sparrow  ===
                 Spotted gar  ===
B D                    Medaka  ===
B D                 Zebrafish  ===
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===
  D    Spiny softshell turtle  ===
  D            Painted turtle  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
          Tibetan ground jay  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
B D              Atlantic cod  ===
B D                    Turkey  ===
               Big brown bat  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                  Platypus  ===
B D                  Elephant  ===
B D                  Squirrel  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                       Dog  ===
B D        American alligator  ===
B D               Zebra finch  ===
B D                   Ferret   ===
B D                       Cat  ===
B D          White rhinoceros  ===
B D                     Horse  ===
B D              Green monkey  ---
B D       Crab-eating macaque  ---
B D                    Rhesus  ---

Inserts between block 4 and 5 in window
B D           Naked mole-rat 18bp

Alignment block 5 of 38 in window, 42879888 - 42879888, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                Guinea pig  a
                   Chinchilla  g
             Brush-tailed rat  g
B D                       Pig  g
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  a
B D                   Megabat  a
          Cape elephant shrew  a
B D                   Manatee  a
             Cape golden mole  a
B D                 Armadillo  a
              Golden hamster  =
B D                    Tenrec  =
                Prairie vole  =
B D           Chinese hamster  =
B D                       Rat  =
B D            Naked mole-rat  =
B D                     Mouse  =
      Lesser Egyptian jerboa  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
B D                    Lizard  =
B D              Nile tilapia  =
       Burton's mouthbreeder  =
B D               Stickleback  =
                    Aardvark  =
B D                    Baboon  -
B D                   Wallaby  =
  D    White-throated sparrow  =
                 Spotted gar  =
B D                    Medaka  =
B D                 Zebrafish  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
          Tibetan ground jay  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Opossum  =
B D              Atlantic cod  =
B D                    Turkey  =
               Big brown bat  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                  Platypus  =
B D                  Elephant  =
B D                  Squirrel  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                       Dog  =
B D        American alligator  =
B D               Zebra finch  =
B D                   Ferret   =
B D                       Cat  =
B D          White rhinoceros  =
B D                     Horse  =
B D              Green monkey  -
B D       Crab-eating macaque  -
B D                    Rhesus  -

Inserts between block 5 and 6 in window
B D               Guinea pig 17bp
B D                      Pig 2bp
B D                   Alpaca 11871bp
              Bactrian camel 11898bp
B D                  Dolphin 2bp
                Killer whale 6493bp
            Tibetan antelope 2bp
B D                      Cow 2bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp

Alignment block 6 of 38 in window, 42879889 - 42879890, 2 bps 
B D                     Human  --at
B D                     Chimp  --at
B D                   Gorilla  --at
B D                 Orangutan  --at
B D                    Gibbon  --at
B D                  Marmoset  --at
B D           Squirrel monkey  --at
B D                  Bushbaby  --ct
           Chinese tree shrew  --gt
                   Chinchilla  ---t
             Brush-tailed rat  ---t
B D                       Pig  --g-
B D                   Dolphin  --g-
             Tibetan antelope  --g-
B D                       Cow  --g-
B D                     Sheep  --g-
                Domestic goat  --g-
B D                     Panda  --g-
               Pacific walrus  --g-
                 Weddell seal  --g-
             Black flying-fox  --g-
B D                   Megabat  --g-
          Cape elephant shrew  at--
B D                   Manatee  gt--
             Cape golden mole  at--
B D                 Armadillo  ac--
              Golden hamster  ====
B D                    Tenrec  ====
                Prairie vole  ====
B D           Chinese hamster  ====
B D                       Rat  ====
B D            Naked mole-rat  ====
B D                     Mouse  ====
      Lesser Egyptian jerboa  ====
B D                Guinea pig  ====
                 Zebra mbuna  ====
         Pundamilia nyererei  ====
B D                    Lizard  ====
B D              Nile tilapia  ====
       Burton's mouthbreeder  ====
B D               Stickleback  ====
                    Aardvark  ====
B D                    Baboon  ----
B D                   Wallaby  ====
  D    White-throated sparrow  ====
                 Spotted gar  ====
B D                    Medaka  ====
B D                 Zebrafish  ====
  D           Green seaturtle  ====
  D  Chinese softshell turtle  ====
  D    Spiny softshell turtle  ====
  D            Painted turtle  ====
B D                Budgerigar  ====
  D          Peregrine falcon  ====
  D              Saker falcon  ====
          Tibetan ground jay  ====
  D               Rock pigeon  ====
  D       Collared flycatcher  ====
B D           Tasmanian devil  ====
B D                   Opossum  ====
                Killer whale  ====
              Bactrian camel  ====
B D              Atlantic cod  ====
B D                    Turkey  ====
               Big brown bat  ====
B D                   Chicken  ====
B D       Medium ground finch  ====
B D                  Platypus  ====
B D                  Elephant  ====
B D                  Squirrel  ====
B D                  Microbat  ====
        David's myotis (bat)  ====
B D                       Dog  ====
B D        American alligator  ====
B D               Zebra finch  ====
B D                    Alpaca  ====
B D                   Ferret   ====
B D                       Cat  ====
B D          White rhinoceros  ====
B D                     Horse  ====
B D              Green monkey  ----
B D       Crab-eating macaque  ----
B D                    Rhesus  ----

Inserts between block 6 and 7 in window
          Chinese tree shrew 880bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp
B D                      Pig 2bp
B D                  Dolphin 2bp
            Tibetan antelope 2bp
B D                      Cow 1bp
B D                    Sheep 2bp
               Domestic goat 2bp
B D                    Panda 2bp
              Pacific walrus 2bp
                Weddell seal 2bp
            Black flying-fox 2bp
B D                  Megabat 2bp

Alignment block 7 of 38 in window, 42879891 - 42879892, 2 bps 
B D                     Human  ga
B D                     Chimp  ga
B D                   Gorilla  ga
B D                 Orangutan  ga
B D                    Gibbon  ga
B D                  Marmoset  ga
B D           Squirrel monkey  ga
B D                  Bushbaby  ga
          Cape elephant shrew  ga
B D                   Manatee  ac
             Cape golden mole  aa
B D                 Armadillo  ga
              Golden hamster  ==
B D                    Tenrec  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                       Rat  ==
B D            Naked mole-rat  ==
                  Chinchilla  ==
B D                     Mouse  ==
            Brush-tailed rat  ==
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
B D                   Dolphin  ==
B D                   Megabat  ==
B D                       Pig  ==
                    Aardvark  ==
B D                    Baboon  --
B D                   Wallaby  ==
  D    White-throated sparrow  ==
                 Spotted gar  ==
B D                    Medaka  ==
B D                 Zebrafish  ==
                Weddell seal  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  ==
              Bactrian camel  ==
B D              Atlantic cod  ==
B D                    Turkey  ==
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                  Platypus  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
            Black flying-fox  ==
B D                  Squirrel  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                       Dog  ==
               Domestic goat  ==
B D        American alligator  ==
B D               Zebra finch  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
B D                   Ferret   ==
          Chinese tree shrew  ==
B D                       Cat  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D              Green monkey  --
B D       Crab-eating macaque  --
B D                    Rhesus  --

Inserts between block 7 and 8 in window
B D                 Marmoset 1bp
B D          Squirrel monkey 1bp
B D                Armadillo 32650bp

Alignment block 8 of 38 in window, 42879893 - 42879894, 2 bps 
B D                     Human  ac
B D                     Chimp  ac
B D                   Gorilla  ac
B D                 Orangutan  gc
B D                    Gibbon  gc
B D                  Marmoset  gc
B D           Squirrel monkey  gc
                   Chinchilla  -c
             Brush-tailed rat  -c
B D                       Pig  tc
B D                   Dolphin  tc
             Tibetan antelope  tc
B D                     Sheep  tc
                Domestic goat  tc
B D                     Panda  aa
               Pacific walrus  gt
                 Weddell seal  gg
             Black flying-fox  ct
B D                   Megabat  ct
          Cape elephant shrew  gc
B D                   Manatee  gt
             Cape golden mole  gc
              Golden hamster  ==
B D                    Tenrec  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                       Rat  ==
B D            Naked mole-rat  ==
B D                 Armadillo  ==
B D                     Mouse  ==
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
                    Aardvark  ==
B D                    Baboon  --
B D                   Wallaby  ==
  D    White-throated sparrow  ==
                 Spotted gar  ==
B D                    Medaka  ==
B D                 Zebrafish  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  ==
              Bactrian camel  ==
B D              Atlantic cod  ==
B D                    Turkey  ==
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                  Platypus  ==
B D                       Cow  ==
B D                  Elephant  ==
B D                  Squirrel  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                       Dog  ==
B D        American alligator  ==
B D               Zebra finch  ==
B D                    Alpaca  ==
B D                   Ferret   ==
          Chinese tree shrew  ==
B D                       Cat  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Bushbaby  --
B D              Green monkey  --
B D       Crab-eating macaque  --
B D                    Rhesus  --

Inserts between block 8 and 9 in window
         Cape elephant shrew 50575bp
B D                  Manatee 5bp
            Cape golden mole 6bp

Alignment block 9 of 38 in window, 42879895 - 42879899, 5 bps 
B D                     Human  --cggg-----------------------------------------------g
B D                     Chimp  --cggg-----------------------------------------------g
B D                   Gorilla  --cggg-----------------------------------------------g
B D                 Orangutan  --cggg-----------------------------------------------g
B D                    Gibbon  --cggg-----------------------------------------------g
B D                  Marmoset  --ccgg-----------------------------------------------c
B D           Squirrel monkey  --ctgg-----------------------------------------------c
                   Chinchilla  --tagggaacatcaggcccaggaatcggccgcgggggtgggtgtcactggtggg
             Brush-tailed rat  --tcgg------------------------------------------------
B D                       Pig  --tgag------------------------------------------------
B D                   Dolphin  --tgag------------------------------------------------
             Tibetan antelope  --tgag------------------------------------------------
B D                     Sheep  --tgag------------------------------------------------
                Domestic goat  --tgag------------------------------------------------
B D                     Panda  --tgag------------------------------------------------
               Pacific walrus  --tgac------------------------------------------------
                 Weddell seal  --tgag------------------------------------------------
             Black flying-fox  --t---------------------------------------------------
B D                   Megabat  --t---------------------------------------------------
B D                   Manatee  agtgg-------------------------------------------------
             Cape golden mole  gttta-------------------------------------------------
              Golden hamster  ======================================================
B D                    Tenrec  ======================================================
                Prairie vole  ======================================================
B D           Chinese hamster  ======================================================
B D                       Rat  ======================================================
B D            Naked mole-rat  ======================================================
B D                 Armadillo  ======================================================
         Cape elephant shrew  ======================================================
B D                     Mouse  ======================================================
      Lesser Egyptian jerboa  ======================================================
B D                Guinea pig  ======================================================
                 Zebra mbuna  ======================================================
         Pundamilia nyererei  ======================================================
B D                    Lizard  ======================================================
B D              Nile tilapia  ======================================================
       Burton's mouthbreeder  ======================================================
B D               Stickleback  ======================================================
                    Aardvark  ======================================================
B D                    Baboon  ------------------------------------------------------
B D                   Wallaby  ======================================================
  D    White-throated sparrow  ======================================================
                 Spotted gar  ======================================================
B D                    Medaka  ======================================================
B D                 Zebrafish  ======================================================
  D           Green seaturtle  ======================================================
  D  Chinese softshell turtle  ======================================================
  D    Spiny softshell turtle  ======================================================
  D            Painted turtle  ======================================================
B D                Budgerigar  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
          Tibetan ground jay  ======================================================
  D               Rock pigeon  ======================================================
  D       Collared flycatcher  ======================================================
B D           Tasmanian devil  ======================================================
B D                   Opossum  ======================================================
                Killer whale  ======================================================
              Bactrian camel  ======================================================
B D              Atlantic cod  ======================================================
B D                    Turkey  ======================================================
               Big brown bat  ======================================================
B D                   Chicken  ======================================================
B D       Medium ground finch  ======================================================
B D                  Platypus  ======================================================
B D                       Cow  ======================================================
B D                  Elephant  ======================================================
B D                  Squirrel  ======================================================
B D                  Microbat  ======================================================
        David's myotis (bat)  ======================================================
B D                       Dog  ======================================================
B D        American alligator  ======================================================
B D               Zebra finch  ======================================================
B D                    Alpaca  ======================================================
B D                   Ferret   ======================================================
          Chinese tree shrew  ======================================================
B D                       Cat  ======================================================
B D          White rhinoceros  ======================================================
B D                     Horse  ======================================================
B D                  Bushbaby  ------------------------------------------------------
B D              Green monkey  ------------------------------------------------------
B D       Crab-eating macaque  ------------------------------------------------------
B D                    Rhesus  ------------------------------------------------------

Inserts between block 9 and 10 in window
B D                  Dolphin 5683bp
            Tibetan antelope 11740bp
B D                    Sheep 9133bp
               Domestic goat 9106bp
            Black flying-fox 2bp
B D                  Megabat 2bp

Alignment block 10 of 38 in window, 42879900 - 42879905, 6 bps 
B D                     Human  gccgtg
B D                     Chimp  gccgtg
B D                   Gorilla  gccgtg
B D                 Orangutan  gccgtg
B D                    Gibbon  gccgtg
B D                    Rhesus  --cgtg
B D       Crab-eating macaque  --cgtg
B D                    Baboon  --cgtg
B D              Green monkey  --cgtg
B D                  Marmoset  gcggcg
B D           Squirrel monkey  gcggcg
                   Chinchilla  gtcgcg
B D                       Pig  --ctcg
B D                       Cow  gtctga
B D                     Panda  --ccca
               Pacific walrus  --cctg
                 Weddell seal  --cctg
B D                   Manatee  gcggtt
             Cape golden mole  gcagtt
              Golden hamster  ======
B D                    Tenrec  ======
                Prairie vole  ======
B D           Chinese hamster  ======
B D                       Rat  ======
B D            Naked mole-rat  ======
B D                 Armadillo  ======
         Cape elephant shrew  ======
B D                     Mouse  ======
            Brush-tailed rat  ------
      Lesser Egyptian jerboa  ======
B D                Guinea pig  ======
                 Zebra mbuna  ======
         Pundamilia nyererei  ======
B D                    Lizard  ======
B D              Nile tilapia  ======
       Burton's mouthbreeder  ======
B D               Stickleback  ======
B D                   Dolphin  ======
B D                   Megabat  ======
                    Aardvark  ======
B D                   Wallaby  ======
  D    White-throated sparrow  ======
                 Spotted gar  ======
B D                    Medaka  ======
B D                 Zebrafish  ======
  D           Green seaturtle  ======
  D  Chinese softshell turtle  ======
  D    Spiny softshell turtle  ======
  D            Painted turtle  ======
B D                Budgerigar  ======
  D          Peregrine falcon  ======
  D              Saker falcon  ======
          Tibetan ground jay  ======
  D               Rock pigeon  ======
  D       Collared flycatcher  ======
B D           Tasmanian devil  ======
B D                   Opossum  ======
                Killer whale  ======
              Bactrian camel  ======
B D              Atlantic cod  ======
B D                    Turkey  ======
               Big brown bat  ======
B D                   Chicken  ======
B D       Medium ground finch  ======
B D                  Platypus  ======
B D                     Sheep  ======
            Tibetan antelope  ======
B D                  Elephant  ======
            Black flying-fox  ======
B D                  Squirrel  ======
B D                  Microbat  ======
        David's myotis (bat)  ======
B D                       Dog  ======
               Domestic goat  ======
B D        American alligator  ======
B D               Zebra finch  ======
B D                    Alpaca  ======
B D                   Ferret   ======
          Chinese tree shrew  ======
B D                       Cat  ======
B D          White rhinoceros  ======
B D                     Horse  ======
B D                  Bushbaby  ------

Inserts between block 10 and 11 in window
B D                      Pig 11498bp
B D                    Panda 15bp
              Pacific walrus 15bp
                Weddell seal 15bp

Alignment block 11 of 38 in window, 42879906 - 42879913, 8 bps 
B D                     Human  gctca---ca--------------------------------------------t
B D                     Chimp  gctca---ca--------------------------------------------t
B D                   Gorilla  gctca---ca--------------------------------------------t
B D                 Orangutan  gctca---ca--------------------------------------------t
B D                    Gibbon  gctca---cg--------------------------------------------t
B D                    Rhesus  cctca---ca--------------------------------------------t
B D       Crab-eating macaque  cctca---ca--------------------------------------------t
B D                    Baboon  cctca---ca--------------------------------------------t
B D              Green monkey  gctca---ca--------------------------------------------t
B D                  Marmoset  gctca---cacctgtactccctgcactttgggagacctaggcgggcggatcacct
B D           Squirrel monkey  gctca---cgcctgtaatccctgcactttgggagaccta-------ggatcacct
B D                  Bushbaby  gtttg---ag--------------------------------------------t
                   Chinchilla  gctga---tg--------------accttggacgagcgcct-------------g
B D                       Cow  gttcgcat-----------------------------------------------
B D                     Panda  gctca--------------------------------------------------
               Pacific walrus  gctca--------------------------------------------------
                 Weddell seal  gctca--------------------------------------------------
             Black flying-fox  gttcagat-----------------------------------------------
B D                   Megabat  gttcagat-----------------------------------------------
B D                   Manatee  cctca---aaaacttacacat----------------------------------
             Cape golden mole  ccaca---aa---------------------------------------------
              Golden hamster  =======================================================
B D                    Tenrec  =======================================================
                Prairie vole  =======================================================
B D           Chinese hamster  =======================================================
B D                       Rat  =======================================================
B D            Naked mole-rat  =======================================================
B D                 Armadillo  =======================================================
         Cape elephant shrew  =======================================================
B D                     Mouse  =======================================================
            Brush-tailed rat  -------------------------------------------------------
      Lesser Egyptian jerboa  =======================================================
B D                Guinea pig  =======================================================
                 Zebra mbuna  =======================================================
         Pundamilia nyererei  =======================================================
B D                    Lizard  =======================================================
B D              Nile tilapia  =======================================================
       Burton's mouthbreeder  =======================================================
B D               Stickleback  =======================================================
B D                   Dolphin  =======================================================
B D                       Pig  =======================================================
                    Aardvark  =======================================================
B D                   Wallaby  =======================================================
  D    White-throated sparrow  =======================================================
                 Spotted gar  =======================================================
B D                    Medaka  =======================================================
B D                 Zebrafish  =======================================================
  D           Green seaturtle  =======================================================
  D  Chinese softshell turtle  =======================================================
  D    Spiny softshell turtle  =======================================================
  D            Painted turtle  =======================================================
B D                Budgerigar  =======================================================
  D          Peregrine falcon  =======================================================
  D              Saker falcon  =======================================================
          Tibetan ground jay  =======================================================
  D               Rock pigeon  =======================================================
  D       Collared flycatcher  =======================================================
B D           Tasmanian devil  =======================================================
B D                   Opossum  =======================================================
                Killer whale  =======================================================
              Bactrian camel  =======================================================
B D              Atlantic cod  =======================================================
B D                    Turkey  =======================================================
               Big brown bat  =======================================================
B D                   Chicken  =======================================================
B D       Medium ground finch  =======================================================
B D                  Platypus  =======================================================
B D                     Sheep  =======================================================
            Tibetan antelope  =======================================================
B D                  Elephant  =======================================================
B D                  Squirrel  =======================================================
B D                  Microbat  =======================================================
        David's myotis (bat)  =======================================================
B D                       Dog  =======================================================
               Domestic goat  =======================================================
B D        American alligator  =======================================================
B D               Zebra finch  =======================================================
B D                    Alpaca  =======================================================
B D                   Ferret   =======================================================
          Chinese tree shrew  =======================================================
B D                       Cat  =======================================================
B D          White rhinoceros  =======================================================
B D                     Horse  =======================================================

Inserts between block 11 and 12 in window
B D                      Cow 9629bp
            Black flying-fox 4bp
B D                  Megabat 4bp

Alignment block 12 of 38 in window, 42879914 - 42879933, 20 bps 
B D                     Human  gaagtcagcagttcgagagc
B D                     Chimp  gaagtcagcagttcgagacc
B D                   Gorilla  gaagtcagcaattcgagacc
B D                 Orangutan  gaagtcagcagttcgagacc
B D                    Gibbon  gaagtcagcagttcgagacc
B D                    Rhesus  gaagtcagcagttcgaaact
B D       Crab-eating macaque  gaagtcagcagttcgaaact
B D                    Baboon  gaagtcagcagttcgaaact
B D              Green monkey  gaagtcagcagttcgagact
B D                  Marmoset  gaggtcgggagttcgagacc
B D           Squirrel monkey  gaggtcgggagttcgagacc
B D                  Bushbaby  g-------------------
                   Chinchilla  ctacccaccacaccgagacg
B D                     Panda  gagctcaggagctggaaggg
               Pacific walrus  gagctcaggcgctggaaggg
                 Weddell seal  gagttcaggcgctggaaggg
B D                   Manatee  agaatcaccattgctattgc
              Golden hamster  ====================
B D                    Tenrec  ====================
                Prairie vole  ====================
B D           Chinese hamster  ====================
B D                       Rat  ====================
B D            Naked mole-rat  ====================
B D                 Armadillo  ====================
         Cape elephant shrew  ====================
B D                     Mouse  ====================
            Brush-tailed rat  --------------------
      Lesser Egyptian jerboa  ====================
B D                Guinea pig  ====================
                 Zebra mbuna  ====================
         Pundamilia nyererei  ====================
B D                    Lizard  ====================
B D              Nile tilapia  ====================
       Burton's mouthbreeder  ====================
B D               Stickleback  ====================
B D                   Dolphin  ====================
B D                   Megabat  ====================
B D                       Pig  ====================
                    Aardvark  ====================
B D                   Wallaby  ====================
  D    White-throated sparrow  ====================
                 Spotted gar  ====================
B D                    Medaka  ====================
B D                 Zebrafish  ====================
  D           Green seaturtle  ====================
  D  Chinese softshell turtle  ====================
  D    Spiny softshell turtle  ====================
  D            Painted turtle  ====================
            Cape golden mole  --------------------
B D                Budgerigar  ====================
  D          Peregrine falcon  ====================
  D              Saker falcon  ====================
          Tibetan ground jay  ====================
  D               Rock pigeon  ====================
  D       Collared flycatcher  ====================
B D           Tasmanian devil  ====================
B D                   Opossum  ====================
                Killer whale  ====================
              Bactrian camel  ====================
B D              Atlantic cod  ====================
B D                    Turkey  ====================
               Big brown bat  ====================
B D                   Chicken  ====================
B D       Medium ground finch  ====================
B D                  Platypus  ====================
B D                     Sheep  ====================
B D                       Cow  ====================
            Tibetan antelope  ====================
B D                  Elephant  ====================
            Black flying-fox  ====================
B D                  Squirrel  ====================
B D                  Microbat  ====================
        David's myotis (bat)  ====================
B D                       Dog  ====================
               Domestic goat  ====================
B D        American alligator  ====================
B D               Zebra finch  ====================
B D                    Alpaca  ====================
B D                   Ferret   ====================
          Chinese tree shrew  ====================
B D                       Cat  ====================
B D          White rhinoceros  ====================
B D                     Horse  ====================

Inserts between block 12 and 13 in window
B D                  Manatee 462bp

Alignment block 13 of 38 in window, 42879934 - 42879938, 5 bps 
B D                     Human  agcct
B D                     Chimp  agcct
B D                   Gorilla  agcct
B D                 Orangutan  agcct
B D                    Gibbon  agcct
B D                    Rhesus  agcct
B D       Crab-eating macaque  agcct
B D                    Baboon  agcct
B D              Green monkey  agcct
B D                  Marmoset  agtct
B D           Squirrel monkey  agtct
                   Chinchilla  agccc
B D                     Panda  agcct
               Pacific walrus  agcct
                 Weddell seal  agcct
             Cape golden mole  atctt
              Golden hamster  =====
B D                    Tenrec  =====
                Prairie vole  =====
B D           Chinese hamster  =====
B D                       Rat  =====
B D            Naked mole-rat  =====
B D                 Armadillo  =====
         Cape elephant shrew  =====
B D                     Mouse  =====
            Brush-tailed rat  -----
      Lesser Egyptian jerboa  =====
B D                Guinea pig  =====
                 Zebra mbuna  =====
         Pundamilia nyererei  =====
B D                    Lizard  =====
B D              Nile tilapia  =====
       Burton's mouthbreeder  =====
B D               Stickleback  =====
B D                   Dolphin  =====
B D                   Megabat  =====
B D                       Pig  =====
                    Aardvark  =====
B D                   Wallaby  =====
  D    White-throated sparrow  =====
                 Spotted gar  =====
B D                    Medaka  =====
B D                 Zebrafish  =====
  D           Green seaturtle  =====
  D  Chinese softshell turtle  =====
  D    Spiny softshell turtle  =====
  D            Painted turtle  =====
B D                Budgerigar  =====
  D          Peregrine falcon  =====
  D              Saker falcon  =====
          Tibetan ground jay  =====
  D               Rock pigeon  =====
  D       Collared flycatcher  =====
B D           Tasmanian devil  =====
B D                   Opossum  =====
                Killer whale  =====
              Bactrian camel  =====
B D              Atlantic cod  =====
B D                    Turkey  =====
B D                   Manatee  =====
               Big brown bat  =====
B D                   Chicken  =====
B D       Medium ground finch  =====
B D                  Platypus  =====
B D                     Sheep  =====
B D                       Cow  =====
            Tibetan antelope  =====
B D                  Elephant  =====
            Black flying-fox  =====
B D                  Squirrel  =====
B D                  Microbat  =====
        David's myotis (bat)  =====
B D                       Dog  =====
               Domestic goat  =====
B D        American alligator  =====
B D               Zebra finch  =====
B D                    Alpaca  =====
B D                   Ferret   =====
          Chinese tree shrew  =====
B D                       Cat  =====
B D          White rhinoceros  =====
B D                     Horse  =====
B D                  Bushbaby  -----

Inserts between block 13 and 14 in window
B D                    Panda 9868bp
              Pacific walrus 9833bp
                Weddell seal 10046bp

Alignment block 14 of 38 in window, 42879939 - 42879947, 9 bps 
B D                     Human  gaccaatat
B D                     Chimp  gaccaatat
B D                   Gorilla  gaccaatat
B D                 Orangutan  gaccaatat
B D                    Gibbon  gaccaatat
B D                    Rhesus  gaccaatat
B D       Crab-eating macaque  gaccaatat
B D                    Baboon  gaccaatat
B D              Green monkey  gaccaatat
B D                  Marmoset  gaccaacat
B D           Squirrel monkey  gaccaacat
B D                  Bushbaby  ----aatat
                   Chinchilla  gg--aagag
             Cape golden mole  ---aaaca-
              Golden hamster  =========
B D                    Tenrec  =========
                Prairie vole  =========
B D           Chinese hamster  =========
B D                       Rat  =========
B D            Naked mole-rat  =========
B D                 Armadillo  =========
         Cape elephant shrew  =========
B D                     Mouse  =========
            Brush-tailed rat  ---------
      Lesser Egyptian jerboa  =========
B D                Guinea pig  =========
                 Zebra mbuna  =========
         Pundamilia nyererei  =========
B D                    Lizard  =========
B D              Nile tilapia  =========
       Burton's mouthbreeder  =========
B D               Stickleback  =========
B D                   Dolphin  =========
B D                   Megabat  =========
B D                       Pig  =========
                    Aardvark  =========
B D                   Wallaby  =========
  D    White-throated sparrow  =========
                 Spotted gar  =========
B D                    Medaka  =========
B D                 Zebrafish  =========
                Weddell seal  =========
  D           Green seaturtle  =========
  D  Chinese softshell turtle  =========
  D    Spiny softshell turtle  =========
  D            Painted turtle  =========
B D                Budgerigar  =========
  D          Peregrine falcon  =========
  D              Saker falcon  =========
          Tibetan ground jay  =========
  D               Rock pigeon  =========
  D       Collared flycatcher  =========
B D           Tasmanian devil  =========
B D                   Opossum  =========
                Killer whale  =========
              Bactrian camel  =========
B D              Atlantic cod  =========
B D                    Turkey  =========
B D                   Manatee  =========
               Big brown bat  =========
B D                   Chicken  =========
B D       Medium ground finch  =========
B D                  Platypus  =========
B D                     Sheep  =========
B D                       Cow  =========
            Tibetan antelope  =========
B D                  Elephant  =========
            Black flying-fox  =========
B D                  Squirrel  =========
B D                  Microbat  =========
        David's myotis (bat)  =========
B D                       Dog  =========
               Domestic goat  =========
B D        American alligator  =========
B D               Zebra finch  =========
B D                    Alpaca  =========
              Pacific walrus  =========
B D                     Panda  =========
B D                   Ferret   =========
          Chinese tree shrew  =========
B D                       Cat  =========
B D          White rhinoceros  =========
B D                     Horse  =========

Inserts between block 14 and 15 in window
                  Chinchilla 15bp

Alignment block 15 of 38 in window, 42879948 - 42879975, 28 bps 
B D                     Human  ggtgaaacccc-----------------------------------------------------------
B D                     Chimp  ggtgaaacccc-----------------------------------------------------------
B D                   Gorilla  ggtgaaacccc-----------------------------------------------------------
B D                 Orangutan  ggtgaaacccc-----------------------------------------------------------
B D                    Gibbon  ggtgaaacccc-----------------------------------------------------------
B D                    Rhesus  ggtgaaacccc-----------------------------------------------------------
B D       Crab-eating macaque  ggtgaaacccc-----------------------------------------------------------
B D                    Baboon  ggtgaaacccc-----------------------------------------------------------
B D              Green monkey  ggtgaaacccc-----------------------------------------------------------
B D                  Marmoset  ggagaaacccc-----------------------------------------------------------
B D           Squirrel monkey  ggagaaacccc-----------------------------------------------------------
                   Chinchilla  gtttcgaccctaatggtggctattctcgatcgttctgacgcagttgtggcagagtcagcgaccggcagag
             Cape golden mole  ----------------------------------------------------------------------
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                 Armadillo  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  ----------------------------------------------------------------------
      Lesser Egyptian jerboa  ======================================================================
B D                Guinea pig  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                    Lizard  ======================================================================
B D              Nile tilapia  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D               Stickleback  ======================================================================
B D                   Dolphin  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                 Spotted gar  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
                Weddell seal  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
          Tibetan ground jay  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Turkey  ======================================================================
B D                   Manatee  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                  Platypus  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Elephant  ======================================================================
            Black flying-fox  ======================================================================
B D                  Squirrel  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
               Domestic goat  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
          Chinese tree shrew  ======================================================================
B D                       Cat  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------

                        Human  -----------------------------------gtttctactaaaagtac
                        Chimp  -----------------------------------gtttctactaaaagcac
                      Gorilla  -----------------------------------gtttctactaaaagtac
                    Orangutan  -----------------------------------gtttctactaaaaatac
                       Gibbon  -----------------------------------gtttctaccaaaaatac
                       Rhesus  -----------------------------------gtttctactaaaaatat
          Crab-eating macaque  -----------------------------------gtttctactaaaaatat
                       Baboon  -----------------------------------gtttctactaaaaatat
                 Green monkey  -----------------------------------gtttctactaaaaatac
                     Marmoset  -----------------------------------gtcccgactaaaaatac
              Squirrel monkey  -----------------------------------gtcctgactaaaaatac
                   Chinchilla  ggtggggaacgagcagaaccctgagcccttaactggttctcattagaaatat
             Cape golden mole  -------------------------------------------taaaattac
               Golden hamster  ====================================================
                       Tenrec  ====================================================
                 Prairie vole  ====================================================
              Chinese hamster  ====================================================
                          Rat  ====================================================
               Naked mole-rat  ====================================================
                    Armadillo  ====================================================
          Cape elephant shrew  ====================================================
                        Mouse  ====================================================
             Brush-tailed rat  ----------------------------------------------------
       Lesser Egyptian jerboa  ====================================================
                   Guinea pig  ====================================================
                  Zebra mbuna  ====================================================
          Pundamilia nyererei  ====================================================
                       Lizard  ====================================================
                 Nile tilapia  ====================================================
        Burton's mouthbreeder  ====================================================
                  Stickleback  ====================================================
                      Dolphin  ====================================================
                      Megabat  ====================================================
                          Pig  ====================================================
                     Aardvark  ====================================================
                      Wallaby  ====================================================
       White-throated sparrow  ====================================================
                  Spotted gar  ====================================================
                       Medaka  ====================================================
                    Zebrafish  ====================================================
                 Weddell seal  ====================================================
              Green seaturtle  ====================================================
     Chinese softshell turtle  ====================================================
       Spiny softshell turtle  ====================================================
               Painted turtle  ====================================================
                   Budgerigar  ====================================================
             Peregrine falcon  ====================================================
                 Saker falcon  ====================================================
           Tibetan ground jay  ====================================================
                  Rock pigeon  ====================================================
          Collared flycatcher  ====================================================
              Tasmanian devil  ====================================================
                      Opossum  ====================================================
                 Killer whale  ====================================================
               Bactrian camel  ====================================================
                 Atlantic cod  ====================================================
                       Turkey  ====================================================
                      Manatee  ====================================================
                Big brown bat  ====================================================
                      Chicken  ====================================================
          Medium ground finch  ====================================================
                     Platypus  ====================================================
                        Sheep  ====================================================
                          Cow  ====================================================
             Tibetan antelope  ====================================================
                     Elephant  ====================================================
             Black flying-fox  ====================================================
                     Squirrel  ====================================================
                     Microbat  ====================================================
         David's myotis (bat)  ====================================================
                          Dog  ====================================================
                Domestic goat  ====================================================
           American alligator  ====================================================
                  Zebra finch  ====================================================
                       Alpaca  ====================================================
               Pacific walrus  ====================================================
                        Panda  ====================================================
                      Ferret   ====================================================
           Chinese tree shrew  ====================================================
                          Cat  ====================================================
             White rhinoceros  ====================================================
                        Horse  ====================================================
                     Bushbaby  ----------------------------------------------------

Inserts between block 15 and 16 in window
B D                 Marmoset 302bp
                  Chinchilla 1bp

Alignment block 16 of 38 in window, 42879976 - 42879976, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Gibbon  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
             Cape golden mole  c-
              Golden hamster  ==
B D                    Tenrec  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                       Rat  ==
B D            Naked mole-rat  ==
B D                 Armadillo  ==
         Cape elephant shrew  ==
                  Chinchilla  ==
B D                     Mouse  ==
            Brush-tailed rat  --
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
B D                   Dolphin  ==
B D                   Megabat  ==
B D                       Pig  ==
                    Aardvark  ==
B D                   Wallaby  ==
  D    White-throated sparrow  ==
                 Spotted gar  ==
B D                    Medaka  ==
B D                 Zebrafish  ==
                Weddell seal  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  ==
              Bactrian camel  ==
B D              Atlantic cod  ==
B D                    Turkey  ==
B D                   Manatee  ==
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                  Platypus  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
            Black flying-fox  ==
B D                  Squirrel  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                       Dog  ==
               Domestic goat  ==
B D        American alligator  ==
B D               Zebra finch  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
B D                   Ferret   ==
          Chinese tree shrew  ==
B D                       Cat  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D                  Bushbaby  --
B D           Squirrel monkey  --
B D                  Marmoset  ==

Alignment block 17 of 38 in window, 42879977 - 42880030, 54 bps 
B D                     Human  aaaatttgttgggcgtggtggcgtg-----cgact----gtagcccca-------actacttgggaggct
B D                     Chimp  aaaatttgctgggcgtggtggcgtg-----cgact----gtagcccca-------actacttgggaggct
B D                   Gorilla  aaaatttgctgggcgtggtggcgtg-----cgact----gtagcccca-------actacttgggaggct
B D                 Orangutan  aaaatttgctgggcgtggtggcgtg-----cgact----gtaacccca-------actacttgggaggct
B D                    Gibbon  aaaatttgctgggcgtggtggcgtg-----cgact----gtagcccca-------actacttgggaggct
B D                    Rhesus  aaaattagctgggcgtgttggcgtg-----cgact----gtagcccca-------gctacttgggaggct
B D       Crab-eating macaque  aaaatttgctgggcgtggtggcgtg-----cgact----gtagcccca-------gctacttgggaggct
B D                    Baboon  aaaatctgctgggcgtggtggcgtg-----cgact----gtagcccca-------gctacttgggaggct
B D              Green monkey  aaaatttgctgggcgtggtggcgtg-----cgact----gtagcccca-------gctacttgggaggct
B D                  Marmoset  aaaattagccggtcgaagtggcgcg-----ctcct----gtaatccca-------gctactcaggaggct
B D           Squirrel monkey  aaaattagccgggcccggtagcaca-----tgcct-----taatccca-------gccactcgggaggct
                   Chinchilla  tgttttcgccgggcgtggtggcgca-----cgcct----gtaatccca-------gc-actcgggaggct
             Brush-tailed rat  ------cgccaagcgtggtagtaca-----cgcct----gtaatctca-------gc-actcgggaggct
             Cape golden mole  -attgttgttagttgctgtggggtaaattctgactcatagcaaccccatgtgtacgcttctaggaagatt
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                 Armadillo  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                Guinea pig  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                    Lizard  ======================================================================
B D              Nile tilapia  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D               Stickleback  ======================================================================
B D                   Dolphin  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                 Spotted gar  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
                Weddell seal  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
          Tibetan ground jay  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Turkey  ======================================================================
B D                   Manatee  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                  Platypus  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Elephant  ======================================================================
            Black flying-fox  ======================================================================
B D                  Squirrel  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
               Domestic goat  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
          Chinese tree shrew  ======================================================================
B D                       Cat  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------

Inserts between block 17 and 18 in window
            Cape golden mole 480bp

Alignment block 18 of 38 in window, 42880031 - 42880084, 54 bps 
B D                     Human  gagacagaagaattgcctgaacccgggaggcggaggttgcagtgagtcgagatc
B D                     Chimp  gagacagaagaattgcctgaacccgggaggcggaggttgcagtgagtcgagatc
B D                   Gorilla  gagacagaagaattgcctgaacccgggaggcggaggtt----------------
B D                 Orangutan  gagacagaagaattgcctgaacccgggaggcggaggttgcagtgagtcgagatc
B D                    Gibbon  gagacagaagaattgcctgaacccgggaggcggaggttgcagtgagtcgagatc
B D                    Rhesus  gagacagaagaattgcctgaacccgggaggtagaggttgcagtgagtcaagatt
B D       Crab-eating macaque  gagacagaagaattgcctgaacccgggaggtggaggttgcagtgagtcaagatt
B D                    Baboon  gagacagaagaattgcctgaacccgggaggtggaggttgcagtgagtcaagatt
B D              Green monkey  gagacagaagaattgcctgaacccgggaggtggaggttgcagtgagtcaagatt
B D                  Marmoset  gaggcaggagaatcgcttgaagccgggaggtggaggttgcagtgagttgagatt
B D           Squirrel monkey  gaggcaggagactcgcttgaacccagaaggcggaggttgcggtaagccgaggtc
                   Chinchilla  gaggcaggaggatcgttgcgatc-----ggtgcgagtt---------cgagacc
             Brush-tailed rat  gaagc----ggatggtt-------------tgcgagtt---------cgagatc
              Golden hamster  ======================================================
B D                    Tenrec  ======================================================
                Prairie vole  ======================================================
B D           Chinese hamster  ======================================================
B D                       Rat  ======================================================
B D            Naked mole-rat  ======================================================
B D                 Armadillo  ======================================================
         Cape elephant shrew  ======================================================
B D                     Mouse  ======================================================
      Lesser Egyptian jerboa  ======================================================
B D                Guinea pig  ======================================================
                 Zebra mbuna  ======================================================
         Pundamilia nyererei  ======================================================
B D                    Lizard  ======================================================
B D              Nile tilapia  ======================================================
       Burton's mouthbreeder  ======================================================
B D               Stickleback  ======================================================
B D                   Dolphin  ======================================================
B D                   Megabat  ======================================================
B D                       Pig  ======================================================
                    Aardvark  ======================================================
B D                   Wallaby  ======================================================
  D    White-throated sparrow  ======================================================
                 Spotted gar  ======================================================
B D                    Medaka  ======================================================
B D                 Zebrafish  ======================================================
                Weddell seal  ======================================================
  D           Green seaturtle  ======================================================
  D  Chinese softshell turtle  ======================================================
  D    Spiny softshell turtle  ======================================================
  D            Painted turtle  ======================================================
            Cape golden mole  ======================================================
B D                Budgerigar  ======================================================
  D          Peregrine falcon  ======================================================
  D              Saker falcon  ======================================================
          Tibetan ground jay  ======================================================
  D               Rock pigeon  ======================================================
  D       Collared flycatcher  ======================================================
B D           Tasmanian devil  ======================================================
B D                   Opossum  ======================================================
                Killer whale  ======================================================
              Bactrian camel  ======================================================
B D              Atlantic cod  ======================================================
B D                    Turkey  ======================================================
B D                   Manatee  ======================================================
               Big brown bat  ======================================================
B D                   Chicken  ======================================================
B D       Medium ground finch  ======================================================
B D                  Platypus  ======================================================
B D                     Sheep  ======================================================
B D                       Cow  ======================================================
            Tibetan antelope  ======================================================
B D                  Elephant  ======================================================
            Black flying-fox  ======================================================
B D                  Squirrel  ======================================================
B D                  Microbat  ======================================================
        David's myotis (bat)  ======================================================
B D                       Dog  ======================================================
               Domestic goat  ======================================================
B D        American alligator  ======================================================
B D               Zebra finch  ======================================================
B D                    Alpaca  ======================================================
              Pacific walrus  ======================================================
B D                     Panda  ======================================================
B D                   Ferret   ======================================================
          Chinese tree shrew  ======================================================
B D                       Cat  ======================================================
B D          White rhinoceros  ======================================================
B D                     Horse  ======================================================
B D                  Bushbaby  ------------------------------------------------------

Inserts between block 18 and 19 in window
B D          Squirrel monkey 629bp
                  Chinchilla 1bp
            Brush-tailed rat 1bp

Alignment block 19 of 38 in window, 42880085 - 42880130, 46 bps 
B D                     Human  gcccccgctgcact-----------------ccagccagggcgacagagcgagactctctctc-------
B D                     Chimp  g-ccccaccgcact-----------------ccagccagggcgacagagcgagactctctctcaaaaaaa
B D                   Gorilla  ---------gcgct-----------------tcagcctgggcgacagagcgagactccgtctc-------
B D                 Orangutan  g-ccccactgcact-----------------ccagccagggcgacagagcgagactctctctc-------
B D                    Rhesus  -gccccacgccact-----------------ccagccggggcgacagagcgagaccctctctc-------
B D       Crab-eating macaque  -gccccactgcact-----------------ccagccggggcgacagagcgagaccctctctc-------
B D                    Baboon  -gccccactgcact-----------------ccagccggggtgacagagcgagaccctttctc-------
B D              Green monkey  -gccccactgcact-----------------ccagccggggcgacagagcgagaccctctctc-------
B D                  Marmoset  -gccccactgcact-----------------ccagcctgggcaacaaagcgaga--ctgtctc-------
B D           Squirrel monkey  -gccccactgcact-----------------ccatcctgggcaacaaagcgaga--ctgtctc-------
                   Chinchilla  -----gcctgggctacatagtgagctttaggccggcctgaactgcataaggagaccctgtctc-------
             Brush-tailed rat  -----gcctgggctacaaaatgagagcggggccagcctgaactacatagcaaaaccctgtctc-------
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                 Armadillo  ======================================================================
         Cape elephant shrew  ======================================================================
B D                     Mouse  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                Guinea pig  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                    Lizard  ======================================================================
B D              Nile tilapia  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D               Stickleback  ======================================================================
B D                   Dolphin  ======================================================================
B D                   Megabat  ======================================================================
B D                       Pig  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                 Spotted gar  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
                Weddell seal  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
            Cape golden mole  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
          Tibetan ground jay  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Turkey  ======================================================================
B D                   Manatee  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Gibbon  ----------------------------------------------------------------------
B D                  Platypus  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Elephant  ======================================================================
            Black flying-fox  ======================================================================
B D                  Squirrel  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
               Domestic goat  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
          Chinese tree shrew  ======================================================================
B D                       Cat  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================
B D                  Bushbaby  ----------------------------------------------------------------------

                        Human  --
                        Chimp  aa
                      Gorilla  -a
                    Orangutan  --
                       Rhesus  --
          Crab-eating macaque  --
                       Baboon  --
                 Green monkey  --
                     Marmoset  --
              Squirrel monkey  --
                   Chinchilla  --
             Brush-tailed rat  --
               Golden hamster  ==
                       Tenrec  ==
                 Prairie vole  ==
              Chinese hamster  ==
                          Rat  ==
               Naked mole-rat  ==
                    Armadillo  ==
          Cape elephant shrew  ==
                        Mouse  ==
       Lesser Egyptian jerboa  ==
                   Guinea pig  ==
                  Zebra mbuna  ==
          Pundamilia nyererei  ==
                       Lizard  ==
                 Nile tilapia  ==
        Burton's mouthbreeder  ==
                  Stickleback  ==
                      Dolphin  ==
                      Megabat  ==
                          Pig  ==
                     Aardvark  ==
                      Wallaby  ==
       White-throated sparrow  ==
                  Spotted gar  ==
                       Medaka  ==
                    Zebrafish  ==
                 Weddell seal  ==
              Green seaturtle  ==
     Chinese softshell turtle  ==
       Spiny softshell turtle  ==
               Painted turtle  ==
             Cape golden mole  ==
                   Budgerigar  ==
             Peregrine falcon  ==
                 Saker falcon  ==
           Tibetan ground jay  ==
                  Rock pigeon  ==
          Collared flycatcher  ==
              Tasmanian devil  ==
                      Opossum  ==
                 Killer whale  ==
               Bactrian camel  ==
                 Atlantic cod  ==
                       Turkey  ==
                      Manatee  ==
                Big brown bat  ==
                      Chicken  ==
          Medium ground finch  ==
                       Gibbon  --
                     Platypus  ==
                        Sheep  ==
                          Cow  ==
             Tibetan antelope  ==
                     Elephant  ==
             Black flying-fox  ==
                     Squirrel  ==
                     Microbat  ==
         David's myotis (bat)  ==
                          Dog  ==
                Domestic goat  ==
           American alligator  ==
                  Zebra finch  ==
                       Alpaca  ==
               Pacific walrus  ==
                        Panda  ==
                      Ferret   ==
           Chinese tree shrew  ==
                          Cat  ==
             White rhinoceros  ==
                        Horse  ==
                     Bushbaby  --

Alignment block 20 of 38 in window, 42880131 - 42880144, 14 bps 
B D                     Human  aaaaa----aa---------aaa--aaaa
B D                     Chimp  aaaaa----aa---------aaa--aaaa
B D                   Gorilla  aaaaa----aa---------aaa--aaaa
B D                 Orangutan  ----a----aa---------aaa--aaaa
B D                    Rhesus  tcaaa----aa---------aaa--agaa
B D       Crab-eating macaque  tcaaa----aa---------aaa--aaaa
B D                    Baboon  tcaaa----aa---------aaa----aa
B D              Green monkey  ccaaa----aa---------aaaaaaaaa
B D                  Marmoset  aaaaa----aa-taaaaattaaa--aaat
B D           Squirrel monkey  aaaaa----aagtaaaaattaaa--caat
B D                  Bushbaby  --------------------------cag
                   Chinchilla  aaaaagaccaa---------aaa--aaaa
             Brush-tailed rat  aaaaa----aa---------aaa--agaa
B D          White rhinoceros  aaaaa----aa---------aaa--gaaa
              Golden hamster  =============================
B D                    Tenrec  =============================
                Prairie vole  =============================
B D           Chinese hamster  =============================
B D                       Rat  =============================
B D            Naked mole-rat  =============================
B D                 Armadillo  =============================
         Cape elephant shrew  =============================
B D                     Mouse  =============================
      Lesser Egyptian jerboa  =============================
B D                Guinea pig  =============================
                 Zebra mbuna  =============================
         Pundamilia nyererei  =============================
B D                    Lizard  =============================
B D              Nile tilapia  =============================
       Burton's mouthbreeder  =============================
B D               Stickleback  =============================
B D                   Dolphin  =============================
B D                   Megabat  =============================
B D                       Pig  =============================
                    Aardvark  =============================
B D                   Wallaby  =============================
  D    White-throated sparrow  =============================
                 Spotted gar  =============================
B D                    Medaka  =============================
B D                 Zebrafish  =============================
                Weddell seal  =============================
  D           Green seaturtle  =============================
  D  Chinese softshell turtle  =============================
  D    Spiny softshell turtle  =============================
  D            Painted turtle  =============================
            Cape golden mole  =============================
B D                Budgerigar  =============================
  D          Peregrine falcon  =============================
  D              Saker falcon  =============================
          Tibetan ground jay  =============================
  D               Rock pigeon  =============================
  D       Collared flycatcher  =============================
B D           Tasmanian devil  =============================
B D                   Opossum  =============================
                Killer whale  =============================
              Bactrian camel  =============================
B D              Atlantic cod  =============================
B D                    Turkey  =============================
B D                   Manatee  =============================
               Big brown bat  =============================
B D                   Chicken  =============================
B D       Medium ground finch  =============================
B D                    Gibbon  -----------------------------
B D                  Platypus  =============================
B D                     Sheep  =============================
B D                       Cow  =============================
            Tibetan antelope  =============================
B D                  Elephant  =============================
            Black flying-fox  =============================
B D                  Squirrel  =============================
B D                  Microbat  =============================
        David's myotis (bat)  =============================
B D                       Dog  =============================
               Domestic goat  =============================
B D        American alligator  =============================
B D               Zebra finch  =============================
B D                    Alpaca  =============================
              Pacific walrus  =============================
B D                     Panda  =============================
B D                   Ferret   =============================
          Chinese tree shrew  =============================
B D                       Cat  =============================
B D                     Horse  =============================

Inserts between block 20 and 21 in window
                  Chinchilla 1880bp
            Brush-tailed rat 3028bp

Alignment block 21 of 38 in window, 42880145 - 42880145, 1 bps 
B D                     Human  -t
B D                     Chimp  -t
B D                   Gorilla  -t
B D                 Orangutan  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D              Green monkey  -a
B D                  Marmoset  -a
B D           Squirrel monkey  -a
B D                  Bushbaby  -g
B D          White rhinoceros  c-
              Golden hamster  ==
B D                    Tenrec  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                       Rat  ==
B D            Naked mole-rat  ==
B D                 Armadillo  ==
         Cape elephant shrew  ==
                  Chinchilla  ==
B D                     Mouse  ==
            Brush-tailed rat  ==
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
B D                   Dolphin  ==
B D                   Megabat  ==
B D                       Pig  ==
                    Aardvark  ==
B D                   Wallaby  ==
  D    White-throated sparrow  ==
                 Spotted gar  ==
B D                    Medaka  ==
B D                 Zebrafish  ==
                Weddell seal  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
            Cape golden mole  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  ==
              Bactrian camel  ==
B D              Atlantic cod  ==
B D                    Turkey  ==
B D                   Manatee  ==
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                    Gibbon  --
B D                  Platypus  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
            Black flying-fox  ==
B D                  Squirrel  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                       Dog  ==
               Domestic goat  ==
B D        American alligator  ==
B D               Zebra finch  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
B D                   Ferret   ==
          Chinese tree shrew  ==
B D                       Cat  ==
B D                     Horse  ==

Inserts between block 21 and 22 in window
B D         White rhinoceros 24bp

Alignment block 22 of 38 in window, 42880146 - 42880241, 96 bps 
B D                     Human  gtccaagatgtgg-tcatgggtgagggtgtctc--gggtggcgtcaagtctgaggtcgctagaagtaagc
B D                     Chimp  gtccaagatgtgg-tcatgggtgagggtgtctc--gggtggcgtcaagtctgaggtcgctggaagtaagc
B D                   Gorilla  gtccaagatgtgg-tcatgggtgagggtgtctc--gggtggcgtcaagtctgaggtcgctggaagtaagc
B D                 Orangutan  gtccaagatgtgg-tcatgggtgtgggtgtctc--gggtggcgtcaagtctgaggtcgcttgaagtaagc
B D                    Rhesus  gtccaaaatgtgg-tcatgggtgtgggtgtctc--gggtggcgttaagtctgaggtcgctaaaggtaagc
B D       Crab-eating macaque  gtccaaaatgtgg-tcatgggtgtaggtgtctc--gggtggcgttaagtctgaggtcgctaaaggtaagc
B D                    Baboon  gtccataatgtgg-tcatgggtgtgggtgtctc--gggtggcgttaagtctgaggtcgctaaaggtaagc
B D              Green monkey  gtccaaaatgtgg-tcatgggtgtgagtgtctc--gggtggcgttaagtctgaggtcgctaaaggtaagc
B D                  Marmoset  gtccaagatgtgg-tcatgggtgtgggtgtcacataggtggggtcaagtctgaggttgctggaagtaagc
B D           Squirrel monkey  gtccaagatgtgg-tcatgggtgggggtgtcacacagttggggtcaagtctgaggttgcaggaagtaagc
B D                  Bushbaby  tcccagagtggggttcctgggtgggggcgtctt--ggc---cgtcaaggctggggacg---------atc
B D            Naked mole-rat  gcccaggatgtgg-ccacgggcgtgggtatcac--tggtggggtcgaggctgaggtcgctggaagcgcac
B D                Guinea pig  gcccagggattgg-ccgcgggtgtgggtgtcac--tggtggggtagaggctgacgtccttggaagagtgc
B D                     Horse  gtccaggatgt-g--tgtccgtgtgcgtgcctg--aggtgggctcaaagctgaggtcactggaa------
B D          White rhinoceros  gtccaggatatgg--tgtcggtgtgcgtgtccg--aggtgggctcaaagctgatgccactggaagtgagc
             Black flying-fox  gtcccggacgtgg--cgtcgccgtgcgtgtctg--aggcgggcttagagccggggtcgccggaagtgagc
B D                   Megabat  gtcccggacgtgg--cgtcgccgtgcgtgtctg--aggcgggcttagagccagggtcgccggaagtgagc
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
B D                 Armadillo  ======================================================================
         Cape elephant shrew  ======================================================================
                  Chinchilla  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                    Lizard  ======================================================================
B D              Nile tilapia  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D               Stickleback  ======================================================================
B D                   Dolphin  ======================================================================
B D                       Pig  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                 Spotted gar  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
                Weddell seal  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
            Cape golden mole  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
          Tibetan ground jay  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Turkey  ======================================================================
B D                   Manatee  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Gibbon  ----------------------------------------------------------------------
B D                  Platypus  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
B D                  Elephant  ======================================================================
B D                  Squirrel  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
               Domestic goat  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
          Chinese tree shrew  ======================================================================
B D                       Cat  ======================================================================

                        Human  ctactgaatctttgcacttag-acaagcca
                        Chimp  ctactgaatctttgcacttag-acaagcca
                      Gorilla  ctactgaatctttgcacttag-acaagcca
                    Orangutan  ctactgaatctttgcacttag-acaagcca
                       Rhesus  ctacttaatctttgcacttag-aaaagcca
          Crab-eating macaque  ctacttaatctttgcacttag-aaaagcca
                       Baboon  ctacttaatctttgcacttag-aaaagcca
                 Green monkey  ctacttaatctttgcagttag-aaaagcca
                     Marmoset  ctgcttaacctttgcacttag-acaagcca
              Squirrel monkey  ctacttaacctttgcacttag-acaagcca
                     Bushbaby  ctcct-----tctactcttaacacaagccg
               Naked mole-rat  ctact-tccctccgcactcag-acgagccc
                   Guinea pig  ctgct-atccaccgcattgag-acaagcca
                        Horse  ----gtaaactctacacttag-ataagcta
             White rhinoceros  ctacgtaacctctacacttag-ataagcca
             Black flying-fox  cctcgtaacccgtatggctag-acaagcca
                      Megabat  cctcgtaacccgtgtggctag-acaagcca
               Golden hamster  ==============================
                       Tenrec  ==============================
                 Prairie vole  ==============================
              Chinese hamster  ==============================
                          Rat  ==============================
                    Armadillo  ==============================
          Cape elephant shrew  ==============================
                   Chinchilla  ==============================
                        Mouse  ==============================
             Brush-tailed rat  ==============================
       Lesser Egyptian jerboa  ==============================
                  Zebra mbuna  ==============================
          Pundamilia nyererei  ==============================
                       Lizard  ==============================
                 Nile tilapia  ==============================
        Burton's mouthbreeder  ==============================
                  Stickleback  ==============================
                      Dolphin  ==============================
                          Pig  ==============================
                     Aardvark  ==============================
                      Wallaby  ==============================
       White-throated sparrow  ==============================
                  Spotted gar  ==============================
                       Medaka  ==============================
                    Zebrafish  ==============================
                 Weddell seal  ==============================
              Green seaturtle  ==============================
     Chinese softshell turtle  ==============================
       Spiny softshell turtle  ==============================
               Painted turtle  ==============================
             Cape golden mole  ==============================
                   Budgerigar  ==============================
             Peregrine falcon  ==============================
                 Saker falcon  ==============================
           Tibetan ground jay  ==============================
                  Rock pigeon  ==============================
          Collared flycatcher  ==============================
              Tasmanian devil  ==============================
                      Opossum  ==============================
                 Killer whale  ==============================
               Bactrian camel  ==============================
                 Atlantic cod  ==============================
                       Turkey  ==============================
                      Manatee  ==============================
                Big brown bat  ==============================
                      Chicken  ==============================
          Medium ground finch  ==============================
                       Gibbon  ------------------------------
                     Platypus  ==============================
                        Sheep  ==============================
                          Cow  ==============================
             Tibetan antelope  ==============================
                     Elephant  ==============================
                     Squirrel  ==============================
                     Microbat  ==============================
         David's myotis (bat)  ==============================
                          Dog  ==============================
                Domestic goat  ==============================
           American alligator  ==============================
                  Zebra finch  ==============================
                       Alpaca  ==============================
               Pacific walrus  ==============================
                        Panda  ==============================
                      Ferret   ==============================
           Chinese tree shrew  ==============================
                          Cat  ==============================

Inserts between block 22 and 23 in window
B D           Naked mole-rat 2bp
B D               Guinea pig 653bp

Alignment block 23 of 38 in window, 42880242 - 42880266, 25 bps 
B D                     Human  cagatgccttaaaatctccgaactg
B D                     Chimp  aagatgccttaaaatctccgaactg
B D                   Gorilla  aagatgccttaaaatctccgaactg
B D                 Orangutan  aagatgccttaaaatctccgaactg
B D                    Rhesus  aagatgccttaaaatctccaaacta
B D       Crab-eating macaque  aagatgccttaaaatctccaaacta
B D                    Baboon  aagatgacttaaaatctccaaactg
B D              Green monkey  aagatgccttaaaatctccaaattg
B D                  Marmoset  aaaatgccttaaaatttccaaacag
B D           Squirrel monkey  aagatgccttaaaatcttcaaacag
B D                  Bushbaby  aaaacacctcagagtctccccctgg
B D            Naked mole-rat  aagagacctgga-------------
B D                     Horse  aaagcccctg---------------
B D          White rhinoceros  aaggcgcctg---------------
             Black flying-fox  gaggcgcctg---------------
B D                   Megabat  gaggcgcctg---------------
              Golden hamster  =========================
B D                    Tenrec  =========================
                Prairie vole  =========================
B D           Chinese hamster  =========================
B D                       Rat  =========================
B D                 Armadillo  =========================
         Cape elephant shrew  =========================
                  Chinchilla  =========================
B D                     Mouse  =========================
            Brush-tailed rat  =========================
      Lesser Egyptian jerboa  =========================
B D                Guinea pig  =========================
                 Zebra mbuna  =========================
         Pundamilia nyererei  =========================
B D                    Lizard  =========================
B D              Nile tilapia  =========================
       Burton's mouthbreeder  =========================
B D               Stickleback  =========================
B D                   Dolphin  =========================
B D                       Pig  =========================
                    Aardvark  =========================
B D                   Wallaby  =========================
  D    White-throated sparrow  =========================
                 Spotted gar  =========================
B D                    Medaka  =========================
B D                 Zebrafish  =========================
                Weddell seal  =========================
  D           Green seaturtle  =========================
  D  Chinese softshell turtle  =========================
  D    Spiny softshell turtle  =========================
  D            Painted turtle  =========================
            Cape golden mole  =========================
B D                Budgerigar  =========================
  D          Peregrine falcon  =========================
  D              Saker falcon  =========================
          Tibetan ground jay  =========================
  D               Rock pigeon  =========================
  D       Collared flycatcher  =========================
B D           Tasmanian devil  =========================
B D                   Opossum  =========================
                Killer whale  =========================
              Bactrian camel  =========================
B D              Atlantic cod  =========================
B D                    Turkey  =========================
B D                   Manatee  =========================
               Big brown bat  =========================
B D                   Chicken  =========================
B D       Medium ground finch  =========================
B D                    Gibbon  -------------------------
B D                  Platypus  =========================
B D                     Sheep  =========================
B D                       Cow  =========================
            Tibetan antelope  =========================
B D                  Elephant  =========================
B D                  Squirrel  =========================
B D                  Microbat  =========================
        David's myotis (bat)  =========================
B D                       Dog  =========================
               Domestic goat  =========================
B D        American alligator  =========================
B D               Zebra finch  =========================
B D                    Alpaca  =========================
              Pacific walrus  =========================
B D                     Panda  =========================
B D                   Ferret   =========================
          Chinese tree shrew  =========================
B D                       Cat  =========================

Alignment block 24 of 38 in window, 42880267 - 42880304, 38 bps 
B D                     Human  tagtgata-t-tttcaacccaaactatggttagtttccag
B D                     Chimp  gagtgata-t-tttcaacccaaactatggttagtttccag
B D                   Gorilla  gagtgata-t-tttcaacccaaactatggttagtttccag
B D                 Orangutan  gagtgata-t-tttcaacccaaactatggttagtttccag
B D                    Rhesus  gagtgata-t-ttccaacccaaactatggttagtttccag
B D       Crab-eating macaque  gagtgata-t-ttccaacccaaactatggttagtttccag
B D                    Baboon  gagtgata-t-ttccaacccaaacgatggttagtttccag
B D              Green monkey  gagtgata-t-tttcaacccaaactatgattagtttccag
B D                  Marmoset  gagagata-t-tttcaacccaaactgtgattggtttccag
B D           Squirrel monkey  gagtgata-t-tttcaacccaaactatgattggtttccag
B D                  Bushbaby  aagtgata-c-tttccacccacactgcggctgtttactag
           Chinese tree shrew  tattgata-t-tttcaacctaaattgtagtgattttccag
B D            Naked mole-rat  -agtgatg-tgtttcagccccactggtggttattctccat
B D                     Horse  aagggctgtt-ttttaacccaagataaggctccttttcaa
B D          White rhinoceros  aagggcta-t-ttttaatccaagatatggctcttttccaa
             Black flying-fox  aaatgctg-g-tttcaacccaagatactgctctttcccag
B D                   Megabat  cagtgctg-g-tttcaacccaagatactgctctttcccag
              Golden hamster  ========================================
B D                    Tenrec  ========================================
                Prairie vole  ========================================
B D           Chinese hamster  ========================================
B D                       Rat  ========================================
B D                 Armadillo  ========================================
         Cape elephant shrew  ========================================
                  Chinchilla  ========================================
B D                     Mouse  ========================================
            Brush-tailed rat  ========================================
      Lesser Egyptian jerboa  ========================================
B D                Guinea pig  ========================================
                 Zebra mbuna  ========================================
         Pundamilia nyererei  ========================================
B D                    Lizard  ========================================
B D              Nile tilapia  ========================================
       Burton's mouthbreeder  ========================================
B D               Stickleback  ========================================
B D                   Dolphin  ========================================
B D                       Pig  ========================================
                    Aardvark  ========================================
B D                   Wallaby  ========================================
  D    White-throated sparrow  ========================================
                 Spotted gar  ========================================
B D                    Medaka  ========================================
B D                 Zebrafish  ========================================
                Weddell seal  ========================================
  D           Green seaturtle  ========================================
  D  Chinese softshell turtle  ========================================
  D    Spiny softshell turtle  ========================================
  D            Painted turtle  ========================================
            Cape golden mole  ========================================
B D                Budgerigar  ========================================
  D          Peregrine falcon  ========================================
  D              Saker falcon  ========================================
          Tibetan ground jay  ========================================
  D               Rock pigeon  ========================================
  D       Collared flycatcher  ========================================
B D           Tasmanian devil  ========================================
B D                   Opossum  ========================================
                Killer whale  ========================================
              Bactrian camel  ========================================
B D              Atlantic cod  ========================================
B D                    Turkey  ========================================
B D                   Manatee  ========================================
               Big brown bat  ========================================
B D                   Chicken  ========================================
B D       Medium ground finch  ========================================
B D                    Gibbon  ----------------------------------------
B D                  Platypus  ========================================
B D                     Sheep  ========================================
B D                       Cow  ========================================
            Tibetan antelope  ========================================
B D                  Elephant  ========================================
B D                  Squirrel  ========================================
B D                  Microbat  ========================================
        David's myotis (bat)  ========================================
B D                       Dog  ========================================
               Domestic goat  ========================================
B D        American alligator  ========================================
B D               Zebra finch  ========================================
B D                    Alpaca  ========================================
              Pacific walrus  ========================================
B D                     Panda  ========================================
B D                   Ferret   ========================================
B D                       Cat  ========================================

Inserts between block 24 and 25 in window
B D             Green monkey 6bp

Alignment block 25 of 38 in window, 42880305 - 42880307, 3 bps 
B D                     Human  tgt
B D                     Chimp  tgt
B D                   Gorilla  tgt
B D                 Orangutan  tgt
B D                    Rhesus  tgt
B D       Crab-eating macaque  tgt
B D                    Baboon  tgt
B D                  Marmoset  tgt
B D           Squirrel monkey  tgt
B D                  Bushbaby  tgt
           Chinese tree shrew  ggt
B D            Naked mole-rat  tgt
B D                     Horse  tgt
B D          White rhinoceros  tgt
             Black flying-fox  tgt
B D                   Megabat  tgt
              Golden hamster  ===
B D                    Tenrec  ===
                Prairie vole  ===
B D           Chinese hamster  ===
B D                       Rat  ===
B D                 Armadillo  ===
         Cape elephant shrew  ===
                  Chinchilla  ===
B D                     Mouse  ===
            Brush-tailed rat  ===
      Lesser Egyptian jerboa  ===
B D                Guinea pig  ===
                 Zebra mbuna  ===
         Pundamilia nyererei  ===
B D                    Lizard  ===
B D              Nile tilapia  ===
       Burton's mouthbreeder  ===
B D               Stickleback  ===
B D                   Dolphin  ===
B D                       Pig  ===
                    Aardvark  ===
B D                   Wallaby  ===
  D    White-throated sparrow  ===
                 Spotted gar  ===
B D                    Medaka  ===
B D                 Zebrafish  ===
                Weddell seal  ===
  D           Green seaturtle  ===
  D  Chinese softshell turtle  ===
  D    Spiny softshell turtle  ===
  D            Painted turtle  ===
            Cape golden mole  ===
B D                Budgerigar  ===
  D          Peregrine falcon  ===
  D              Saker falcon  ===
          Tibetan ground jay  ===
  D               Rock pigeon  ===
  D       Collared flycatcher  ===
B D           Tasmanian devil  ===
B D                   Opossum  ===
                Killer whale  ===
              Bactrian camel  ===
B D              Atlantic cod  ===
B D                    Turkey  ===
B D                   Manatee  ===
               Big brown bat  ===
B D                   Chicken  ===
B D       Medium ground finch  ===
B D                    Gibbon  ---
B D                  Platypus  ===
B D                     Sheep  ===
B D                       Cow  ===
            Tibetan antelope  ===
B D                  Elephant  ===
B D                  Squirrel  ===
B D                  Microbat  ===
        David's myotis (bat)  ===
B D                       Dog  ===
               Domestic goat  ===
B D        American alligator  ===
B D               Zebra finch  ===
B D                    Alpaca  ===
              Pacific walrus  ===
B D                     Panda  ===
B D                   Ferret   ===
B D                       Cat  ===
B D              Green monkey  ===

Alignment block 26 of 38 in window, 42880308 - 42880308, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D            Naked mole-rat  t
B D                     Horse  t
B D          White rhinoceros  t
             Black flying-fox  t
B D                   Megabat  t
B D                   Manatee  t
              Golden hamster  =
B D                    Tenrec  =
                Prairie vole  =
B D           Chinese hamster  =
B D                       Rat  =
B D                 Armadillo  =
         Cape elephant shrew  =
                  Chinchilla  =
B D                     Mouse  =
            Brush-tailed rat  =
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
B D                    Lizard  =
B D              Nile tilapia  =
       Burton's mouthbreeder  =
B D               Stickleback  =
B D                   Dolphin  =
B D                       Pig  =
                    Aardvark  =
B D                   Wallaby  =
  D    White-throated sparrow  =
                 Spotted gar  =
B D                    Medaka  =
B D                 Zebrafish  =
                Weddell seal  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
            Cape golden mole  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
          Tibetan ground jay  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Opossum  =
                Killer whale  =
              Bactrian camel  =
B D              Atlantic cod  =
B D                    Turkey  =
               Big brown bat  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Gibbon  -
B D                  Platypus  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Elephant  =
B D                  Squirrel  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                       Dog  =
               Domestic goat  =
B D        American alligator  =
B D               Zebra finch  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
B D                   Ferret   =
B D                       Cat  =
B D              Green monkey  =

Alignment block 27 of 38 in window, 42880309 - 42880309, 1 bps 
B D                     Human  c
B D                     Chimp  c
B D                   Gorilla  c
B D                 Orangutan  c
B D                    Rhesus  c
B D       Crab-eating macaque  c
B D                    Baboon  c
B D                  Marmoset  c
B D           Squirrel monkey  c
B D                  Bushbaby  c
           Chinese tree shrew  t
B D            Naked mole-rat  c
B D                     Horse  c
B D          White rhinoceros  c
             Black flying-fox  c
B D                   Megabat  c
B D                   Manatee  c
             Cape golden mole  c
              Golden hamster  =
B D                    Tenrec  =
                Prairie vole  =
B D           Chinese hamster  =
B D                       Rat  =
B D                 Armadillo  =
         Cape elephant shrew  =
                  Chinchilla  =
B D                     Mouse  =
            Brush-tailed rat  =
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
B D                    Lizard  =
B D              Nile tilapia  =
       Burton's mouthbreeder  =
B D               Stickleback  =
B D                   Dolphin  =
B D                       Pig  =
                    Aardvark  =
B D                   Wallaby  =
  D    White-throated sparrow  =
                 Spotted gar  =
B D                    Medaka  =
B D                 Zebrafish  =
                Weddell seal  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
          Tibetan ground jay  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Opossum  =
                Killer whale  =
              Bactrian camel  =
B D              Atlantic cod  =
B D                    Turkey  =
               Big brown bat  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Gibbon  -
B D                  Platypus  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Elephant  =
B D                  Squirrel  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                       Dog  =
               Domestic goat  =
B D        American alligator  =
B D               Zebra finch  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
B D                   Ferret   =
B D                       Cat  =
B D              Green monkey  =

Inserts between block 27 and 28 in window
B D           Naked mole-rat 1929bp
B D                    Horse 8600bp
B D         White rhinoceros 8973bp
            Black flying-fox 6592bp

Alignment block 28 of 38 in window, 42880310 - 42880310, 1 bps 
B D                     Human  -a
B D                     Chimp  -a
B D                   Gorilla  -a
B D                 Orangutan  -a
B D                    Rhesus  -a
B D       Crab-eating macaque  -a
B D                    Baboon  -a
B D                  Marmoset  -c
B D           Squirrel monkey  -c
B D                  Bushbaby  -t
           Chinese tree shrew  -c
B D                   Manatee  t-
             Cape golden mole  t-
              Golden hamster  ==
B D                    Tenrec  ==
                Prairie vole  ==
B D           Chinese hamster  ==
B D                       Rat  ==
B D            Naked mole-rat  ==
B D                 Armadillo  ==
         Cape elephant shrew  ==
                  Chinchilla  ==
B D                     Mouse  ==
            Brush-tailed rat  ==
      Lesser Egyptian jerboa  ==
B D                Guinea pig  ==
                 Zebra mbuna  ==
         Pundamilia nyererei  ==
B D                    Lizard  ==
B D              Nile tilapia  ==
       Burton's mouthbreeder  ==
B D               Stickleback  ==
B D                   Dolphin  ==
B D                       Pig  ==
                    Aardvark  ==
B D                   Wallaby  ==
  D    White-throated sparrow  ==
                 Spotted gar  ==
B D                    Medaka  ==
B D                 Zebrafish  ==
                Weddell seal  ==
  D           Green seaturtle  ==
  D  Chinese softshell turtle  ==
  D    Spiny softshell turtle  ==
  D            Painted turtle  ==
B D                Budgerigar  ==
  D          Peregrine falcon  ==
  D              Saker falcon  ==
          Tibetan ground jay  ==
  D               Rock pigeon  ==
  D       Collared flycatcher  ==
B D           Tasmanian devil  ==
B D                   Opossum  ==
                Killer whale  ==
              Bactrian camel  ==
B D              Atlantic cod  ==
B D                    Turkey  ==
               Big brown bat  ==
B D                   Chicken  ==
B D       Medium ground finch  ==
B D                    Gibbon  --
B D                  Platypus  ==
B D                     Sheep  ==
B D                       Cow  ==
            Tibetan antelope  ==
B D                  Elephant  ==
            Black flying-fox  ==
B D                  Squirrel  ==
B D                  Microbat  ==
        David's myotis (bat)  ==
B D                       Dog  ==
               Domestic goat  ==
B D        American alligator  ==
B D               Zebra finch  ==
B D                    Alpaca  ==
              Pacific walrus  ==
B D                     Panda  ==
B D                   Ferret   ==
B D                       Cat  ==
B D          White rhinoceros  ==
B D                     Horse  ==
B D              Green monkey  ==

Alignment block 29 of 38 in window, 42880311 - 42880317, 7 bps 
B D                     Human  tcccaag
B D                     Chimp  tcccaag
B D                   Gorilla  tcccaag
B D                 Orangutan  tcccaag
B D                    Rhesus  tcccaag
B D       Crab-eating macaque  tcccaag
B D                    Baboon  tcccaag
B D                  Marmoset  tcccaag
B D           Squirrel monkey  tcccaag
B D                  Bushbaby  tcctcag
           Chinese tree shrew  ttccaag
B D                  Elephant  tcccaag
B D                   Manatee  ttgcaag
             Cape golden mole  tgtcaag
              Golden hamster  =======
B D                    Tenrec  =======
                Prairie vole  =======
B D           Chinese hamster  =======
B D                       Rat  =======
B D            Naked mole-rat  =======
B D                 Armadillo  =======
         Cape elephant shrew  =======
                  Chinchilla  =======
B D                     Mouse  =======
            Brush-tailed rat  =======
      Lesser Egyptian jerboa  =======
B D                Guinea pig  =======
                 Zebra mbuna  =======
         Pundamilia nyererei  =======
B D                    Lizard  =======
B D              Nile tilapia  =======
       Burton's mouthbreeder  =======
B D               Stickleback  =======
B D                   Dolphin  =======
B D                       Pig  =======
                    Aardvark  =======
B D                   Wallaby  =======
  D    White-throated sparrow  =======
                 Spotted gar  =======
B D                    Medaka  =======
B D                 Zebrafish  =======
                Weddell seal  =======
  D           Green seaturtle  =======
  D  Chinese softshell turtle  =======
  D    Spiny softshell turtle  =======
  D            Painted turtle  =======
B D                Budgerigar  =======
  D          Peregrine falcon  =======
  D              Saker falcon  =======
          Tibetan ground jay  =======
  D               Rock pigeon  =======
  D       Collared flycatcher  =======
B D           Tasmanian devil  =======
B D                   Opossum  =======
                Killer whale  =======
              Bactrian camel  =======
B D              Atlantic cod  =======
B D                    Turkey  =======
               Big brown bat  =======
B D                   Chicken  =======
B D       Medium ground finch  =======
B D                    Gibbon  -------
B D                  Platypus  =======
B D                     Sheep  =======
B D                       Cow  =======
            Tibetan antelope  =======
            Black flying-fox  =======
B D                  Squirrel  =======
B D                  Microbat  =======
        David's myotis (bat)  =======
B D                       Dog  =======
               Domestic goat  =======
B D        American alligator  =======
B D               Zebra finch  =======
B D                    Alpaca  =======
              Pacific walrus  =======
B D                     Panda  =======
B D                   Ferret   =======
B D                       Cat  =======
B D          White rhinoceros  =======
B D                     Horse  =======
B D              Green monkey  =======

Alignment block 30 of 38 in window, 42880318 - 42880740, 423 bps 
B D                     Human  atccccaaaagcctcttacaatcccagcatcaggcac-aaaatctaggatctcacggtctgttttagat-
B D                     Chimp  atccccaaaaacctcttacaatcccagcatcaggcac-aaaatctaggatctcacggtctgttttagat-
B D                   Gorilla  atccccaaaagcctcttacaatcccagcatcaggcac-aaaatctaggatctcacggtctgttttagat-
B D                 Orangutan  atccccaaaagcctcttacaatcccagcatcagacac-aaaatctaggatctcacggtctgttttagat-
B D                    Rhesus  atcccccaaagcctcttacaatcccagcatcaggcac-aaaatctaggatctcatggtctgtcttagat-
B D       Crab-eating macaque  atcccccaaagcctcttacaatcccagcatcaggcac-aaaatctaggatctcatggtctgtcttagat-
B D                    Baboon  atccccaaaagcctcttacaatcccagcatcaggcac-aaaatctaggatctcatggtctgtcttagat-
B D              Green monkey  atccccaaaagcctcttacaatcccagcatcaggcac-aaaatctaggatctcatggtctgtcttagat-
B D                  Marmoset  atccccaaaagcttcttccaatcccaacatcaggcac-aaaatctaggatctcattgtctgtcctagat-
B D           Squirrel monkey  atccccaaaagctt-tttcagtcccaacatcaggcac-aaaatctaggatctcattgcctgtcctagat-
B D                  Bushbaby  atcccccaaagtctcatctaatttc-gcatcagactcaaaaatcgaggatgttctggtctgtctagggt-
           Chinese tree shrew  atccccaaatgtcttatctgatcccaacaataggctc-aaattccagggacttgtgatctgtactaggtg
B D                  Elephant  atccccaaaggcctcatccaatcacagcatcaggatc-agaattcaaggtcttatgatctatattagat-
B D                   Manatee  atccccaaaggccaaatccaatcacagcatcaggatc-agaacccaggatctcatgatctatgttagat-
             Cape golden mole  atcctcaaaggtc---tccaatcacagcgtcaggatc-agagctca-gatctc---atctgtattagaa-
              Golden hamster  ======================================================================
B D                    Tenrec  ======================================================================
                Prairie vole  ======================================================================
B D           Chinese hamster  ======================================================================
B D                       Rat  ======================================================================
B D            Naked mole-rat  ======================================================================
B D                 Armadillo  ======================================================================
         Cape elephant shrew  ======================================================================
                  Chinchilla  ======================================================================
B D                     Mouse  ======================================================================
            Brush-tailed rat  ======================================================================
      Lesser Egyptian jerboa  ======================================================================
B D                Guinea pig  ======================================================================
                 Zebra mbuna  ======================================================================
         Pundamilia nyererei  ======================================================================
B D                    Lizard  ======================================================================
B D              Nile tilapia  ======================================================================
       Burton's mouthbreeder  ======================================================================
B D               Stickleback  ======================================================================
B D                   Dolphin  ======================================================================
B D                       Pig  ======================================================================
                    Aardvark  ======================================================================
B D                   Wallaby  ======================================================================
  D    White-throated sparrow  ======================================================================
                 Spotted gar  ======================================================================
B D                    Medaka  ======================================================================
B D                 Zebrafish  ======================================================================
                Weddell seal  ======================================================================
  D           Green seaturtle  ======================================================================
  D  Chinese softshell turtle  ======================================================================
  D    Spiny softshell turtle  ======================================================================
  D            Painted turtle  ======================================================================
B D                Budgerigar  ======================================================================
  D          Peregrine falcon  ======================================================================
  D              Saker falcon  ======================================================================
          Tibetan ground jay  ======================================================================
  D               Rock pigeon  ======================================================================
  D       Collared flycatcher  ======================================================================
B D           Tasmanian devil  ======================================================================
B D                   Opossum  ======================================================================
                Killer whale  ======================================================================
              Bactrian camel  ======================================================================
B D              Atlantic cod  ======================================================================
B D                    Turkey  ======================================================================
               Big brown bat  ======================================================================
B D                   Chicken  ======================================================================
B D       Medium ground finch  ======================================================================
B D                    Gibbon  ----------------------------------------------------------------------
B D                  Platypus  ======================================================================
B D                     Sheep  ======================================================================
B D                       Cow  ======================================================================
            Tibetan antelope  ======================================================================
            Black flying-fox  ======================================================================
B D                  Squirrel  ======================================================================
B D                  Microbat  ======================================================================
        David's myotis (bat)  ======================================================================
B D                       Dog  ======================================================================
               Domestic goat  ======================================================================
B D        American alligator  ======================================================================
B D               Zebra finch  ======================================================================
B D                    Alpaca  ======================================================================
              Pacific walrus  ======================================================================
B D                     Panda  ======================================================================
B D                   Ferret   ======================================================================
B D                       Cat  ======================================================================
B D          White rhinoceros  ======================================================================
B D                     Horse  ======================================================================

                        Human  -----t-------ggct----tgtccggtgcagctcctcttgatccag---agacttacaaactaaaaag
                        Chimp  -----t-------ggct----tgtcaggtgcagctcctcttgatccag---agacttacaaactaaaaag
                      Gorilla  -----t-------ggct----tgtccggtgcagctcctcttgatccag---agacttacaaactaaaaag
                    Orangutan  -----t-------ggct----tgtccggtgcagctcctcttgatccag---agacttacaaactaaaaag
                       Rhesus  -----t-------ggct----tgtccagtgcagcttctcttgattcag---agacttacaaactaagaag
          Crab-eating macaque  -----t-------ggct----tgtccagtgcagcttctcttgattcag---agacttacaaagtaagaag
                       Baboon  -----t-------ggct----tgtccagtgcagcttctcttgattcag---agacttacaaactaagaag
                 Green monkey  -----t-------ggct----tgtccagtgcagcagcttttgattcag---agacttacaaactaagaag
                     Marmoset  -----t-------ggct----tgtccagtgcagctcctcttgatccag---agacttacaaactaaaaag
              Squirrel monkey  -----t-------ggct----tgtccagtgcaactcctcttgatctag---agacttacaaactgaaaag
                     Bushbaby  -----c-------ggaggtgacctcccatccagctcctc----tccagcttagacctgcagactaaaaag
           Chinese tree shrew  ggatat-------gact----tctccaatgcagcgcctcttcaaccag---a-atctgcaaagtgaaaag
                     Elephant  -----ttggatgagtct----ctgcagatgcagtgcctcttggtccag---agacctacgaacggaaaag
                      Manatee  -----ttggatgagtct----ctgcagatgcagtgcctcttggtccag---agacctacaaactgaaaag
             Cape golden mole  -----ctagatgag--t----ctgcagatg---------------cag---agacctacagacttaaaag
               Golden hamster  ======================================================================
                       Tenrec  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
               Naked mole-rat  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                   Chinchilla  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                   Guinea pig  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
                       Lizard  ======================================================================
                 Nile tilapia  ======================================================================
        Burton's mouthbreeder  ======================================================================
                  Stickleback  ======================================================================
                      Dolphin  ======================================================================
                          Pig  ======================================================================
                     Aardvark  ======================================================================
                      Wallaby  ======================================================================
       White-throated sparrow  ======================================================================
                  Spotted gar  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
                 Weddell seal  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
       Spiny softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           Tibetan ground jay  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                 Atlantic cod  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Gibbon  ----------------------------------------------------------------------
                     Platypus  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
                Domestic goat  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  attaattttctctcc--cgtgcacgcaatatatgatggtgagccgggaccagataaccacaataaatact
                        Chimp  attaattttctctcc--catgcacgcaacatatgatggtgagccgggaccagataaccacaataaatact
                      Gorilla  attaattttctgtcc--catgcacgcaacatatgatggtgagccgggaccagataaccacaataaatact
                    Orangutan  atgaattttctctcc--catgcacgcaacatatgatggtgagccgggaccagataaccacaataaatact
                       Rhesus  atgaattttctctcc--catgcacccaacatatgatggtgaaccaggaccagataaccacaataaatact
          Crab-eating macaque  atgaattttctctcc--catgcacccaacatatgatggtgaaccaggaccagataaccacaataaatact
                       Baboon  atgaattttctctcc--catgcacccaacatatgatggtgaaccaggaccagataaccacaataaatact
                 Green monkey  atgaattttctgtcc--catgcacccaacatatgatggtgaaccaggaccagataaccacaataaatact
                     Marmoset  atgcattttctctcc--catgcactcagcatatgatgg-g--------ccagataaccacaatgaatacc
              Squirrel monkey  atgcattttctctcc--catgcacccaacatatgatgg-gaatggggaccagataaccacaataaatacc
                     Bushbaby  atagcttgtctactg--tacacacccagagtatggtggtgaaacaagtaagggttagcaaaataaatacg
           Chinese tree shrew  atgaattgtccactc--cacacacccagcataggatgatggaacagggaaagacaaccataataaatact
                     Elephant  atgagttatctgccctctacacacccaactttaaatggtaaaatgggaaaggaggtccataataaacact
                      Manatee  atgaattatctgctctccacacacccaacattaaatggtaaaatggagaaggacatccacaataaatact
             Cape golden mole  aagaattatctgccctgcacacacccaacattaagtggtaaaatggagaaa---------aatcaatact
               Golden hamster  ======================================================================
                       Tenrec  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
               Naked mole-rat  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                   Chinchilla  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                   Guinea pig  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
                       Lizard  ======================================================================
                 Nile tilapia  ======================================================================
        Burton's mouthbreeder  ======================================================================
                  Stickleback  ======================================================================
                      Dolphin  ======================================================================
                          Pig  ======================================================================
                     Aardvark  ======================================================================
                      Wallaby  ======================================================================
       White-throated sparrow  ======================================================================
                  Spotted gar  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
                 Weddell seal  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
       Spiny softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           Tibetan ground jay  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                 Atlantic cod  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Gibbon  ----------------------------------------------------------------------
                     Platypus  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
                Domestic goat  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  tgcat-----------gtgaaaatgagaagaggaggag--acacagtaatcac--tggtccaaagcaatt
                        Chimp  tgcat-----------gtgaaaatgagaagaggaggag--acacagcaatcac--tggtccaaagcaatt
                      Gorilla  tgcat-----------gtgaaaatgagaagaggaggag--acacagcaatcac--tggtccaaagcaatt
                    Orangutan  tgcat-----------gtgaaaatgagaagaggaggag--acagagcaatcac--tggtccaaagcaatt
                       Rhesus  tgcat-----------gtgaaaatgagaagaggaggag--acagagcaatcac--ggggccagagcaatt
          Crab-eating macaque  tgcat-----------gtgaaaatgagaagaggaggag--acagagcagtcac--ggggccagagcaatt
                       Baboon  tgcat-----------gtgaaaatgagaagaggaggag--acagagcaatcac--tgggccagagcaatt
                 Green monkey  tgcat-----------gtgaaaatgagaagaggaggag--acagagcaatcac--tggtccagagcaatt
                     Marmoset  tcaac-----------gtgaaaaagagaagagg-agag--acagaacaatcac---ggtccacagcaatt
              Squirrel monkey  tccat-----------gtgaaaaggagacgaggaagag--acagaacaatcac--tggtccaaagc-att
                     Bushbaby  tgggcaggggatgggaggggaaggaagaacaggagaca--ctagagtgatcgc--tggtccctagcaatt
           Chinese tree shrew  tccat-----------gtagaaaagggcaggacaggagcaacagaacggccactgtgacacaaagtagtt
                     Elephant  tctgt-----------ttgaaaaggagaagaatgggaggcccatc-ccctcac--tgacccatagcagat
                      Manatee  tccat-----------ttgaaaagaagaagaatgggaggcacagagccatcac--cgacacatagcagat
             Cape golden mole  gccat-----------ttgaaa---agatgaatgggaggcacagagccatcac--caat-cacaatcaat
               Golden hamster  ======================================================================
                       Tenrec  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
               Naked mole-rat  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                   Chinchilla  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                   Guinea pig  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
                       Lizard  ======================================================================
                 Nile tilapia  ======================================================================
        Burton's mouthbreeder  ======================================================================
                  Stickleback  ======================================================================
                      Dolphin  ======================================================================
                          Pig  ======================================================================
                     Aardvark  ======================================================================
                      Wallaby  ======================================================================
       White-throated sparrow  ======================================================================
                  Spotted gar  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
                 Weddell seal  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
       Spiny softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           Tibetan ground jay  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                 Atlantic cod  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Gibbon  ----------------------------------------------------------------------
                     Platypus  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
                Domestic goat  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  ctgaaatcctactggaagatgttttcaggccctacaagaataagaagt----cttaaccaggcccgagtt
                        Chimp  ctgaaatcctactggaagatgttttcaggccctacaagaataagaagtcttccttaaccaggcccgagtt
                      Gorilla  ctgaaatcctactggaagatgttttcaggccctacaagaataagaagtcttccttaaccaggcccgagtt
                    Orangutan  ctgaaatcctactggaagatgttttcaggccctacaagaataagaagtcttccttaaccaggcccgagtt
                       Rhesus  ctcaaatcctattggaagctgttttcaggccctacaagaataagaagttctccttaaccaggcccgagtt
          Crab-eating macaque  ctcaaatcctattggaagctgttttcaggccctacaagaataagaagttctccttaaccaggcccgagtt
                       Baboon  ctcaaatcctattggaagctgttttcaggccctacaagaataagaagtcctccttaaccaggccagagtt
                 Green monkey  ctcaaatcctattggaagatgttttcaggccctacaagaataagaagtcctccttaaccaggcccgagtt
                     Marmoset  ctgaaataaaactggaagatgttttcaggccctaggggggtaagaagtgttcctaaaccagacccaagtt
              Squirrel monkey  ctgaaataatactgcaagaagttttcagaccttagggggataagaagtgttccttaacgagacccaagtt
                     Bushbaby  ctaaaatccacttgaaagacattttcaagtcctacaaaagcaagaaacattcctcaactaggcctg----
           Chinese tree shrew  ctgaaatccattgggaagacgttttcaggtcctggagaagctggaagtattccttggctaggtccgagtt
                     Elephant  ctgaaatccactgaggaattgtttccaggtcccccaggagttgggaatgctccttatggaggcctaaatt
                      Manatee  ctgaaatccactggggaaatgtttctaggtcttccgggagttgggaatgctccctatcgaggcctgaatt
             Cape golden mole  ctgaaatccactggggaaatatttccaggtc-cccagaagttgagaatgtt-----------cctaaatt
               Golden hamster  ======================================================================
                       Tenrec  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
               Naked mole-rat  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                   Chinchilla  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                   Guinea pig  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
                       Lizard  ======================================================================
                 Nile tilapia  ======================================================================
        Burton's mouthbreeder  ======================================================================
                  Stickleback  ======================================================================
                      Dolphin  ======================================================================
                          Pig  ======================================================================
                     Aardvark  ======================================================================
                      Wallaby  ======================================================================
       White-throated sparrow  ======================================================================
                  Spotted gar  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
                 Weddell seal  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
       Spiny softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           Tibetan ground jay  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                 Atlantic cod  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Gibbon  ----------------------------------------------------------------------
                     Platypus  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
                Domestic goat  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  ctgcttcctggga-gtatctccccaggctgtatctcagcacagctcttgcctctgccctcttgggtg--t
                        Chimp  ctgcttcctggga-ctatctccccaggctgtatctcagcacagctcttgcctctgccctcttgggtg--t
                      Gorilla  ctgtttcctggga-gtatctccccaggctgtatctcagcacagctcttgcctctgccctcttgggtg--t
                    Orangutan  ctgcttcctggga-gtatctccccgggctgtatctcagcacagctcttgcctgtgccctcttgggtg--a
                       Rhesus  ctgcttcctgggaggtgcctccccaggctgtatctccgcacaactcttgcctctgccctcttgggtg--t
          Crab-eating macaque  ctgcttcctgggaggtgcctccccaggctgtatctccgcacaactcttgcctctgccctcttgggtg--t
                       Baboon  ctgcttcctggga-gcgcctccccaggctgtatctccgcacaactcttgcctctgccctcttgggtg--t
                 Green monkey  ctgcttcctggga-gtgtctccccaagctgtatctctgcacaactcttgcctctgccatcttgggtg--t
                     Marmoset  ctgcctgctggga-gtacctcgccaggctgtatctcagcacgactcttgcctctgcctttctgggtg--a
              Squirrel monkey  ctgcttgctggga-gtacctccccaggctgtgtctcagtacaagtcttgcctctgccttcctgggtg--a
                     Bushbaby  --gccttc----a-gcatctgcccaggccgtatctcagcttgactcttaccttggccctcttgggtatct
           Chinese tree shrew  ttgccctcgggga-gtgtctccctaagccatatttcaatagcatacttgactctgtccgc-taggtg--t
                     Elephant  ctgttccttggga-gtgtctccccaatctatgtttcaacatgactcctgcctctgtcctcttggatg--t
                      Manatee  ctgctcattggga-gtgtctccccaatttacatttcaacatgactcctgcctctgtcctcttagatg--t
             Cape golden mole  cagctcactggga-acatctttccaatcta--tttcaacatgacttatgcctctgtcctcttggttg--c
               Golden hamster  ======================================================================
                       Tenrec  ======================================================================
                 Prairie vole  ======================================================================
              Chinese hamster  ======================================================================
                          Rat  ======================================================================
               Naked mole-rat  ======================================================================
                    Armadillo  ======================================================================
          Cape elephant shrew  ======================================================================
                   Chinchilla  ======================================================================
                        Mouse  ======================================================================
             Brush-tailed rat  ======================================================================
       Lesser Egyptian jerboa  ======================================================================
                   Guinea pig  ======================================================================
                  Zebra mbuna  ======================================================================
          Pundamilia nyererei  ======================================================================
                       Lizard  ======================================================================
                 Nile tilapia  ======================================================================
        Burton's mouthbreeder  ======================================================================
                  Stickleback  ======================================================================
                      Dolphin  ======================================================================
                          Pig  ======================================================================
                     Aardvark  ======================================================================
                      Wallaby  ======================================================================
       White-throated sparrow  ======================================================================
                  Spotted gar  ======================================================================
                       Medaka  ======================================================================
                    Zebrafish  ======================================================================
                 Weddell seal  ======================================================================
              Green seaturtle  ======================================================================
     Chinese softshell turtle  ======================================================================
       Spiny softshell turtle  ======================================================================
               Painted turtle  ======================================================================
                   Budgerigar  ======================================================================
             Peregrine falcon  ======================================================================
                 Saker falcon  ======================================================================
           Tibetan ground jay  ======================================================================
                  Rock pigeon  ======================================================================
          Collared flycatcher  ======================================================================
              Tasmanian devil  ======================================================================
                      Opossum  ======================================================================
                 Killer whale  ======================================================================
               Bactrian camel  ======================================================================
                 Atlantic cod  ======================================================================
                       Turkey  ======================================================================
                Big brown bat  ======================================================================
                      Chicken  ======================================================================
          Medium ground finch  ======================================================================
                       Gibbon  ----------------------------------------------------------------------
                     Platypus  ======================================================================
                        Sheep  ======================================================================
                          Cow  ======================================================================
             Tibetan antelope  ======================================================================
             Black flying-fox  ======================================================================
                     Squirrel  ======================================================================
                     Microbat  ======================================================================
         David's myotis (bat)  ======================================================================
                          Dog  ======================================================================
                Domestic goat  ======================================================================
           American alligator  ======================================================================
                  Zebra finch  ======================================================================
                       Alpaca  ======================================================================
               Pacific walrus  ======================================================================
                        Panda  ======================================================================
                      Ferret   ======================================================================
                          Cat  ======================================================================
             White rhinoceros  ======================================================================
                        Horse  ======================================================================

                        Human  ccctccttttccagcaccttcttggccatgttg-aagaatgtgc-ccttt
                        Chimp  ccctccttttccagcaccttcttggccatgttg-aagaatgtgc-ccttt
                      Gorilla  ccctccttttccagcaccttcttggccatgttg-aagaatgtgc-ccttt
                    Orangutan  ctctccttttccagcaccttcttggccgttttg-aagaatgtgc-ccttt
                       Rhesus  ccctccttttccagcaccttcttggccattttg-aagaaaaagg-ctttt
          Crab-eating macaque  ccctccttttccagcaccttcttggccattttg-aagaaaaagg-ctttt
                       Baboon  ccctccttttccagcaccttcttggccattttg-aagaaaaagg-ctttt
                 Green monkey  ccctccttttccagcactttcttggccattttg-aagaatgtgc-ccttt
                     Marmoset  ccctcctttgccagaaccttcttggccattttg-aagaatg----ccttt
              Squirrel monkey  ccctcctttgccaccaccttcttagccattttg-aagaatgtgc-ccttt
                     Bushbaby  ccctcttttttcagtactttatttgctattttg-aagactgttc-ccttt
           Chinese tree shrew  cccgcctttgccagcaccttcttgaccactttg-aagaatgcat-ccttt
                     Elephant  tcctccttttccagcacctaactggccactttg-aaaaaaatgtgcctct
                      Manatee  ccctccttttccagcacctacttggccactctgaaaaaaaatgtgcctct
             Cape golden mole  ccctccttttccagcatcttcttggccacttag-aaaaaaaaat-cctat
               Golden hamster  ==================================================
                       Tenrec  ==================================================
                 Prairie vole  ==================================================
              Chinese hamster  ==================================================
                          Rat  ==================================================
               Naked mole-rat  ==================================================
                    Armadillo  ==================================================
          Cape elephant shrew  ==================================================
                   Chinchilla  ==================================================
                        Mouse  ==================================================
             Brush-tailed rat  ==================================================
       Lesser Egyptian jerboa  ==================================================
                   Guinea pig  ==================================================
                  Zebra mbuna  ==================================================
          Pundamilia nyererei  ==================================================
                       Lizard  ==================================================
                 Nile tilapia  ==================================================
        Burton's mouthbreeder  ==================================================
                  Stickleback  ==================================================
                      Dolphin  ==================================================
                          Pig  ==================================================
                     Aardvark  ==================================================
                      Wallaby  ==================================================
       White-throated sparrow  ==================================================
                  Spotted gar  ==================================================
                       Medaka  ==================================================
                    Zebrafish  ==================================================
                 Weddell seal  ==================================================
              Green seaturtle  ==================================================
     Chinese softshell turtle  ==================================================
       Spiny softshell turtle  ==================================================
               Painted turtle  ==================================================
                   Budgerigar  ==================================================
             Peregrine falcon  ==================================================
                 Saker falcon  ==================================================
           Tibetan ground jay  ==================================================
                  Rock pigeon  ==================================================
          Collared flycatcher  ==================================================
              Tasmanian devil  ==================================================
                      Opossum  ==================================================
                 Killer whale  ==================================================
               Bactrian camel  ==================================================
                 Atlantic cod  ==================================================
                       Turkey  ==================================================
                Big brown bat  ==================================================
                      Chicken  ==================================================
          Medium ground finch  ==================================================
                       Gibbon  --------------------------------------------------
                     Platypus  ==================================================
                        Sheep  ==================================================
                          Cow  ==================================================
             Tibetan antelope  ==================================================
             Black flying-fox  ==================================================
                     Squirrel  ==================================================
                     Microbat  ==================================================
         David's myotis (bat)  ==================================================
                          Dog  ==================================================
                Domestic goat  ==================================================
           American alligator  ==================================================
                  Zebra finch  ==================================================
                       Alpaca  ==================================================
               Pacific walrus  ==================================================
                        Panda  ==================================================
                      Ferret   ==================================================
                          Cat  ==================================================
             White rhinoceros  ==================================================
                        Horse  ==================================================

Inserts between block 30 and 31 in window
B D                 Elephant 22280bp
B D                  Manatee 16929bp

Alignment block 31 of 38 in window, 42880741 - 42880741, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
             Cape golden mole  g
              Golden hamster  =
B D                    Tenrec  =
                Prairie vole  =
B D           Chinese hamster  =
B D                       Rat  =
B D            Naked mole-rat  =
B D                 Armadillo  =
         Cape elephant shrew  =
                  Chinchilla  =
B D                     Mouse  =
            Brush-tailed rat  =
      Lesser Egyptian jerboa  =
B D                Guinea pig  =
                 Zebra mbuna  =
         Pundamilia nyererei  =
B D                    Lizard  =
B D              Nile tilapia  =
       Burton's mouthbreeder  =
B D               Stickleback  =
B D                   Dolphin  =
B D                       Pig  =
                    Aardvark  =
B D                   Wallaby  =
  D    White-throated sparrow  =
                 Spotted gar  =
B D                    Medaka  =
B D                 Zebrafish  =
                Weddell seal  =
  D           Green seaturtle  =
  D  Chinese softshell turtle  =
  D    Spiny softshell turtle  =
  D            Painted turtle  =
B D                Budgerigar  =
  D          Peregrine falcon  =
  D              Saker falcon  =
          Tibetan ground jay  =
  D               Rock pigeon  =
  D       Collared flycatcher  =
B D           Tasmanian devil  =
B D                   Opossum  =
                Killer whale  =
              Bactrian camel  =
B D              Atlantic cod  =
B D                    Turkey  =
B D                   Manatee  =
               Big brown bat  =
B D                   Chicken  =
B D       Medium ground finch  =
B D                    Gibbon  -
B D                  Platypus  =
B D                     Sheep  =
B D                       Cow  =
            Tibetan antelope  =
B D                  Elephant  =
            Black flying-fox  =
B D                  Squirrel  =
B D                  Microbat  =
        David's myotis (bat)  =
B D                       Dog  =
               Domestic goat  =
B D        American alligator  =
B D               Zebra finch  =
B D                    Alpaca  =
              Pacific walrus  =
B D                     Panda  =
B D                   Ferret   =
B D                       Cat  =
B D          White rhinoceros  =
B D                     Horse  =

Inserts between block 31 and 32 in window
            Cape golden mole 58823bp

Alignment block 32 of 38 in window, 42880742 - 42880745, 4 bps 
B D                     Human  agaa
B D                     Chimp  agaa
B D                   Gorilla  agaa
B D                 Orangutan  agaa
B D                    Rhesus  agac
B D       Crab-eating macaque  agac
B D                    Baboon  agac
B D              Green monkey  agac
B D                  Marmoset  agaa
B D           Squirrel monkey  agaa
B D                  Bushbaby  agca
           Chinese tree shrew  ggga
              Golden hamster  ====
B D                    Tenrec  ====
                Prairie vole  ====
B D           Chinese hamster  ====
B D                       Rat  ====
B D            Naked mole-rat  ====
B D                 Armadillo  ====
         Cape elephant shrew  ====
                  Chinchilla  ====
B D                     Mouse  ====
            Brush-tailed rat  ====
      Lesser Egyptian jerboa  ====
B D                Guinea pig  ====
                 Zebra mbuna  ====
         Pundamilia nyererei  ====
B D                    Lizard  ====
B D              Nile tilapia  ====
       Burton's mouthbreeder  ====
B D               Stickleback  ====
B D                   Dolphin  ====
B D                       Pig  ====
                    Aardvark  ====
B D                   Wallaby  ====
  D