Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 126 in window, 15600700 - 15600712, 13 bps 
B D                     Human  agc--cca-at-agag----------------c
B D                     Chimp  agc--cca-at-agag----------------c
B D                   Gorilla  agc--cca-at-agag----------------c
B D                 Orangutan  agc--cca-at-agag----------------c
B D                    Gibbon  agc--cca-at-agag----------------c
B D                    Rhesus  agc--cca-at-agag----------------c
B D       Crab-eating macaque  agc--cca-at-agag----------------c
B D                    Baboon  agc--cca-at-agag----------------c
B D              Green monkey  agc--cca-at-agag----------------c
B D                  Marmoset  agc--cct-at-agag----------------c
B D           Squirrel monkey  agc--cct-at-agag----------------c
B D                  Bushbaby  ---------at-gcag----------------c
           Chinese tree shrew  atc--cct-at-gtag----------------c
B D                  Squirrel  acc--cgctgt-gtaa----------------a
       Lesser Egyptian jerboa  acc--atg-------------------------
                 Prairie vole  acc--ccc-ag-gtag----------------t
B D           Chinese hamster  acc--ccctag-gtat----------------a
               Golden hamster  acc--ccatag-gtag----------------c
B D                     Mouse  acc--ccctgg-gtag----------------c
B D                       Rat  acc--ccctag-gtag----------------c
B D            Naked mole-rat  acc--tgctat-gcaa----------------c
B D                Guinea pig  acc--ctttat-gtat----------------c
                   Chinchilla  acc--cactct-gtat----------------c
             Brush-tailed rat  aac--cactat-gtat----------------c
B D                    Rabbit  agc--ccc-at-gtaa----------------c
B D                      Pika  acc--ccg-gt-ataa----------------t
B D                    Alpaca  acc--cct-ag-gtag----------------c
               Bactrian camel  acc--cct-ag-gtag----------------c
B D                   Dolphin  atc--ctt-at-gcag----------------c
                 Killer whale  atc--ctt-at-gcag----------------c
             Tibetan antelope  acc--cct-ct-gtag----------------c
B D                       Cow  acc--cct-ct-gtag----------------c
B D                     Sheep  acc--cct-ct-gtag----------------c
                Domestic goat  acc--cct-ct-gtag----------------c
B D                     Horse  atc--cct-gt-gtag----------------c
B D          White rhinoceros  atc--cct-gt-gtag----------------c
B D                       Cat  acc--cct-at-gtaa----------------c
B D                       Dog  acc--ctt-at-gtag----------------c
B D                   Ferret   acc--cct-ac-atag----------------c
B D                     Panda  acc--cct-at-gtag----------------c
               Pacific walrus  acc--cct-ag-gtag----------------c
                 Weddell seal  acc--cct-ag-gtag----------------c
             Black flying-fox  acc--cct-at-gcac----------------c
B D                   Megabat  acc--cct-at-gcac----------------c
                Big brown bat  act--cat-at-gaag----------------c
         David's myotis (bat)  gct--cat-at-gaag----------------c
B D                  Microbat  gct--cat-at-gaag----------------c
B D                  Hedgehog  gcc--cct-caggcag----------------t
B D                     Shrew  atc--cct-gc--cag-------------ttac
              Star-nosed mole  acc--cct-gc-acag----------------a
B D                  Elephant  atc--cct-at-gtca----------------t
          Cape elephant shrew  acc--cta-gtaagcc----------------c
B D                   Manatee  acc--cct-at-gtca----------------t
             Cape golden mole  atc--tct-at-ggca----------------t
B D                    Tenrec  accctttt-at-gtca----------------t
                     Aardvark  acc--cct-at-ggca----------------t
B D                 Armadillo  acc--ccc-at-gcag----------------c
B D                   Opossum  att--cat-ac-atag----------------t
B D           Tasmanian devil  act--cat-ac-atag----------------t
B D                   Wallaby  act--cat-gc-atag----------------t
B D                  Platypus  agc--aac-aa-agag----------------t
  D               Rock pigeon  acc--cac-ag-gaca-----------------
  D              Saker falcon  acc--cac-ag-gacagagcc------------
  D          Peregrine falcon  acc--cac-ag-gacagagcc------------
           Tibetan ground jay  acc--tgc-ag-gatg-----------------
  D              Mallard duck  acc--cat-ag-aata-----------------
B D                    Turkey  acc--caa-gg-aatg-----------------
B D        American alligator  att--cac-ag-acag-----tcct--------
  D           Green seaturtle  att--ccg-ag-tccg---------catt----
  D            Painted turtle  att--cct-ag-acag---------tgtt----
  D  Chinese softshell turtle  att--cct-ag-acag---------tatt----
  D    Spiny softshell turtle  att--cct-ag-acag---------tgtt----
B D                    Lizard  ata--act-tg-tcag-----------------
B D                Coelacanth  agt--cac-------------------------
           Southern platyfish  gag--tct-gt-agaa----------------g
       Burton's mouthbreeder  =================================
B D              Nile tilapia  =================================
         Pundamilia nyererei  ---------------------------------
B D                 Tetraodon  =================================
  D             Scarlet macaw  =================================
                 Zebra mbuna  ---------------------------------
  D                    Parrot  =================================
B D                    Medaka  =================================
         Princess of Burundi  ---------------------------------
B D                Budgerigar  =================================
    Mexican tetra (cavefish)  =================================
                 Spotted gar  =================================
  D       Collared flycatcher  =================================
B D       Medium ground finch  =================================
  D    White-throated sparrow  =================================
B D                   Chicken  =================================
B D             X. tropicalis  =================================
B D               Zebra finch  =================================

Alignment block 2 of 126 in window, 15600713 - 15600715, 3 bps 
B D                     Human  cat
B D                     Chimp  cat
B D                   Gorilla  cat
B D                 Orangutan  cat
B D                    Gibbon  cat
B D                    Rhesus  cat
B D       Crab-eating macaque  cat
B D                    Baboon  tat
B D              Green monkey  cat
B D                  Marmoset  cat
B D           Squirrel monkey  cat
B D                  Bushbaby  cgt
           Chinese tree shrew  cag
B D                  Squirrel  cat
                 Prairie vole  ctc
B D           Chinese hamster  ctc
               Golden hamster  ctc
B D                     Mouse  ctc
B D                       Rat  ctg
B D            Naked mole-rat  c-t
B D                Guinea pig  cgt
                   Chinchilla  cat
             Brush-tailed rat  agg
B D                    Rabbit  cat
B D                      Pika  cag
B D                    Alpaca  aat
               Bactrian camel  aat
B D                   Dolphin  tat
                 Killer whale  tat
             Tibetan antelope  cat
B D                       Cow  cat
B D                     Sheep  cat
                Domestic goat  cat
B D                     Horse  cat
B D          White rhinoceros  cgt
B D                       Cat  cat
B D                       Dog  cat
B D                   Ferret   cac
B D                     Panda  cat
               Pacific walrus  cat
                 Weddell seal  cgt
             Black flying-fox  cat
B D                   Megabat  cac
                Big brown bat  cat
         David's myotis (bat)  cat
B D                  Microbat  cat
B D                  Hedgehog  cgt
B D                     Shrew  caa
              Star-nosed mole  cat
B D                  Elephant  cat
          Cape elephant shrew  cgc
B D                   Manatee  cat
             Cape golden mole  cgt
B D                    Tenrec  cat
                     Aardvark  gat
B D                 Armadillo  cat
B D                   Opossum  cac
B D           Tasmanian devil  cat
B D                   Wallaby  cat
B D                  Platypus  cat
B D                    Medaka  cat
           Southern platyfish  cat
      Lesser Egyptian jerboa  ---
       Burton's mouthbreeder  ===
B D              Nile tilapia  ===
         Pundamilia nyererei  ---
B D                 Tetraodon  ===
  D             Scarlet macaw  ===
B D                    Lizard  ---
                 Zebra mbuna  ---
  D                    Parrot  ===
  D           Green seaturtle  ---
         Princess of Burundi  ---
  D  Chinese softshell turtle  ---
B D                Budgerigar  ===
  D          Peregrine falcon  ---
    Mexican tetra (cavefish)  ===
  D              Mallard duck  ---
  D            Painted turtle  ---
                 Spotted gar  ===
  D    Spiny softshell turtle  ---
B D                Coelacanth  ---
  D              Saker falcon  ---
B D                    Turkey  ---
  D       Collared flycatcher  ===
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D                   Chicken  ===
          Tibetan ground jay  ---
B D             X. tropicalis  ===
B D        American alligator  ---
B D               Zebra finch  ===
  D               Rock pigeon  ---

Inserts between block 2 and 3 in window
B D                  Dolphin 4bp
                Killer whale 4bp
          Southern platyfish 2bp

Alignment block 3 of 126 in window, 15600716 - 15600716, 1 bps 
B D                     Human  g
B D                     Chimp  g
B D                   Gorilla  g
B D                 Orangutan  g
B D                    Gibbon  g
B D                    Rhesus  g
B D       Crab-eating macaque  g
B D                    Baboon  g
B D              Green monkey  g
B D                  Marmoset  g
B D           Squirrel monkey  g
B D                  Bushbaby  g
           Chinese tree shrew  g
B D                  Squirrel  g
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D                       Rat  a
B D            Naked mole-rat  g
B D                Guinea pig  g
                   Chinchilla  g
             Brush-tailed rat  g
B D                    Rabbit  g
B D                      Pika  g
B D                    Alpaca  g
               Bactrian camel  g
B D                   Dolphin  g
                 Killer whale  g
             Tibetan antelope  g
B D                       Cow  g
B D                     Sheep  g
                Domestic goat  g
B D                     Horse  g
B D          White rhinoceros  g
B D                       Cat  g
B D                       Dog  g
B D                   Ferret   g
B D                     Panda  g
               Pacific walrus  g
                 Weddell seal  g
             Black flying-fox  g
B D                   Megabat  g
                Big brown bat  g
         David's myotis (bat)  g
B D                  Microbat  g
B D                  Hedgehog  g
B D                     Shrew  a
              Star-nosed mole  g
B D                  Elephant  a
          Cape elephant shrew  g
B D                   Manatee  a
             Cape golden mole  a
B D                    Tenrec  a
                     Aardvark  a
B D                 Armadillo  g
B D                   Opossum  g
B D           Tasmanian devil  g
B D                   Wallaby  g
B D                  Platypus  g
  D               Rock pigeon  g
  D       Collared flycatcher  g
  D    White-throated sparrow  g
B D       Medium ground finch  g
B D               Zebra finch  g
           Tibetan ground jay  g
B D                Budgerigar  g
  D                    Parrot  g
  D             Scarlet macaw  g
  D              Mallard duck  g
B D                   Chicken  g
B D                    Turkey  g
B D        American alligator  g
  D           Green seaturtle  a
  D            Painted turtle  g
  D  Chinese softshell turtle  g
  D    Spiny softshell turtle  g
B D                    Lizard  c
B D                Coelacanth  a
B D                    Medaka  g
           Southern platyfish  a
      Lesser Egyptian jerboa  -
       Burton's mouthbreeder  =
B D              Nile tilapia  =
         Pundamilia nyererei  -
B D                 Tetraodon  =
                 Zebra mbuna  -
         Princess of Burundi  -
  D          Peregrine falcon  -
    Mexican tetra (cavefish)  =
                 Spotted gar  =
  D              Saker falcon  -
B D             X. tropicalis  =

Alignment block 4 of 126 in window, 15600717 - 15600719, 3 bps 
B D                     Human  ag--a
B D                     Chimp  ag--a
B D                   Gorilla  ag--a
B D                 Orangutan  ag--a
B D                    Gibbon  ag--a
B D                    Rhesus  ag--a
B D       Crab-eating macaque  ag--a
B D                    Baboon  ag--a
B D              Green monkey  ag--a
B D                  Marmoset  ag--a
B D           Squirrel monkey  ag--a
B D                  Bushbaby  ag--a
           Chinese tree shrew  ag--a
B D                  Squirrel  ag--a
       Lesser Egyptian jerboa  ag--a
                 Prairie vole  aa--a
B D           Chinese hamster  aa--a
               Golden hamster  aaaca
B D                     Mouse  ag--a
B D                       Rat  ag--a
B D            Naked mole-rat  ag--a
B D                Guinea pig  ac--a
                   Chinchilla  ag--a
             Brush-tailed rat  ag--a
B D                    Rabbit  aa--a
B D                      Pika  aa--a
B D                    Alpaca  ag--a
               Bactrian camel  ag--a
B D                   Dolphin  ag--a
                 Killer whale  ag--a
             Tibetan antelope  ag--g
B D                       Cow  ag--g
B D                     Sheep  ag--g
                Domestic goat  ag--g
B D                     Horse  ag--a
B D          White rhinoceros  ag--a
B D                       Cat  ag--a
B D                       Dog  aa--a
B D                   Ferret   ga--a
B D                     Panda  aa--a
               Pacific walrus  aa--a
                 Weddell seal  aa--a
             Black flying-fox  aa--c
B D                   Megabat  aa--c
                Big brown bat  ca--c
         David's myotis (bat)  ca--c
B D                  Microbat  ca--c
B D                  Hedgehog  ag--a
B D                     Shrew  ag--a
              Star-nosed mole  ag--c
B D                  Elephant  ag--a
          Cape elephant shrew  gg--a
B D                   Manatee  aa--a
             Cape golden mole  ag--a
B D                    Tenrec  ag--a
                     Aardvark  ga--a
B D                 Armadillo  ag--a
B D                   Opossum  ag--a
B D           Tasmanian devil  aa--a
B D                   Wallaby  ag--a
B D                  Platypus  ag--a
  D               Rock pigeon  ag--t
  D       Collared flycatcher  ag--c
  D    White-throated sparrow  ag--c
B D       Medium ground finch  ag--c
B D               Zebra finch  ag--c
           Tibetan ground jay  ag--c
B D                Budgerigar  ag--t
  D                    Parrot  ag--c
  D             Scarlet macaw  ag--c
  D              Mallard duck  ag--c
B D                   Chicken  ag--c
B D                    Turkey  ag--c
B D        American alligator  ag--t
  D           Green seaturtle  tg--t
  D            Painted turtle  ag--t
  D  Chinese softshell turtle  ag--t
  D    Spiny softshell turtle  ag--t
B D                    Lizard  ag--t
B D             X. tropicalis  at--a
B D                Coelacanth  aa--t
B D                 Tetraodon  aa--g
B D              Nile tilapia  ag--t
        Burton's mouthbreeder  ag--t
B D                    Medaka  aa--t
           Southern platyfish  ag--g
         Pundamilia nyererei  -----
                 Zebra mbuna  -----
         Princess of Burundi  -----
  D          Peregrine falcon  -----
    Mexican tetra (cavefish)  =====
                 Spotted gar  =====
  D              Saker falcon  -----

Alignment block 5 of 126 in window, 15600720 - 15600725, 6 bps 
B D                     Human  actcac
B D                     Chimp  actcac
B D                   Gorilla  actcac
B D                 Orangutan  actcac
B D                    Gibbon  actcac
B D                    Rhesus  actcac
B D       Crab-eating macaque  actcac
B D                    Baboon  actcac
B D              Green monkey  actcac
B D                  Marmoset  actcac
B D           Squirrel monkey  actcac
B D                  Bushbaby  actcac
           Chinese tree shrew  actcac
B D                  Squirrel  actcac
       Lesser Egyptian jerboa  actcac
                 Prairie vole  actcac
B D           Chinese hamster  actcac
               Golden hamster  actcac
B D                     Mouse  acttac
B D                       Rat  acttac
B D            Naked mole-rat  acttac
B D                Guinea pig  acttac
                   Chinchilla  acttac
             Brush-tailed rat  acttac
B D                    Rabbit  actcac
B D                      Pika  actcac
B D                    Alpaca  actcac
               Bactrian camel  actcac
B D                   Dolphin  actcac
                 Killer whale  actcac
             Tibetan antelope  actcac
B D                       Cow  actcac
B D                     Sheep  actcac
                Domestic goat  actcac
B D                     Horse  actcac
B D          White rhinoceros  actcac
B D                       Cat  actcac
B D                       Dog  actcac
B D                   Ferret   actcac
B D                     Panda  actcac
               Pacific walrus  actcac
                 Weddell seal  actcac
             Black flying-fox  actcac
B D                   Megabat  actcac
                Big brown bat  actcac
         David's myotis (bat)  actcac
B D                  Microbat  actcac
B D                  Hedgehog  actcac
B D                     Shrew  acttac
              Star-nosed mole  actcac
B D                  Elephant  acttac
          Cape elephant shrew  actcac
B D                   Manatee  actcac
             Cape golden mole  actcac
B D                    Tenrec  actcac
                     Aardvark  acttac
B D                 Armadillo  actcac
B D                   Opossum  actcac
B D           Tasmanian devil  actcac
B D                   Wallaby  actcac
B D                  Platypus  acttac
  D               Rock pigeon  acttac
  D              Saker falcon  -cttac
  D          Peregrine falcon  -cttac
  D       Collared flycatcher  acttac
  D    White-throated sparrow  actcac
B D       Medium ground finch  actcac
B D               Zebra finch  actcac
           Tibetan ground jay  acttac
B D                Budgerigar  acttac
  D                    Parrot  acttac
  D             Scarlet macaw  acttac
  D              Mallard duck  acttac
B D                   Chicken  acttac
B D                    Turkey  acttac
B D        American alligator  acttac
  D           Green seaturtle  acccac
  D            Painted turtle  acccac
  D  Chinese softshell turtle  acccac
  D    Spiny softshell turtle  acccac
B D                    Lizard  acccac
B D             X. tropicalis  acctac
B D                Coelacanth  acaaac
B D                 Tetraodon  actcac
B D              Nile tilapia  gctgac
        Burton's mouthbreeder  gctgac
B D                    Medaka  acctac
           Southern platyfish  acgtac
     Mexican tetra (cavefish)  actcac
                  Spotted gar  acttac
         Pundamilia nyererei  ------
                 Zebra mbuna  ------
         Princess of Burundi  ------

Inserts between block 5 and 6 in window
B D                  Opossum 9bp
B D                  Wallaby 293bp

Alignment block 6 of 126 in window, 15600726 - 15600797, 72 bps 
B D                     Human  catgttttggacattctcttcagtaatattggtgttataattccaagaagcaagtgaactttgatagaac
B D                     Chimp  catgttttggacattctcttcagtaatattggtgttataattccaagaagcaagtgaactttgatagaac
B D                   Gorilla  catgttttggacattctcttcagtaatattggtgttataattccaagaagcaagtgaactttgatagaac
B D                 Orangutan  catgttttggacattctcttcagtaatattggtgttataattccaagaagcaagtgaactttgatagaac
B D                    Gibbon  catgttttggacattctcttcagtaatattggtgttataattccaagaagcaagtgaactttgatagaac
B D                    Rhesus  catgttttggacattctcttcggtaatattggtgttataattccaagaagcaagtgaactttgatagaac
B D       Crab-eating macaque  catgttttggacattctcttcagtaatattggtgttataattccaagaagcaagtgaactttgatagaac
B D                    Baboon  catgttttggacattctcttcagtaatattggtgttataattccaagaagcaagtgaactttgatagaac
B D              Green monkey  catgttttggacattctcttcagtaatattggtgttataattccaagaagcaagtgaactttgatagaac
B D                  Marmoset  catgttttgaacattctcttcggtaatattggtgttataattccaagaagcaagtgaattttcatggaac
B D           Squirrel monkey  catgttttgaacattctcttcagtaatattggtgttataattccaagaagcaagtgaattttcatggaac
B D                  Bushbaby  catcttttgggcattctcttcagtaatattggtgttataatcccaagaagcaagtgcagcttgatgagac
           Chinese tree shrew  catcttttggatattctcttcagtaatattggtgttataatcccaagacgccagtgaactttgatgagac
B D                  Squirrel  catcttttgggtattctcctctgtgatatttgtgttataattccaagcagcaagtgaacgttgataatcc
       Lesser Egyptian jerboa  catcttttgggcattctcctcagtaatattggtgttataattccaagaagcaagtgaactttgataagac
                 Prairie vole  catcttttgggcattctcctcagtaatattggtgttataattccaagaagcaagtgcactttgataagac
B D           Chinese hamster  catcttttgggcattctcttcagtaatattggtgttataattccaagaagcaagtgcactttgataagac
               Golden hamster  catcttttgggcattctcctcagtaatattggtgttataattccaagaagcaagtgcactttgataagac
B D                     Mouse  catcttttgggcattttcttcagtaatgttagtattataattccaagaagcaagtgaactttgataagac
B D                       Rat  catcttttgggcattctcctccgtaatgttggtgttgtaattccaagaagcaagtgaactttgattttac
B D            Naked mole-rat  catcttttggacattctcctcagtaatattggtgttataattccaagaagcaagtgaactttgatatgac
B D                Guinea pig  catcttttggacattttcatcagtaatattggtgttataattccaagaagcaagtgaactttgataatac
                   Chinchilla  catcttttgaacattctcctcagtaatattggtgttataattccaagaagcaagtgaactttgataagat
             Brush-tailed rat  catcttttgaacattttcgtcagtaatattggtgttataatcccaagaagcaagtgagctttgataagat
B D                    Rabbit  catcttttggacattctcttcggtaatattggtgttataatcccaagaagcaagtgcactttgataagac
B D                      Pika  cattttttgggcattctcttcagtaatgttggtgttatagtcccaagcagcaagtgcactttgataagag
B D                    Alpaca  catcttttggacattctcatctgtaatattggtgttataattccaagaagcaagtgaactttgataagac
               Bactrian camel  catcttttggacattctcatctgtaatattggtgttataattccaagaagcaagtgaactttgataagac
B D                   Dolphin  catcttttggacattctcatcggtaatattggtgttataattccaagaagcaagtgaactttgataagac
                 Killer whale  catcttttggacattctcatcggtaatattggtgttataattccaagaagcaagtgaactttgataagac
             Tibetan antelope  catcttttggacattctcatcggtaatattggtgttataattccaagaagcaagtgaactttgataagac
B D                       Cow  catcttttggacattctcatcggtaatattggtgttataattccaagaagcaagtgaactttgataagac
B D                     Sheep  catcttttggacattctcatcggtaatattggtgttataattccaagaagcaagtgaactttgataagac
                Domestic goat  catcttttggacattctcatcggtaatattggtgttataattccaagaagcaagtgaactttgataagac
B D                     Horse  catcttttggacattctcgtcagtaatattggtgttataactccaagaagcaagtgaactttgatgagac
B D          White rhinoceros  catcttttggacattctcgtcggtaatattggtgttataactccaagaagcaagtgcactttgataagac
B D                       Cat  cattttttggacattctcgtctgtgatattggtgttataattccaggaagcaagtgaactttgataagac
B D                       Dog  catcttttggacattctcgtcggtaatattgatgttataattccaagaagcaagtgaactttgataagac
B D                   Ferret   catcttttggatattctcgtcggtaatattggtgttataattccaagaagcaagtgaattttgataagac
B D                     Panda  catcttttcgatattctcgtcggtaatattggtgttataattccaagaagcaagagaactttgataatac
               Pacific walrus  catcttttggacattctcgtcggtaatattggtgttataattccaagaaacaaatgaactttgataaaac
                 Weddell seal  catcttttggatattctcgtcggtaatattggtgttagcattccaagaagcaagtgaactttgataagac
             Black flying-fox  catcttttggacattctcatcggtaatattggtgttataatcccaagaagcgagtgaactttgataaaac
B D                   Megabat  catcttttggacattctcatcggtaatattggtgttataatcccaagaagcaagtgaactttgataaaac
                Big brown bat  cattttttgggcattctcgtcggtaatattggtgttataattccaagaagcaagcgcactttcatgagac
         David's myotis (bat)  cattttttggacattctcgtcggtaatattggtgttataatcccaagaagcgagtgcactttcatgagac
B D                  Microbat  cattttttggacattctcgtcggtaatattggtgttataattccaagaagcgagtgcactttcatgagac
B D                  Hedgehog  catcttttggatattctcttcagtaatattgatgttataattccaagaagccagggcactttcgtaagac
B D                     Shrew  cattttttggacattttcatcggtaatatttgtgttataatcccaggaagcaagtgaactattgtaagac
              Star-nosed mole  catcttttggacattctcatcggtgatattcgtgttataatcccaggaggcaagcgaactattatacgac
B D                  Elephant  catcttttggacattctcgtcggtaatattggtgttataatcccaagaagcaagtgaactttgataagac
          Cape elephant shrew  catcttctgagcattctcgtcagtgatgttggtgttataatcccaagaagcgagtgagctctgataagac
B D                   Manatee  catcttttggacattctcgtcagtaatattggtgttataatcccaagatgcaagtgaactttgataagac
             Cape golden mole  catcttttgggcattctcgtcggtaatattggtgttataatcccaagaagcaagtgaactttgatgatat
B D                    Tenrec  catctttttggcattctcttcggtaatattggtgttataattccaagaagcaagggcactttggtaagag
                     Aardvark  catcttttgagcattctcgtcggtaatattggtgttataatcccaagaagcaagtgaactttgataagac
B D                 Armadillo  catctttgcctcattctcgtcagtaatattggtgttataattccaagaagcaagggcactttgatgagac
B D                   Opossum  catcttttcgacattctcgtttgtaatattagtgttatattcccaagaagcaagtgcactttgatgagat
B D           Tasmanian devil  cattttttggacattctcatcagtaatattagtgttataattccaagaagcaagtgaactttgataagac
B D                   Wallaby  catcctttggacattctcatcagtaatattattgttgtaatcccaagaagcaagtgaactttgatgagat
B D                  Platypus  catcttttgggcattctcagcagagatgttggtattatattcccaagaagccagtgagctttggtaagac
  D               Rock pigeon  cattttcctggcagtctcatcagtgatgttggtgttgtagttccatgaggcaagggagctttcatagttg
  D              Saker falcon  cattttcctggcagtctcctcagtgatgttcgtgttatagttccacgtggcgagggagctctcatagctg
  D          Peregrine falcon  cattttcctggcagtctcctcagtgatgttcgtgttatagttccacgtggcgagggagctctcatagctg
  D       Collared flycatcher  cattttattggcattatcctcagtgatgttggtgttgtagttccatgaggcaatggagttctcatagctg
  D    White-throated sparrow  cattttattggcattctcctcagtgatgttggtgttgtagttccatgaggcaatggaattctcatagctg
B D       Medium ground finch  cattttattggcattctcctcagtgatgttggtgttgtagttccatgaggcaatggagttctcatagctg
B D               Zebra finch  cattttattggcattctcctcagtgatgttggtgttgtagttccatgaggcaatggagttctcatagctg
           Tibetan ground jay  cattttattggcattctcctcagtgatgttggtgttgtagttccatgacgcaatggagttctcatagctg
B D                Budgerigar  catttgcctggcagtctcctcagtgatgttggtgttgtagttccatgaggcaagggagctatcatagctg
  D                    Parrot  catttgcctggcagtctcctcagtgatgttggtgttgtagttccatgaggcaagggagctttcatagctg
  D             Scarlet macaw  catttgcctggcagtctcctcagtgatgttggtgttgtagttccatgaggcaagagagctttcatagctg
  D              Mallard duck  catctttgtggccgtctcctcagtaatgttggtgttgtagtcccatgaggcaagggagttttcatagttg
B D                   Chicken  cattttcctggctgtctcctcagttatgttggtgttgtagttccacgaggcaagtgagttttcatagctg
B D                    Turkey  catcttcctggctgtctcctcagttatgttggtgttgtagtcccatgaggcaagtgagttttcatagctg
B D        American alligator  catcttcttggcattctcttctgtaatgttggtgttgtaggcccatgaagcaagtgaactttcataatac
  D           Green seaturtle  catcttttcagcgttctcatctgtgatgttggtgttgtagtcccaggaggcaagtgaacttgcataagac
  D            Painted turtle  catctttctggaattctcatccgtgatgttggtgttatagtcccaggaggcaagtgaacttgcataagat
  D  Chinese softshell turtle  catctttttggcattttcatcagtgatgttggtgttatagttccaggaggcaagtgaacttgcataagac
  D    Spiny softshell turtle  catctttttggcattttcatctgtgatgttggtgttatagttccaggaggcaagtgaacttgcataagac
B D                    Lizard  catcctcttggcattctcttctgtgatgttggtgttataatcccatgaagcgagtgaactttcataagat
B D             X. tropicalis  cattttttgggcattttcatcagtgatattggtgttgtattcccattgtgcaagtgcgctttgatgataa
B D                Coelacanth  cgcatttttagcattctcatcagtaatgtttgtattgtaatcccatgatgctagggatgactgataggcg
B D                 Tetraodon  cagcttctgggagttctccttggtgatgttggtattgtacgcccatgatgccagcgagtagttgtaaata
B D              Nile tilapia  ctctttgtctgcgttctcctgtgtgatgtcggtgttgtaggcccatgatgccagcgagtactggtacata
        Burton's mouthbreeder  ctctttgtctgcattctcctgtgtgatgttggtgttgtaggcccatgatgccagcgagtactggtacata
B D                    Medaka  cactttgttggaattttcctcagtgatgttggtgttgtaggcccacgatgccaggctgtactcatacatc
           Southern platyfish  ctctttgtccaagttctcctgagtgatgtcggtgttgtaggcccatgatgccagtgagtacttgtacatc
     Mexican tetra (cavefish)  cagtttgttcgagttctctgttgtgatgttgatgttgtaggcccaggacgccagggagtactggtacatg
                  Spotted gar  catcttttttgcattttcctcagtaatgttagtattgtattcccatgatgccagtgagttcaggtacgtc
         Pundamilia nyererei  ----------------------------------------------------------------------
                 Zebra mbuna  ----------------------------------------------------------------------
         Princess of Burundi  ----------------------------------------------------------------------

                        Human  ag
                        Chimp  ag
                      Gorilla  ag
                    Orangutan  ag
                       Gibbon  ag
                       Rhesus  ag
          Crab-eating macaque  ag
                       Baboon  ag
                 Green monkey  aa
                     Marmoset  ag
              Squirrel monkey  ag
                     Bushbaby  aa
           Chinese tree shrew  ag
                     Squirrel  ag
       Lesser Egyptian jerboa  aa
                 Prairie vole  ag
              Chinese hamster  ag
               Golden hamster  ag
                        Mouse  ag
                          Rat  ag
               Naked mole-rat  ag
                   Guinea pig  ag
                   Chinchilla  aa
             Brush-tailed rat  ag
                       Rabbit  ag
                         Pika  ag
                       Alpaca  cg
               Bactrian camel  ag
                      Dolphin  ag
                 Killer whale  ag
             Tibetan antelope  ag
                          Cow  ag
                        Sheep  ag
                Domestic goat  ag
                        Horse  ag
             White rhinoceros  ag
                          Cat  ag
                          Dog  ag
                      Ferret   ag
                        Panda  ag
               Pacific walrus  ag
                 Weddell seal  ag
             Black flying-fox  ag
                      Megabat  ag
                Big brown bat  ag
         David's myotis (bat)  ag
                     Microbat  ag
                     Hedgehog  ac
                        Shrew  ag
              Star-nosed mole  ag
                     Elephant  ag
          Cape elephant shrew  ag
                      Manatee  aa
             Cape golden mole  ag
                       Tenrec  ac
                     Aardvark  ag
                    Armadillo  ag
                      Opossum  aa
              Tasmanian devil  ac
                      Wallaby  ag
                     Platypus  ag
                  Rock pigeon  at
                 Saker falcon  at
             Peregrine falcon  at
          Collared flycatcher  at
       White-throated sparrow  at
          Medium ground finch  at
                  Zebra finch  at
           Tibetan ground jay  at
                   Budgerigar  at
                       Parrot  at
                Scarlet macaw  at
                 Mallard duck  at
                      Chicken  at
                       Turkey  at
           American alligator  ag
              Green seaturtle  ag
               Painted turtle  ag
     Chinese softshell turtle  ag
       Spiny softshell turtle  ag
                       Lizard  cg
                X. tropicalis  ag
                   Coelacanth  at
                    Tetraodon  cg
                 Nile tilapia  ag
        Burton's mouthbreeder  ag
                       Medaka  aa
           Southern platyfish  tt
     Mexican tetra (cavefish)  ag
                  Spotted gar  ag
          Pundamilia nyererei  --
                  Zebra mbuna  --
          Princess of Burundi  --

Inserts between block 6 and 7 in window
B D                      Rat 510bp

Alignment block 7 of 126 in window, 15600798 - 15600900, 103 bps 
B D                     Human  gtcttcggcttcgtggttaaacttgtccaaaaatgtcttggcctgttcctcaa-tggtggactgagc---
B D                     Chimp  gtcttcggcttcgtggttaaacttgtccaaaaatgtcttggcctgttcctcaa-tggtggactgagc---
B D                   Gorilla  gtcttcggcttcgtggttaaacttgtccaaaaatgtcttggcctgttcctcaa-tggtggactgagc---
B D                 Orangutan  gtcttcggcttcgtggttaaacttgtccaaaaatgtctttgcctgttcctcaa-tggtggactgagc---
B D                    Gibbon  gtcttcggcttcatggttaaacttgtccaaaaatgtcctggcctgttcctcaa-tggtggactgagc---
B D                    Rhesus  gtcttcggcttcgtggttaaacttgtccaaaaatgtcttggcctgttcctcaa-tggtggactgagc---
B D       Crab-eating macaque  gtcttcggcttcgtggttaaacttgtccaaaaatgtcttggcctgttcctcaa-tggtggactgagc---
B D                    Baboon  gtcttcggcttcgtggttaaacttgtccaaaaatgtcttggcctgttcctcaa-tggtggactgagc---
B D              Green monkey  gtcttcggcttcgtggttaaacttgtccaaaaatgtcttggcctgttcctcaa-tggtggactgagc---
B D                  Marmoset  gtcttcagcttcatggttaaacttgtccaaaaatgtcttggcctgttcctcta-tggtagactgagc---
B D           Squirrel monkey  gtcttcagcttcatggttaaacttgtccaaaaatgtcttggcctgttcctcta-tggtagactgagc---
B D                  Bushbaby  ctcttcaacttcacgattaaagttgtccaaaaatgtcttggcttgttcttcgg-tggtggactgagc---
           Chinese tree shrew  ttcttcagcctcaatgttaaacttgttcaaaaataccttggcctcttcttcaa-tggttgtctgagc---
B D                  Squirrel  gtcttcagcttcctggttaaacttgtccaaaaatgtcttggccagttcctcga-tggtggactgagc---
       Lesser Egyptian jerboa  atcttcagcttcctggttaaacttgtctaaaaatgtcttggccatttcctcag-tggtggactgagc---
                 Prairie vole  gtcttcagcttcctggttaaacttgtctaaaaatgccttggcatcttcctcga-tgatagactggac---
B D           Chinese hamster  gtcttcagcttcctggttaaacttgtctaaaaatgtcttggcctgttcctcga-tgatggactgagc---
               Golden hamster  gtcttcagcttcctggttaaacttgtctaaaaatgtcttggcctgttcctcga-tgatggactgagc---
B D                     Mouse  gtcttcagcttcctgattaaagttgtttaaaaatgtcttggcattttcctcgg-tgagggactgagc---
B D            Naked mole-rat  atcttcagcttcctgattaaacttgtccaaaaatgtcttggcctgctcctccc-tagtgagctgagc---
B D                Guinea pig  gtcttcagctttcagattaaactcatccaaaaatgtcttggcctgttcctcga-ggttgaactgagc---
                   Chinchilla  gtcttcagctttctcattaaagttgtccaaaaatgtcttggcctgttcctcta-tagtggactgagc---
             Brush-tailed rat  gtcttcagctttctgattaaagttgtccaaaaatgtcttggcctgttcctcta-tggtaaactgagc---
B D                    Rabbit  gtcttcagcttcctggttaaacttctccaaaaatgtcttggccagttcctcga-tggtagactgagc---
B D                      Pika  gtcttcagcttcttggttaaacttgtccaaaaatgtcacggccagttcctcga-cagtggactgagc---
B D                    Alpaca  gtcttcggcttcatggttaaactccttcaaaaatgtcttggccagttcctcag-tggtggattgagc---
               Bactrian camel  gtcttcggcttcatggttaaactcctccaaaaatgtcttggccagttcctcag-tggtggattgagc---
B D                   Dolphin  gtcttcagcttcacggtcaaacttctgcaaaaatgtcttggcccgttcctcag-tggcggattgagc---
                 Killer whale  gtcttcagcttcacggtcaaacttctgcaaaaatgtcttggcccgttcctcag-tggcggattgagc---
             Tibetan antelope  gtcttcggcttcatggttaaacttctccaaaaatgtcttggcctgtccttcag-tggtggattgagc---
B D                       Cow  gtcttcggcttcatggttaaacttctccaaaaatgtcttggcctgttcttcag-tggtggattgagc---
B D                     Sheep  gtcttcggcttcatggttaaacttctccaaaaatgtcttggcctgtccttcag-tggtggattgagc---
                Domestic goat  gtcttcagcttcatggttaaacttctccaaaaatgtcttggcctgttcttcag-tggtggattgagc---
B D                     Horse  ctcttcagcttcagagttaaacttctccaaaaatgtcttggctaggtcctcag-tggtggattgagc---
B D          White rhinoceros  gtcttcagcttcggggttaaacttctccaaaaatgtcttggctagttcctcag-tggtggattgagc---
B D                       Cat  ctcttcggcttcatggttaaacttctccaaaaatgtcttggccagttcttcag-tggtggattgagc---
B D                       Dog  ctcttcagcttcatagttaaacttctccaaaaatgtcttgaccagatcctca----gtggattgagc---
B D                   Ferret   ttcttcggcttcatagttaaacttctccaaaaatgtcttggccagatcctcag-tggtggactgagc---
B D                     Panda  gtcttcagcttcatagttaaacttctccaaaaatgtctcggccagatcctcag-tggtggattgagc---
               Pacific walrus  ctcttcagcttcatagttaaacttctccaaaaatgtcttgaccagatcctcag-tggtggatcgagc---
                 Weddell seal  ctcttcagcttcatagttaaacgtctccaaaaatgtcttgaccagattctcag-tggtggattgagc---
             Black flying-fox  gtcttcaacttcagtgttaaacttctctaaaaatgtcttggccagttcctcag-gagtggattgagc---
B D                   Megabat  gtcttcaacttcagtgttaaacttctctaaaaatgtcttggccagttcctcag-gagtggattgagc---
                Big brown bat  gtcttcagcttcagagttaaaattctccaaaaatatcgtggcgtttttctcag-tcgtggattgagc---
         David's myotis (bat)  gtcttcagctttagagttaaaattgtccaaaaatatcttggccttttcctcag-tggaggattgagc---
B D                  Microbat  gtcttcagctttagagttaaaattctccaaaaatatcttggccttttcctcag-tggaggattgagc---
B D                  Hedgehog  attctcagcttgcctgttaaaatcatccaaaaatttcttggcctcttcctcaa-tgttggtttgagc---
B D                     Shrew  gtcttcgacatccttattaaagttctccaaaaattttgtggc---attttcct-gaacactttgggc---
              Star-nosed mole  ctcttcagcttcacggttaaaagtctccaaaaacttcttggtttggttttcag-tgtcagactgggc---
B D                  Elephant  gtcttcggcttcttggttaaatgtgtccaaaaaggtcctggccagatcctcgg-tggtagattgagc---
          Cape elephant shrew  gtcttcggcttgttggttaaattgctccagaaaggccttggcctgctcttcag-tggtgggctgagc---
B D                   Manatee  gtcttcggcttcttggttaaatgtgtccaaaaatgtcctggccagatcctcag-tggttgattgagc---
             Cape golden mole  gttttcagcttcttggttgaagttgttcataaaggcctccgccagatcattgg-tg---gactgagc---
B D                    Tenrec  gttttcggcttcattgttaaatgtggtcagaaagctcctggcctggtcttcgg-tggtcgactgagc---
                     Aardvark  gttttcggcttcttggttaaacttctccagaaaggtcccggccaaatcttcag-tggtggcctgagc---
B D                 Armadillo  ctcttcagcttgttggttaaatgtctccaaaaatgttgaggcctgttcctcag-tg---gactgagc---
B D                   Opossum  ctcttctgccttggcgttatagtcatccagaaatgttttagcatcttcttcaa-tggagttttgagc---
B D           Tasmanian devil  atcttccgcagctttagtaaaattttccagaaatcctttagccatatcttcag-tggagagttgagc---
B D                   Wallaby  ctcttctgcttcctt-ttaaaactttccagaaatactttagcactttcttcag-tggagagttgagt---
B D                  Platypus  gtcttctgcctgcttgttgaactgtgtcagaaattgtcgcgcctcctcttcgg-gttt---ctgggc---
  D               Rock pigeon  atcttctgccctcttgttaaactcttccagaaacatttgggc---ttgttgtg-tgacagtctgtgg---
  D              Saker falcon  attttctgccctcctgttaaactcttctagaaacatttgggc---ttcttgtg-tgacatcctgagg---
  D          Peregrine falcon  attttctgccctcctgttaaactcttctagaaacatttgggc---ttcttgtg-tgacatcctgagg---
  D       Collared flycatcher  atcctctgccctcctgttaaactcttctaaaaaaatttgggc---ttcttgtg-tgacattctgagg---
  D    White-throated sparrow  atcttctgccctcctgttaaactctactaaaaacatttgggc---ttgttgag-tgacatcctgagg---
B D       Medium ground finch  atcttctgccctcatgttaaactcttctaaaaacgttttggc---ttgttgtg-ttacatcctgagg---
B D               Zebra finch  attttctgccctcctgttaaactcttctaaaaatatttgggc---ttgttgtg-tgacatcctgagg---
           Tibetan ground jay  attttctgctctcctgttaaactcttctaaaaactcttgggc---ttcttgtg-tgacattctgagg---
B D                Budgerigar  gtcttctgccttcctgttaaactcttctagaaacatttgggc---ttgtggtg-tgacatcctgggg---
  D                    Parrot  gttttctgcctgaatgttaaactcttctagaaacatttgggc---ttgtggtg-tgacatcctgagg---
  D             Scarlet macaw  gttttctgccttcctgttaaactcttctagaaacatttgggc---ttgtggtg-tgacatcctgagg---
  D              Mallard duck  gtcttctgccctcacattgaactctgccagaaacattttggc---ttgatttg-tgacatcctgtgg---
B D                   Chicken  gtcttctgctctcacattgaactctgccagaaatgtttgggc---ttcctgtg-tgacgtcctgagg---
B D                    Turkey  gtcttctgctctcacattgaactctgccagaaatgtttgggc---ttcctgtg-tgacatcctgagg---
B D        American alligator  gccttctgcattctgattgaattgattcaaaaaggtt---------------g-tcacattctgtgg---
  D           Green seaturtle  atcttctgctcgtacattgaattgagacaaaaagttgctggc---ctcttgtg-ttgtatcctgtga---
  D            Painted turtle  atcttctgctcgtacattgaattgagacaaaaagttgctggc---ctcttgtg-ttgtatcctgtga---
  D  Chinese softshell turtle  atcttctgcttgtacattgaattcagacaaaaagttgatggc---ctcttgtg-ttatatcctgtga---
  D    Spiny softshell turtle  atcttctgcttgtacattgaattcagacaaaaagttgctggc---ctcttgtg-ttatatcctgtga---
B D                    Lizard  gttttctgcattgatattaaattgcaacaaaaattcagctgc---ttgttggg-tcacatcctgtgc---
B D             X. tropicalis  gacttctgcttcctgttcaaaccgttttaggaaatccctggc---ttggtctg-taacactttggct---
B D                Coelacanth  ttcttgtacattctgattaaaatccttcaggaa---ctcagctgcctgcttag-ttgttagctgggc---
B D                 Tetraodon  gccagtggcttcttcatcgaacctcttcaggaagtctgcggcctgggtctcca-catctgactgggc---
B D              Nile tilapia  gtcactcgcctccttgtcaaacctgtccaggaactccctcgcctggttctcca-cgtctgactgagc---
        Burton's mouthbreeder  gtcactcgcctccttgtcaaacctgtccaggaattccctcgcctggctctcca-cgtctgactgagc---
B D                    Medaka  cacagttgcctgatcatcgtagcttttaaggaagtctttcgcttgagtttcca-catccagctcagctgc
           Southern platyfish  ctcactggcattctggtcaaacctctccaggaacgccctggcctcagactcca-cgtcgg---cagtcgc
     Mexican tetra (cavefish)  gcgagacgcgtcctcatcaaatttcagcaggaagtccttggctctgtcctcaagcgtctg----agc---
                  Spotted gar  atgggtagcgttcttgtcaaattcgtccaaaaacactgcagc---atcccctt-cagttaactgggc---
B D                       Rat  ======================================================================
         Pundamilia nyererei  ----------------------------------------------------------------------
                 Zebra mbuna  ----------------------------------------------------------------------
         Princess of Burundi  ----------------------------------------------------------------------

                        Human  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
                        Chimp  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
                      Gorilla  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
                    Orangutan  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
                       Gibbon  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
                       Rhesus  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
          Crab-eating macaque  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
                       Baboon  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
                 Green monkey  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
                     Marmoset  ---agcagtcacagcaacaag------gctgagaaggagccagaaa-
              Squirrel monkey  ---agcaattacagcaacaag------gctgagaaggagccagaaa-
                     Bushbaby  ---agcagttacagcaacaag------gctgagcaggagccagaaa-
           Chinese tree shrew  ---agcagttacagcaacgag------gctgagaaggagccaggga-
                     Squirrel  ---agcagtcacagcaacaaa------gctgagaaggagccaggaa-
       Lesser Egyptian jerboa  ---agcagttacagcaacaag------gctgagaaggagccaggaa-
                 Prairie vole  ---ggtagttacagcaacaag------gctgagaaggagccaggag-
              Chinese hamster  ---agtagttacagcaacaag------gctgagaaggagccaggag-
               Golden hamster  ---agtagttacagcaacaag------gctgagaaggagccaggag-
                        Mouse  ---agtagtaacagcaacaag------gctgagaaggagccaggag-
               Naked mole-rat  ---cgcagttacaggaacgag------ggtgagaaagagccaaaga-
                   Guinea pig  ---agtagttacagcaacaag------attgagcaggaaccagaaa-
                   Chinchilla  ---agcagttacagcaacaag------gctgagaaggaaccaggag-
             Brush-tailed rat  ---agcagttacagcaacaag------gctgagaaggaaccaggag-
                       Rabbit  ---agcagtgacagccacaag------gctgagaaggagccaggaa-
                         Pika  ---agcagtgacagccacaag------gctgagaaggagccaacaa-
                       Alpaca  ---agccgttacagcaacgag------gctgagaaggagccagaaa-
               Bactrian camel  ---agccgttacagcaacgag------gctgagaaggagccagaaa-
                      Dolphin  ---agccgttacagcaacaag------gctgagaaggagccagaaa-
                 Killer whale  ---agccgttacagcaacaag------gctgagaaggagccagaaa-
             Tibetan antelope  ---agcagttacagcaacaag------gctgagaaggagccagaaa-
                          Cow  ---agcagttacagcaacaag------gctgagaaggagccagaaa-
                        Sheep  ---agcagttacagcaacaag------gctgagaaggagccagaaa-
                Domestic goat  ---agcagttacagcaacaag------gctgagaaggagccagaaa-
                        Horse  ---agcagttacagcaacgag------gctgagaaggagccaggaa-
             White rhinoceros  ---agcagtcacagctacaag------gctgagaaggagccaggag-
                          Cat  ---agcagttaaagcagcaaa------gctgagaaggagccagaaa-
                          Dog  ---agcagttagagcagcaag------gctgagaaggagccaggaa-
                      Ferret   ---agcagttagagcagcgag------gctgagaaggagccaggaa-
                        Panda  ---agcggttagagcagcaag------gctgagaaggagccaggaa-
               Pacific walrus  ---agcagttagagcagcaag------gctgagaaggagccaggaa-
                 Weddell seal  ---agcagttagagcagcaag------gctgagaaggagccaggaa-
             Black flying-fox  ---agcagttacagcaacgag------gctgagaaggagccagaaa-
                      Megabat  ---agcagttacagcaacgag------gctgagaaggagccagaaa-
                Big brown bat  ---agcagttacagcaacaag------gctgagaaagagccaggaa-
         David's myotis (bat)  ---agcagctacagcaacaag------gctgagaaagagccaggaa-
                     Microbat  ---agcagctacagcaacaag------gctgagaaagagccaggaa-
                     Hedgehog  ---agcagtcacagcaacaag------gctgagaaagagccagaaa-
                        Shrew  ---agcagtcacagcagcaag------gctgaggagcagccaggaa-
              Star-nosed mole  ---agcggctacagcaacaag------gctgagaaggagccaggaa-
                     Elephant  ---agcagttacagccataag------gctgagaaagagccagaaa-
          Cape elephant shrew  ---ggcagctacggccacaag------gctgagaaggagccagcca-
                      Manatee  ---agcagttacagcaataag------gctcagaaagagccagaaa-
             Cape golden mole  ---agtagtaacagcaacaaa------gctgagaaggagccagaaa-
                       Tenrec  ---aagagatacagcagcgag------gctgagaaggagccagata-
                     Aardvark  ---agcagctgctgcaacaag------gctgagaaggtgccagaaa-
                    Armadillo  ---agcagttaccgcaaggag------gctgagaaagagccaggaa-
                      Opossum  ---tgcagtcacagccagaag------gctgaaaaaaagccagaga-
              Tasmanian devil  ---agcagtcacagccagaag------gctgaaaaagagccagaga-
                      Wallaby  ---ggcagttacagtcacaag------gctgaaaaagagccagaga-
                     Platypus  ---agccgccacagcaacgaa------gctgaaaacgagccacaga-
                  Rock pigeon  ---gctcacaacagcaatcag------accacagagaagccagatg-
                 Saker falcon  ---ggtcacaacagtgctcag------accacagagaagccagagg-
             Peregrine falcon  ---ggtcacaacagtgctcag------accacagagaagccagagg-
          Collared flycatcher  ---ggtcacaacagtgctcag------gtggcagagaagccagaag-
       White-throated sparrow  ---ggtcacaacagcgctcag------gctgcaaagaagacagaag-
          Medium ground finch  ---ggtcacaacagcgctcag------gctgcagagaagccagaag-
                  Zebra finch  ---ggtcacaacagcactcag------gccgcagagaagccagaag-
           Tibetan ground jay  ---ggccacaacagcactcag------gccacagagaagccagaag-
                   Budgerigar  ---ggtcacgacagcactcag------aacacagacaagccaaagg-
                       Parrot  ---ggtcacgacagcactcag------actgcagacaagccaaagg-
                Scarlet macaw  ---ggtcacaacagcgctcag------accacagacaagccaaagg-
                 Mallard duck  ---gatcacaacagcgctcag------accacagagaagcaagacg-
                      Chicken  ---ggtcacaacagcgctcag------accacagagaagccagaag-
                       Turkey  ---agtcacaacagcgctcag------accacagagaagccagaag-
           American alligator  ---cacagcaactgcaaacag------accacaaaaaacccaaatg-
              Green seaturtle  ---tgtagcaacagcagtgag------actgcaaagaagccaaaga-
               Painted turtle  ---tgtagcaacagcagtgag------actgcaaagaagccaaaga-
     Chinese softshell turtle  ---tttaacaacaacagtgag------actgcaaagaatccaaaga-
       Spiny softshell turtle  ---tttaacaatagcagtgag------actgcaaagaatccaaaga-
                       Lizard  ---tacagccagaagaaccaa------gttccaaataagatagagc-
                X. tropicalis  ---cctgccagtggcaaggagtagcccaatacaaaaaagccaaagc-
                   Coelacanth  ---aacaatagttgtagcaaa------acccaacacgacccacagc-
                    Tetraodon  ---ggaagcggcagaggacgc------gaccagcagtgctacaagta
                 Nile tilapia  ---agaaacagcacaggacac------agccagaagcgttacaagaa
        Burton's mouthbreeder  ---agaaacagcacaggacac------ggccaggagcgttacaagaa
                       Medaka  tgaagagaacgccggcgacaa------ggccagcag-----------
           Southern platyfish  cagagaaacagccgaagacac------ggccagaaa-----------
     Mexican tetra (cavefish)  ---ccaggccccggaggccaa------ggccaaaaccaggagaaag-
                  Spotted gar  ---agcagcagcaactgccac------aatcaacactaacagaaga-
                          Rat  ===============================================
          Pundamilia nyererei  -----------------------------------------------
                  Zebra mbuna  -----------------------------------------------
          Princess of Burundi  -----------------------------------------------

Inserts between block 7 and 8 in window
B D                Tetraodon 8bp
B D             Nile tilapia 10bp
B D                   Medaka 13bp
          Southern platyfish 13bp

Alignment block 8 of 126 in window, 15600901 - 15600945, 45 bps 
B D                     Human  gagcttgacatcgtcccctgtgagc-----c---aagatcaca--------tcca--ctg-----aat
B D                     Chimp  gagcctgacatcgtcccctgtgagc-----c---aagatcaca--------tcca--ctg-----aat
B D                   Gorilla  gagcctgacatcgtcccctgtgagc-----c---aagatcaca--------tcca--cgg-----aat
B D                 Orangutan  gagcctgacatcgtcccctgtgagc-----c---aagatcaca--------tcca--ctg-----aat
B D                    Gibbon  gagcctgacatcgtcccctgtgagc-----c---aagatcaca--------tcca--ctg-----aat
B D                    Rhesus  gagcctgacatcgtcccctgtgagc-----c---aagatcaca--------tcca--ctg-----aat
B D       Crab-eating macaque  gagcctgacatcgtcccctgtgagc-----c---aagatcaca--------tcca--ctg-----aat
B D                    Baboon  gagcctgacatcgtcccctgtgagc-----c---aagatcaca--------tcca--ctg-----aat
B D              Green monkey  gagcctgacatcgtcccctgtgagc-----c---aagatcaca--------tcca--ctg-----aat
B D                  Marmoset  gagcctgacattgtcccctctgagc-----c---aagatccca--------ttca--ctg-----aat
B D           Squirrel monkey  gagcctgacatcgtcccctgtaagc-----c---aagatcaca--------tcca--ctg-----aat
B D                  Bushbaby  gagcttgacatcttccctggtgagc-----c---acgatcaca--------ttca--ctg-----aat
           Chinese tree shrew  gaggctgccatctttccctctatgc-----c---aagatccca--------tcca--ctg-----gat
B D                  Squirrel  gagcctaacatctttccccgtgcgccaggac---aggatccca--------tcca--ctg-----aac
       Lesser Egyptian jerboa  gagcttgacatctttccccgtgcgc-----c---aagatcc-----------cca--ctg-----aac
                 Prairie vole  gagcgtgacatctttccctgtgcac-----c---aagctccca--------tcca--ctg-----agc
B D           Chinese hamster  gagcttgacatctttccccgtgagc-----c---aagatccca--------tcca--ctg-----agc
               Golden hamster  gagcttgacatctttccccgtgcac-----c---aagatccca--------tcca--ctg-----agc
B D                     Mouse  gagctggacatctttccccgtgcgc-----c---aagatccca--------tcca--ctg-----agc
B D            Naked mole-rat  gagcctgacatctttccctgtgagc-----c---aggatccca--------tcca--ctg-----aac
B D                Guinea pig  gagccggacatctttccccgtccac-----c----agatctca--------tcca--ctg-----aac
                   Chinchilla  gagcctgacatctttccccgtgcac-----c---aagacctca--------tcca--ctg-----aac
             Brush-tailed rat  gagcctgacatc-ttccccgtgcac-----a---aagatctca--------tcca--ctg-----aac
B D                    Rabbit  gaacctgacatctttcccggtgcac-----c---aagatccca--------tcca--ctg-----agt
B D                      Pika  gagcctgacatgtttcccattgcgc-----t---gagatccca--------tcta--ctgagccaagt
B D                    Alpaca  gagcctgacatctttctctgtgcac-----c---aagatccca--------tcca--ctg-----aac
               Bactrian camel  gagcctgacatctttctctgtgcac-----c---aagatccca--------tcca--ctg-----aac
B D                   Dolphin  gagcctgacatcttgctctgtgcgc-----c---aagatccca--------tcca--ctg-----aac
                 Killer whale  gagcctgacatcttgctctgtgcgc-----c---aagatccca--------tcca--ctg-----aac
             Tibetan antelope  gagcctgtcatctttctctgtacgc-----c---aagatccca--------tcca--ctg-----aac
B D                       Cow  gagcctgtcatctttctctgtacgc-----c---aagatccca--------tcca--ctg-----aac
B D                     Sheep  gagcctgtcatctttctctgtacac-----c---aagatccca--------tcca--ctg-----aac
                Domestic goat  gagcctgtcatctttctctgtacgc-----c---aagatccca--------tcca--ctg-----aac
B D                     Horse  gagcctgacatctttccctctgcgc-----c---aagatcaca--------tcca--ctg-----aac
B D          White rhinoceros  gagcctgacatctttccctgtgcac-----c---aagatccca--------tcca--ctg-----aac
B D                       Cat  gagcctgacatctttccctatgcac-----c---aagattcca--------tcta--ctg-----aac
B D                       Dog  gagcctgacatctttccctatgcac-----c---aagatccca--------tcca--ctg-----aac
B D                   Ferret   gagcctaacatccttccctatgcac-----c---aagatccca--------tcca--ctg-----aac
B D                     Panda  gagcctaacatctttccctatgcac-----c---aagatccca--------ttca--ctg-----aac
               Pacific walrus  gagcctaacatctttccctatgcac-----c---aagatccca--------tcca--ctg-----aac
                 Weddell seal  gagcctaacatctttccctatgcac-----c---aagatccca--------tcca--ctg-----aac
             Black flying-fox  gagcctgacatctttctctgtgcgc-----c---aagacccca--------ttca--ctg-----aac
B D                   Megabat  gagcctgacatctttctctgtgcgc-----c---aagacccca--------ttca--ctg-----aac
                Big brown bat  gagcctgacatctttccctgtgcgc-----c---aagatccca--------tcca--ctg-----aac
         David's myotis (bat)  gagcctgacatctttccctgtgcgc-----c---aagatccca--------ttca--ctg-----aag
B D                  Microbat  gagcctgacatctttccctgtgcgc-----c---aagatccca--------ttca--ctg-----aag
B D                  Hedgehog  gagcccaacatctttctctgtgcgc-----c---aagctccca--------tcca--ctg-----aac
B D                     Shrew  gagagtaacatctttccctgtgctc-----c---aagctccca--------tcca--ctg-----aac
              Star-nosed mole  aagcctgacatctttccctgtgcgc-----c---aagctccca--------tcca--ctg-----aag
B D                  Elephant  gagcctgacatctttccccaagcac-----c---aagatccca--------tcca--ctg-----aac
          Cape elephant shrew  gagcctgacatcttccccc-ggcgc-----c---cagagccca--------gcca--ctg-----agc
B D                   Manatee  gagcctgacatctttccccgagcgc-----c---aagatccca--------taca--ctg-----aac
             Cape golden mole  gagcctgacatctttcctcaagctc-----c---acgctccca--------taca--ctg-----acc
B D                    Tenrec  gagcctgacatc-ttccccgagcac-----c---aagatccca--------tcca--ctg-----aag
                     Aardvark  gaggctgacatctttccctgagcgc-----c---cagat-ccg--------tcca--ctg-----aac
B D                 Armadillo  gagcctgacatctttccctgtgtgc-----c---aagatctca--------tcca--ctg-----aac
B D                   Opossum  gggtctaacatcttttcctgtgagc-----c---aagatccca--------tcca--ctg-----agc
B D           Tasmanian devil  gggtctaacatctttccctgtgagc-----c---aagatccca--------tcca--ctg-----agc
B D                   Wallaby  gggtctaacatcttttctggtgagc-----c---aaaatccca--------tcca--ctg-----agc
B D                  Platypus  gaacctcccatcctttctcccgctc-----c---aagatccca--------tcaa--ctg-----aat
  D               Rock pigeon  cagaccaacatatccatgtctaggc-----t---gagaat-ct--------ccca--aca-----aag
  D              Saker falcon  tggacaaacatcttcatgtccatgc-----t---gagaac-ct--------ccca--acg-----aag
  D          Peregrine falcon  tggacaaacatcttcatgtccatgc-----t---gagaac-ct--------ccca--acg-----aag
  D       Collared flycatcher  tggaccaacttactcatgttcagga-----t---gagaac-ct--------ctca--act-----aag
  D    White-throated sparrow  tgaaccaacatattcatgttcagga-----t---gagaac-ct--------ctca--gtg-----aag
B D       Medium ground finch  tggaccaacatattcacgttcaggg-----t---gagaac-cc--------ctca--gtg-----aag
B D               Zebra finch  cggaccaacatattcatgttcagga-----t---gagaac-ct--------cttc--act-----aag
           Tibetan ground jay  tggaccaacatattcatgttcagca-----t---gagaac-ct--------ctca--ac------aag
B D                Budgerigar  tgtaccaacatattcttgtctgggc-----t---gagaac-ca--------ctca--atg-----aag
  D                    Parrot  tggaccaacatactcatgtgtggtc-----t---gagaat-ga--------ccca--gcg-----aag
  D             Scarlet macaw  tggaccaacatattcatgtgtgggc-----t---gagaac-ta--------ccca--aca-----aag
  D              Mallard duck  tgagccaacatgttcgtgtccaggc-----t---gagaac-ct--------ccca--atg-----aag
B D                   Chicken  tgaagcaacatattcacaagtggac-----t---gagaac-ct--------ctgg--atg-----aag
B D                    Turkey  tgaaccaacatattcacgagcagac-----t---gagaac-ct--------ctgg--atg-----aag
B D        American alligator  tagcccaacatagttcctcccgagc-----c---aagagt-ct--------ccca--at---------
  D           Green seaturtle  tggaccaacatacttcctt-tgagc-----c---aagatc-ca--------ctga--ttg-----agt
  D            Painted turtle  tggaccaacatagttccttctgagc-----c---aagagc-ca--------cgaa--ttg-----agg
  D  Chinese softshell turtle  tgggacaacatgcttccttctgagt-----c---aagatg-ca--------ctaa--cta-----aat
  D    Spiny softshell turtle  tgggaaaacatacttctttctgagc-----c---aagatg-ca--------ctaa--ccg-----agt
B D                    Lizard  tggaacagcaaacttccacttgagc-----t---aagaga-tg--------ccat--ggg-----aat
B D             X. tropicalis  agacccggcatcttacttcctgagc-----c---gaggtgttc--------tcaa--ctg-----caa
B D                Coelacanth  tggaaaggcatccttccttccgagt-----t---gagagcaac--------ccaa--ctg-----aat
B D                 Tetraodon  gttgcagacatc-----ttcagctc-----c-------gtctg--------aaca--cgc-----aca
B D              Nile tilapia  catgctggctgc-----ttcagctc-----c-------acaca--------gacaagctc-----tca
B D                    Medaka  ctcacagacatc-----gtcagctc-----c-------atcca--------caca--cac-----ggc
           Southern platyfish  ccggtggacatc------ttggctt-----ct----tgatcca--------cgca--cac-----aat
     Mexican tetra (cavefish)  cgaactgacatc------tctccac-----c-------gtccgagtccagcagca--ctg-----aca
                  Spotted gar  tggacagacattctgcagtcaaaac-----ccaaagaagcact--------acca--cag-----aaa
B D                       Rat  ====================================================================
       Burton's mouthbreeder  --------------------------------------------------------------------
         Pundamilia nyererei  --------------------------------------------------------------------
                 Zebra mbuna  --------------------------------------------------------------------
         Princess of Burundi  --------------------------------------------------------------------

Inserts between block 8 and 9 in window
B D             Nile tilapia 5bp
B D                   Medaka 2bp
          Southern platyfish 2bp
    Mexican tetra (cavefish) 12bp

Alignment block 9 of 126 in window, 15600946 - 15601002, 57 bps 
B D                     Human  gactttccctagac------t-aaaacctcc-tcatgag--atttt------ctct--------------
B D                     Chimp  gactttccctagac------t-aaaacctcc-tcatgag--atttt------ctct--------------
B D                   Gorilla  gactttccctagac------t-aaaacctcc-tcatgag--atttt------ctct--------------
B D                 Orangutan  gactttccctagac------t-aaaacctcc-tcatgag--atttt------ctct--------------
B D                    Gibbon  gactttccctagac------t-aaaacctcc-tcatgag--atttt------ctct--------------
B D                    Rhesus  gactttccctagac------t-aaaacctcc-tcatgag--atttt------ctct--------------
B D       Crab-eating macaque  gactttccctagac------t-aaaacctcc-tcatgag--atttt------ctct--------------
B D                    Baboon  gactttccctagac------t-aaaacctcc-tcatgag--atttt------ctct--------------
B D              Green monkey  gactttccctagac------t-aaaacctcc-tcatgag--atttt------ctct--------------
B D                  Marmoset  gactttccctagac------t-aaaacctcc-ttatgag--atttt------ctct--------------
B D           Squirrel monkey  gactttccctagac------t-aaaacctcc-ttatgag--atttt------ctct--------------
B D                  Bushbaby  aactgtccctagag------t-taaacctcc-tcctgag--atttg-------tct--------------
           Chinese tree shrew  aactttccctagag------t-gaaacctcc-tcatgag--ttttg------ctct--------------
B D                  Squirrel  aactttccctagag------t-aaaatttcc-tcatgag--ttttt-------tct--------------
       Lesser Egyptian jerboa  aactttccctagag------t-aaaatttcc-tcatgag--tttttc-----ctct--------------
                 Prairie vole  aactttccctagag------t-aaaatctct-tcatgag--ttttt------ctct--------------
B D           Chinese hamster  aactttccctagag------t-aaaatctct-tcatgag--atttt------ctct--------------
               Golden hamster  aactttccctagag------t-aaaatctct-tcatgag--atttt------ctct--------------
B D                     Mouse  aactttccctagag------t-aaaatctct-tcatgag--ttttt------ctct--------------
B D            Naked mole-rat  aactttccctagag------t-aaaatctcc-tcgtgag--ttttt------ctct--------------
B D                Guinea pig  aactttccctagtg------t-aaaatcgcc-tcctgag--tttt--------tct--------------
                   Chinchilla  aactttccctagag------t-aaaatctcc-tcctgag--ttttt------ctct--------------
             Brush-tailed rat  aactttccccagag------t-aaaatctcc-tcctgag--ttttt------ctct--------------
B D                    Rabbit  gactttccctggag------t---------------------tttg------ctct--------------
B D                      Pika  gcctttgcctggag----------------------------taaa------atct--------------
B D                    Alpaca  aactt-ccctagag------ggaaaacctcc-tcatgag--ttttt------ctct--------------
               Bactrian camel  aactt-ccctagag------gaaaaacctcc-tcatgag--ttttt------ctct--------------
B D                   Dolphin  aactt-ccctagag------t-aaaacctcc-tcatgag--atttt------ctct--------------
                 Killer whale  aactt-ccctagag------t-aaaacctcc-tcatgag--atttt------ctct--------------
             Tibetan antelope  aactt-ccctagag------t-aaaacctcc-tcatgag--attta------ctct--------------
B D                       Cow  aactt-ccctagag------t-aaaacctcc-tcatgag--attta------ctct--------------
B D                     Sheep  aactt-ccctagag------t-aaaacctcc-tcatgag--attta------ctct--------------
                Domestic goat  aactt-ccctagag------t-aaaacctcc-tcatgag--attta------ctct--------------
B D                     Horse  aactttcccgagag------t-aaaacctcc-tcatgag--ttttt------ttct--------------
B D          White rhinoceros  aactttcccgagag------t-aaaacctcc-tcatgag--ttttt------ttct--------------
B D                       Cat  aactttccctagag------t-aaaacctct-tcatgag--ttttt------cttg--------------
B D                       Dog  aactttccctagag------t-aaaacctct-tcatgag--ttttt------ctgt--------------
B D                   Ferret   aactttccctagag------t-aaaacctct-tcatgag--ttttt------ctct--------------
B D                     Panda  aactttccctagag------t-aaaacctct-tcatgag--ttttt------ctct--------------
               Pacific walrus  aactttccctagag------t-aaaacctct-tcatgac--tttttc-----ctct--------------
                 Weddell seal  aactttccctagag------t-aaaacctct-tcatgag--tttttc-----ctct--------------
             Black flying-fox  aactttccctagag------t-aaaacctcc-tcatgag--atcct------ctct--------------
B D                   Megabat  aactttccctagag------t-aaaacctcc-tcatgag--atcct------ctct--------------
                Big brown bat  aactttccctagag------t-aaaacctcc-tcatgag--ttttt------ctct--------------
         David's myotis (bat)  aacttcccctagag------t-aaaacctct-tcatgag--ttttt------ctct--------------
B D                  Microbat  aactttccctagag------t-aaaacctct-tcatgag--ttttt------ctct--------------
B D                  Hedgehog  aactctccctcgag------t-caaacctct-tcaagag--ttgta------ctct--------------
B D                     Shrew  aactttccctagag------t-caaacctct-tcatgag--ttg-t------ctct--------------
              Star-nosed mole  aactttccctagag------t-caaacctct-tcatgac--tcgtt------ctct--------------
B D                  Elephant  aagtttccctagag------g-aaaaaatcc-tcataagttttttt------ttct--------------
          Cape elephant shrew  cactctccctgcag------t-cagaggtcc-tcacgag----ttg------ttct--------------
B D                   Manatee  aagtctccctagag------t-aaaaactcc-tcataag--ttgtt------ctct--------------
             Cape golden mole  aagtctccctggagtcttgtt-caaaactcc-tcatgag--ttttt------ctct--------------
B D                    Tenrec  aagtcttcctgtag------t-caaagctcc-tcgtgag--cgttc------ctct--------------
                     Aardvark  aa-tatccctggag------t-aaaaacgcc-tcatgag--ttttt------ctct--------------
B D                 Armadillo  aagtttccctagag------t-aaaatctcc-tcatgag--ttttt------ctct--------------
B D                   Opossum  aaatttccctcaag------c--aaaccaat-tcatggg--ttttt------ctct--------------
B D           Tasmanian devil  aaatttccttcaag------c--aaacctct-tcatggg--ttttt------ctct--------------
B D                   Wallaby  aaatttctctcaag------c--aaacctgt-tcatgga--cttct------ctct--------------
B D                  Platypus  gagtgtctcttaag------c--aaagcttc-tcatgga--tttgt------ctct--------------
  D               Rock pigeon  taggtttcctcacg------t--aagcttct-ctgtcag--gct--------ctgt--------------
  D              Saker falcon  taggtttcctcagg------t--aagcttcc-ctgtcag--gct--------ctgt--------------
  D          Peregrine falcon  taggtttcctcagg------t--aggcttcc-ctgtcag--gct--------ctgt--------------
  D       Collared flycatcher  taggtttcctcagg------t--aagcttct-ctgttgg--cct--------ctgc--------------
  D    White-throated sparrow  taggtttcctcagg------c--aagcttct-ctgttgg--cct--------ctgc--------------
B D       Medium ground finch  taggtttcctcagg------c--aagcctct-ctgttgg--cct--------ctgc--------------
B D               Zebra finch  taagtttcctcaag------t--aaaattct-ctgttgg--cct--------ctgc--------------
           Tibetan ground jay  taggtttcctcagg------t--aagcttct-ctgttgg--cct--------ctgc--------------
B D                Budgerigar  taggtttcctcaga------t--aagcttct-gtgtcgg--gct--------atgt--------------
  D                    Parrot  taggtttcctcagg------t--aagcttct-ctgtcag--gct--------atgt--------------
  D             Scarlet macaw  taggtttcctcagg------t--aagcttct-ctgtcgg--gct--------atgt--------------
  D              Mallard duck  tagttttcctcaga------t--gagcttct-ct----a--cct--------cctt--------------
B D                   Chicken  taggtttcctcagg------t--gagcttct-ct----g--cct--------tctt--------------
B D                    Turkey  taggtttcctcagg------t--gagcttct-ct----g--cct--------tctt--------------
B D        American alligator  --ggtttcctgaag------c--aactgttt-taattaa--cta--------ctat--------------
  D           Green seaturtle  taggttccctcaaa------t--aagcttcc-taatcag--ctt--------ctgt--------------
  D            Painted turtle  aaggttccctcaaa------t--aagcttcc-taatcag--ctg--------ctgt--------------
  D  Chinese softshell turtle  taggttccctcaaa------t--acgtttct-taatcag--ctt--------gtgt--------------
  D    Spiny softshell turtle  taggttccctcaaa------t--acgtttct-taatcag--ctt--------gtgt--------------
B D                    Lizard  acactttcttcaag------a--aggtttctgcagttgg--ca---------------------------
B D             X. tropicalis  catgtccctcctgg------c-aatggtaaa-aaactag--cgt--------ctct--------------
B D                Coelacanth  gtgatctcttgatg------c--aggcttac-ttatctg--ttc--------aggt--------------
B D              Nile tilapia  ------------------------------a-gggaagg--actcttttatacaac--------------
B D                    Medaka  -------------------------gactct-gagaagg--aagct------gaat---ccac------c
           Southern platyfish  -------------------------gactct-gagaagg--gagct------cact--------------
     Mexican tetra (cavefish)  ------------------------------------------------------------tgctt----c
                  Spotted gar  -----------------------------------------------------aatgtcttgtttgacgt
B D                       Rat  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
                 Zebra mbuna  ----------------------------------------------------------------------
         Princess of Burundi  ----------------------------------------------------------------------

                        Human  ---------cttatcag---cctttgaac
                        Chimp  ---------cttatcag---cctttgaac
                      Gorilla  ---------cttatcag---cctttgaac
                    Orangutan  ---------cttatcag---cctttgaac
                       Gibbon  ---------cttatcag---cctttgaac
                       Rhesus  ---------cttatcag---cctttgaac
          Crab-eating macaque  ---------cttatcag---cctttgaac
                       Baboon  ---------cttatcag---cctttgaac
                 Green monkey  ---------cttatcag---cctttgaac
                     Marmoset  ---------cttatcag---cctttgaac
              Squirrel monkey  ---------cttatcag---cctttgaac
                     Bushbaby  ---------cgcatcag---cctttgaac
           Chinese tree shrew  ---------ctcatcag---cctttgaac
                     Squirrel  ---------ctcttcag---cctttgaac
       Lesser Egyptian jerboa  ---------ctcatcag---cctttgaac
                 Prairie vole  ---------ctcatcag---cctttgaac
              Chinese hamster  ---------ctcatcag---cctttgaac
               Golden hamster  ---------ctcatcag---cctttgaac
                        Mouse  ---------ctcatcag---cctttgaac
               Naked mole-rat  ---------ctcctcag---cctttgaac
                   Guinea pig  ---------ctcaacag---cctttgaac
                   Chinchilla  ---------ctcatcag---cctttgaac
             Brush-tailed rat  ---------ctcatcag---cctttgaac
                       Rabbit  ---------ctcatcag---cctttgaac
                         Pika  ---------ctcagcag---cctttgaac
                       Alpaca  ---------ctcatcag---cctttgaac
               Bactrian camel  ---------ctcatcag---cctttgaac
                      Dolphin  ---------ctcatcag---cctttgaac
                 Killer whale  ---------ctcatcag---cctttgaac
             Tibetan antelope  ---------ct-atcag---cctttgacc
                          Cow  ---------ct-atcag---cctttgacc
                        Sheep  ---------ct-atcag---cctttgacc
                Domestic goat  ---------ct-atcag---cctttgacc
                        Horse  ---------ctcatcag---cctttgaac
             White rhinoceros  ---------ctcatcag---cctttgaac
                          Cat  ---------ctcatcag---cctttgaac
                          Dog  ---------ctcatcag---cctttgaac
                      Ferret   ---------ctcatcag---cctttgaac
                        Panda  ---------ctcatcag---cctttgaac
               Pacific walrus  ---------ctcatcag---cctttgaac
                 Weddell seal  ---------ctcatcag---cctttgaac
             Black flying-fox  ---------ctcatcag---cctttgaac
                      Megabat  ---------ctcatcag---cctttgaac
                Big brown bat  ---------ctcatcag---cctttgaac
         David's myotis (bat)  ---------ctcatcag---cctttgaac
                     Microbat  ---------ctcatcag---cctttgaac
                     Hedgehog  ---------ctcatcag---cctttgaac
                        Shrew  ---------atcattag---cctttgaac
              Star-nosed mole  ---------ctcatcag---cctttgaac
                     Elephant  ---------ctcatcag---cctttgaac
          Cape elephant shrew  ---------ctcgtcag---cctttgaac
                      Manatee  ---------ctcatcag---cctttgaac
             Cape golden mole  ---------ctcatcag---cctttgaac
                       Tenrec  ---------ctcatcag---cctttgaac
                     Aardvark  ---------ctcatcag---cctttgaac
                    Armadillo  ---------ctcatcag---cctttgaac
                      Opossum  ---------cccatcag---cctttgaac
              Tasmanian devil  ---------cccatcag---cctttgaac
                      Wallaby  ---------ctcatcag---cctttgaac
                     Platypus  ---------tcctgcag---cctttgaac
                  Rock pigeon  ---------ctcatcag---ccttcaagc
                 Saker falcon  ---------ctcatcag---ccttcaagc
             Peregrine falcon  ---------ctcatcag---ccttcaagc
          Collared flycatcher  ---------ctcatcgg---ccttcaagc
       White-throated sparrow  ---------ctcatcag---ccttcaagc
          Medium ground finch  ---------ctcatcag---ccttcaagc
                  Zebra finch  ---------ctcatcag---ccttcaagc
           Tibetan ground jay  ---------ctcatcag---ccttcaagc
                   Budgerigar  ---------ctcattgg---ccttcaagc
                       Parrot  ---------ctcatcag---ccttcaagg
                Scarlet macaw  ---------ctcatcag---ccttcaagc
                 Mallard duck  ---------ctcatcag---catttatgc
                      Chicken  ---------ctcatcag---cctttatgc
                       Turkey  ---------ctcatcag---cctttatgc
           American alligator  ---------cccatcca---cctttatgc
              Green seaturtle  ---------ctcaacag---cctttgcac
               Painted turtle  ---------ctcatcag---cctttgcac
     Chinese softshell turtle  ---------ttcatcag---cctttgcac
       Spiny softshell turtle  ---------ctcatcag---cctttgcac
                       Lizard  ---------cttatttg---tatataggc
                X. tropicalis  ---------atcattag---cctttgaac
                   Coelacanth  ---------actactgc---cctttgaac
                 Nile tilapia  ---------ttcattaa---ccttctgtg
                       Medaka  gctgtacagtttattaa---ccttcaggg
           Southern platyfish  ---------tttattaa---cctgctgag
     Mexican tetra (cavefish)  actgt----cttatcaagagctttctgcg
                  Spotted gar  gctatcaaattagttat---cataccgtc
                          Rat  =============================
        Burton's mouthbreeder  -----------------------------
          Pundamilia nyererei  -----------------------------
                  Zebra mbuna  -----------------------------
          Princess of Burundi  -----------------------------

Inserts between block 9 and 10 in window
B D                     Pika 5bp
                 Spotted gar 8bp

Alignment block 10 of 126 in window, 15601003 - 15601003, 1 bps 
B D                     Human  t
B D                     Chimp  t
B D                   Gorilla  t
B D                 Orangutan  t
B D                    Gibbon  t
B D                    Rhesus  t
B D       Crab-eating macaque  t
B D                    Baboon  t
B D              Green monkey  t
B D                  Marmoset  t
B D           Squirrel monkey  t
B D                  Bushbaby  t
           Chinese tree shrew  t
B D                  Squirrel  t
       Lesser Egyptian jerboa  t
                 Prairie vole  t
B D           Chinese hamster  t
               Golden hamster  t
B D                     Mouse  t
B D            Naked mole-rat  t
B D                Guinea pig  t
                   Chinchilla  t
             Brush-tailed rat  t
B D                    Rabbit  t
B D                      Pika  t
B D                    Alpaca  t
               Bactrian camel  t
B D                   Dolphin  t
                 Killer whale  t
             Tibetan antelope  t
B D                       Cow  t
B D                     Sheep  t
                Domestic goat  t
B D                     Horse  t
B D          White rhinoceros  t
B D                       Cat  t
B D                       Dog  t
B D                   Ferret   t
B D                     Panda  t
               Pacific walrus  t
                 Weddell seal  t
             Black flying-fox  t
B D                   Megabat  t
                Big brown bat  t
         David's myotis (bat)  t
B D                  Microbat  t
B D                  Hedgehog  t
B D                     Shrew  t
              Star-nosed mole  t
B D                  Elephant  t
          Cape elephant shrew  t
B D                   Manatee  t
             Cape golden mole  t
B D                    Tenrec  t
                     Aardvark  t
B D                 Armadillo  t
B D                   Opossum  t
B D           Tasmanian devil  t
B D                   Wallaby  t
B D                  Platypus  t
  D               Rock pigeon  t
  D              Saker falcon  a
  D          Peregrine falcon  a
  D       Collared flycatcher  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  a
           Tibetan ground jay  a
B D                Budgerigar  a
  D                    Parrot  a
  D             Scarlet macaw  a
  D              Mallard duck  a
B D                   Chicken  a
B D                    Turkey  a
B D        American alligator  g
  D           Green seaturtle  a
  D            Painted turtle  a
  D  Chinese softshell turtle  g
  D    Spiny softshell turtle  a
B D             X. tropicalis  t
B D                Coelacanth  a
B D              Nile tilapia  c
B D                    Medaka  t
           Southern platyfish  c
                  Spotted gar  t
B D                       Rat  =
       Burton's mouthbreeder  -
         Pundamilia nyererei  -
B D                    Lizard  -
                 Zebra mbuna  -
         Princess of Burundi  -

Inserts between block 10 and 11 in window
B D            X. tropicalis 37591bp
B D               Coelacanth 8bp

Alignment block 11 of 126 in window, 15601004 - 15601006, 3 bps 
B D                     Human  tg-g
B D                     Chimp  tg-g
B D                   Gorilla  tg-g
B D                 Orangutan  tg-g
B D                    Gibbon  tg-g
B D                    Rhesus  tg-g
B D       Crab-eating macaque  tg-g
B D                    Baboon  tg-g
B D              Green monkey  tg-g
B D                  Marmoset  tg-g
B D           Squirrel monkey  tg-g
B D                  Bushbaby  tg-g
           Chinese tree shrew  tg-g
B D                  Squirrel  tg-g
       Lesser Egyptian jerboa  tg-g
                 Prairie vole  tg-g
B D           Chinese hamster  tg-g
               Golden hamster  tg-g
B D                     Mouse  tg-g
B D            Naked mole-rat  tg-g
B D                Guinea pig  tg-g
                   Chinchilla  tg-g
             Brush-tailed rat  tg-g
B D                    Rabbit  tg-g
B D                      Pika  tg-g
B D                    Alpaca  tg-g
               Bactrian camel  tg-g
B D                   Dolphin  tg-g
                 Killer whale  tg-g
             Tibetan antelope  tg-g
B D                       Cow  tg-g
B D                     Sheep  tg-g
                Domestic goat  tg-g
B D                     Horse  cg-g
B D          White rhinoceros  cg-g
B D                       Cat  tg-g
B D                       Dog  tg-g
B D                   Ferret   tg-g
B D                     Panda  tg-g
               Pacific walrus  tg-g
                 Weddell seal  tg-g
             Black flying-fox  tg-g
B D                   Megabat  tg-g
                Big brown bat  tg-g
         David's myotis (bat)  tg-g
B D                  Microbat  tg-g
B D                  Hedgehog  tg-g
B D                     Shrew  tg-g
              Star-nosed mole  tg-g
B D                  Elephant  tg-g
          Cape elephant shrew  tg-g
B D                   Manatee  tg-g
             Cape golden mole  tg-g
B D                    Tenrec  tg-g
                     Aardvark  tg-g
B D                 Armadillo  tg-g
B D                   Opossum  tg-g
B D           Tasmanian devil  tg-g
B D                   Wallaby  tg-g
B D                  Platypus  tg-g
  D               Rock pigeon  tt--
  D              Saker falcon  tg-g
  D          Peregrine falcon  tg-g
  D       Collared flycatcher  tg-g
  D    White-throated sparrow  tg-g
B D       Medium ground finch  gg-g
B D               Zebra finch  tg-g
           Tibetan ground jay  tg-g
B D                Budgerigar  tg-a
  D                    Parrot  tg-a
  D             Scarlet macaw  tg-a
  D              Mallard duck  tg-g
B D                   Chicken  ta-g
B D                    Turkey  ta-g
B D        American alligator  taag
  D           Green seaturtle  ta-g
  D            Painted turtle  ta-g
  D  Chinese softshell turtle  ta-g
  D    Spiny softshell turtle  ta-g
B D                    Lizard  tg-g
B D                Coelacanth  ag-g
B D              Nile tilapia  tg-c
B D                    Medaka  tg-c
           Southern platyfish  tg-c
                  Spotted gar  tg-g
B D                       Rat  ====
       Burton's mouthbreeder  ----
         Pundamilia nyererei  ----
                 Zebra mbuna  ----
         Princess of Burundi  ----
B D             X. tropicalis  ====

Alignment block 12 of 126 in window, 15601007 - 15601017, 11 bps 
B D                     Human  gttgggc-g-ctg
B D                     Chimp  gttgggc-g-ctg
B D                   Gorilla  gttgggc-g-ctg
B D                 Orangutan  gttgggc-a-ctg
B D                    Gibbon  gttgggc-a-ctg
B D                    Rhesus  gttgggc-a-ctg
B D       Crab-eating macaque  gttgggc-a-ctg
B D                    Baboon  gttgggc-a-ctg
B D              Green monkey  gttgggc-a-ctg
B D                  Marmoset  gttgggc-a-ctg
B D           Squirrel monkey  gttgggc-a-ctg
B D                  Bushbaby  gttgggc-a-ctg
           Chinese tree shrew  gttgggc-a-ctg
B D                  Squirrel  gttgggc-a-ttg
       Lesser Egyptian jerboa  gttgggc-a-ctg
                 Prairie vole  gttgggc-a-ctg
B D           Chinese hamster  gttgggc-a-cta
               Golden hamster  gttgggc-a-ctg
B D                     Mouse  gttgggc-a-ctg
B D            Naked mole-rat  gttgggc-a-ctg
B D                Guinea pig  gttgggc-a-ctg
                   Chinchilla  gttgggc-a-ctg
             Brush-tailed rat  gttgggc-a-ctg
B D                    Rabbit  gttgggc-a-ctg
B D                      Pika  gttgggc-a-ctg
B D                    Alpaca  gttgggc-a-ctg
               Bactrian camel  gttgggc-a-ctg
B D                   Dolphin  gttgggc-a-ctg
                 Killer whale  gttgggc-a-ctg
             Tibetan antelope  gttgggc-a-ctg
B D                       Cow  gttgggc-a-ctg
B D                     Sheep  gttgggc-a-ctg
                Domestic goat  gttgggc-a-ctg
B D                     Horse  gttgggc-a-ctg
B D          White rhinoceros  gttgggc-a-ctg
B D                       Cat  gttgggc-a-ctg
B D                       Dog  gttgggc-a-ctg
B D                   Ferret   gttgggc-a-ctg
B D                     Panda  gttgggc-a-ctg
               Pacific walrus  gttgggc-a-ctg
                 Weddell seal  gttgggc-a-ctg
             Black flying-fox  gttgggc-a-ctg
B D                   Megabat  gttgggc-a-ctg
                Big brown bat  gttgggc-a-ctg
         David's myotis (bat)  gttgggc-a-ctg
B D                  Microbat  gttgggc-g-ctg
B D                  Hedgehog  gttgggc-a-ctg
B D                     Shrew  gttgggc-a-ctg
              Star-nosed mole  gttgggc-a-ctg
B D                  Elephant  gctgggc-a-ctg
          Cape elephant shrew  gttgggc-a-ctg
B D                   Manatee  gttgggc-a-ctg
             Cape golden mole  gttgggc-a-ctg
B D                    Tenrec  gttgggc-a-ctg
                     Aardvark  gttgggc-a-ctg
B D                 Armadillo  gttgggc-a-ctg
B D                   Opossum  gttgggc-g-ctg
B D           Tasmanian devil  gttgggc-g-ctg
B D                   Wallaby  attgggt-g-ctg
B D                  Platypus  gttgggc-c-ctg
  D               Rock pigeon  ------t-c----
  D              Saker falcon  ctagcatgg----
  D          Peregrine falcon  ctagcatgg----
  D       Collared flycatcher  ccactgt-g----
  D    White-throated sparrow  ccaccgt-g----
B D       Medium ground finch  ccaccgt-g----
B D               Zebra finch  ctgctgt-g----
           Tibetan ground jay  tcacggt-g----
B D                Budgerigar  cttgagt-g----
  D                    Parrot  ccagagt-g----
  D             Scarlet macaw  ctagagt-g----
  D              Mallard duck  ctaatgt-g----
B D                   Chicken  caagtgt-g----
B D                    Turkey  caagtgt-g----
B D        American alligator  tttgcac-c----
  D           Green seaturtle  ---gtgt-gt---
  D            Painted turtle  ---gtgt-gt---
  D  Chinese softshell turtle  gt-gtgt-gt---
  D    Spiny softshell turtle  ---gtgt-gt---
B D                    Lizard  ctaaag--g----
B D                Coelacanth  catg---------
B D              Nile tilapia  cttggcc-t-ttg
B D                    Medaka  cttggcc-t-ttg
           Southern platyfish  cttggcc-t-ttg
B D                       Rat  =============
       Burton's mouthbreeder  -------------
         Pundamilia nyererei  -------------
                 Zebra mbuna  -------------
         Princess of Burundi  -------------
                 Spotted gar  -------------
B D             X. tropicalis  =============

Inserts between block 12 and 13 in window
B D                 Squirrel 54bp
      Lesser Egyptian jerboa 8bp
B D          Chinese hamster 85bp

Alignment block 13 of 126 in window, 15601018 - 15601021, 4 bps 
B D                     Human  ag-----ca
B D                     Chimp  ag-----ca
B D                   Gorilla  ag-----ca
B D                 Orangutan  ag-----ca
B D                    Gibbon  ag-----ca
B D                    Rhesus  ag-----ca
B D       Crab-eating macaque  ag-----ca
B D                    Baboon  ag-----ca
B D              Green monkey  ag-----ca
B D                  Marmoset  ag-----ca
B D           Squirrel monkey  ag-----ca
B D                  Bushbaby  ag-----ca
           Chinese tree shrew  ag-----ca
B D                  Squirrel  aa-----aa
       Lesser Egyptian jerboa  aa-----aa
                 Prairie vole  ag-----aa
               Golden hamster  ag-----aa
B D                     Mouse  ag-----aa
B D            Naked mole-rat  ag-----ga
B D                Guinea pig  ag-----ga
                   Chinchilla  ag-----ga
             Brush-tailed rat  ag-----ga
B D                    Rabbit  aa-----aa
B D                      Pika  ag-----ga
B D                    Alpaca  ag-----ca
               Bactrian camel  ag-----ca
B D                   Dolphin  ag-----ca
                 Killer whale  ag-----ca
             Tibetan antelope  ag-----ca
B D                       Cow  ag-----ca
B D                     Sheep  ag-----ca
                Domestic goat  ag-----ca
B D                     Horse  ag-----ca
B D          White rhinoceros  ag-----ca
B D                       Cat  ag-----ca
B D                       Dog  ag-----ca
B D                   Ferret   ag-----ca
B D                     Panda  ag-----ca
               Pacific walrus  ag-----ca
                 Weddell seal  ag-----ca
             Black flying-fox  ag-----ca
B D                   Megabat  ag-----ca
                Big brown bat  ag-----ca
         David's myotis (bat)  ag-----cg
B D                  Microbat  ag-----cg
B D                  Hedgehog  ag-----ca
B D                     Shrew  ag-----ca
              Star-nosed mole  ag-----ca
B D                  Elephant  ag-----ca
          Cape elephant shrew  ag-----ca
B D                   Manatee  ag-----ca
             Cape golden mole  ag-----ca
B D                    Tenrec  ag-----ca
                     Aardvark  ag-----ca
B D                 Armadillo  at-----ta
B D                   Opossum  ag-------
B D           Tasmanian devil  ag-------
B D                   Wallaby  agaaaaa--
B D                  Platypus  ag-----c-
B D                Coelacanth  -----caca
B D              Nile tilapia  ga-----ca
B D                    Medaka  aa-----ca
           Southern platyfish  ga-----ca
B D                       Rat  =========
B D           Chinese hamster  =========
       Burton's mouthbreeder  ---------
         Pundamilia nyererei  ---------
  D             Scarlet macaw  ---------
B D                    Lizard  ---------
                 Zebra mbuna  ---------
  D                    Parrot  ---------
  D           Green seaturtle  ---------
         Princess of Burundi  ---------
  D  Chinese softshell turtle  ---------
B D                Budgerigar  ---------
  D          Peregrine falcon  ---------
  D              Mallard duck  ---------
  D            Painted turtle  ---------
                 Spotted gar  ---------
  D    Spiny softshell turtle  ---------
  D              Saker falcon  ---------
B D                    Turkey  ---------
  D       Collared flycatcher  ---------
B D       Medium ground finch  ---------
  D    White-throated sparrow  ---------
B D                   Chicken  ---------
          Tibetan ground jay  ---------
B D             X. tropicalis  =========
B D        American alligator  ---------
B D               Zebra finch  ---------
  D               Rock pigeon  ---------

Alignment block 14 of 126 in window, 15601022 - 15601024, 3 bps 
B D                     Human  gg---------a
B D                     Chimp  gg---------a
B D                   Gorilla  gg---------a
B D                 Orangutan  gg---------a
B D                    Gibbon  gg---------a
B D                    Rhesus  gg---------a
B D       Crab-eating macaque  gg---------a
B D                    Baboon  gg---------a
B D              Green monkey  gg---------a
B D                  Marmoset  gg---------a
B D           Squirrel monkey  gg---------a
B D                  Bushbaby  gg---------a
           Chinese tree shrew  ga---------g
B D                  Squirrel  aa---------a
       Lesser Egyptian jerboa  aa---------a
                 Prairie vole  gg---------g
               Golden hamster  gg---------g
B D                     Mouse  ga---------g
B D            Naked mole-rat  gt---------g
B D                Guinea pig  ga---------g
                   Chinchilla  ga---------a
             Brush-tailed rat  ga---------g
B D                    Rabbit  gg---------g
B D                      Pika  gg---------g
B D                    Alpaca  gg---------g
               Bactrian camel  gg---------g
B D                   Dolphin  ggaagataaaaa
                 Killer whale  ggaagat----a
             Tibetan antelope  gg---------g
B D                       Cow  gg---------g
B D                     Sheep  gg---------g
                Domestic goat  gg---------g
B D                     Horse  gg---------g
B D          White rhinoceros  gg---------g
B D                       Cat  gg---------g
B D                       Dog  gg---------a
B D                   Ferret   gg---------a
B D                     Panda  gg---------a
               Pacific walrus  gg---------a
                 Weddell seal  gg---------a
             Black flying-fox  gg---------g
B D                   Megabat  gg---------g
                Big brown bat  gg---------g
         David's myotis (bat)  gg---------g
B D                  Microbat  gg---------g
B D                  Hedgehog  gg---------g
B D                     Shrew  gc---------g
              Star-nosed mole  gg---------g
B D                  Elephant  gg---------g
          Cape elephant shrew  gg---------g
B D                   Manatee  ag---------g
             Cape golden mole  gg---------g
B D                    Tenrec  gg---------g
                     Aardvark  ag---------g
B D                 Armadillo  ag---------g
B D                Coelacanth  tg---------a
B D              Nile tilapia  g-----------
           Southern platyfish  g-----------
B D                       Rat  ============
B D           Chinese hamster  ============
       Burton's mouthbreeder  ------------
         Pundamilia nyererei  ------------
  D             Scarlet macaw  ------------
B D                    Lizard  ------------
                 Zebra mbuna  ------------
  D                    Parrot  ------------
  D           Green seaturtle  ------------
         Princess of Burundi  ------------
  D  Chinese softshell turtle  ------------
B D                Budgerigar  ------------
  D          Peregrine falcon  ------------
B D                   Wallaby  ============
  D              Mallard duck  ------------
  D            Painted turtle  ------------
                 Spotted gar  ------------
  D    Spiny softshell turtle  ------------
B D           Tasmanian devil  ------------
B D                   Opossum  ------------
  D              Saker falcon  ------------
B D                    Turkey  ------------
  D       Collared flycatcher  ------------
B D                  Platypus  ------------
B D       Medium ground finch  ------------
  D    White-throated sparrow  ------------
B D                   Chicken  ------------
          Tibetan ground jay  ------------
B D             X. tropicalis  ============
B D        American alligator  ------------
B D               Zebra finch  ------------
  D               Rock pigeon  ------------

Alignment block 15 of 126 in window, 15601025 - 15601026, 2 bps 
B D                     Human  -aa
B D                     Chimp  -aa
B D                   Gorilla  -aa
B D                 Orangutan  -aa
B D                    Gibbon  -aa
B D                    Rhesus  -aa
B D       Crab-eating macaque  -aa
B D                    Baboon  -aa
B D              Green monkey  -aa
B D                  Marmoset  -aa
B D           Squirrel monkey  -aa
B D                  Bushbaby  -ag
           Chinese tree shrew  -aa
B D                  Squirrel  -aa
       Lesser Egyptian jerboa  -aa
                 Prairie vole  -aa
               Golden hamster  -aa
B D                     Mouse  -aa
B D            Naked mole-rat  -aa
B D                Guinea pig  -aa
                   Chinchilla  -aa
             Brush-tailed rat  -aa
B D                    Rabbit  -aa
B D                      Pika  -aa
B D                    Alpaca  -aa
               Bactrian camel  -aa
B D                   Dolphin  -aa
                 Killer whale  -aa
             Tibetan antelope  -aa
B D                       Cow  -aa
B D                     Sheep  -aa
                Domestic goat  -aa
B D                     Horse  -aa
B D          White rhinoceros  -aa
B D                       Cat  -aa
B D                       Dog  -aa
B D                   Ferret   -aa
B D                     Panda  -aa
               Pacific walrus  -aa
                 Weddell seal  -aa
             Black flying-fox  -aa
B D                   Megabat  -aa
                Big brown bat  -aa
         David's myotis (bat)  -aa
B D                  Microbat  -aa
B D                  Hedgehog  -aa
B D                     Shrew  -aa
              Star-nosed mole  -aa
B D                  Elephant  -aa
          Cape elephant shrew  -ga
B D                   Manatee  -aa
             Cape golden mole  -aa
B D                    Tenrec  -aa
B D                 Armadillo  -aa
B D                Coelacanth  -ag
B D              Nile tilapia  ta-
           Southern platyfish  ca-
B D                       Rat  ===
B D           Chinese hamster  ===
       Burton's mouthbreeder  ---
         Pundamilia nyererei  ---
  D             Scarlet macaw  ---
B D                    Lizard  ---
                 Zebra mbuna  ---
  D                    Parrot  ---
                    Aardvark  ---
  D           Green seaturtle  ---
         Princess of Burundi  ---
  D  Chinese softshell turtle  ---
B D                Budgerigar  ---
  D          Peregrine falcon  ---
B D                   Wallaby  ===
  D              Mallard duck  ---
  D            Painted turtle  ---
                 Spotted gar  ---
  D    Spiny softshell turtle  ---
B D           Tasmanian devil  ---
B D                   Opossum  ---
  D              Saker falcon  ---
B D                    Turkey  ---
  D       Collared flycatcher  ---
B D                  Platypus  ---
B D       Medium ground finch  ---
  D    White-throated sparrow  ---
B D                   Chicken  ---
          Tibetan ground jay  ---
B D             X. tropicalis  ===
B D        American alligator  ---
B D               Zebra finch  ---
  D               Rock pigeon  ---

Alignment block 16 of 126 in window, 15601027 - 15601038, 12 bps 
B D                     Human  gac-------c------aaa--------------------------------------------------
B D                     Chimp  gac-------c------aaa--------------------------------------------------
B D                   Gorilla  gac-------c------aaa--------------------------------------------------
B D                 Orangutan  gac-------c------aaa--------------------------------------------------
B D                    Gibbon  gac-------c------aaa--------------------------------------------------
B D                    Rhesus  gac-------c------aaa--------------------------------------------------
B D       Crab-eating macaque  gac-------c------aaa--------------------------------------------------
B D                    Baboon  gac-------c------aaa--------------------------------------------------
B D              Green monkey  gac-------c------aaa--------------------------------------------------
B D                  Marmoset  gac-------c------aaa--------------------------------------------------
B D           Squirrel monkey  gac-------c------aaa--------------------------------------------------
B D                  Bushbaby  aac-------c------aaa--------------------------------------------------
           Chinese tree shrew  gac-------a------gaa--------------------------------------------------
B D                  Squirrel  aaa-------a------aga--------------------------------------------------
       Lesser Egyptian jerboa  aaa-------a------aaa--------------------------------------------------
                 Prairie vole  gac-------a------aaa--------------------------------------------------
               Golden hamster  gac----------------a--------------------------------------------------
B D                     Mouse  g------------------a--------------------------------------------------
B D            Naked mole-rat  g------------------g--------------------------------------------------
B D                Guinea pig  g------------------a--------------------------------------------------
                   Chinchilla  g------------------a--------------------------------------------------
             Brush-tailed rat  g------------------a--------------------------------------------------
B D                    Rabbit  gac-------a------aaa--------------------------------------------------
B D                      Pika  gac-------c------aaa--------------------------------------------------
B D                    Alpaca  gat-------g-----aaaa--------------------------------------------------
               Bactrian camel  gac-------gaaaaaaaaa--------------------------------------------------
B D                   Dolphin  aaa-------a------aaa--------------------------------------------------
                 Killer whale  aaa-------a------aaa--------------------------------------------------
             Tibetan antelope  gat-------g------aaa--------------------------------------------------
B D                       Cow  gat-------g------aaa--------------------------------------------------
B D                     Sheep  gat-------g------aaa--------------------------------------------------
                Domestic goat  gat-------g------aaa--------------------------------------------------
B D                     Horse  gat-------g------aga-------------------------------------------------a
B D          White rhinoceros  gac-------------------------------------------------------------------
B D                       Cat  gat-------g------aaa-------------------------------------------------a
B D                       Dog  gat-------g------aaa-------------------------------------------------a
B D                   Ferret   gat-------g------gga-------------------------------------------------a
B D                     Panda  gat-------g------aaa-------------------------------------------------a
               Pacific walrus  gat-------g------aaa-------------------------------------------------a
                 Weddell seal  gat-------g------aaa-------------------------------------------------a
             Black flying-fox  gac-------a------gaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn-
B D                   Megabat  gac-------a------gaa--------------------------------------------------
                Big brown bat  gac-------a------gaa--------------------------------------------------
         David's myotis (bat)  gac-------a------gaa--------------------------------------------------
B D                  Microbat  gat-------a------gaa--------------------------------------------------
B D                  Hedgehog  gat-------g------gaa--------------------------------------------------
B D                     Shrew  gat-------g------ggg--------------------------------------------------
              Star-nosed mole  gac-------g------gaa--------------------------------------------------
B D                  Elephant  gaccaaaaaaa------aaa--------------------------------------------------
          Cape elephant shrew  gacaaggaggg------gga--------------------------------------------------
B D                   Manatee  gac------ag------gaa--------------------------------------------------
             Cape golden mole  gacaaaaaaaa------aga--------------------------------------------------
B D                    Tenrec  gataaaaaaaa------aaa--------------------------------------------------
                     Aardvark  ---------aa------aaa--------------------------------------------------
B D                 Armadillo  gat------aa------aaa--------------------------------------------------
B D              Nile tilapia  --------------------------------------------------------------------ga
           Southern platyfish  --------------------------------------------------------------------ga
B D                       Rat  ======================================================================
B D           Chinese hamster  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
                 Zebra mbuna  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
         Princess of Burundi  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D          Peregrine falcon  ----------------------------------------------------------------------
B D                   Wallaby  ======================================================================
  D              Mallard duck  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
                 Spotted gar  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
B D           Tasmanian devil  ----------------------------------------------------------------------
B D                   Opossum  ----------------------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------------------
  D       Collared flycatcher  ----------------------------------------------------------------------
B D                  Platypus  ----------------------------------------------------------------------
B D       Medium ground finch  ----------------------------------------------------------------------
  D    White-throated sparrow  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
          Tibetan ground jay  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================
B D        American alligator  ----------------------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------

                        Human  --aaaag---
                        Chimp  --aaaag---
                      Gorilla  --aaaag---
                    Orangutan  --aaaag---
                       Gibbon  --aaaag---
                       Rhesus  --aaaag---
          Crab-eating macaque  --aaaag---
                       Baboon  --aaaag---
                 Green monkey  --aaaag---
                     Marmoset  --aaaag---
              Squirrel monkey  --aaaag---
                     Bushbaby  --aaaaa---
           Chinese tree shrew  --agaaa---
                     Squirrel  --aaaaa---
       Lesser Egyptian jerboa  --aaaaa---
                 Prairie vole  --aaaaa---
               Golden hamster  --aaaaa---
                        Mouse  --aaaaa---
               Naked mole-rat  --aaaaa---
                   Guinea pig  --aaaaa---
                   Chinchilla  --aaaaa---
             Brush-tailed rat  --aaaaa---
                       Rabbit  --aaaaa---
                         Pika  --aaaaa---
                       Alpaca  --aaaaa---
               Bactrian camel  --aaaaa---
                      Dolphin  --aaaaa---
                 Killer whale  --aaaaa---
             Tibetan antelope  --aaaaa---
                          Cow  --aaaaa---
                        Sheep  --aaaaa---
                Domestic goat  --aaaaa---
                        Horse  aaaaaaa---
             White rhinoceros  -aaaaaa---
                          Cat  aaaaaaa---
                          Dog  aaaaaaa---
                      Ferret   aaaaaaa---
                        Panda  aaaaaaa---
               Pacific walrus  aaaaaaa---
                 Weddell seal  aaaaaaa---
             Black flying-fox  ----------
                      Megabat  -aaaaaa---
                Big brown bat  --aaaaa---
         David's myotis (bat)  --aaaaa---
                     Microbat  --aaaaa---
                     Hedgehog  --aaaaa---
                        Shrew  --cgggg---
              Star-nosed mole  --aaaaa---
                     Elephant  --aaaaa---
          Cape elephant shrew  --gagaa---
                      Manatee  --aaaaa---
             Cape golden mole  --aaaaa---
                       Tenrec  --aaaaa---
                     Aardvark  --aaaaa---
                    Armadillo  --aaaaa---
                 Nile tilapia  gccataacgg
           Southern platyfish  gcaataacag
                          Rat  ==========
              Chinese hamster  ==========
        Burton's mouthbreeder  ----------
          Pundamilia nyererei  ----------
                Scarlet macaw  ----------
                       Lizard  ----------
                  Zebra mbuna  ----------
                       Parrot  ----------
              Green seaturtle  ----------
          Princess of Burundi  ----------
     Chinese softshell turtle  ----------
                   Budgerigar  ----------
             Peregrine falcon  ----------
                      Wallaby  ==========
                 Mallard duck  ----------
               Painted turtle  ----------
                  Spotted gar  ----------
       Spiny softshell turtle  ----------
                   Coelacanth  ----------
              Tasmanian devil  ----------
                      Opossum  ----------
                 Saker falcon  ----------
                       Turkey  ----------
          Collared flycatcher  ----------
                     Platypus  ----------
          Medium ground finch  ----------
       White-throated sparrow  ----------
                      Chicken  ----------
           Tibetan ground jay  ----------
                X. tropicalis  ==========
           American alligator  ----------
                  Zebra finch  ----------
                  Rock pigeon  ----------

Alignment block 17 of 126 in window, 15601039 - 15601070, 32 bps 
B D                     Human  aa---------------a------------------------------a---------------------
B D                     Chimp  aa---------------a------------------------------a---------------------
B D                   Gorilla  aa---------------a------------------------------a---------------------
B D                 Orangutan  aa---------------a------------------------------a---------------------
B D                    Gibbon  aa---------------a------------------------------a---------------------
B D                    Rhesus  aa---------------a----------------------------------------------------
B D       Crab-eating macaque  aa---------------a----------------------------------------------------
B D                    Baboon  aa---------------a----------------------------------------------------
B D              Green monkey  aa---------------a----------------------------------------------------
B D                  Marmoset  aa---------------a----------------------------------------------------
B D           Squirrel monkey  aa---------------a----------------------------------------------------
B D                  Bushbaby  aa---------------aaagaaaaagga------------------aa---------------------
           Chinese tree shrew  aa---------------a-----aaaaaa------------------ga---------------------
B D                  Squirrel  aa---------------a--ggaggaggaggaggaggaggagaaaacga---------------------
       Lesser Egyptian jerboa  aa---------------a--acagaagaa------------------ga---------------------
                 Prairie vole  aa---------------a--gcagaagaa------------------ga---------------------
               Golden hamster  aa---------------a--gcagaagaa------------------ga---------------------
B D                     Mouse  aa---------------a--gcagaagaa------------------ga---------------------
B D            Naked mole-rat  aa---------------a-----------------------------ag---------------------
B D                Guinea pig  -----------------------------------------------ag---------------------
                   Chinchilla  aa---------------------------------------------ag---------------------
             Brush-tailed rat  aa---------------a--t--------------------------ag---------------------
B D                    Rabbit  aa---------------a--aa-------------------------aa---------------------
B D                      Pika  aa---------------a--aa-------------------------aa---------------------
B D                    Alpaca  aa---------------g-----------------------------ga---------------------
               Bactrian camel  aa---------------g-----------------------------ga---------------------
B D                   Dolphin  aa---------------g-----------------------------ga---------------------
                 Killer whale  aa---------------g-----------------------------ga---------------------
             Tibetan antelope  aa---------------g-----------------------------ga---------------------
B D                       Cow  aa---------------g-----------------------------ga---------------------
B D                     Sheep  ag---------------g-----------------------------ga---------------------
                Domestic goat  ag---------------g-----------------------------ga---------------------
B D                     Horse  aa-------------aaa-----------------------------ga---------------------
B D          White rhinoceros  aa-------------aaa-----------------------------ga---------------------
B D                       Cat  aaaagaaaagaagaagaa-----------------------------ga---------------------
B D                       Dog  ag--------------aa-----------------------------ga---------------------
B D                   Ferret   aa------------aaaa-----------------------------ga---------------------
B D                     Panda  aa-------------aaa-----------------------------aa---------------------
               Pacific walrus  aa-------------gaa-----------------------------ga---------------------
                 Weddell seal  aa--------------aa-----------------------------ga---------------------
B D                   Megabat  aa--------------------------------------------------------------------
                Big brown bat  aa--------------------------------------------------------------------
         David's myotis (bat)  aa--------------------------------------------------------------------
B D                  Microbat  aa--------------------------------------------------------------------
B D                  Hedgehog  aa---------------g-----------------------------aa---------------------
B D                     Shrew  gg---------------g-----------------------------gg---------------------
              Star-nosed mole  aa---------------a-----------------------------aa---------------------
B D                  Elephant  aa---------------a-----------------------------ga---agaagaagaaat------
          Cape elephant shrew  ga---------------a-----------------------------gagagagagaggggggg------
B D                   Manatee  aa---------------a-----------------------------aagggagaagaagaaat------
             Cape golden mole  aa---------------a-----------------------------aa---aagggagg----------
B D                    Tenrec  ga---------------g-----------------------------ga---tgaagaagaaattttaa-
                     Aardvark  aa---------------a-----------------------------ga---agaagaagaaat------
B D                 Armadillo  at---------------a-----------------------------ga---------------------
B D                   Opossum  ------------------------------------------------------------aactttgaa-
B D           Tasmanian devil  ------------------------------------------------------------aactttaaaa
B D                   Wallaby  ------------------------------------------------------------aactt-----
B D                  Platypus  ----------------------------------------------------------------------
  D               Rock pigeon  ----------------------------------------------------------------------
  D              Saker falcon  ----------------------------------------------------------------------
  D          Peregrine falcon  ----------------------------------------------------------------------
  D       Collared flycatcher  ----------------------------------------------------------------------
  D    White-throated sparrow  ----------------------------------------------------------------------
B D       Medium ground finch  ----------------------------------------------------------------------
B D               Zebra finch  ----------------------------------------------------------------------
           Tibetan ground jay  ----------------------------------------------------------------------
B D                Budgerigar  ----------------------------------------------------------------------
  D                    Parrot  ----------------------------------------------------------------------
  D             Scarlet macaw  ----------------------------------------------------------------------
  D              Mallard duck  ----------------------------------------------------------------------
B D                   Chicken  ----------------------------------------------------------------------
B D                    Turkey  ----------------------------------------------------------------------
B D        American alligator  ----------------------------------------------------------------------
  D           Green seaturtle  ----------------------------------------------------------------------
  D            Painted turtle  ----------------------------------------------------------------------
  D  Chinese softshell turtle  ----------------------------------------------------------------------
  D    Spiny softshell turtle  ----------------------------------------------------------------------
B D                    Lizard  ----------------------------------------------------------------------
B D                Coelacanth  ----------------------------------------------------------------------
           Southern platyfish  ----------------------------------------------------------------------
B D                       Rat  ======================================================================
B D           Chinese hamster  ======================================================================
            Black flying-fox  ----------------------------------------------------------------------
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
                 Zebra mbuna  ----------------------------------------------------------------------
         Princess of Burundi  ----------------------------------------------------------------------
                 Spotted gar  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================

                        Human  ------aga----------------------------------agaaga--acacagtaaaca-------
                        Chimp  ------aga----------------------------------agaaga--acacagtaaaca-------
                      Gorilla  ------aga----------------------------------agaaga--acacagtaaaca-------
                    Orangutan  ------aga----------------------------------agaaga--acacagtaaaca-------
                       Gibbon  ------aga----------------------------------agaaga--acacagtaaaca-------
                       Rhesus  --------a----------------------------------agaaga--gcacagtaaaca-------
          Crab-eating macaque  --------a----------------------------------agaaga--gcacagtaaaca-------
                       Baboon  --------a----------------------------------agaaga--gcacagtaaaca-------
                 Green monkey  --------a----------------------------------agaaga--gcacagtaaaca-------
                     Marmoset  ------aga----------------------------------agaaga--acacagtaaaca-------
              Squirrel monkey  ------aga----------------------------------agaaga--acacagtaaaca-------
                     Bushbaby  ------aga----------------------------------agaaga--aaacagtaaaca-------
           Chinese tree shrew  ------aga----------------------------------aggaga--gaatagtaaaca-------
                     Squirrel  ------aga----------------------------------agaaga--aaacagtaaaca-------
       Lesser Egyptian jerboa  ------aac----------------------------------agaaga--gaacagtaaaca-------
                 Prairie vole  ------aac----------------------------------agaaga--gaacagtaaaca-------
               Golden hamster  ------aac----------------------------------agaaga--gaacagtaaaca-------
                        Mouse  ------aac----------------------------------agaaga--gaacagtaaaca-------
               Naked mole-rat  ------aca----------------------------------agagga--aaacagtaaaca-------
                   Guinea pig  ------aca----------------------------------agagga--aaacagtaaaca-------
                   Chinchilla  ------aca----------------------------------agagga--aaacagtaaaca-------
             Brush-tailed rat  ------aca----------------------------------agagga--aaacagtaaaca-------
                       Rabbit  ------aga----------------------------------agaaga--aaaccgtaaaca-------
                         Pika  ------aaa----------------------------------aaccca--aca-tgtaaaca-------
                       Alpaca  ------aga----------------------------------agaagaaaaaacagtaaaca-------
               Bactrian camel  ------aga----------------------------------agaagaaaaaacagtaaaca-------
                      Dolphin  ------aga----------------------------------agaagaaaaaacagtaaaca-------
                 Killer whale  ------aga----------------------------------agaagaaaaaacagtaaaca-------
             Tibetan antelope  ------aga----------------------------------agaagagaaaactgtaaaca-------
                          Cow  ------aga----------------------------------agaagaaaaaactgtaaaca-------
                        Sheep  ------aga----------------------------------agaagagaaaactgtaaaca-------
                Domestic goat  ------aga----------------------------------agaagagaaaactgtaaaca-------
                        Horse  ------aga----------------------------------agaagaaaaaacagtaaaca-------
             White rhinoceros  ------aga----------------------------------agaagaagaaacagtaaaca-------
                          Cat  ------agaagaagaagaagaagaagaaga-------------agaagaagaaacagtaaaca-------
                          Dog  ------agaagaagtagtagaaga---aga-------------agaagaagaaacagtaaaca-------
                      Ferret   ------agaagaagtagtagtagtagtaga-------------agaagaagaaacagtaaaca-------
                        Panda  ------agaagaagaagtagtagt-------------------agaagaagaaacagtaaaca-------
               Pacific walrus  ------agaagaagaagtagtagt-------------------agaagaagaaacagtaaaca-------
                 Weddell seal  ------tgaagaagaagaagtagt-------------------agaagaagaaacagtaaaca-------
                      Megabat  -------------------------------------------aaaagaagaaacagtaaaca-------
                Big brown bat  -------------------------------------------ggaagaagaaacagtaaaca-------
         David's myotis (bat)  -------------------------------------------ggaagaagaaacagtaaaca-------
                     Microbat  --------------------------------------------aaagaagaaacagtaaaca-------
                     Hedgehog  ------gg--------------------------------------agaaaaaacagtaaaca-------
                        Shrew  ------agcgggagggcgggg----------------------aagagaagaaacagaaaaca-------
              Star-nosed mole  ------ag-------------------------------------aagaagaaacagtaaaca-------
                     Elephant  ------aaa----------------------------------aaaagaaaacacagtcaaca-------
          Cape elephant shrew  ------ggg----------------------------------gaaaaaggacacagtcaaca-------
                      Manatee  ------aaa----------------------------------aaaagaaaacacagtcaaca-------
             Cape golden mole  ------gga----------------------------------aaaataaagcacagtccaca-------
                       Tenrec  ------aaa----------------------------------aaaagaaagcacagccaacc-------
                     Aardvark  ------aaa----------------------------------aaaagaaaacatagtcaaca-------
                    Armadillo  ------aaa----------------------------------aa--------acagtaaaca-------
                      Opossum  ------aaa----------------------------------aaaaag--aggcagtaaata-------
              Tasmanian devil  aaaaaaaaa----------------------------------aaaaaa--aggcagtaaata-------
                      Wallaby  ------aaa----------------------------------aaaaaa--aggcagtaaata-------
                     Platypus  ---------------------------act-------------gagaaaagaggtggtaaaca-------
                  Rock pigeon  -------------------------------------------aagaaaaaaggctgaatcca-------
                 Saker falcon  -------------------------------------------aagaaaaaaggctgaatcca-------
             Peregrine falcon  -------------------------------------------aagaaaaaaggctgaatcca-------
          Collared flycatcher  -------------------------------------------aagaagaaaggctgaatcca-------
       White-throated sparrow  -------------------------------------------aagaggaaaggctgaatcca-------
          Medium ground finch  -------------------------------------------aagaagaaaggctgaatcca-------
                  Zebra finch  -------------------------------------------aagaagaaaggctgaatcca-------
           Tibetan ground jay  -------------------------------------------aagaagaaaggctgaatcca-------
                   Budgerigar  -------------------------------------------aagaaaaaaggctgaatcca-------
                       Parrot  -------------------------------------------aagaaaaaaggctgaatcca-------
                Scarlet macaw  -------------------------------------------acgaaaaaaggctgaatcca-------
                 Mallard duck  -------------------------------------------aactaaagaggctgaatcca-------
                      Chicken  -------------------------------------------agctaaagaggctgaaccca-------
                       Turkey  -------------------------------------------aactaaagaggctgaaccca-------
           American alligator  -------------------------------------------acttaaaagggaagaaccca-------
              Green seaturtle  ----------------------------gcta-----------ggggaaaaagggagaatcca-------
               Painted turtle  ----------------------------gcta-----------ggggaaaaggggagaatcca-------
     Chinese softshell turtle  ----------------------------gcta-----------ggggaaaaagggagaatcca-------
       Spiny softshell turtle  ----------------------------gcta-----------ggggaaaaagggagaatcta-------
                       Lizard  -------------------------------------------aggaaaaaagacagaatcca-------
                   Coelacanth  ------------------------------tataatttggtataagataataattagtcaata-------
           Southern platyfish  ---------------------------------------------agggtgtatcagttttcatttacag
                          Rat  ======================================================================
              Chinese hamster  ======================================================================
             Black flying-fox  ----------------------------------------------------------------------
        Burton's mouthbreeder  ----------------------------------------------------------------------
                 Nile tilapia  ----------------------------------------------------------------------
          Pundamilia nyererei  ----------------------------------------------------------------------
                  Zebra mbuna  ----------------------------------------------------------------------
          Princess of Burundi  ----------------------------------------------------------------------
                  Spotted gar  ----------------------------------------------------------------------
                X. tropicalis  ======================================================================

                        Human  atctgct
                        Chimp  atctgct
                      Gorilla  atctgct
                    Orangutan  atctgct
                       Gibbon  atctgct
                       Rhesus  atctgct
          Crab-eating macaque  atctgct
                       Baboon  atctgct
                 Green monkey  atctgct
                     Marmoset  atctgct
              Squirrel monkey  atctgct
                     Bushbaby  ctctgct
           Chinese tree shrew  atctgtt
                     Squirrel  atctgct
       Lesser Egyptian jerboa  aactgct
                 Prairie vole  agctgct
               Golden hamster  agctgct
                        Mouse  agctgct
               Naked mole-rat  atctgct
                   Guinea pig  atctgct
                   Chinchilla  atctgct
             Brush-tailed rat  atctgtt
                       Rabbit  atctgct
                         Pika  atctgct
                       Alpaca  atctgct
               Bactrian camel  atctgct
                      Dolphin  atctgct
                 Killer whale  atctgct
             Tibetan antelope  atctgct
                          Cow  atctgct
                        Sheep  atctgct
                Domestic goat  atctgct
                        Horse  atctgct
             White rhinoceros  atctgct
                          Cat  gtctgct
                          Dog  atctgct
                      Ferret   atctgct
                        Panda  atctgct
               Pacific walrus  gtctgct
                 Weddell seal  gtctgct
                      Megabat  atctgct
                Big brown bat  atctgat
         David's myotis (bat)  atctgat
                     Microbat  atctgat
                     Hedgehog  atctgct
                        Shrew  atctgct
              Star-nosed mole  atctgct
                     Elephant  atctgct
          Cape elephant shrew  atctgct
                      Manatee  atctgct
             Cape golden mole  atctgct
                       Tenrec  atctgct
                     Aardvark  atctgct
                    Armadillo  atctgct
                      Opossum  atctgtt
              Tasmanian devil  atctgtt
                      Wallaby  atctgtt
                     Platypus  atttgct
                  Rock pigeon  atctgcc
                 Saker falcon  gtttgct
             Peregrine falcon  gtttgct
          Collared flycatcher  atttgct
       White-throated sparrow  atttcct
          Medium ground finch  atttgct
                  Zebra finch  atttgct
           Tibetan ground jay  atttgct
                   Budgerigar  atttgcg
                       Parrot  atttgca
                Scarlet macaw  atttgag
                 Mallard duck  attttcc
                      Chicken  gttttcc
                       Turkey  attttcc
           American alligator  atttgct
              Green seaturtle  atttgct
               Painted turtle  atttgct
     Chinese softshell turtle  atttgct
       Spiny softshell turtle  atttgct
                       Lizard  gtgattc
                   Coelacanth  ccttgtt
           Southern platyfish  atatgat
                          Rat  =======
              Chinese hamster  =======
             Black flying-fox  -------
        Burton's mouthbreeder  -------
                 Nile tilapia  -------
          Pundamilia nyererei  -------
                  Zebra mbuna  -------
          Princess of Burundi  -------
                  Spotted gar  -------
                X. tropicalis  =======

Inserts between block 17 and 18 in window
            Tibetan antelope 238bp
  D              Rock pigeon 1bp
  D             Saker falcon 1bp
  D         Peregrine falcon 1bp
  D      Collared flycatcher 1bp
  D   White-throated sparrow 1bp
B D      Medium ground finch 1bp
B D              Zebra finch 1bp
          Tibetan ground jay 1bp
B D               Budgerigar 1bp
  D                   Parrot 1bp
  D            Scarlet macaw 1bp
  D             Mallard duck 1bp
B D                  Chicken 1bp
B D                   Turkey 1bp
B D       American alligator 1bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp
B D                   Lizard 1bp
B D               Coelacanth 3bp

Alignment block 18 of 126 in window, 15601071 - 15601081, 11 bps 
B D                     Human  gag-cca-atata
B D                     Chimp  gag-cca-atata
B D                   Gorilla  gag-cca-atata
B D                 Orangutan  gag-cca-atata
B D                    Gibbon  gag-cca-atata
B D                    Rhesus  gaa-cca-atata
B D       Crab-eating macaque  gaa-cca-atata
B D                    Baboon  gaa-cca-atata
B D              Green monkey  gaa-cca-acata
B D                  Marmoset  gaa-cca-atata
B D           Squirrel monkey  gaa-cca-atata
B D                  Bushbaby  gaa-tca-acata
           Chinese tree shrew  taa-cca-atata
B D                  Squirrel  gaa-cca-atata
       Lesser Egyptian jerboa  gaa-cca-atata
                 Prairie vole  gaa-cca-atatg
               Golden hamster  gaa-cca-atatg
B D                     Mouse  gga-cca-atatg
B D            Naked mole-rat  gaa-cca-atata
B D                Guinea pig  gaa-cca-atata
                   Chinchilla  gaa-cca-atata
             Brush-tailed rat  gaa-cca-ctata
B D                    Rabbit  gaa-cca-ataga
B D                      Pika  gaa-ccatatata
B D                    Alpaca  gaa-ccg-acata
               Bactrian camel  gaa-ccg-acata
B D                   Dolphin  gaa-cca-acaca
                 Killer whale  gaa-cca-acaca
             Tibetan antelope  gaa-cca-acata
B D                       Cow  gaa-cca-acata
B D                     Sheep  gaa-cca-acata
                Domestic goat  gaa-cca-acata
B D                     Horse  gaa-cca-acata
B D          White rhinoceros  gaa-cca-acata
B D                       Cat  gaa-cca-atata
B D                       Dog  gaa-cca-atata
B D                   Ferret   gaa-cca-ctata
B D                     Panda  gaa-cca-atata
               Pacific walrus  gaa-cca-ctata
                 Weddell seal  gaa-cca-ccata
B D                   Megabat  gaa-cca-atata
                Big brown bat  gaa-cca-atagg
         David's myotis (bat)  gaa-cca-ataga
B D                  Microbat  gaa-cca-ataga
B D                  Hedgehog  gaa-cca-acata
B D                     Shrew  gaa-cta-acata
              Star-nosed mole  gaa-cca-acata
B D                  Elephant  gaa-cca-atata
          Cape elephant shrew  gaa-ctt-ctata
B D                   Manatee  aaa-cta-atata
             Cape golden mole  gaa-ctt-atata
B D                    Tenrec  gaa-ctt-atata
                     Aardvark  gaa-cta-ctgca
B D                 Armadillo  gaa-cca-ataca
B D                   Opossum  gaa-ct-------
B D           Tasmanian devil  gaa-ctc-ttata
B D                   Wallaby  gaa-cta-ttaca
B D                  Platypus  gag-cca-ttata
  D               Rock pigeon  ggc-ctt-ttata
  D              Saker falcon  ggc-ctt-ttata
  D          Peregrine falcon  ggc-ctt-ttata
  D       Collared flycatcher  gac-ctt-ttata
  D    White-throated sparrow  gac-ctt-ttata
B D       Medium ground finch  gac-ctt-ttata
B D               Zebra finch  gac-ctt-ttatg
           Tibetan ground jay  gac-ctt-ttata
B D                Budgerigar  ggc-ctt-ttata
  D                    Parrot  ggc-ttt-ttata
  D             Scarlet macaw  ggc-ctt-ttata
  D              Mallard duck  ggc-ctt-ttata
B D                   Chicken  ggc-ctt-ttata
B D                    Turkey  ggc-ctt-ttata
B D        American alligator  gactttt-ttata
  D           Green seaturtle  gat-ctt-ttatt
  D            Painted turtle  gat-ctt-ttatt
  D  Chinese softshell turtle  gat-ctt-ttata
  D    Spiny softshell turtle  gat-ttt-ttata
B D                    Lizard  gac-cct-ttata
B D                Coelacanth  gaa-atg-tc---
           Southern platyfish  gtc-tta-aggga
B D                       Rat  =============
B D           Chinese hamster  =============
            Black flying-fox  -------------
       Burton's mouthbreeder  -------------
B D              Nile tilapia  -------------
         Pundamilia nyererei  -------------
                 Zebra mbuna  -------------
         Princess of Burundi  -------------
                 Spotted gar  -------------
B D             X. tropicalis  =============

Inserts between block 18 and 19 in window
B D                   Rabbit 5bp

Alignment block 19 of 126 in window, 15601082 - 15601137, 56 bps 
B D                     Human  a--agttcatcctggagaggacagatatgt---a---acaga--ttttagaataa--t------------
B D                     Chimp  a--agttcatcctggagaggacagatatgt---a---acaga--ttttagaataa--t------------
B D                   Gorilla  a--agttcatcctggagaggacagatatgt---a---acaga--ttttagaataa--t------------
B D                 Orangutan  a--agttcatcctggagaggacagatatgt---a---acaga--ttttagaataa--t------------
B D                    Gibbon  a--agttcatcctggagaggacagatatgt---a---acaga--ttttagaataa--t------------
B D                    Rhesus  a--agttcatcctggagaggacagatatgt---a---acaga--tttcagaataa--t------------
B D       Crab-eating macaque  a--agttcatcctggagaggacagatatgt---a---acaga--tttcagaataa--t------------
B D                    Baboon  a--agttcatcctggagaggacagatatgt---a---acaga--tttcagaataa--t------------
B D              Green monkey  a--agttcatcctggagaggacagatatgt---a---acaga--ttttagaataa--t------------
B D                  Marmoset  a--agttcatcctggagaagacagata-at---a---acaga--ttttagaataa--t------------
B D           Squirrel monkey  a--agttcatcctggagaagacagatatgt---a---acaga--ttttagaataa--t------------
B D                  Bushbaby  a--agttcgtcctgcagaggacagatatgt---a---gcaga--tttcagaaaaa--a------------
           Chinese tree shrew  a--agtttatcttgcagaggacagaaatatataa---acaga--tttttaaatga--t------------
B D                  Squirrel  a--acctaatcctggagaggacagatatgt--aa---acaga--ttttagaatgatat------------
       Lesser Egyptian jerboa  a--agttaatcctggagaggacagatctgt--aa---acagat-ttttagaatgat-t------------
                 Prairie vole  a--agttaatcctggagaggacagatatgt--aa---acagattttttagaatga--t------------
B D           Chinese hamster  a--ggttaatcctggagaggacagatatgt--aa---acagattttttaggatgat-t------------
               Golden hamster  a--agttaatcctggagaggacagatatgt--aa---acagattttttaggatga--t------------
B D                     Mouse  a--agttaatcctggagaggacagatatgt--aa---acagatattttagaatga--t------------
B D            Naked mole-rat  a--agttaatcctggagaggacagatatgt--aa---acaga--ttttagaatga---------------
B D                Guinea pig  a--agttaatcccggcgagaacagatatgt--aa---acaga--ttttagaatga---------------
                   Chinchilla  a--agttaatcctggagagaacagatatgt--aa---acaga--ttttagaatgattt------------
             Brush-tailed rat  a--agttaatactgaagagaaaagatatgt--aa---acaga--ttttaaaatga---------------
B D                    Rabbit  a--agttcatcctggagaggacagatatgc--aa---acaga--ttttagaaaga--t------------
B D                      Pika  a--agttcatccccggagagacagatatgc--aa---acaga--ttttagaagga---------------
B D                    Alpaca  a--aattcatcctggaaaaaacagatatgt--aa---acaga--ttttagaatga--t------------
               Bactrian camel  a--aattcatcctggaaaaaacagatatgt--aa---acaga--ttttagaatga--t------------
B D                   Dolphin  a--aattcatcctggagaggacagatatgt--aa---acaga--ttttagaatga--t------------
                 Killer whale  a--aattcatcctggagaggacagatatgt--aa---acaga--ttttagaatga--t------------
             Tibetan antelope  a--aactcatcctggagaggccagatatgt--aa---acaga--ttttagaatga--t------------
B D                       Cow  a--aattcatcctggagaggccagatatgt--aa---acaga--ttttagaatga--t------------
B D                     Sheep  a--aactcatcctggagaggccagatatgt--aa---acaga--ttttagaatga--t------------
                Domestic goat  a--aactcatcctggagaggccagatatgt--aa---acaga--ttttagaatga--t------------
B D                     Horse  a--agttcatcctggagagaacagatatgt--aa---acaga--ttttagcatga--t------------
B D          White rhinoceros  a--agttcatcctggagagaacagatatgt--aa---acaga--ttttagaatga--t------------
B D                       Cat  a--agttcatcctggagaggacagatatgt--aa---acaga--ttttagaatga--t------------
B D                       Dog  a--agttcatcctggagaggacagatatat--aa---acagat-ttttagaatga--t------------
B D                   Ferret   a--atttcaccctggagaggacagatatgt--aa---acaga--ttttagaatga--t------------
B D                     Panda  a--agttcatcctggagaggacagatatgt--aa---acaga--gtttagaatga--g------------
               Pacific walrus  a--agttcatcctggagaggacagatacat--aa---acaga--ttttagaatga--t------------
                 Weddell seal  a--agttcatcctggagaggacagatatat--aa---acaga--ttttagaatga--t------------
             Black flying-fox  ----------------gaggaca-----gt--aa---gcata--ttttagaatga--t------------
B D                   Megabat  a--agttcatcccggagaggaca-----gt--aa---gcata--ttttagaatga--t------------
                Big brown bat  a--agttcatcctggagaggacagatatgt--ac---gcata--ttttaaaatga--t------------
         David's myotis (bat)  a--agttcatcctagagaggacagatatgt--ac---gcata--ttttaaaatga--t------------
B D                  Microbat  a--agttcatcctagagaggacagatatgt--ac---gcata--ttttaaaatga--t------------
B D                  Hedgehog  a--agttcatcttggacaggacagatatgt--aa---acaga--ttttagaacga--t------------
B D                     Shrew  a--agttcttcatggaaagaacagatatgc--aa---ac-------------tgt--t------------
              Star-nosed mole  a--agttcatcctggagagaacagatatgt--aa---acaga--ttttagaatga--t------------
B D                  Elephant  g--agtttatcctggagaggacagatatat--ca---gcaga--ttttagaatga--ct-----------
          Cape elephant shrew  g--agttcattctggggagaacagatacac--aa---acaga--tttgagaatgg--gttgtgggtgtgt
B D                   Manatee  g--agttcatcctggagaggacagatatat--aa---acaga--ttttataatga--tc-----------
             Cape golden mole  g--agttcatcctagagagaacagatatat--aa---acaga--ttttagaacga--ttt----------
B D                    Tenrec  a--agttcatcgtggagagaacagatatat--aa---acaga--ttttagaatga--aat----------
                     Aardvark  g--agttcaccccggagaggacagacacat--aa---agaga--ttttagaatga--tttt---------
B D                 Armadillo  g--agttcatcctggggaggacagatacat--aa---acaga--ttttaggatga---------------
B D                   Opossum  g--tttgcatccaggaaaagacacacatgt--aa---acagc--tttaagaatga--t------------
B D           Tasmanian devil  g--ttttcatccaggaaaagacatacatgt--aa---acagc--tttaagaatga--t------------
B D                   Wallaby  g--tttccatccaggaaaagac--acatat--aa---acaac--tttaagaatga--t------------
B D                  Platypus  c--ttttcctccagtgaaagacagaaatgt--aa---acagt--tttaagaacga--t------------
  D               Rock pigeon  g--gttttatctgttgtaagagagaaagga--aa---a---t------------g--t------------
  D              Saker falcon  g--gttttatccattgtaggagagaaagga--aa---a---a------------g--t------------
  D          Peregrine falcon  g--gttttatccattgtaggagagaaagga--aa---a---a------------g--t------------
  D       Collared flycatcher  g--gctttattcattacaggagagaaagga--aa---a---a------------g--t------------
  D    White-throated sparrow  g--gttttattcattataggagagaaagga--aa---a---a------------g--t------------
B D       Medium ground finch  g--gttttattcattataggagagaaagga--aa---a---a------------g--t------------
B D               Zebra finch  g--gttttattcattataggagagaaagga--aa---a---a------------g--t------------
           Tibetan ground jay  g--gttttattcattataggagagaaagga--aa---a---a------------g--t------------
B D                Budgerigar  g--gttctatccattgtaggagagaaagga--aa---a---a------------g--t------------
  D                    Parrot  g--gttttatccattgtaggagagaaagga--aa---a---a------------g--t------------
  D             Scarlet macaw  g--gttttatccattgtaggagagaaagga--aa---a---a------------g--t------------
  D              Mallard duck  g--gttttatccattg-aggagagaaagga--aa---a---a------------g--t------------
B D                   Chicken  g--gttttatccattgtaggaaagaaaggt--aa---a---a------------g---------------
B D                    Turkey  g--gttttatccattgtaggaaagaaaggt--aa---a---a------------g---------------
B D        American alligator  g--ttttcagctgggggaggacagaaaaga--aa---g---a------------a---------------
  D           Green seaturtle  g--tttttatccagcgaaggacaaaaatga--aa---a---t------------a--g------------
  D            Painted turtle  g--tttttatccactgaaggacagaaatga--aa---a---t------------a--g------------
  D  Chinese softshell turtle  gt-tttttatccagtgaaggacagaaatga--aa---a---t------------a--g------------
  D    Spiny softshell turtle  g--tttttatccagtgaaggacagaaatga--aa---a---t------------a--g------------
B D                    Lizard  g--ttttattactgcaaagggcagaatcta--ga------------------------------------
B D                Coelacanth  -------catttcttttaggagataaaggt--aaggcactaa--tttt---------t------------
           Southern platyfish  -tcattcaatgccaccgtgctgaagtctgt--at---c---a--tacttcgatgc--t------------
B D                       Rat  ======================================================================
       Burton's mouthbreeder  ----------------------------------------------------------------------
B D              Nile tilapia  ----------------------------------------------------------------------
         Pundamilia nyererei  ----------------------------------------------------------------------
                 Zebra mbuna  ----------------------------------------------------------------------
         Princess of Burundi  ----------------------------------------------------------------------
                 Spotted gar  ----------------------------------------------------------------------
B D             X. tropicalis  ======================================================================

                        Human  -----tttt------------------t---aa-agt
                        Chimp  -----tttt------------------t---aa-agt
                      Gorilla  -----tttt------------------t---aa-agt
                    Orangutan  -----tttt------------------t---aa-agt
                       Gibbon  -----tttt------------------t---aa-agt
                       Rhesus  -----tttt------------------t---aa-agt
          Crab-eating macaque  -----tttt------------------t---aa-agt
                       Baboon  -----tttt------------------t---aa-agt
                 Green monkey  -----tttt------------------t---aa-agt
                     Marmoset  -----tttt------------------t---aa-agt
              Squirrel monkey  -----tttt------------------t---aa-agt
                     Bushbaby  -----attt------------------t---ga-agt
           Chinese tree shrew  -----ttta------------------t---aa-agt
                     Squirrel  -----tctt------------------t---aa-agt
       Lesser Egyptian jerboa  -----tttt------------------t---tt-agt
                 Prairie vole  -----tttt------------------t---ta-aat
              Chinese hamster  -----tttt------------------t---ta-agt
               Golden hamster  -----tttt------------------t---ta-agt
                        Mouse  -----tttt------------------t---ta-agt
               Naked mole-rat  -----gttt------------------t---ta-agt
                   Guinea pig  -----tttt------------------t---ta-agt
                   Chinchilla  -----tttt------------------t---tt-agt
             Brush-tailed rat  -----tttt------------------t---ta-agt
                       Rabbit  -----tttt------------------t---ta-agt
                         Pika  -----tttt------------------t---ta-agt
                       Alpaca  -----ttct------------------t---aa-agt
               Bactrian camel  -----ttct------------------t---aa-agt
                      Dolphin  -----ttct------------------t---aa-agg
                 Killer whale  -----ttct------------------t---aa-agg
             Tibetan antelope  -----ttct------------------t---ag-agc
                          Cow  -----ttct------------------t---ag-agc
                        Sheep  -----ttct------------------t---ag-agc
                Domestic goat  -----ttct------------------t---ag-agc
                        Horse  -----ttt-------------------a---aa-agt
             White rhinoceros  -----ttt-------------------t---aa-agt
                          Cat  -----tttt------------------t---aa-agt
                          Dog  -----ttt-------------------t---aa-agt
                      Ferret   -----ttta------------------t---aa-agt
                        Panda  -----tttt------------------t---ca-agt
               Pacific walrus  -----tttt------------------t---aa-agt
                 Weddell seal  -----tttt------------------t---aa-agt
             Black flying-fox  -----ttt-------------------tttaaa-agt
                      Megabat  -----ttt-------------------tttaaa-agt
                Big brown bat  -----ttt-------------------t---aa-agt
         David's myotis (bat)  -----ttt-------------------t---aa-agt
                     Microbat  -----ttt-------------------t---aa-agt
                     Hedgehog  -----ttt-------------------t---aa-agt
                        Shrew  -----ttt-------------------t---ta-agt
              Star-nosed mole  -----ttt-------------------t---ac-agt
                     Elephant  -----tttt------------------c---ta-agt
          Cape elephant shrew  tgaggtttt------------------t---tt-tgc
                      Manatee  -----tttt------------------t---aa-att
             Cape golden mole  -----tttt------------------t---ca-agt
                       Tenrec  -----tttt------------------t---aa-agg
                     Aardvark  -----tttt------------------t---aa-agt
                    Armadillo  -----tttt------------------t---aa-agg
                      Opossum  -----tacc-----caaaaaaaatcaaa---ga-aag
              Tasmanian devil  -----tcca---------aaaaaaaaag---ga-aag
                      Wallaby  -----tacaaagaaaaagaaagaaaaaa---ga-aag
                     Platypus  ---------------------------a---aa-gat
                  Rock pigeon  -----tttt------------------t---at-aaa
                 Saker falcon  -----tttt------------------t---at-aaa
             Peregrine falcon  -----tttt------------------t---at-aaa
          Collared flycatcher  -----tttt------------------t---at-aaa
       White-throated sparrow  -----tttt------------------t---at-aaa
          Medium ground finch  -----tttt------------------t---ac-aaa
                  Zebra finch  -----tttt------------------t---at-aaa
           Tibetan ground jay  -----tttt------------------t---ataaaa
                   Budgerigar  -----ttct------------------t---ac-aaa
                       Parrot  -----tttt------------------t---ac-aaa
                Scarlet macaw  -----tttt------------------t---ac-aaa
                 Mallard duck  -----tttt------------------t---at-aaa
                      Chicken  -----tttt------------------t---gt-aaa
                       Turkey  -----tttt------------------t---gt-aaa
           American alligator  --------a------------------a---at-aaa
              Green seaturtle  -----cttt-------------------------aaa
               Painted turtle  -----cttt-------------------------aaa
     Chinese softshell turtle  -----cttt-------------------------aaa
       Spiny softshell turtle  -----catt-------------------------aaa
                       Lizard  -----tgtt------------------g---at-acg
                   Coelacanth  -----tttt------------------t---aa-agt
           Southern platyfish  -----ttat------------------c---a-----
                          Rat  =====================================
        Burton's mouthbreeder  -------------------------------------
                 Nile tilapia  -------------------------------------
          Pundamilia nyererei  -------------------------------------
                  Zebra mbuna  -------------------------------------
          Princess of Burundi  -------------------------------------
                  Spotted gar  -------------------------------------
                X. tropicalis  =====================================

Inserts between block 19 and 20 in window
B D               Coelacanth 314bp

Alignment block 20 of 126 in window, 15601138 - 15601177, 40 bps 
B D                     Human  gaa-----------------tcaaataaga-atacgtta-ttctttaatcctagagaa-c
B D                     Chimp  gaa-----------------tcaaataaga-atacgtta-ttctttaatcctagagaa-c
B D                   Gorilla  gaa-----------------tcaaataaga-aaacgtta-ttctttaatcctagagaa-c
B D                 Orangutan  aaa-----------------tcaaataaga-aaacgtta-ttctttaatcctagagaa-a
B D                    Gibbon  aca-----------------tcaaataaga-aaacgtta-ttctttaatcctagagaa-c
B D                    Rhesus  aaa-----------------tcaaataaga-aaacgtta-ttctttaatcctagagaa-c
B D       Crab-eating macaque  aaa-----------------tcaaataaga-aaacgtta-ttctttaatcctagagaa-c
B D                    Baboon  aaa-----------------tcaaataaga-aaacgtta-ttctttaatcctagagaa-c
B D              Green monkey  aaa-----------------tcaaataaga-aaacgtta-ttctttaatcctagagaa-c
B D                  Marmoset  aaa-----------------taaaataaga-aaacgtta-ttctttaattctaaagaa-c
B D           Squirrel monkey  aaa-----------------taaaataaga-aaacatta-ttctttaattctaaagaa-c
B D                  Bushbaby  aaa-----------------ttgaa--------acattg-ttcattaatcctagggaa-c
           Chinese tree shrew  -aa-----------------tcaaataaac-aaatgtta-ctcattaatcttagagaa-c
B D                  Squirrel  aaa-----------------acaaataaag-acatgtta-ttcattaatcctagaaaa-c
       Lesser Egyptian jerboa  aaa-----------------ccaaataaag-acatgtta-ttcattaatcctagaaaa-c
                 Prairie vole  aaa-----------------ctaaataaag-acatgtta-ttcattaatcctagaaaa-c
B D           Chinese hamster  aaa-----------------ctaaataaag-acatgtta-ttcattaatcctagaaaa-c
               Golden hamster  aaa-----------------ctaaataaag-acatgtta-ttcattaatcctagaaaa-c
B D                     Mouse  aaa-----------------ctaaataaag-acatgtta-ttcattaatcctagaaaa-c
B D            Naked mole-rat  aaa-----------------ccaaataaag-acatgtta-ttcattaatcctagaaaa-c
B D                Guinea pig  aaa-----------------ccaaataaag-acatgtta-ttcattaatcctagaaaa-c
                   Chinchilla  aaa-----------------ccaaataaag-acatgtta-ttcattaatcctagaaaa-c
             Brush-tailed rat  aaa-----------------ccaaataaag-acatgtta-ttcattaatcctaaaaaa-c
B D                    Rabbit  aaa-----------------ttaaataaag-aaacgtta-ttcattaatcctagagaa-a
B D                      Pika  aaa-----------------tcaaat-----aaacgtta-ctcattattcctggagaa-g
B D                    Alpaca  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagga-t
               Bactrian camel  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagga-t
B D                   Dolphin  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
                 Killer whale  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
             Tibetan antelope  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
B D                       Cow  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
B D                     Sheep  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
                Domestic goat  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
B D                     Horse  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
B D          White rhinoceros  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
B D                       Cat  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
B D                       Dog  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
B D                   Ferret   aaa-----------------tcaaataaac-aaacgtta-ttcattaatcctagagaa-t
B D                     Panda  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagaaaa-t
               Pacific walrus  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
                 Weddell seal  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
             Black flying-fox  aaa-----------------tcaaataaac-aaatgtta-ctcattaatctcagagaa-t
B D                   Megabat  aaa-----------------tcaaataaac-aaatgtta-ctcattaatctcagagaa-t
                Big brown bat  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcccagagaa-t
         David's myotis (bat)  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcccagagaa-t
B D                  Microbat  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcccagagaa-t
B D                  Hedgehog  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
B D                     Shrew  aaa-----------------ta----aaac-aagtgtta-ttcattaatcctagaaaa-t
              Star-nosed mole  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagagaa-t
B D                  Elephant  aaa-----------------taaaataaac-aaatgttattttgtcaatcctagagaa-c
          Cape elephant shrew  aaa-----------------gcaaataaac-aaatgtta-ttcattaatcctagaaaacc
B D                   Manatee  aaa-----------------tcaaataaac-aaatgtta-tttgtcaatcctagagaa-c
             Cape golden mole  aaa-----------------ctaaataaac-aaatgtta-ttcattaatcctagcgaa-c
B D                    Tenrec  aaa-----------------ccaaataaac-aaatgtta-ttcattaatcctagagaa-c
                     Aardvark  aaa-----------------tcaaataaac-aagtgtta-tccattaatcctagaaag-c
B D                 Armadillo  aaa-----------------tcaaataaac-aaatgtta-ttcattaatcctagaga--c
B D                   Opossum  aaa-----------------tcaggtaaat-aaatgtta-attattaacttaaacgaa-c
B D           Tasmanian devil  aaa-----------------tcaggtaaac-aaatgtta-ataattaacttgaaagaa-c
B D                   Wallaby  aaa-----------------tcaggtaaac-aaatgtta-attattaacttgaaagaa-c
B D                  Platypus  --g-----------------tcaaataaac-aaatgtta-attattaacttcagagaa-c
  D               Rock pigeon  aag-----------------ccaaataaac-aaaagtca-attattaactttggaaaa-a
  D              Saker falcon  aag-----------------ccaaataaac-aaaagtca-atgattaactttggaaaa-a
  D          Peregrine falcon  aag-----------------ccaaataaac-aaaagtca-atgattaactttggaaaa-a
  D       Collared flycatcher  aag-----------------ccaaataaac-aaaagtca-atgattaactttggaaaa-a
  D    White-throated sparrow  aag-----------------ccaaataaac-aaaagtca-atgattaactttggaaaa-a
B D       Medium ground finch  aag-----------------ccaaataaac-aaaagtca-atgattaactttggaaaa-a
B D               Zebra finch  aag-----------------ccaaataaac-aaatgtca-ataattaactttggaaaa-a
           Tibetan ground jay  aag-----------------ccaaataaac-aaaagtca-attattaactttggaaaa-a
B D                Budgerigar  aag-----------------acaaataaac-aaaagtca-attattaactttgggaaa-a
  D                    Parrot  aag-----------------acaaataaac-aaaagtca-attattaactttgggaaa-a
  D             Scarlet macaw  aag-----------------acaaataaac-aaaagtca-attattaacttcgggaaa-a
  D              Mallard duck  aag-----------------tcaaataaac-agaagtca-atgattaactttggaa-a-a
B D                   Chicken  aag-----------------ccaaataaac-aaaagtca-atgattaactttggaaga-a
B D                    Turkey  aag-----------------tcaaataaac-aaaagtca-atgattaactttggaaga-a
B D        American alligator  aac-----------------tcaaataaac-aaaagtca-atgattaactttgaagaa-a
  D           Green seaturtle  aag-----------------gcaaataaac-agaagtta-atagttaactctggagaa-a
  D            Painted turtle  aag-----------------gcaaataaac-aaaagtta-atgattaacttcggagaa-a
  D  Chinese softshell turtle  aaa-----------------gcaaataaac-----gtta-atggttaactttggagaa-g
  D    Spiny softshell turtle  aag-----------------gcaaataaac-----gtta-atggttaactttggagaa-g
B D                    Lizard  tggggtttttccttcttcttccaagcatgctaacagtga-ataattaacttaaaagaa-g
           Southern platyfish  gat-----------------tca---aaac-agatatct-c------attctggaaga-c
B D                       Rat  ============================================================
       Burton's mouthbreeder  ------------------------------------------------------------
B D              Nile tilapia  ------------------------------------------------------------
         Pundamilia nyererei  ------------------------------------------------------------
                 Zebra mbuna  ------------------------------------------------------------
         Princess of Burundi  ------------------------------------------------------------
                 Spotted gar  ------------------------------------------------------------
B D                Coelacanth  ============================================================
B D             X. tropicalis  ============================================================

Alignment block 21 of 126 in window, 15601178 - 15601183, 6 bps 
B D                     Human  cttacc
B D                     Chimp  cttacc
B D                   Gorilla  cttacc
B D                 Orangutan  cttacc
B D                    Gibbon  cttacc
B D                    Rhesus  cttacc
B D       Crab-eating macaque  cttacc
B D                    Baboon  cttacc
B D              Green monkey  cttacc
B D                  Marmoset  cttagc
B D           Squirrel monkey  cttagc
B D                  Bushbaby  ctca-c
           Chinese tree shrew  cttagc
B D                  Squirrel  cttagc
       Lesser Egyptian jerboa  cttagc
                 Prairie vole  cttagc
B D           Chinese hamster  cttagc
               Golden hamster  cttagc
B D                     Mouse  cttagc
B D            Naked mole-rat  cttagc
B D                Guinea pig  cttagc
                   Chinchilla  cttagc
             Brush-tailed rat  ctcagt
B D                    Rabbit  tttagt
B D                      Pika  ctcagt
B D                    Alpaca  catagc
               Bactrian camel  catagc
B D                   Dolphin  catagc
                 Killer whale  catagc
             Tibetan antelope  cacagc
B D                       Cow  cacagc
B D                     Sheep  cacagc
                Domestic goat  cacagc
B D                     Horse  catagc
B D          White rhinoceros  catagc
B D                       Cat  catatc
B D                       Dog  catagc
B D                   Ferret   tatagt
B D                     Panda  catagc
               Pacific walrus  catagc
                 Weddell seal  catagc
             Black flying-fox  catcat
B D                   Megabat  catcat
                Big brown bat  catagc
         David's myotis (bat)  catagc
B D                  Microbat  catagc
B D                  Hedgehog  catgac
B D                     Shrew  cataac
              Star-nosed mole  cataat
B D                  Elephant  cataac
          Cape elephant shrew  cataac
B D                   Manatee  catagc
             Cape golden mole  catagc
B D                    Tenrec  catagc
                     Aardvark  caccgc
B D                 Armadillo  catagc
B D                   Opossum  cataac
B D           Tasmanian devil  cataac
B D                   Wallaby  cataac
B D                  Platypus  cataac
  D               Rock pigeon  cataat
  D              Saker falcon  cataat
  D          Peregrine falcon  cataat
  D       Collared flycatcher  cataat
  D    White-throated sparrow  cataat
B D       Medium ground finch  cataat
B D               Zebra finch  cataat
           Tibetan ground jay  cataat
B D                Budgerigar  cataat
  D                    Parrot  cataat
  D             Scarlet macaw  cataat
  D              Mallard duck  cataat
B D                   Chicken  cattat
B D                    Turkey  cattat
B D        American alligator  cataat
  D           Green seaturtle  cataat
  D            Painted turtle  cataat
  D  Chinese softshell turtle  cataat
  D    Spiny softshell turtle  cataat
B D                    Lizard  cttaag
B D                Coelacanth  ctttct
           Southern platyfish  tttgtc
B D                       Rat  ======
       Burton's mouthbreeder  ------
B D              Nile tilapia  ------
         Pundamilia nyererei  ------
                 Zebra mbuna  ------
         Princess of Burundi  ------
                 Spotted gar  ------
B D             X. tropicalis  ======

Alignment block 22 of 126 in window, 15601184 - 15601221, 38 bps 
B D                     Human  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D                     Chimp  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D                   Gorilla  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D                 Orangutan  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D                    Gibbon  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ctggtactt--
B D                    Rhesus  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D       Crab-eating macaque  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D                    Baboon  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D              Green monkey  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D                  Marmoset  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D           Squirrel monkey  t-ctcct-gtca-ctttat-g--gccaaat-caaaa----ccggtactt--
B D                  Bushbaby  t-gtcct-ttca-ctctct-g--gccaaat-cagag----cttgtgcat--
           Chinese tree shrew  t-ttcct-agta-ctttgt-g--acccaat-caaaa----ctttcatat--
B D                  Squirrel  t-ctcct-agca-ctttat-g--gctaaat-caaaa----cttgtacat--
       Lesser Egyptian jerboa  t-ctcct-agca-ttttat-g--gccaaat-caaaa----cttggacat--
                 Prairie vole  t-ctgct-agta-ttttat-g--gccaaat-caaaa----ctcggacat--
B D           Chinese hamster  t-ctgct-aaca-ttttat-g--gccaaat-caaaa----cttggacat--
               Golden hamster  t-ctgct-aacg-ttttat-g--accaaat-caaaa----cttggactt--
B D                     Mouse  t-ttgct-aaca-ttttat-g--gccaaat-caaaa----cctggacat--
B D            Naked mole-rat  t-cccct-agta-ctttac-a--gccaaat-c-aaa----cttgtgcat--
B D                Guinea pig  t-cccct-agta-ctttac-a--gccaaat-caaaa----cttgcgcat--
                   Chinchilla  t-cccct-agta-ctttac-a--gccaaat-caaaa----cttgtgcag--
             Brush-tailed rat  tccccct-agta-ttttac-a--gccaaat-c-aga----cttgtgcat--
B D                    Rabbit  t-ctctt-agaa-cattac-a--gccaaat-caaaa----cttgtacat--
B D                      Pika  t-ctcct-ag-a-ctttac-a--gccaaat-caaaa----cttgtacat--
B D                    Alpaca  c-ctcct-agca-ttttat-g--gccaaat-caaaa----cttgtacat--
               Bactrian camel  c-ctcct-agca-ttttat-g--gccaaat-caaaa----cttgtacat--
B D                   Dolphin  t-ctc-----aaattttat-g--gccaaat-caaaa----cgtgtccat--
                 Killer whale  t-ctc-----aaattttat-g--gccaaat-caaaa----cttgtccat--
             Tibetan antelope  t-cttct-tgcatttttat-g--gccaaat-caaaa----cttgtacat--
B D                       Cow  t-cttct-tgcatttttat-g--gccaaat-caaaa----cttgtacat--
B D                     Sheep  t-cttct-tgcatttttat-g--gccaaat-caaaa----cttgtacat--
                Domestic goat  t-cttct-tgcatttttat-g--gccaaat-caaaa----cttgtacat--
B D                     Horse  t-ctcct-agca-ttttac-g--gccaaat-caaaa----cttgtacat--
B D          White rhinoceros  t-ctccc-agca-ttttac-g--tccaaat-caaaa----cttgtacat--
B D                       Cat  c-ctcct-agta-ttttat-g--gccagat-cagaa----cttgcacat--
B D                       Dog  t-ctcct-agca-ttttat-a--gccagat-cctaa----cttgcacat--
B D                   Ferret   t-ctcct-agta-ttttat-g--gccagat-cagaa----cttgcacat--
B D                     Panda  t-ctcct-agta-ttttat-g--gcgagat-cagaa----cttgcacat--
               Pacific walrus  t-ctcct-agta-ttttat-g--gccagat-cagaa----cttgcacat--
                 Weddell seal  t-ctcct-agta-ttttat-g--gccagat-cagaa----cttgcacat--
             Black flying-fox  t-ctcct-agc--ttttat-g--gccaagt-caaaa----cttgtatat--
B D                   Megabat  t-ctcct-agc--ttttat-g--gccaagt-caaaa----cttgtatat--
                Big brown bat  t-ttcct-agc--ttttat-g--gccaaat-caaaa----cttgtacat--
         David's myotis (bat)  t-ttcct-agc--ttttat-g--gccaaat-caaaa----cttgtacat--
B D                  Microbat  t-ttcct-agc--ttttat-g--gccaaat-caaaa----cttatacat--
B D                  Hedgehog  t-ctctt-agca-ctttat-g--accaaat-caaaa----cttgtagat--
B D                     Shrew  t-cactt-aaca-ttttat-a--tccaaag-caaag----cttgtatat--
              Star-nosed mole  t-cctct-tgca-cattat-g--gccaaat-caaaa----cttgtacat--
B D                  Elephant  t-ctctc-agca-ctttat-g--gacaaat-caaaa----tgtttatac--
          Cape elephant shrew  t-ctccc-agca-ctttat-g--accaact-caaaa----cttttatat--
B D                   Manatee  t-ctccc-ggca-ctttatgg--gacaaat-caaaa----tgtttacac--
             Cape golden mole  t-ctcct-agca-ctttat-g--gccaaat-caaaa----tttttacat--
B D                    Tenrec  t-ctcccaagca-ctttac-g--gccaaat-caaaa----gttttacat--
                     Aardvark  a-ctcct-agca-ctttat-g--gccaaat-caaaa----cttttccat--
B D                 Armadillo  t-ctcct-ggca-ttttat-g--gccaaat-aaaaa----attctacat--
B D                   Opossum  a-ctagt-agca-ttttat-g--atcttat-agaaa---gcttttactt--
B D           Tasmanian devil  a-ctagt-agca-ttttat-a--atcttat-caaaa---gcttttactt--
B D                   Wallaby  a-ctagt-agca-ttttac-g--atcttat-cgaaa---gcttttactt--
B D                  Platypus  a-ctagt-agca-ttttat-g--gacttttacaaag----cttttactt--
  D               Rock pigeon  tactcct-gcca-ttttat-g--gccttct-tatgaagggcttttactt--
  D              Saker falcon  tactcct-gcca-ttttat-g--gccttct-tataaaaggcttttactt--
  D          Peregrine falcon  tactcct-gcca-ttttat-g--gccttct-tataaaaggcttttactt--
  D       Collared flycatcher  tactcct-gcca-ttttat-g--gccttct-tataaaaggcttttactt--
  D    White-throated sparrow  tactcct-gcca-ttttat-g--gccttct-tataaaaggcttttactt--
B D       Medium ground finch  tactcct-gcca-ttttat-g--gccttct-tataaaaggcttttactt--
B D               Zebra finch  tactcct-gcca-ttttat-g--gccttct-tataaaaggcttttactt--
           Tibetan ground jay  tactcct-gcca-ttttat-a--gccttct-tataaaaggcttttagtt--
B D                Budgerigar  tactgct-gcca-ttttat-g--gccttct-tataaaaggcttttactt--
  D                    Parrot  tactgct-tcca-ttttat-g--gccttct-tataaaaggcttttactt--
  D             Scarlet macaw  taccgct-gctg-ttttat-g--gccttct-tataaaaggcttttactt--
  D              Mallard duck  tactcct-acca-ttttat-g--gccttct-tataaaaggcttttactt--
B D                   Chicken  tactgct-acca-ttttat-g--gccttct-tataaaaggcttttactt--
B D                    Turkey  tactcct-acca-ttttat-g--gccttct-tataaaaggcttttactt--
B D        American alligator  tactagt-agca-ttttat-g--accttct-tataaaaggcttttactt--
  D           Green seaturtle  tactagt-agca-ttttat-g--gtcttct-tataaaaggcttttactt--
  D            Painted turtle  tactagt-agca-ttttat-g--gtcttct-tataaaaggcttttactt--
  D  Chinese softshell turtle  tactagt-agca-ttttat-g--gtcttct-tataaaaggcttttactt--
  D    Spiny softshell turtle  tactagt-agca-ttttat-g--gtcttct-tataaaaggcttttactt--
B D                    Lizard  tgctttt-agta-ctttac-a--ac--tct-tttgaaaggcttttccat--
B D                Coelacanth  t-ttttt-ttaa-attcat-gcatctctag-cagag----ctgatctaatt
B D                       Rat  ===================================================
       Burton's mouthbreeder  ---------------------------------------------------
B D              Nile tilapia  ---------------------------------------------------
         Pundamilia nyererei  ---------------------------------------------------
                 Zebra mbuna  ---------------------------------------------------
         Princess of Burundi  ---------------------------------------------------
                 Spotted gar  ---------------------------------------------------
B D             X. tropicalis  ===================================================

Inserts between block 22 and 23 in window
B D                  Dolphin 284bp

Alignment block 23 of 126 in window, 15601222 - 15601234, 13 bps 
B D                     Human  ttggttaatat-tt
B D                     Chimp  ttggttaatat-tt
B D                   Gorilla  ttggttaatat-tt
B D                 Orangutan  ttggttaatat-tt
B D                    Gibbon  ttggttaatat-tt
B D                    Rhesus  ttggttaatgt-tt
B D       Crab-eating macaque  ttggttaatgt-tt
B D                    Baboon  ttggttaatgt-tt
B D              Green monkey  ttggttaatgt-tt
B D                  Marmoset  ttggttaatat-tt
B D           Squirrel monkey  tcggttaatat-tt
B D                  Bushbaby  ttggttaatatgcc
           Chinese tree shrew  ttggttaatat-gt
B D                  Squirrel  ttggttaatat-at
       Lesser Egyptian jerboa  ttggttaatat-gt
                 Prairie vole  ttggttaatat-gt
B D           Chinese hamster  tcagttaatat-gt
               Golden hamster  tcagttaatat-at
B D                     Mouse  ttagttaatat-gt
B D            Naked mole-rat  ttggttaatat-gt
B D                Guinea pig  ttggttaatat-gt
                   Chinchilla  ttggttaatat-gt
             Brush-tailed rat  ttggttaatat-gt
B D                    Rabbit  tttgttaatat-gt
B D                      Pika  tttgttaataa-gt
B D                    Alpaca  ttggttaatat-gt
               Bactrian camel  ttggttaatat-gt
B D                   Dolphin  ttgcttagtat-gt
                 Killer whale  ttgcttagtat-gt
             Tibetan antelope  ttggttaatat-gt
B D                       Cow  ttggttaatat-gt
B D                     Sheep  ttggttaatat-gt
                Domestic goat  ttggttaatat-gt
B D                     Horse  ttggttaatat-gt
B D          White rhinoceros  tcggttaatat-gt
B D                       Cat  ttggttaatat-gt
B D                       Dog  ttggttaatat-gt
B D                   Ferret   ttggttaatat-gt
B D                     Panda  ttggttaatat-gt
               Pacific walrus  ttagttaatat-gt
                 Weddell seal  ttagttaatat-gt
             Black flying-fox  ttggttaataa-gt
B D                   Megabat  ttggttaataa-gt
                Big brown bat  gtggttaataa-gt
         David's myotis (bat)  ttggttaataa-gt
B D                  Microbat  ttggttaataa-gt
B D                  Hedgehog  ttggttaatat-gt
B D                     Shrew  ttggtcaatat-ga
              Star-nosed mole  ttggttaatat-gt
B D                  Elephant  atggttaatat-gt
          Cape elephant shrew  atggttaatct-gt
B D                   Manatee  atggttaatat-gt
             Cape golden mole  atggttaatat-gt
B D                    Tenrec  acggttaatat-gt
                     Aardvark  atggttaatat-gt
B D                 Armadillo  ttggttaatat-gt
B D                   Opossum  ttagttaatat-tt
B D           Tasmanian devil  ttagttaatat-tt
B D                   Wallaby  ttagttaatat-tt
B D                  Platypus  tgggttaatat-tt
  D               Rock pigeon  ttagttaatgt-tt
  D              Saker falcon  ttggttaatgt-tt
  D          Peregrine falcon  ttggttaatgt-tt
  D       Collared flycatcher  ttggttaatgt-tt
  D    White-throated sparrow  ttggttaatgt-tt
B D       Medium ground finch  ttggttaatgt-tt
B D               Zebra finch  ttggttaatgt-tt
           Tibetan ground jay  ttggttaatgt-tt
B D                Budgerigar  ttggttaatgt-tt
  D                    Parrot  ttggttaatgt-tt
  D             Scarlet macaw  ttggttaatgt-tt
  D              Mallard duck  ttggttaatgt-tt
B D                   Chicken  ttagttaatgt-tt
B D                    Turkey  ttagttaatgt-tt
B D        American alligator  ttagttaatat-tt
  D           Green seaturtle  ttagttaatat-tt
  D            Painted turtle  ttagttaatat-tt
  D  Chinese softshell turtle  ttagttaatat-tt
  D    Spiny softshell turtle  ttagttaatat-tt
B D                    Lizard  acagttaatat-tt
B D                Coelacanth  ttagttaatat-tt
B D                       Rat  ==============
       Burton's mouthbreeder  --------------
B D              Nile tilapia  --------------
         Pundamilia nyererei  --------------
                 Zebra mbuna  --------------
         Princess of Burundi  --------------
                 Spotted gar  --------------
B D             X. tropicalis  ==============

Inserts between block 23 and 24 in window
B D                   Lizard 18954bp

Alignment block 24 of 126 in window, 15601235 - 15601249, 15 bps 
B D                     Human  tcc--t-agaaagc-tgtt
B D                     Chimp  tcc--t-agaaagc-tgtt
B D                   Gorilla  tcc--t-agaaagc-tgtt
B D                 Orangutan  tcc--t-agaaagc-tgtt
B D                    Gibbon  tcc--t-agaaagc-tgtt
B D                    Rhesus  tcc--t-agaaagc-tgtt
B D       Crab-eating macaque  tcc--t-agaaagc-tgtt
B D                    Baboon  tcc--t-agaaagc-tgtt
B D              Green monkey  tcc--t-agaaagc-tgtt
B D                  Marmoset  tcc--t-agaaagc-tgtt
B D           Squirrel monkey  tcc--t-acaaagc-tgtt
B D                  Bushbaby  tct--t-aaaaatc-tgtt
           Chinese tree shrew  tcc--t-aaaaagt-tgtt
B D                  Squirrel  tcc--c-cccaaac-tgtt
       Lesser Egyptian jerboa  tcc--t-taacagc-tgtt
                 Prairie vole  tcc--t-taaaagc-tgtt
B D           Chinese hamster  tcc--t-taaaagc-tgtt
               Golden hamster  tcc--t-taaaagc-tgtt
B D                     Mouse  tcc--t-taaaagc-tgtt
B D            Naked mole-rat  tcc--t-aaaaagc-tgtt
B D                Guinea pig  tcc--t-aaaaagc-tgtt
                   Chinchilla  tcc--t-aaaaagc-tgtt
             Brush-tailed rat  tcc--t-aaaaagc-tgtt
B D                    Rabbit  ccc--t-aaaaatc-tgtt
B D                      Pika  tcc--t-aaaaatc-tgtt
B D                    Alpaca  tcc--t-taaaatc-tgtt
               Bactrian camel  tcc--t-taaaatc-tgtt
B D                   Dolphin  tcc--t-taaaatc-tgtt
                 Killer whale  tcc--t-taaaatc-tgtt
             Tibetan antelope  tcc--t-taaaatc-tgtt
B D                       Cow  tcc--t-taaaatc-tgtt
B D                     Sheep  tcc--t-taaaatc-tgtt
                Domestic goat  tcc--t-taaaatc-tgtt
B D                     Horse  tcc--t-aaaaaac-tgtt
B D          White rhinoceros  tcc--t-aaaaaac-tgtt
B D                       Cat  tcc--t-aaaaagc-tgtt
B D                       Dog  tcc--t-aaaaagc-tgtt
B D                   Ferret   tcc--taaaaaagc-tgtt
B D                     Panda  tct--t-aaaaagc-tatt
               Pacific walrus  tcc--t-aaaaagc-tgtt
                 Weddell seal  tcc--t-aaaaagc-tgtt
             Black flying-fox  tcc--t-aaaaagc-tgtt
B D                   Megabat  tcc--t-aaaaagc-tgtt
                Big brown bat  tcc--t-aaaaagc-tgtt
         David's myotis (bat)  tcc--t-aaaaagc-tgtt
B D                  Microbat  tcc--t-aaaaagc-tgtt
B D                  Hedgehog  tcc--t-aagaagc-tgct
B D                     Shrew  tccttt-taaaaat-ggtt
              Star-nosed mole  tcc--t-aaaaagc-tgtt
B D                  Elephant  tcc--t-aaaaagcttttt
          Cape elephant shrew  tac--t-aagaagc-tgtt
B D                   Manatee  tcc--t-aaaaagc-tttt
             Cape golden mole  tac--taaaaaagc-tgtt
B D                    Tenrec  tac--t-aaaaagc-tgtt
                     Aardvark  tac--c-aaaaagc-tgtt
B D                 Armadillo  tcc--t-aaaaagc-tgtt
B D                   Opossum  ccc--t-agaaagc-tgtc
B D           Tasmanian devil  ccc--t-agaaagc-tgtc
B D                   Wallaby  ctc--t-agaaagc-tgtc
B D                  Platypus  ccc--t-aaaatgc-tgtc
  D               Rock pigeon  ccc--a-aatgtgc-tgtc
  D              Saker falcon  ccc--a-aatgtgc-tgtc
  D          Peregrine falcon  ccc--a-aatgtgc-tgtc
  D       Collared flycatcher  ccc--a-aatgtgc-tgtc
  D    White-throated sparrow  ccc--a-aatgtgc-tgtc
B D       Medium ground finch  ccc--a-aatgtgc-tgtc
B D               Zebra finch  ccc--a-aatgtgc-tgtc
           Tibetan ground jay  ccc--a-agtgtgc-tgtc
B D                Budgerigar  ccc--a-aatgtgc-tgtc
  D                    Parrot  ccc--a-aatgtgc-tgtc
  D             Scarlet macaw  ccc--a-aatgtgc-tgtc
  D              Mallard duck  ccc--a-aatgcgc-tgtc
B D                   Chicken  ccc--a-agtgtgc-tgtc
B D                    Turkey  ccc--a-agtgtgc-tgtc
B D        American alligator  ccc--c-agtgtgc-tatc
  D           Green seaturtle  ccc--c-agtatgc-tgtc
  D            Painted turtle  ccc--c-agtatgc-tgtc
  D  Chinese softshell turtle  ccc--c-agtatgc-tgtc
  D    Spiny softshell turtle  ccc--c-agtatgc-tgtc
B D                Coelacanth  ttc--t-agggagc-tgct
B D                       Rat  ===================
       Burton's mouthbreeder  -------------------
B D              Nile tilapia  -------------------
         Pundamilia nyererei  -------------------
B D                    Lizard  ===================
                 Zebra mbuna  -------------------
         Princess of Burundi  -------------------
                 Spotted gar  -------------------
B D             X. tropicalis  ===================

Inserts between block 24 and 25 in window
B D               Coelacanth 57949bp

Alignment block 25 of 126 in window, 15601250 - 15601257, 8 bps 
B D                     Human  aaagat----------------ac
B D                     Chimp  aaagat----------------ac
B D                   Gorilla  aaagat----------------ac
B D                 Orangutan  aaagat----------------ac
B D                    Gibbon  aaagat----------------ac
B D                    Rhesus  aaagat----------------ac
B D       Crab-eating macaque  aaagat----------------ac
B D                    Baboon  aaagat----------------ac
B D              Green monkey  aaagat----------------ac
B D                  Marmoset  aaagat----------------ac
B D           Squirrel monkey  aaagat----------------ac
B D                  Bushbaby  aaagat----------------at
           Chinese tree shrew  aaatat----------------at
B D                  Squirrel  aaatat----------------ac
       Lesser Egyptian jerboa  aaagat----------------ag
                 Prairie vole  aaagtt----------------ac
B D           Chinese hamster  aaagat----------------ac
               Golden hamster  aaagat----------------ac
B D                     Mouse  aaagat----------------ac
B D            Naked mole-rat  gaaggt----------------ac
B D                Guinea pig  aaaagt----------------ac
                   Chinchilla  aaaggt----------------ac
             Brush-tailed rat  aaaggt----------------ac
B D                    Rabbit  aaagat----------------ac
B D                      Pika  aaagat----------------ac
B D                    Alpaca  aaagat----------------ac
               Bactrian camel  aaagat----------------ac
B D                   Dolphin  aaagat----------------ac
                 Killer whale  aaagat----------------ac
             Tibetan antelope  aaagat----------------ac
B D                       Cow  aaagat----------------ac
B D                     Sheep  aaagat----------------ac
                Domestic goat  aaagat----------------ac
B D                     Horse  aaagat----------------ac
B D          White rhinoceros  aaagat----------------ac
B D                       Cat  aaagat----------------ac
B D                       Dog  aaagat----------------ac
B D                   Ferret   aaagat----------------ac
B D                     Panda  aaagat----------------ac
               Pacific walrus  aaagat----------------ac
                 Weddell seal  aaagat----------------ac
             Black flying-fox  aagaat----------------ac
B D                   Megabat  aagaat----------------ac
                Big brown bat  aaaaat----------------ac
         David's myotis (bat)  aaaaat----------------ac
B D                  Microbat  aaaaat----------------ac
B D                  Hedgehog  aaacat----------------ac
B D                     Shrew  taaaatgggggctagagtgatagt
              Star-nosed mole  aaagat----------------ac
B D                  Elephant  aaagat----------------at
          Cape elephant shrew  aaagat----------------cc
B D                   Manatee  aaagat----------------at
             Cape golden mole  aaagat----------------ac
B D                    Tenrec  taaaat----------------gt
                     Aardvark  aaagat----------------ac
B D                 Armadillo  aaagat----------------at
B D                   Opossum  aaagat----------------ac
B D           Tasmanian devil  aaagat----------------at
B D                   Wallaby  aaagat----------------ac
B D                  Platypus  aatgat----------------ac
  D               Rock pigeon  aatgat----------------ac
  D              Saker falcon  aatgat----------------ac
  D          Peregrine falcon  aatgat----------------ac
  D       Collared flycatcher  aatgat----------------ac
  D    White-throated sparrow  aatgat----------------ac
B D       Medium ground finch  aatgat----------------ac
B D               Zebra finch  aatgat----------------ac
           Tibetan ground jay  aatgat----------------ac
B D                Budgerigar  aatgat----------------ac
  D                    Parrot  aatgat----------------ac
  D             Scarlet macaw  aatgat----------------ac
  D              Mallard duck  aatgat----------------ac
B D                   Chicken  aatgat----------------ac
B D                    Turkey  aatgat----------------ac
B D        American alligator  agtgat----------------at
  D           Green seaturtle  catgat----------------ac
  D            Painted turtle  aatgat----------------ac
  D  Chinese softshell turtle  aatgat----------------ac
  D    Spiny softshell turtle  aatgat----------------ag
B D                       Rat  ========================
       Burton's mouthbreeder  ------------------------
B D              Nile tilapia  ------------------------
         Pundamilia nyererei  ------------------------
B D                    Lizard  ========================
                 Zebra mbuna  ------------------------
         Princess of Burundi  ------------------------
                 Spotted gar  ------------------------
B D                Coelacanth  ========================
B D             X. tropicalis  ========================

Inserts between block 25 and 26 in window
  D            Scarlet macaw 9556bp
B D                  Chicken 13069bp
B D                   Turkey 8668bp
B D       American alligator 3bp
  D          Green seaturtle 3bp
  D           Painted turtle 3bp
  D Chinese softshell turtle 3bp
  D   Spiny softshell turtle 3bp

Alignment block 26 of 126 in window, 15601258 - 15601258, 1 bps 
B D                     Human  a
B D                     Chimp  a
B D                   Gorilla  a
B D                 Orangutan  a
B D                    Gibbon  a
B D                    Rhesus  a
B D       Crab-eating macaque  a
B D                    Baboon  a
B D              Green monkey  a
B D                  Marmoset  a
B D           Squirrel monkey  a
B D                  Bushbaby  a
           Chinese tree shrew  a
B D                  Squirrel  a
       Lesser Egyptian jerboa  a
                 Prairie vole  a
B D           Chinese hamster  a
               Golden hamster  a
B D                     Mouse  a
B D            Naked mole-rat  a
B D                Guinea pig  a
                   Chinchilla  a
             Brush-tailed rat  a
B D                    Rabbit  a
B D                    Alpaca  a
               Bactrian camel  a
B D                   Dolphin  a
                 Killer whale  a
             Tibetan antelope  a
B D                       Cow  a
B D                     Sheep  a
                Domestic goat  a
B D                     Horse  a
B D          White rhinoceros  a
B D                       Cat  a
B D                       Dog  a
B D                   Ferret   a
B D                     Panda  a
               Pacific walrus  a
                 Weddell seal  a
             Black flying-fox  c
B D                   Megabat  c
                Big brown bat  a
         David's myotis (bat)  a
B D                  Microbat  a
B D                  Hedgehog  a
B D                     Shrew  a
              Star-nosed mole  a
B D                  Elephant  g
          Cape elephant shrew  c
B D                   Manatee  g
             Cape golden mole  t
B D                    Tenrec  c
                     Aardvark  c
B D                 Armadillo  a
B D                   Opossum  a
B D           Tasmanian devil  a
B D                   Wallaby  a
B D                  Platypus  a
  D               Rock pigeon  a
  D              Saker falcon  a
  D          Peregrine falcon  a
  D       Collared flycatcher  a
  D    White-throated sparrow  a
B D       Medium ground finch  a
B D               Zebra finch  a
           Tibetan ground jay  a
B D                Budgerigar  a
  D                    Parrot  a
  D              Mallard duck  a
B D                      Pika  -
B D                       Rat  =
       Burton's mouthbreeder  -
B D              Nile tilapia  -
         Pundamilia nyererei  -
  D             Scarlet macaw  =
B D                    Lizard  =
                 Zebra mbuna  -
  D           Green seaturtle  =
         Princess of Burundi  -
  D  Chinese softshell turtle  =
  D            Painted turtle  =
                 Spotted gar  -
  D    Spiny softshell turtle  =
B D                Coelacanth  =
B D                    Turkey  =
B D                   Chicken  =
B D             X. tropicalis  =
B D        American alligator  =

Inserts between block 26 and 27 in window
  D              Rock pigeon 15038bp
  D             Saker falcon 9193bp
  D         Peregrine falcon 9334bp
  D      Collared flycatcher 16760bp
  D   White-throated sparrow 9401bp
B D      Medium ground finch 14161bp
B D              Zebra finch 14232bp
          Tibetan ground jay 14470bp
B D               Budgerigar 14334bp
  D                   Parrot 9782bp
  D             Mallard duck 2bp

Alignment block 27 of 126 in window, 15601259 - 15601266, 8 bps 
B D                     Human  cggaaa---------a--t-
B D                     Chimp  cggaaa---------a--t-
B D                   Gorilla  aggaaa---------a--t-
B D                 Orangutan  tggaaa---------a--t-
B D                    Gibbon  cggaaa---------a--t-
B D                    Rhesus  tgggaa---------a--t-
B D       Crab-eating macaque  tgggaa---------a--t-
B D                    Baboon  tgggaa---------a--t-
B D              Green monkey  tgggaa---------a--t-
B D                  Marmoset  cggaaa---------a--t-
B D           Squirrel monkey  tggaaa---------a--t-
B D                  Bushbaby  ctgaag---------a--t-
           Chinese tree shrew  ctgaag---------g--t-
B D                  Squirrel  ctgagg---------g--t-
       Lesser Egyptian jerboa  ctgag----------g--t-
                 Prairie vole  ctgtgga--------t--t-
B D           Chinese hamster  ctgtggg--------t--t-
               Golden hamster  ctgtgtg--------t--t-
B D                     Mouse  ctggaggaggagggtg--t-
B D            Naked mole-rat  ctgagg---------g--t-
B D                Guinea pig  cagagg---------g--t-
                   Chinchilla  ctgagg---------g--t-
             Brush-tailed rat  ctgagg---------g--t-
B D                    Rabbit  ctgaaa---------g--t-
B D                      Pika  ----aa---------g--t-
B D                    Alpaca  ctgaag---------g--t-
               Bactrian camel  ctgaag---------g--t-
B D                   Dolphin  ctgaag---------g--t-
                 Killer whale  ctgaag---------g--t-
             Tibetan antelope  ctgaag---------a--t-
B D                       Cow  ctgaag---------a--t-
B D                     Sheep  ctgaag---------a--t-
                Domestic goat  ctgaag---------a--t-
B D                     Horse  ctgaag---------g--t-
B D          White rhinoceros  ctgaaa---------g--t-
B D                       Cat  ctgaag---------g--t-
B D                       Dog  ctgaag---------g--t-
B D                   Ferret   ctaaag---------g--t-
B D                     Panda  ctgaag---------g--t-
               Pacific walrus  ctgaag---------g--t-
                 Weddell seal  ctgaag---------g--t-
             Black flying-fox  ctgaag---------g--t-
B D                   Megabat  ctgaag---------g--t-
                Big brown bat  ctgaag---------g--t-
         David's myotis (bat)  ctgaag---------g--t-
B D                  Microbat  ctgaag---------g--t-
B D                  Hedgehog  ctgaaa---------a--t-
B D                     Shrew  tggaaa---------g--t-
              Star-nosed mole  ctgaaa---------g--t-
B D                  Elephant  ctgaag---------a--t-
          Cape elephant shrew  ctgaag---------c--t-
B D                   Manatee  ctgaag---------g--a-
             Cape golden mole  ctgaac---------g--t-
B D                    Tenrec  ctgaaa---------g--t-
                     Aardvark  ctgaag---------g--t-
B D                 Armadillo  cccaac---------g--c-
B D                   Opossum  ctcagg---------g--t-
B D           Tasmanian devil  ctcaga---------g--t-
B D                   Wallaby  ctcagg---------g--t-
B D                  Platypus  tttggg---------t--a-
  D              Mallard duck  -tggtc---------acttt
B D        American alligator  -tgatc---------a--tt
  D           Green seaturtle  -tggtt---------a--tt
  D            Painted turtle  -tggtt---------a--tt
  D  Chinese softshell turtle  -tggtt---------a--tt
  D    Spiny softshell turtle  -tggtt---------a--tt
B D                       Rat  ====================
       Burton's mouthbreeder  --------------------
B D              Nile tilapia  --------------------
         Pundamilia nyererei  --------------------
  D             Scarlet macaw  ====================
B D                    Lizard  ====================
                 Zebra mbuna  --------------------
  D                    Parrot  ====================
         Princess of Burundi  --------------------
B D                Budgerigar  ====================
  D          Peregrine falcon  ====================
                 Spotted gar  --------------------
B D                Coelacanth  ====================
  D              Saker falcon  ====================
B D                    Turkey  ====================
  D       Collared flycatcher  ====================
B D       Medium ground finch  ====================
  D    White-throated sparrow  ====================
B D                   Chicken  ====================
          Tibetan ground jay  ====================
B D             X. tropicalis  ====================
B D               Zebra finch  ====================
  D               Rock pigeon  ====================

Inserts between block 27 and 28 in window
B D                    Shrew 123bp

Alignment block 28 of 126 in window, 15601267 - 15601296, 30 bps 
B D                     Human  -gtta-taatt-ttaca--gtgaccaaag-----a-ggtc--t
B D                     Chimp  -gtta-taatt-ttaca--gtgaccaaag-----a-ggtc--t
B D                   Gorilla  -gtta-taatt-ttaca--gtgaccaaag-----a-ggtc--t
B D                 Orangutan  -gtta-taatt-ttaca--gtgaccaaag-----a-ggtc--t
B D                    Gibbon  -gtta-taatt-ttaca--gtgaccaaag-----a-ggtc--t
B D                    Rhesus  -gtta-taatt-ttaca--gtgaccaaag-----a-ggtc--t
B D       Crab-eating macaque  -gtta-taatt-ttaca--gtgaccaaag-----a-ggtc--t
B D                    Baboon  -gtta-taatt-ttaca--gtgaccaaag-----a-ggtc--t
B D              Green monkey  -gtta-taatt-ttaca--gtgaccaaag-----a-ggtc--t
B D                  Marmoset  -gtta-taatt-ttaca--gtcaccaaaa-----a-gatc--t
B D           Squirrel monkey  -gtta-taatt-ttaca--gtcaccaaag-----a-ggtc--t
B D                  Bushbaby  -ggtg-ttatt-ttaca--gtaaccaaag-----g-ggtc--t
           Chinese tree shrew  -gcta-taatt-ttaca--gtaaccaaat-----a-ggcc--t
B D                  Squirrel  -atta-tgatt-tttca--gtaatggaga-------gggt--t
       Lesser Egyptian jerboa  -gtta-tcatt-ttacc--ataacaaaag-------aggc--t
                 Prairie vole  -acta-tgatt-tttca--gtaacaaaaa-----agaggc--t
B D           Chinese hamster  -acta-taatt-ttaca--gtaacaaaaa-----agaggc--t
               Golden hamster  -acta-tgatt-ttaca--gtaacaaaaa-----agaggc--t
B D                     Mouse  -acta-tgatt-ttact--ataacagaaa-------gggc--t
B D            Naked mole-rat  -gtta-tgatt-ttaca--gtaatgagag-----a-gggt--t
B D                Guinea pig  -gtta-tgatt-ttaca--gtaatgagag-----a-gggc--t
                   Chinchilla  -gtta-tgatt-ttaca--gtaatgagag-----a-gggc--t
             Brush-tailed rat  -gtca-tgatt-ttaca--ataatgagag-----a-gagc--t
B D                    Rabbit  -gttg-tgatt-ttaca--gtatcc--ag-----a-gacc--c
B D                      Pika  -gtta-tgatt-ttaca--gtaaccaaag-----g-gacc--c
B D                    Alpaca  -gtta-tgatt-ttaca--gtgaccaaag-----a-actc--t
               Bactrian camel  -gtta-tgatt-ttaca--gtgaccaaag-----a-actc--t
B D                   Dolphin  -gtta-tgatt-ttaca--gtgaccaacg-----a-actc--t
                 Killer whale  -gtta-tgatt-ttaca--gtgaccaacg-----a-actc--t
             Tibetan antelope  -atta-ggatt-ttaca--gtgaccaatg-----a-actc--t
B D                       Cow  -atta-ggatt-ttaca--gtgaccaatg-----a-gctc--t
B D                     Sheep  -atta-ggatt-ttaca--gtgaccaatg-----a-actc--t
                Domestic goat  -atta-ggatt-ttaca--gtgaccaatg-----a-actc--t
B D                     Horse  -gtta-taatt-ttaca--gtgaccaaaa-----a-agcc--t
B D          White rhinoceros  -gtta-taatt-ttaca--gtgaccaaag-----a-agtc--t
B D                       Cat  -gtta-taatt-ttaca--gggaccaaag-----a-aggc--t
B D                       Dog  -gtta-taatt-ttaca--gggattgaag-----a-agcc--t
B D                   Ferret   -gtta-taatt-ttaca--gggaccaaag-----a-agtc--t
B D                     Panda  -gtta-taatt-ttaca--gggacgaaag-----a-agcc--t
               Pacific walrus  -gtta-taatt-ttaca--gggaccaaag-----a-agcc--t
                 Weddell seal  -gtta-taatt-ttata--gggaccaaag-----a-agcc--t
             Black flying-fox  -gtta-taatt-ttaca--gtgac---------------c--t
B D                   Megabat  -gtta-taatt-ttaca--gtgac---------------c--t
                Big brown bat  -gtta-taatt-ttaca--gtgaccaaag-----a-aggc--t
         David's myotis (bat)  -gtta-taatt-ttaca--gtgaccaaag-----a-agcc--t
B D                  Microbat  -gtta-taatt-ttaca--gtgaccaaag-----a-agcc--t
B D                  Hedgehog  -gtta-caatt-ttaca--gtgaccagag-----a-aacc--t
B D                     Shrew  -gtta-aaa---ttata--gtgataagagccaaag-agatagt
              Star-nosed mole  -gtta-taatt-ttaca--gtgatcagag-----a-agat--t
B D                  Elephant  -gcta-aaatt-ttaca--gtgacagaag-----a-tgcc--t
          Cape elephant shrew  -gcagtgattt-ttacg--gtgacaaaag-----a-ggcc--t
B D                   Manatee  -gcta-aaatt-ttaca--gtgacaaaaa-----a-tgcc--t
             Cape golden mole  -gcta-taatt-tt--a--gtgacaaaag-----a-gtcc--t
B D                    Tenrec  -gcca-taatt-ttaca--gtgacaaaag-----a-ggcc--t
                     Aardvark  -gctc-taatt-ggaca--gtgac-ggag-----a-ggcc--t
B D                 Armadillo  -gcta-taatt-ttaca--gtgaccaaag-----a-ggcc--t
B D                   Opossum  -ccta-tagtg-tgacagagtgttcaaag-----a-aagc--c
B D           Tasmanian devil  -tcta-tagtg-tgacaaggtgttcaaag-----a-aagc--c
B D                   Wallaby  -ccta-tggtg-tgacagggttttcgaag-----a-aagc--c
B D                  Platypus  -cata-tagtt-ttacaaagtagctacaa-----c-aggt--a
  D              Mallard duck  atcta-tagcc-tgcca--gtgtct------------------
B D        American alligator  atcta-tagac-taaca--gggtct------------------
  D           Green seaturtle  atcta-tagtc-tcaca--gtgtcagagg-----a-agtc--c
  D            Painted turtle  tccta-taatc-tcaca--gtgtcagagg-----a-agtc--c
  D  Chinese softshell turtle  atcta-tagtcttcaca--atgtcagagg-----a-agcc--c
  D    Spiny softshell turtle  atcta-tagtc-tcaca--atgtcagagg-----a-agcc--c
B D                       Rat  ===========================================
       Burton's mouthbreeder  -------------------------------------------
B D              Nile tilapia  -------------------------------------------
         Pundamilia nyererei  -------------------------------------------
  D             Scarlet macaw  ===========================================
B D                    Lizard  ===========================================
                 Zebra mbuna  -------------------------------------------
  D                    Parrot  ===========================================
         Princess of Burundi  -------------------------------------------
B D                Budgerigar  ===========================================
  D          Peregrine falcon  ===========================================
                 Spotted gar  -------------------------------------------
B D                Coelacanth  ===========================================
  D              Saker falcon  ===========================================
B D                    Turkey  ===========================================
  D       Collared flycatcher  ===========================================
B D       Medium ground finch  ===========================================
  D    White-throated sparrow  ===========================================
B D                   Chicken  ===========================================
          Tibetan ground jay  ===========================================
B D             X. tropicalis  ===========================================
B D               Zebra finch  ===========================================
  D               Rock pigeon  ===========================================

Inserts between block 28 and 29 in window
  D             Mallard duck 10bp
B D       American alligator 17079bp
  D          Green seaturtle 1bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 29 of 126 in window, 15601297 - 15601300, 4 bps 
B D                     Human  aga-a
B D                     Chimp  aga-a
B D                   Gorilla  aga-a
B D                 Orangutan  aga-a
B D                    Gibbon  aga-a
B D                    Rhesus  aga-a
B D       Crab-eating macaque  aga-a
B D                    Baboon  aga-a
B D              Green monkey  aga-a
B D                  Marmoset  aaa-a
B D           Squirrel monkey  aaa-a
B D                  Bushbaby  aca-g
           Chinese tree shrew  ata-g
B D                  Squirrel  aga-a
       Lesser Egyptian jerboa  aga-a
                 Prairie vole  agc-a
B D           Chinese hamster  aga-a
               Golden hamster  aga-a
B D                     Mouse  aga-c
B D            Naked mole-rat  gga-a
B D                Guinea pig  ata-a
                   Chinchilla  gga-a
             Brush-tailed rat  gga-a
B D                    Rabbit  aga-a
B D                      Pika  aga-g
B D                    Alpaca  aga-a
               Bactrian camel  aga-a
B D                   Dolphin  aga-a
                 Killer whale  aga-a
             Tibetan antelope  tgt-a
B D                       Cow  tgt-a
B D                     Sheep  tgt-a
                Domestic goat  tgt-a
B D                     Horse  aga-a
B D          White rhinoceros  aga-a
B D                       Cat  aga-a
B D                       Dog  aga-t
B D                   Ferret   aga-t
B D                     Panda  aga-t
               Pacific walrus  aga-t
                 Weddell seal  aga-t
             Black flying-fox  aga-a
B D                   Megabat  aga-a
                Big brown bat  cga-a
         David's myotis (bat)  cga-a
B D                  Microbat  cga-a
B D                  Hedgehog  aaa-a
B D                     Shrew  aga-a
              Star-nosed mole  aaa-g
B D                  Elephant  atg-a
          Cape elephant shrew  ata-a
B D                   Manatee  ata-a
             Cape golden mole  ata-a
B D                    Tenrec  cta-a
                     Aardvark  atg-a
B D                 Armadillo  aga-a
B D                   Opossum  aga-a
B D           Tasmanian devil  aga-a
B D                   Wallaby  aga-g
  D              Mallard duck  agaa-
  D           Green seaturtle  aga--
  D            Painted turtle  aga--
  D  Chinese softshell turtle  aga--
  D    Spiny softshell turtle  aga--
B D                       Rat  =====
       Burton's mouthbreeder  -----
B D              Nile tilapia  -----
         Pundamilia nyererei  -----
  D             Scarlet macaw  =====
B D                    Lizard  =====
                 Zebra mbuna  -----
  D                    Parrot  =====
         Princess of Burundi  -----
B D                Budgerigar  =====
  D          Peregrine falcon  =====
                 Spotted gar  -----
B D                Coelacanth  =====
  D              Saker falcon  =====
B D                    Turkey  =====
  D       Collared flycatcher  =====
B D                  Platypus  -----
B D       Medium ground finch  =====
  D    White-throated sparrow  =====
B D                   Chicken  =====
          Tibetan ground jay  =====
B D             X. tropicalis  =====
B D        American alligator  =====
B D               Zebra finch  =====
  D               Rock pigeon  =====

Inserts between block 29 and 30 in window
  D             Mallard duck 1bp
  D          Green seaturtle 7295bp
  D           Painted turtle 1bp
  D Chinese softshell turtle 1bp
  D   Spiny softshell turtle 1bp

Alignment block 30 of 126 in window, 15601301 - 15601303, 3 bps 
B D                     Human  cta
B D                     Chimp  cta
B D                   Gorilla  cta
B D                 Orangutan  cta
B D                    Gibbon  tta
B D                    Rhesus  tta
B D       Crab-eating macaque  tta
B D                    Baboon  tta
B D              Green monkey  tta
B D                  Marmoset  tta
B D           Squirrel monkey  tta
B D                  Bushbaby  tta
           Chinese tree shrew  tta
B D                  Squirrel  tta
       Lesser Egyptian jerboa  tta
                 Prairie vole  tta
B D           Chinese hamster  tta
               Golden hamster  tta
B D                     Mouse  tta
B D            Naked mole-rat  tta
B D                Guinea pig  tta
                   Chinchilla  tta
             Brush-tailed rat  tta
B D                    Rabbit  tta
B D                      Pika  tta
B D                    Alpaca  tta
               Bactrian camel  tta
B D                   Dolphin  tta
                 Killer whale  tta
             Tibetan antelope  tta
B D                       Cow  tta
B D                     Sheep  tta
                Domestic goat  tta
B D                     Horse  tta
B D          White rhinoceros  tta
B D                       Cat  tta
B D                       Dog  tta
B D                   Ferret   tta
B D                     Panda  tta
               Pacific walrus  tta
                 Weddell seal  tta
             Black flying-fox  tta
B D                   Megabat  tta
                Big brown bat  tta
         David's myotis (bat)  tta
B D                  Microbat  tta
B D                  Hedgehog  tga
B D                     Shrew  ctg
              Star-nosed mole  tta
B D                  Elephant  tta
          Cape elephant shrew  tta
B D                   Manatee  tta
             Cape golden mole  tta
B D                    Tenrec  tta
                     Aardvark  tta
B D                 Armadillo  ttc
B D                   Opossum  tta
B D           Tasmanian devil  tta
B D                   Wallaby  tta
  D              Mallard duck  ctg
  D            Painted turtle  ctg
  D  Chinese softshell turtle  ttg
  D    Spiny softshell turtle  ttg
B D                       Rat  ===
       Burton's mouthbreeder  ---
B D              Nile tilapia  ---
         Pundamilia nyererei  ---
  D             Scarlet macaw  ===
B D                    Lizard  ===
                 Zebra mbuna  ---
  D                    Parrot  ===
  D           Green seaturtle  ===
         Princess of Burundi  ---
B D                Budgerigar  ===
  D          Peregrine falcon  ===
                 Spotted gar  ---
B D                Coelacanth  ===
  D              Saker falcon  ===
B D                    Turkey  ===
  D       Collared flycatcher  ===
B D                  Platypus  ---
B D       Medium ground finch  ===
  D    White-throated sparrow  ===
B D                   Chicken  ===
          Tibetan ground jay  ===
B D             X. tropicalis  ===
B D        American alligator  ===
B D               Zebra finch  ===
  D               Rock pigeon  ===

Inserts between block 30 and 31 in window
B D                  Opossum 42622bp

Alignment block 31 of 126 in window, 15601304 - 15601304, 1 bps 
B D                     Human  -g
B D                     Chimp  -g
B D                   Gorilla  -g
B D                 Orangutan  -g
B D                    Gibbon  -g
B D                    Rhesus  -g
B D       Crab-eating macaque  -g
B D                    Baboon  -g
B D              Green monkey  -g
B D                  Marmoset  -g
B D           Squirrel monkey  -a
B D                  Bushbaby  -g
           Chinese tree shrew  -g
B D                  Squirrel  -g
       Lesser Egyptian jerboa  -g
                 Prairie vole  -g
B D           Chinese hamster  -g
               Golden hamster  -g
B D                     Mouse  -g
B D            Naked mole-rat  -a
B D                Guinea pig  -a
                   Chinchilla  -a
             Brush-tailed rat  -a
B D                    Rabbit  -g
B D                      Pika  -g
B D                    Alpaca  -g
               Bactrian camel  -g
B D                   Dolphin  -g
                 Killer whale  -g
             Tibetan antelope  -g
B D                       Cow  -g
B D                     Sheep  -g
                Domestic goat  -g
B D                     Horse  -g
B D          White rhinoceros  -g
B D                       Cat  -g
B D                       Dog  -g
B D                   Ferret   -g
B D                     Panda  -g
               Pacific walrus  -g
                 Weddell seal  -g
             Black flying-fox  -g
B D                   Megabat  -g
                Big brown bat  -a
         David's myotis (bat)  -a
B D                  Microbat  -a
B D                  Hedgehog  -g
B D                     Shrew  -g
              Star-nosed mole  -g
B D                  Elephant  -t
          Cape elephant shrew  -g
B D                   Manatee  -t
             Cape golden mole  -g
B D                    Tenrec  -g
                     Aardvark  -g
B D                 Armadillo  -a
B D                  Platypus  -g
  D              Mallard duck  t-
  D            Painted turtle  c-
  D  Chinese softshell turtle  c-
  D    Spiny softshell turtle  c-
B D                       Rat  ==
       Burton's mouthbreeder  --
B D              Nile tilapia  --
         Pundamilia nyererei  --
  D             Scarlet macaw  ==
B D                    Lizard  ==
                 Zebra mbuna  --
  D                    Parrot  ==
  D           Green seaturtle  ==
         Princess of Burundi  --
B D                Budgerigar  ==
  D          Peregrine falcon  ==
                 Spotted gar  --
B D                Coelacanth  ==
B D           Tasmanian devil  --
B D                   Opossum  ==
  D              Saker falcon  ==
B D                    Turkey  ==
  D       Collared flycatcher  ==
B D       Medium ground finch  ==
  D    White-throated sparrow  ==
B D                   Chicken  ==
          Tibetan ground jay  ==
B D             X. tropicalis  ==
B D        American alligator  ==
B D               Zebra finch  ==
  D               Rock pigeon  ==

Inserts between block 31 and 32 in window
B D                    Shrew 227bp

Alignment block 32 of 126 in window, 15601305 - 15601336, 32 bps 
B D                     Human  ggat-cat----gaagat-aatg-tt-ggtgt-t-------tgtatgg
B D                     Chimp  ggat-cat----gaagat-aatg-tt-ggtgt-t-------tgtatgg
B D                   Gorilla  ggat-cat----gaagat-aatg-tt-ggtgt-t-------tgtatgg
B D                 Orangutan  ggat-cat----gaagat-aatg-tt-ggtgt-t-------tgtatgg
B D                    Gibbon  ggat-cat----gaagat-aatg-tt-ggtgt-t-------tgtatgg
B D                    Rhesus  ggat-cat----ggagat-aatg-tt-ggtgt-t-------tgtatgg
B D       Crab-eating macaque  ggat-cat----ggagat-aatg-tt-ggtgt-t-------tgtatgg
B D                    Baboon  ggat-cat----gaagat-aatg-tt-ggtgt-t-------tgtatgg
B D              Green monkey  ggat-cat----gaagat-aatg-tt-ggtgt-t-------tgtatgg
B D                  Marmoset  agct-cat----gaagat-aatg-tt-ggtgt-t-------tgtatgg
B D           Squirrel monkey  agat-cat----gaagat-aatg-tt-ggtgt-t-------tgtatgg
B D                  Bushbaby  ggat-cat----ggggct-agtc-tt-tgtga-t-------catatgt
           Chinese tree shrew  ggat-tat----gggagt-aatg-ct-ggtgt-t-------tatacat
B D                  Squirrel  agat-cat----ggagta-a-tg-tt-ggcat-t-------tatg--t
       Lesser Egyptian jerboa  gggt-tat----ggggtg-a-ta-tt-gatgc-t-------tacatgg
                 Prairie vole  aaag-tat----ggcgac-a-ca-tt-ggaac-t-------tataact
B D           Chinese hamster  aaac-cat---gggagac-a-ta-tt-ggaac-t-------tgtaact
               Golden hamster  aaac-cat---gggagac-a-ta-tt-ggaac-t-------tgtaact
B D                     Mouse  aaat-cat---gggacac-a-ta-tt-ggaac-t-------tatagcc
B D            Naked mole-rat  agat-cag----agagat-aatg-tt-ggtgt-t-------tatata-
B D                Guinea pig  agat-cag----agagat-aatg-tt-ggtgt-t-------tatatat
                   Chinchilla  acat-cag----ggagat-a-tg-tt-ggtgt-t-------tatatat
             Brush-tailed rat  acat---g----cgagat-a--g-tt-ggtgt-t-------catctat
B D                    Rabbit  gaat-cat---gggagta-a-tg-tt-gccat-t-------tatatgt
B D                      Pika  aaat-cac---aagagta-a-tg-ct-gcaat-t-------tatattt
B D                    Alpaca  agct-cgt----ggggg--aaag-tt-gagac-t-------tacatgt
               Bactrian camel  ggct-cgc----ggggg--aaag-tt-gagac-t-------t-----t
B D                   Dolphin  gggt-cac----gggggt-aatg-tt-gggac-t-------tacacgt
                 Killer whale  cggt-cac----gggggt-aatg-tt-gggac-t-------tacacgt
             Tibetan antelope  gaat-ctt----ggggct-aatg-ttggggac-t-------tagatgt
B D                       Cow  gaat-ctt----ggggct-aatgtttggggac-t-------tagatgt
B D                     Sheep  gaat-ctt----ggggct-aatg-ttggggac-t-------tagatgt
                Domestic goat  gaat-ctt----ggggct-aatg-ttggggac-t-------tagatgt
B D                     Horse  ggat-cgt----ggggat-aata-ct-ggtacat-------aacatgt
B D          White rhinoceros  ggat-cat----gggggt-aata-cc-agtac-t-------tacatat
B D                       Cat  ggat-cac---ggggggt-aatg-tt-ggtac-t-------tatatgt
B D                       Dog  ggat-cat----gggggt-attg-tt-ggtac-t-------tatatgt