Multiz Alignments of 100 Vertebrates
 

Capitalize exons based on show bases
Place cursor over species for alignment detail. Click on 'B' to link to browser for aligned species, click on 'D' to get DNA for aligned species.
Alignment block 1 of 43 in window, 42879800 - 42879923, 124 bps 
B D                   Human  gcgcccagc---actct------c------cca-------------------------------g-c--a
B D                   Chimp  gcgcccagc---actct------c------cca-------------------------------g-c--a
B D                 Gorilla  gcgcccagc---actct------c------cca-------------------------------g-c--a
B D               Orangutan  gagcccagc---actct------c------cca-------------------------------g-c--a
B D                  Gibbon  gcgcccagc---actct------c------cca-------------------------------g-c--a
B D                  Rhesus  gcgcccagc---actct------c------cca-------------------------------g-c--a
B D     Crab-eating macaque  gcgcccagc---actct------c------cca-------------------------------g-c--a
B D                  Baboon  gcgcccagc---actct------c------cca-------------------------------g-c--a
               Green monkey  gcgcccagc---actct------c------cca-------------------------------g-c--a
B D                Marmoset  gcccccaga---actct------c------cca-------------------------------g-c--a
B D         Squirrel monkey  gctcccaga---acttt------c------cca-------------------------------g-c--a
B D                Bushbaby  cggtgcagc---cccct------t------cag-------------------------------g-c---
         Chinese tree shrew  ------------------------------ccc-------------------------------g-c--a
B D                Squirrel  ggcccgctgt--cgtcc------t------gcc-------------------------------g-c--c
     Lesser Egyptian jerboa  ----ccag----cctct------t------tcg-------------------------------g-c--a
               Prairie vole  gtc-tcaggt--ctcct------c------cca-------------------------------g-t--c
B D         Chinese hamster  gtcaccaggc--cccct------c------cta-------------------------------g-t--c
             Golden hamster  gtcaccaggca-cccct------c------cca-------------------------------g-t--c
B D                   Mouse  gtcgtcgggac-ccctt------c------cca-------------------------------g-t--c
B D                     Rat  gttatccgggc-ccggt------c------cca-------------------------------g-t--c
B D          Naked mole-rat  ggggtgaggttgggtcc------c------ctg-------------------------------c----c
B D              Guinea pig  gggtcggggtggcgtcc------c------ctg-------------------------------a-c--c
                 Chinchilla  ggggtggagtggggtcc------c------ctg-------------------------------g----c
           Brush-tailed rat  ggggtggagtggagtct------c------ccg-------------------------------g-c--c
B D                  Rabbit  ------------ccccg------g------gcg-------------------------------t-c--c
B D                     Pig  gcgcgcgga---atcct------c------ctg-------------------------------a-c--c
B D                 Dolphin  gcgcgcgca---gccct------c------ctg-------------------------------a-c--c
               Killer whale  gcgcgcgca---gccct------c------ctg-------------------------------a-c--c
           Tibetan antelope  gcgcgcgga---accct------c------ccg-------------------------------a-c--c
B D                     Cow  gcgctcgga---acact------c------ctg-------------------------------a-c--c
B D                   Sheep  gcgcgcgga---accct------c------ccg-------------------------------a-c--c
              Domestic goat  gcgcgcgga---accct------c------ccg-------------------------------a-c--c
B D                   Horse  gcgcgcgac---accct------c------cca-------------------------------gcc--c
B D        White rhinoceros  gcgcgcggc---accct------c------cca-------------------------------gcc--c
B D                     Dog  gggcgccgc---gccct------c------cag---------------------------------c--c
B D                 Ferret   gagggtcgc---agcct------c------cag---------------------------------c--c
B D                   Panda  gagcggcgc---accct------c------cag---------------------------------c--c
             Pacific walrus  gcgcgccac---accct------c------cag---------------------------------c--t
               Weddell seal  gcgcgccac---accct------c------cag---------------------------------c--c
B D                 Megabat  gcac-cggc---gccct------c------cca-------------------------------gcc--c
B D                Microbat  tcaggtgac---acact------cgacgggccagaggcgcactagtcgcagcacagtgggctaggca--t
              Big brown bat  gcacgtggc---accct------c------cca-------------------------------gcc--c
B D                Elephant  ggccctggg---cgcct------g------gcg-------------------------------t-c--c
B D                 Manatee  ggtcccggg---cgcct------g------gcg-------------------------------t-c--c
           Cape golden mole  ggtccccgg---cacct------g------gcg-------------------------------t-c--c
B D                  Tenrec  ggtccgggg---tgcct------a------gcg-------------------------------c-ccac
                   Aardvark  agg----------acct------g------gca-------------------------------t-t--c
B D               Armadillo  agtccgagc---cgccc-------------gcg-------------------------------t-cccc
B D             Zebra finch  ctgccagct---ctgccccag--c------cca-------------------------------g-c--c
B D      American alligator  acgactctc---ttgcccggggcc------cca-------------------------------a-c--a
      David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                     Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  -ccccgg-gaggcgccctgcc-cg---------------gctggcccca--gcgctcgac--cctcggg-
                      Chimp  -ccccgg-gaggcgccctgcc-cg---------------gctggcccca--gcgctcgac--cctcggg-
                    Gorilla  -ccccgg-gaggcgccctgcc-cg---------------gctggcccca--gcgctcgac--cctcggg-
                  Orangutan  cccccag-aaggcgccctgcc-cg---------------gctggcccca--gcgctcgac--cctcggg-
                     Gibbon  -cccccg-gaggcgccctgcc-cg---------------gctggcccca--gcgctcgac--cttcggg-
                     Rhesus  -cccccg-gaggcgccctgcc-cg---------------gctgacccca--gtgctcgac--cctcggg-
        Crab-eating macaque  -cccccg-gaggcgccctgcc-cc---------------gctgacccca--gtgctcgac--cgtcggg-
                     Baboon  -cccccg-gaggcgccctgtc-cg---------------gctgacccca--gtgctcgac--cctcggg-
               Green monkey  -ctcccg-gaggcgtcctgcc-cg---------------gccgacccca--gtgctcgac--cctcggg-
                   Marmoset  -cccccg-gaggcaccctgcc-ca---------------gcttgcccca--gcgctcggc--cctcggg-
            Squirrel monkey  -cccccg-gaggcaccctggc-cg---------------gcttgcccca--gcgctcggc--cctcggg-
                   Bushbaby  -ccttgg-agggcgctttgcg-gc---------------tcggcccaca--gcgctcagc--c--cagg-
         Chinese tree shrew  ----cgt-aggccgctttgcc-ca--------------------------------------ccccaag-
                   Squirrel  -cgcaggaagggcgctccgcc-gg-----------------------------cctcagc--cccgagc-
     Lesser Egyptian jerboa  -ccc----------------------------------------------------ccgc----------
               Prairie vole  -cccagaacgtgcgcccggtc-cg------------------------------ctcagt---cccaga-
            Chinese hamster  -cccagaatgcgcacctagtc-cg------------------------------ctcagt--ccccaga-
             Golden hamster  -cccagaatgcgcacctagta-ca------------------------------ctcaata-ccccaga-
                      Mouse  -cccaggacgtacactcgggc-ga------------------------------atcagt--c---aga-
                        Rat  -cccaggacgtacacccgggc-cg------------------------------ctcagt--ctcaaga-
             Naked mole-rat  -cccaggaagggcgctctgcc-cg------------------------------cccaag--cgccaa--
                 Guinea pig  -cctaggaaaggcactctgcc-ca------------------------------cca--g--ggccag--
                 Chinchilla  -cccagg-aaggtgctctacc-tg------------------------------ccc--a--caccag--
           Brush-tailed rat  -cccagg-aaggtgctctatc-tg------------------------------cct--g--caccag--
                     Rabbit  -cctgcgaagggctctcggcc-cg-----------------------------gctcggc--ccgcggg-
                        Pig  -tcgggg-aggtcgctccgcc-cg---------------gctcagccccgcgcgccccgc--cggcgag-
                    Dolphin  -tcacgc-aggtcactttgct-cg---------------gctcagccccgtgcgtcccgc--gggcggg-
               Killer whale  -tcacgc-aggtcactttgct-tg---------------gctcagccccgtgcgtcccgc--gggcggg-
           Tibetan antelope  -tcacgc-aggtcgctttgca-cg---------------gctcagcccagtgcgtcccga--cggcggg-
                        Cow  -tcacgc-aggtcgctttgct-cg---------------gctcagcccagtgcgtccaga--cggcggg-
                      Sheep  -tcacgc-aggtcgctttgca-cg---------------gctcagcccagtgcgtcccga--cggctgg-
              Domestic goat  -tcacgc-aggtcgctttgca-cg---------------gctcagcccagtgcgtcccga--cggctgg-
                      Horse  -ccacgg-aggccactttgcc-tg---------------gctcagccccgcgcgtcc----------gg-
           White rhinoceros  -ccgcgg-agggcactttgcc-ca---------------gctcagccctgggcggcc----------ag-
                        Dog  -ccccc--agggcgctcggcc-cg---------------gcccggcccggagggtcccgc--cggcggg-
                    Ferret   -ccaccg-agggccctttgcc-cg---------------gcccagcccggagagtcccgc--cggtgga-
                      Panda  -ccaccg-agggcc-----------------------------------------tccgc--cggcggg-
             Pacific walrus  -gcaccg-agggccctttgcc-cgggggcccttggccctgcccggcccggagcgtcccgc--cggcggg-
               Weddell seal  -ccaccg-agggccctttgcc-cg---------------gcccggcccggagcgtcccgc--cggcgga-
                    Megabat  -ccac-g-cgggcgcctcgcc-cc---------------gctcagccccgcgcgccc-------------
                   Microbat  -cctcag-gcagtctgccgcagcc---------------gcacagccgcgtgttacc-------------
              Big brown bat  -ccccgg-agagcgcgccgtc-cc---------------gctcaaccccgcgcgtcc-------------
                   Elephant  -tcctgg-tgggcgcgttgcc-cc---------------gttgagcccagagcacccagtgcccgctag-
                    Manatee  -tcctag-aaggcgcgtggcc-ac---------------ggagtgcccagagcacccagtgcccgcgag-
           Cape golden mole  -ccatgg-agggcacgtggct-cg---------------actgagcccagagcatgcagtgctcgcgag-
                     Tenrec  -ccccgg-agggcacgtggcc-cg---------------gcggagtccagagcacccagtgtcagcca--
                   Aardvark  -cccagg-aaggcgcgtggcc-gt---------------gtcgcgcccagagcatccagcgcccgcaag-
                  Armadillo  -ccacgg-agggcgccctgcc-cg---------------gccccgtcca---------------------
                Zebra finch  -acactc---tcctctctcgc-cc---------------cccagatcaacag----cgag--taccgggc
         American alligator  -acccta-aggccaccactgc-cc---------------ct---------------ggac--tatgggat
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  cgcact--cacct------gccg-c------gc-cgcg------ctcc---t----ca--ca--------
                      Chimp  cgcact--cacct------gccg-c------gc-cgcg------ctcc---t----ca--ca--------
                    Gorilla  cgcact--cacct------gccg-c------gc-cgcg------ctcc---t----ca--ca--------
                  Orangutan  cgcact--cacct------gccg-c------gc-cgcg------ctcc---t----ca--ca--------
                     Gibbon  cgcact--cacct------gccg-c------gc-cgcg------ctcc---t----ca--ca--------
                     Rhesus  cgcact--cactt------gccg-c------gc-cgcg------ctcc---t----ca--ca--------
        Crab-eating macaque  cgcact--cactt------gccg-c------gc-cgcg------ctcc---t----ca--ca--------
                     Baboon  cgcact--cacct------gccg-c------gc-cgcg------cacc---t----ca--ca--------
               Green monkey  cgcact--cacct------gccg-c------gc-cgcg------ctcc---t----ca--ca--------
                   Marmoset  cgcact--cacct------gcgg-c------gc-cgcg------ctcc---c----ca--ca--------
            Squirrel monkey  cgcact--cacct------gccg-c------gc-cgcg------ctcc---c----ca--ca--------
                   Bushbaby  aggacg--cacct------gcag-c------gt-agcg------ctcc---t----tg--aa--------
         Chinese tree shrew  tggacg--cacct------gccg-c------gcttgcc------cgcc---t----ca--ca--------
                   Squirrel  gctccg--cccgc------gcagacacacctgc-cccg------caca---c----ct--cg--------
     Lesser Egyptian jerboa  --------cacct------cccc-ctcccagga-ct--------ccca---c----cc--gg--------
               Prairie vole  ccgtcg--cacct------gtcg-cgccctggc-ctcg------ccta---a----cc--ta--------
            Chinese hamster  tggtcg--cacct------gtcg-ctccctggc-ttcg------ccta---a----ct--ca--------
             Golden hamster  cggtcg--cacct------gtag-cgtcctggc-ttcg------ccta---a----cccaca--------
                      Mouse  cggtcg--cacct------gtag-tgccttggc-ctct------ccta---a----ct--ca--------
                        Rat  cggtcgcacacat------gtag-caccttggc-ctca------ccta---a----ct--ca--------
             Naked mole-rat  ----cg--cacct------gtgg-c-------c-caca------cctg---a----tt--ca--------
                 Guinea pig  ----tg--cacct------tcag-c-------c-caca------cctg---c----tt--ca--------
                 Chinchilla  ----tg--cacct------tcag-c-------c-cacacctgcttctg---c----tt--ca--------
           Brush-tailed rat  ----cg--caact------ttgg-c-------c-caca------tctg---c----tt--ca--------
                     Rabbit  cgaact--cacct------gccg-cacccccgg-cgct------ccca---c----ct--gg--------
                        Pig  aggacg--cacct------gtcg-a------gctggag------ccgc---tcgcacg--ca--------
                    Dolphin  aggacg--cacct------gccg-g------gcaggag------ctgc---t----ca--ca--------
               Killer whale  aggacg--cacct------gccg-g------gcaggag------ctgc---t----ca--ca--------
           Tibetan antelope  aggacg--gaccc------accg-g------gccaaag------ctgc---t----ca--ca--------
                        Cow  aggacg--gaact------accg-g------gccggag------ctgc---t----ca--ca--------
                      Sheep  aggacg--gaccc------accg-g------gccgaag------ctgc---t----ca--ca--------
              Domestic goat  aggacg--gaccc------accg-g------gccgaag------ctgc---t----ca--ca--------
                      Horse  aggacc--cacct------gccg-c------gcttgcg------ctgc---t----ca--ca--------
           White rhinoceros  aggacg--cacct------gcgg-c------gctcgcg------ctgc---t----ca--ca--------
                        Dog  aagacg--cacct------gctg-c------gctggcg------ctgc---c----ca--ca--------
                    Ferret   aggacg--cacct------gccg-c------gctcacg------ccgc---g----ca--ca--------
                      Panda  -ggacg--cacct------gctc-c------gctcgcg------ccgc---t----ca--ca--------
             Pacific walrus  aggact--cacct------gctg-c------gctcgcg------ccgc---t----ca--ca--------
               Weddell seal  aggacg--cacct------gctg-c------gctcgcg------ctgc---t----ca--cg--------
                    Megabat  ----cg--cacct------gccg-c------gcccgcg------ctgc---g----ca--ca--------
                   Microbat  ----c-----cgg------gtct-c---------cgag------ctgc---g----ca--cc--------
              Big brown bat  ----cg--caccg------gcca-c------gctcgcc------ctgc---g----ca--ca--------
                   Elephant  ccggct--cacct------gctg-c------cc-tggg------tcgc-tcg----cg--ca--------
                    Manatee  ccggcg--cacct------gcag-c------ct-tggg------ttgc-gtg----cg--ca--------
           Cape golden mole  cggacg--ctcca------gtca-c------ac-cagc------tggc-gcg----cg--ca--------
                     Tenrec  -ggacg--cacct------gctg-c-----ggt-cagc------ttcctgag----aa--ca--------
                   Aardvark  cggacg--cactt------ggcg-t------cc-cggc------tctc-gcg----cg--ca--------
                  Armadillo  ----cg--cacctctcggggcca-c------ct-tggc------tcgc---g----cg--cg--------
                Zebra finch  agagtt--cgccc------gctg-c------ct-ggag------cccc---t----cc--tgatgctcag
         American alligator  caggct--c-tct------gccg-c------tc-tccg------cgcc---c----tc--ggggcaccag
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  ---c-----cc--------gc-----------------tt--tcac--------ct--------------
                      Chimp  ---c-----cc--------gt-----------------tt--tcac--------ct--------------
                    Gorilla  ---c-----cc--------gc-----------------tt--tcac--------ct--------------
                  Orangutan  ---c-----cc--------gc-----------------tt--tcac--------ct--------------
                     Gibbon  ---c-----cc--------gc-----------------tt--tcac--------ct--------------
                     Rhesus  ---c-----cc--------gc-----------------tt--tcac--------ct--------------
        Crab-eating macaque  ---c-----cc--------gc-----------------tt--tcac--------ct--------------
                     Baboon  ---c-----cc--------gc-----------------tt--tcac--------ct--------------
               Green monkey  ---c-----cc--------gc-----------------tt--tcag--------ct--------------
                   Marmoset  ---g-----cc--------gc-----------------tt--tcac--------ct--------------
            Squirrel monkey  ---g-----cc--------gc-----------------tt--tcac--------ct--------------
                   Bushbaby  ---c-----cg--------gc-----------------tt--ctcctccagccacc--------------
         Chinese tree shrew  ---c-----tc--------gg-----------------ctcgtcac--------cc--------------
                   Squirrel  ---c-ttgcct--------cc-----------------ag--ccac--------cc--------------
     Lesser Egyptian jerboa  ---c-ttcacct-------cc-----------------ag--acgc--------cc--------------
               Prairie vole  ---c-tgtacc--------cc-----------------ag--acgc--------cc--------------
            Chinese hamster  ---c-tgtacc--------ct-----------------ag--atac--------cc--------------
             Golden hamster  ---c-tgtaca--------ct-----------------ag--acac--------cc--------------
                      Mouse  ---cttgtacc--------ct-----------------ag--acgc--------cc--------------
                        Rat  ---cctgtacc--------tt-----------------ag--actc--------cc--------------
             Naked mole-rat  ---g---------------ct-----------------cc--gcac--------cc--------------
                 Guinea pig  ---g---------------ct-----------------cc--acac--------cc--------------
                 Chinchilla  ---g---------------ct-----------------ct--gcac--------cc--------------
           Brush-tailed rat  ---g---------------ct-----------------ct--acac--------cc--------------
                     Rabbit  ---t-ttcaccgccagccaac-----------------ac--gcac--------cc--------------
                        Pig  ---c-----ct--------ga-----------------cc--tcac--------tt--------------
                    Dolphin  ---c-----ct--------gg-----------------ct--tcac--------ct--------------
               Killer whale  ---c-----ct--------gg-----------------ct--tcac--------ct--------------
           Tibetan antelope  ---c-----ct--------gg-----------------ct--tcgc--------at--------------
                        Cow  ---c-----ct--------gg-----------------ct--tcac--------ct--------------
                      Sheep  ---c-----ct--------gg-----------------ct--tcac--------at--------------
              Domestic goat  ---c-----ct--------gg-----------------ct--tcac--------at--------------
                      Horse  ---c-----ct--------gg-----------------ct--tctc--------ct--------------
           White rhinoceros  ---c-----ct--------gg-----------------cc--tcac--------ct--------------
                        Dog  ---c-----ct--------gg-----------------cc--tcac------------------------
                    Ferret   ---c-----ct--------gg-----------------cc--tccc--------gt--------------
                      Panda  ---c-----ct--------gg-----------------cc--tcac--------gt--------------
             Pacific walrus  ---c-----cc--------gg-----------------cc--tcac--------gt--------------
               Weddell seal  ---c-----cc--------gg-----------------cc--tcac--------gt--------------
                    Megabat  ---c-----ct--------gg-----------------ct--tcgc--------ct--------------
                   Microbat  ---c-----ct--------gggcccccggcacgtggcacc--ctcc--------ct--------------
              Big brown bat  ---c-----ct--------gg-----------------ct--ccac--------ct--------------
                   Elephant  ---c-----ct--------gg-----------------ct--tcag--------cc--------------
                    Manatee  ---c-----ct--------gg-----------------ct--tcac--------cc--------------
           Cape golden mole  ---c-----ct--------gg-----------------ct--tcac--------cc--------------
                     Tenrec  ---c-----ct--------ga-----------------ct--gcac--------cc--------------
                   Aardvark  ---c-----ct--------ga-----------------ct--tcac--------cc--------------
                  Armadillo  ---c-----cc--------tg-----------------ct--tcac--------gc--------------
                Zebra finch  c--c-----cc--------cg-----------------cc--gctc--------cgtggtgggcagcgct
         American alligator  cgac-----cc--------cg-----------------ct--tccc--------cg--------------
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  ----cc--gggcgg----g----------gca
                      Chimp  ----cc--gggcgg----g----------gca
                    Gorilla  ----cc--gggcgg----g----------gca
                  Orangutan  ----cc--gggcgg----g----------gca
                     Gibbon  ----ct--gggcgg----g----------gca
                     Rhesus  ----cc--gggcgg----g----------gca
        Crab-eating macaque  ----cc--gggcgg----g----------gca
                     Baboon  ----cc--gggctg----g----------gca
               Green monkey  ----cc--gggcgg----g----------gca
                   Marmoset  ----ct--gggcgg----g----------ggc
            Squirrel monkey  ----cc--gggcag----c----------ggc
                   Bushbaby  ----cc--gacccg----g----------gct
         Chinese tree shrew  ---acc--cggcgc----g----------gag
                   Squirrel  gcaccc--acgcac----ccagaactggggca
     Lesser Egyptian jerboa  ----ct--cggtg----------------gca
               Prairie vole  -cagcc--gggcac----c----------gtc
            Chinese hamster  -cggcc--cggcac----c----------gcg
             Golden hamster  -cggcc--aggcac----c----------gcg
                      Mouse  -aggcc--cggcac----c----------gcc
                        Rat  -agccc--cggcac----c----------gcg
             Naked mole-rat  -ccccccaaggttg----t----------tca
                 Guinea pig  -ctgcc--aggttg----t----------ttg
                 Chinchilla  -c-gcc--aggttg----t----------ttg
           Brush-tailed rat  -ctgcc--agattg----t----------ttg
                     Rabbit  -agcgc--gaggac----t-------------
                        Pig  ----cc--cgtg--------------------
                    Dolphin  ----cc--cgct--------------------
               Killer whale  ----cc--cgct--------------------
           Tibetan antelope  ----cc--cgct--------------------
                        Cow  ----cc--cgct--------------------
                      Sheep  ----cc--cgct--------------------
              Domestic goat  ----cc--cgct--------------------
                      Horse  ----cc--c-----------------------
           White rhinoceros  ----cc--tgccag------------------
                        Dog  --------------------------------
                    Ferret   ----cc--aggcgc------------------
                      Panda  ----cc--agccgc------------------
             Pacific walrus  ----cc--agccgc------------------
               Weddell seal  ----cc--agccgc------------------
                    Megabat  ----gc--cgccac------------------
                   Microbat  ----gc--ccccacggac--------------
              Big brown bat  ----gc--cgccac------------------
                   Elephant  tccacc--cagccc------------------
                    Manatee  tccacc--cagcgc------------------
           Cape golden mole  c----------tgc------------------
                     Tenrec  cgcacc--gagcgc------------------
                   Aardvark  tccacc--------------------------
                  Armadillo  cccacc--caccgc------------------
                Zebra finch  --------------------------------
         American alligator  --------------------------------
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                        Cat  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 1 and 2 in window
B D                  Horse 2bp
B D       White rhinoceros 16bp
B D                Ferret  16bp
B D                  Panda 16bp
            Pacific walrus 16bp
              Weddell seal 16bp
B D                Megabat 15bp
B D               Microbat 36bp
             Big brown bat 15bp
B D               Elephant 4bp
B D                Manatee 4bp
          Cape golden mole 4bp
B D                 Tenrec 4bp
B D              Armadillo 4bp

Alignment block 2 of 43 in window, 42879924 - 42879930, 7 bps 
B D                   Human  gg---gggca---
B D                   Chimp  gc---gggca---
B D                 Gorilla  gg---gggca---
B D               Orangutan  gg---gggca---
B D                  Gibbon  gg---gggca---
B D                  Rhesus  gg---gggca---
B D     Crab-eating macaque  gg---gggca---
B D                  Baboon  gg---gggca---
               Green monkey  gg---gggca---
B D                Marmoset  gg---gggca---
B D         Squirrel monkey  c------------
B D                Bushbaby  gg-----------
         Chinese tree shrew  gc---gggag---
B D                Squirrel  gg---gcaat---
     Lesser Egyptian jerboa  gg---gtg-----
               Prairie vole  gg---gtgga---
B D         Chinese hamster  gg---gcgga---
             Golden hamster  gg---gcgga---
B D                   Mouse  gg---acgga---
B D                     Rat  gg---gcgga---
B D          Naked mole-rat  tg---ggcgc---
B D              Guinea pig  gg---ggagc---
                 Chinchilla  gg---ggagc---
           Brush-tailed rat  gg---gca-----
B D                  Rabbit  -----gggga---
B D                     Pig  -----actcc---
B D                 Dolphin  -----gctcc---
               Killer whale  -----gctcc---
           Tibetan antelope  -----actcc---
B D                     Cow  -----actct---
B D                   Sheep  -----actcc---
              Domestic goat  -----actcc---
B D                   Horse  gg---gcgct---
B D        White rhinoceros  gg---gcact---
B D                     Cat  gg---acgct---
B D                 Ferret   ag---gggcc---
B D                   Panda  gg---ccgct---
             Pacific walrus  gg---gcgct---
               Weddell seal  gg---gcgct---
B D                 Megabat  gg---aa------
B D                Microbat  gg---ccgca---
              Big brown bat  gg---tcgcc---
B D                Elephant  ag---g-------
B D                 Manatee  gg---g-------
           Cape golden mole  ag---g-------
B D                  Tenrec  agtcag-------
                   Aardvark  ag---g-------
B D               Armadillo  gg-----------
B D             Zebra finch  ------ggtggca
B D      American alligator  -------------
      David's myotis (bat)  NNNNNNNNNNNNN
          Black flying-fox  NNNNNNNNNNNNN
            Bactrian camel  NNNNNNNNNNNNN
B D                  Alpaca  NNNNNNNNNNNNN
B D                     Dog  -------------

Inserts between block 2 and 3 in window
B D               Marmoset 441bp
        Chinese tree shrew 3bp
B D               Squirrel 2bp
    Lesser Egyptian jerboa 2bp
              Prairie vole 2bp
B D        Chinese hamster 2bp
            Golden hamster 2bp
B D                  Mouse 2bp
B D                    Rat 2bp
B D         Naked mole-rat 2bp
B D             Guinea pig 2bp
                Chinchilla 2bp
          Brush-tailed rat 2bp
B D                 Rabbit 2bp

Alignment block 3 of 43 in window, 42879931 - 42880024, 94 bps 
B D                   Human  tcggcgggtccc--------------------a--g-------gcgcccaggtt-----------cccct
B D                   Chimp  tcggcgggtccc--------------------a--g-------gcgcccaggtt-----------cccct
B D                 Gorilla  tcggcgggtccc--------------------a--g-------gcgcccaggtt-----------cccct
B D               Orangutan  tcggcgggtccc--------------------a--g-------gcgcccaggtt-----------cccct
B D                  Gibbon  tcggccggtccc--------------------a--g-------gcgcccaggtt-----------cccct
B D                  Rhesus  taggcgggtccc--------------------a--g-------gcgcccaggtt-----------cccct
B D     Crab-eating macaque  taggcgggtccc--------------------a--g-------gcgcccaggtt-----------cccct
B D                  Baboon  taggcgggtccc--------------------a--g-------gcgcccaggtt-----------cccct
               Green monkey  taggcgggtccc--------------------a--g-------gcgcccagatt-----------cccct
B D         Squirrel monkey  ccggcgggtccc--------------------a--g-------gctcccaagtg-----------cccct
B D                Bushbaby  --ggtagttcct--------------------g--g-------gccctccagt-------------ctcc
         Chinese tree shrew  tagggagctcct--------------------a--g-------gcgctcaagcc-----------gggat
B D                Squirrel  ggaggttcccag--------------------a--t---------gcccaggtt-----------cccct
     Lesser Egyptian jerboa  cagctcatcccc--------------------a--t-------gctcccgggtc-----------ccctt
               Prairie vole  cgaatcaccccc--------------------a--t----------------tt-----------cacct
B D         Chinese hamster  aaggtcaccccc--------------------a--t----------------tt-----------cccct
             Golden hamster  catggca-cccc--------------------a--t----------------tt-----------cccct
B D                   Mouse  caggtc-acccc--------------------a--t----------------tt-----------ccttt
B D                     Rat  cgggtcaacccc--------------------a--t----------------tt-----------ccttt
B D          Naked mole-rat  agatccgggtcc--------------------a--g----------------ga-----------ccccc
B D              Guinea pig  gtgtccaggttc--------------------a--g----------------ga-----------tccct
                 Chinchilla  aggtccaggccc--------------------a--g----------------ga-----------ccccc
           Brush-tailed rat  aagtccaggccc--------------------a--g----------------gc-----------ccccc
B D                  Rabbit  cgggtcttcccc--------------------g--ggcgcggggcgcgcagggg-----------ctcct
B D                     Pig  cgcctagtgccgagagcgggtaggtcgctcccc--g-------gcgaccaggtc-----------ctccg
B D                 Dolphin  cactcagcgcgggg------------------g--g-------gcgcccagggt-----------ctctc
               Killer whale  cacccagcgc-ggg------------------g--g-------gcgcccagggc-----------ctccc
           Tibetan antelope  cacccagtcc----------------------g--g-------gcgcccaggta-----------ctccc
B D                     Cow  cacccagccc----------------------g--g-------gcgcccaggtc-----------cttcc
B D                   Sheep  caaccagtcc----------------------g--g-------gcgcacaggaa-----------ctccc
              Domestic goat  cacccagtcc----------------------g--g-------gcgcccaggta-----------ctccc
B D                   Horse  taggtcgttccc-----------------------g-------gcgcccaggtc-----------ctccc
B D        White rhinoceros  taggtcgttcct--------------------g--g-------gcgcccgcgtc-----------ttccc
B D                     Cat  tgggttgtcccc--------------------t--g-------gcgcccagatc-----------cttct
B D                     Dog  ----------------------------------------------------------------------
B D                 Ferret   tgactcgtcttc--------------------c--g-------gcgcccaga-c-----------cttcc
B D                   Panda  tggggtgtcccc--------------------c--a-------gcgcccagatc-----------cttcc
             Pacific walrus  tgggttgtcccc--------------------c--g-------gcgcccagatc-----------cttcc
               Weddell seal  tgggttgtcccc--------------------c--g-------gcgcccagatc-----------cttcc
B D                 Megabat  ---------------------------------------------cgctgaggt-----------cgctc
B D                Microbat  c---tcgccctg--------------------c--g-------cacacccggctccacctgccgcctccc
              Big brown bat  c---tcgtc------------------------------------gaccaggtt-----------ctccc
B D                Elephant  taggtcgtttcc--------------------caga-------gagtccaggtc----------------
B D                 Manatee  taggtcgttttc--------------------c--a-------gcgtccaggtc----------------
           Cape golden mole  tcg-----tccc--------------------c--g-------gcgtccaggac----------------
B D                  Tenrec  tgg-----tccc--------------------c--g-------ggaaccaggtc----------------
                   Aardvark  tca----tttcc--------------------c--g-------aggtccaggcc----------------
B D               Armadillo  -----------c--------------------a--g-------gcgcccaggga----------------
B D             Zebra finch  -----------------------------------------------tcggtcc-----------tggca
B D      American alligator  ----------------------------------------------------cc-----------tcccc
      David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                Marmoset  ======================================================================

                      Human  --cccc-agccc-----------g-----------------ga---------c--cccg-a---gc-cgg
                      Chimp  --cccc-agccc-----------c-----------------ga---------c--cccg-a---gc-cgg
                    Gorilla  --cccc-agccc-----------g-----------------ga---------c--cccg-a---gc-cgg
                  Orangutan  --cccc-agccc-----------g-----------------ga---------c--ccca-a---gc-cgg
                     Gibbon  --cccc-agccc-----------g-----------------ga---------c--cccg-a---tc-ccg
                     Rhesus  --cccc-agccc-----------g-----------------ga---------c--cccg-a---gc-cgg
        Crab-eating macaque  --cccc-agccc-----------g-----------------ga---------c--cccg-a---gc-cgg
                     Baboon  --cccc-agccc-----------g-----------------ga---------c--cccg-a---gc-cgg
               Green monkey  --cccc-agccc-----------g-----------------ga---------c--cccg-a---gc-cgg
            Squirrel monkey  --ttcc-agccc-----------------------------ga---------c--cccg-c---gc-agg
                   Bushbaby  --tccc-aaccc-----------t-----------------gt---------a--agcg-c---gc-cag
         Chinese tree shrew  --cccg-agcccag---------g-----------------aa---------g--cccg-c---ac-aag
                   Squirrel  --tcca-agccc-----------a-----------------ga---------c--ccgg-c---gc-tca
     Lesser Egyptian jerboa  --tccgtggccg-----------g-----------------gaa-------cc--ccgg-c---gt----
               Prairie vole  --ccca-ggcag-----------g-----------------ga---------c--ccag-t---gt-gga
            Chinese hamster  --ccca-ggccc-----------g-----------------ga---------c--ccag-tgcggc-gga
             Golden hamster  --ccca-gaccc-----------g-----------------ga---------c--ccag-t---gc-gga
                      Mouse  --tct-----------------------------------------------------g-t---gc-cgg
                        Rat  --tct-----------------------------------------------------g-t---gc-cgg
             Naked mole-rat  -------agcct-----------g-----------------gagccgc---cc--tcggag---ac-cca
                 Guinea pig  -------gacct-----------g-----------------gatccg----ac--tggg-g---ac-cca
                 Chinchilla  -------cgccg-----------g-----------------aaaccac---cc--tcgg-g---ac-cca
           Brush-tailed rat  --g----agtct-----------a-----------------aaactgc---cc--tcag-g---ac-cca
                     Rabbit  --cccg-agccc-----------g-----------------gagccacgctgc--ccgg-a---cc-cca
                        Pig  --cgga-gccca-----------g-----------------gc---------c--cccc-g---gcccca
                    Dolphin  --tcgc-gctct-----------g-----------------ga---------t--ccct-a---gctccc
               Killer whale  --tcgc-gccct-----------g-----------------ga---------c--cccc-a---gccccc
           Tibetan antelope  --ttgc-tcccg-----------c-----------------ga---------t--ctcc-a---gc----
                        Cow  --ttgc-tcccg-----------g-----------------ga---------t--ctcc-a---gc----
                      Sheep  --ttgc-tcccg-----------c-----------------gc---------t--ctcc-a---gc----
              Domestic goat  --ttgc-tcccg-----------c-----------------ga---------t--ctcc-a---gc----
                      Horse  tctcgc-gcccg-----------g-----------------ga---------c--cctc-a---cc-ccg
           White rhinoceros  tctcgc-gcccg-----------g-----------------ga---------c--gcgc-a---cc-ctg
                        Cat  tttcgc-gcctg-----------g-----------------ga---------c--ccgc-g---cc-cca
                        Dog  --tcac-gt-------------------------------------------------------------
                    Ferret   ttttgc-gcccg-----------g-----------------ga---------c--ccgc-a---cg-cca
                      Panda  tttcgc-gcctg-----------g-----------------ga---------c--ccgc-a---cc-cca
             Pacific walrus  tttcgc-gcccg-----------c-----------------ga---------c--ccgc-a---cc-gca
               Weddell seal  tttcgc-gcccg-----------g-----------------ga---------c--ccgc-a---cc-cca
                    Megabat  ctcggc-gccca-----------------------------ggtccccctt-c--ttgc-g---cc-cgg
                   Microbat  caccgc-gcacg-----------ggtcgccctcgcaggccagattctccct-c--ctgc-g---cc-cgg
              Big brown bat  tcctgc-gcccg-----------g-----------------gatcccgcac-c--ccgc-a---cc-ccg
                   Elephant  --ccac-aaccg-----------g-----------------ga---------c--cctg-c---gt-ccc
                    Manatee  --ccac-aacca-----------g-----------------ga---------t--cccg-c---gc-cac
           Cape golden mole  --ctgc-aaccc-----------g-----------------ga---------c--ccgg-c---tc-ccc
                     Tenrec  --ccgg-caccc-----------a-----------------ga---------ctgcagg-g---ac-cct
                   Aardvark  --ctgc-aacct-----------g-----------------aa---------c--ccac-t---gc-cct
                  Armadillo  --cccc-agcc------------g-----------------gc---------t--ccgg-g---at-ccc
                Zebra finch  --tcac-tggcaccaacatgtgag-----------------gt---------g--ccag-g---at-t--
         American alligator  --tcac-ttcccaccccat----g-----------------gc---------t--ctgg-t---gc-c--
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Marmoset  ======================================================================

                      Human  -----ga-ccctg-----------------------------------------gt-ac--cg-gcgc--
                      Chimp  -----ga-ccctg-----------------------------------------gt-ac--cg-gcgc--
                    Gorilla  -----ga-ccctg-----------------------------------------gt-ac--cg-gcgc--
                  Orangutan  -----ga-ccctg-----------------------------------------gt-ac--cg-gcgc--
                     Gibbon  -----ga-ccctg-----------------------------------------gt-ac--cg-gcgc--
                     Rhesus  -----ga-ccccg-----------------------------------------gt-ac--ag-gcgc--
        Crab-eating macaque  -----ga-ccccg-----------------------------------------gt-ac--ag-gcgc--
                     Baboon  -----ga-ccccg-----------------------------------------gt-ac--ag-gcgc--
               Green monkey  -----ga-cccgg-----------------------------------------gt-ac--ag-gcgc--
            Squirrel monkey  -----ga-ccccg-----------------------------------------gc-ac--gc-gcgc--
                   Bushbaby  -----ga-cccgg-----------------------------------------gc-cc--ggcgagc--
         Chinese tree shrew  -----aa---cgg-----------------------------------------gt-cc--cgcgcgc--
                   Squirrel  -----ga-ccccgcagagcg------------g------------tg------cgt-ct--tgag-gc--
     Lesser Egyptian jerboa  ---------cccg------a------------g------------cg------cgt-cctgggcgcgc--
               Prairie vole  -----ga-ccacg------a------------g------------ct------tgt-cc--cgcctgc--
            Chinese hamster  -----ga-ccacg------a------------g------------ct------tct--c--agcctgc--
             Golden hamster  -----ga-ccacg------a------------g------------ct------tct-cc--cgcctgc--
                      Mouse  -----ga--ccgg------a------------g------------ct------tgt-ca--ggcgcgc--
                        Rat  -----ga-ccccg------a------------c------------ct------tgt-cc--ggcgcgc--
             Naked mole-rat  -----gg-cagag------c------------g------------ca------agcttg--cgctggcct
                 Guinea pig  -----gc-catca------a------------g------------gg------cac-ca--tgctcacct
                 Chinchilla  -----gc-cagag------c------------g------------ca------cgc-tg--ggctcacct
           Brush-tailed rat  -----gc-cagag------c------------g------------ca------cgc-tg--tgctcactt
                     Rabbit  -----gccccggg------a------------g------------cg------ggt-cg--cgcgcgc--
                        Pig  -----gc-cctgg------c------------a--c---cgaacacc------cgg-cc--cgcgcgc--
                    Dolphin  -----gt-cctcg------c-----cctccgac--c---agagagcc------cac-cg--cgcgcgc--
               Killer whale  -----gc-ccccg------tccccgcccccgcc--c---agagagcc------cac-cg--cgcgcgc--
           Tibetan antelope  --------------------------------a--c---agagaacc------cgt-cg--cgcgagc--
                        Cow  --------------------------------a--c---agagaacc------cgt-cg--cgcgagc--
                      Sheep  --------------------------------a--c---agagaacc------cgt-cg--cgcgagc--
              Domestic goat  --------------------------------a--c---agagaa-c------cgt-cg--cgcgagc--
                      Horse  -----ga-ccccg------c------------a--c---agagaacc------ggc-cg--c--gcgc--
           White rhinoceros  -----ga-ccccg------c------------a--c---agagaacc------ggc-cg--c--gcgc--
                        Cat  -----ga-ctccg------c------------c--g---ggagaccc------ggc-cg---gcgcgc--
                        Dog  ---------------------------------------------cc------agc-cg--cgcgcgc--
                    Ferret   -----ga-ctc-g------c------------a--c---ggagaacc------ggc-gg--cgcgcgc--
                      Panda  -----ga-ctccg------c------------a--c---ggagaacc------ggc-cg--cgcgcgc--
             Pacific walrus  -----ga-ctcgg------c------------a--c---ggagaacc------ggc-ag--cgagcgc--
               Weddell seal  -----ga-ctcgg------c------------a--c---ggagaacc------ggc-ag--c--gcgc--
                    Megabat  -----ga-ccccg------c------------g--c---------cccgggcgcgc-ac--g--gtgc--
                   Microbat  -----ga-ccccg------c------------a--g---------cc------cgc-ag--t--ccgc--
              Big brown bat  -----ca-ccccg------c------------a--c---------cc------cgc-ac--a--ggga--
                   Elephant  -----gg-acctg------g------------ggac---tgaaggca------ggc-cg--ctcgcgc--
                    Manatee  -----gg-atctc------c------------ggac---cgagagcg------agc-cg--cccgcgt--
           Cape golden mole  -----ag-acctg------g------------agac---agagagct------ggc-tg--ccagtag--
                     Tenrec  gagcagg-agctg------g------------ggaccgaggaggaac------cgc-cg--ccggcgc--
                   Aardvark  -----gg-acctg------g------------ggat---agagagcg------agc-ct--ccaacac--
                  Armadillo  -----gg-gcccg------a------------gagc---cgtgg------------------ccgcgc--
                Zebra finch  -----gc-accca------a------------g--------------------g---ca--catgtgc--
         American alligator  -----gg-ccccg------c------------t--------------------gac-cg--cccgcgc--
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Marmoset  ======================================================================

                      Human  -cgc----tcacct-------gccg-----------cgctccaggcg-----------
                      Chimp  -cgc----tcacct-------gccg-----------cgctccaggcg-----------
                    Gorilla  -cgc----tcacct-------gccg-----------cgctccaggcg-----------
                  Orangutan  -cgc----tcacct-------gccg-----------cgctccaggcg-----------
                     Gibbon  -cgc----tcacct-------gccg-----------cgctccaggcg-----------
                     Rhesus  -cgc----tcacct-------gccg-----------agctccgggcg-----------
        Crab-eating macaque  -cgc----tcacct-------gccg-----------agctccgggcg-----------
                     Baboon  -cgc----tcacct-------gccg-----------agctccgggcg-----------
               Green monkey  -cgc----tcacct-------gccg-----------agctccgggcg-----------
            Squirrel monkey  -cgc----tcacct-------gccg-----------cgctcc-ggcg-----------
                   Bushbaby  -agg----tc------------------------------------------------
         Chinese tree shrew  -tgc----ttacct-------gcct-----------cgctcccggcc-----------
                   Squirrel  -cac----ttacct-------gccgcgctcgg---c----------------------
     Lesser Egyptian jerboa  -cgc----tcacct-------gcctagcgc----------------------------
               Prairie vole  -tgc----tcacct-------gctg---------------------------------
            Chinese hamster  -tgc----tcacct-------gctg---------------------------------
             Golden hamster  -tgc----tcacct-------gctg---------------------------------
                      Mouse  -tac----tcacct-------gttg---------------------------------
                        Rat  -tgc----tcacct-------gctg---------------------------------
             Naked mole-rat  gcgc----tcgcctgcgggcacctg---------------------------------
                 Guinea pig  gtg---------ctgtggg--actg---------------------------------
                 Chinchilla  gtac----tcacctgtggc--actg---------------------------------
           Brush-tailed rat  gtgc----tcacctgcgat--gtga---------------------------------
                     Rabbit  -cgc----ttacct-------ggcgcgctcggggcc----------------------
                        Pig  -cgc----ttacct-------gccg---------------------------------
                    Dolphin  -tgc----tcacct-------gcgg---------------------------------
               Killer whale  -cgc----tcacct-------gcgg---------------------------------
           Tibetan antelope  -cac----ttacct-------gctg---------------------------------
                        Cow  -cac----ttacct-------gctg---------------------------------
                      Sheep  -cac----ttacct-------gctg---------------------------------
              Domestic goat  -cac----ttacct-------gctg---------------------------------
                      Horse  -cgc----ttacct-------gcag---------------------------------
           White rhinoceros  -cgc----ttacct-------gcgg---------------------------------
                        Cat  -cgc----tcacct-------gcgg---------------------------------
                        Dog  -cgc----tcacct-------gcgg---------------------------------
                    Ferret   -gac----ttaccc-------gagg---------------------------------
                      Panda  -cgc----ttacct-------gc-----------------------------------
             Pacific walrus  -ggc----ttacct-------gccg---------------------------------
               Weddell seal  -ggc----tcacct-------gccg---------------------------------
                    Megabat  -cgc----tcacct-------gcgc---------------------------------
                   Microbat  -agc----ccgcac-------cccg---------------------------------
              Big brown bat  -cgc----tcacct-------gccg---------------------------------
                   Elephant  -cgc----ttacct-------gtcg---------------------------------
                    Manatee  -cgc----ttactt-------gcag---------------------------------
           Cape golden mole  -ctc----ttacct-------gctg---------------------------------
                     Tenrec  -cgc----ttacct-------gccg---------------------------------
                   Aardvark  -cac----ttacct-------gctg---------------------------------
                  Armadillo  -cgc----ctacct-------gccg---------------------------------
                Zebra finch  -tgttgtgtcccct-------gcca----------------------cgtgccacgct
         American alligator  -ccttgtgtctcca-------gccc----------------------ag----gcgca
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                     Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                   Marmoset  ==========================================================

Inserts between block 3 and 4 in window
B D               Bushbaby 4bp
        Chinese tree shrew 1bp
B D                    Pig 13bp
B D                Dolphin 15bp
              Killer whale 13bp
          Tibetan antelope 17bp
B D                    Cow 17bp
B D                  Sheep 17bp
             Domestic goat 17bp
B D                  Horse 14bp
B D       White rhinoceros 14bp
B D                    Cat 13bp
B D                    Dog 10bp
B D                Ferret  14bp
B D                  Panda 12bp
            Pacific walrus 14bp
              Weddell seal 14bp
B D                Megabat 12bp
B D               Microbat 34bp
             Big brown bat 13bp
B D               Elephant 21bp
B D                Manatee 21bp
          Cape golden mole 16bp
B D                 Tenrec 16bp
                  Aardvark 17bp
B D              Armadillo 14bp

Alignment block 4 of 43 in window, 42880025 - 42880042, 18 bps 
B D                   Human  g-cgctccccgc---ccc------------------t-cg---------c-----------
B D                   Chimp  g-cgctccccgc---ccc------------------t-cg---------c-----------
B D                 Gorilla  g-cgctccccgc---ccc------------------t-cg---------c-----------
B D               Orangutan  g-cgctccccgc---ccc------------------t-cg---------c-----------
B D                  Gibbon  g-cgctccccgc---ccc------------------t-tg---------c-----------
B D                  Rhesus  g-cgctccccgc---ccc------------------t-tg---------c-----------
B D     Crab-eating macaque  g-cgctccccgc---ccc------------------t-tg---------c-----------
B D                  Baboon  g-cgctccccgc---ccc------------------t-tg---------c-----------
               Green monkey  g-cgctccccgc---ccc------------------t-tg---------c-----------
B D                Marmoset  g-cgctccccgc---ccc------------------t-cg---------c-----------
B D         Squirrel monkey  g-cgctccccgc---ccc------------------t-cg---------c-----------
B D                Bushbaby  g-cgccgctcac---ctg------------------t-gg---------c-----------
         Chinese tree shrew  c-tgctcccagc---ccc------------------tccg---------c-----------
B D                Squirrel  cgcgctccccgc---ccctccgccttcctccgcgcgt-ct---------t-----------
     Lesser Egyptian jerboa  --cgcccctcgccttcct------------------c-ct---------c-----------
               Prairie vole  --cgcttcccgc---ccc------------------t-ct---------c-----------
B D         Chinese hamster  --cgctccctggc--ccc------------------t-ct---------c-----------
             Golden hamster  --tgctccccgg---ctc------------------t-ct---------c-----------
B D                   Mouse  --cgcttcccgc---ccc------------------t-ct---------c-----------
B D                     Rat  --tgctccccgc---ccc------------------t-ct---------c-----------
B D          Naked mole-rat  --cactcacctg---cgc------------------t-gc---------t-----------
B D              Guinea pig  --cgctcccagc---cac------------------c-gc---------c-----------
                 Chinchilla  --cgctccccgc---cgc------------------c-ac---------c-----------
           Brush-tailed rat  --cg-----tgt---cg--------------------------------------------
B D                  Rabbit  ggcgctccccgc---cccttgcccttcct-------c-ct---------c-----------
B D                     Pig  g-cgctccccgc---ccc------------------t-cg---------c-----------
B D                 Dolphin  g-cgctctccgc---ccc------------------t-tc---------t-----------
               Killer whale  g-cgctccccgc---ccc--------------------tc---------t-----------
           Tibetan antelope  c-ttcccctcac---ccc------------------t-tc---------t-----------
B D                     Cow  c-ctcccctcgc---ccc------------------t-tc---------t-----------
B D                   Sheep  c-ctcccctcac---ccc------------------t-tc---------t-----------
              Domestic goat  c-ctcccctcag---ccc------------------t-tc---------t-----------
B D                   Horse  g-cgctccccgc---tcc------------------t-cg---------c-----------
B D        White rhinoceros  a-cgcttcccgc---ctc------------------t-cg---------c-----------
B D                     Cat  g-cgctctccgc---ccc------------------t-ggctcgtcctcc-----------
B D                     Dog  g-cgctccccgc---ccc------------------t-cg---------c-----------
B D                 Ferret   g-cgctctccgc---ccc------------------t-tg---------c-----------
B D                   Panda  g-cgctctccgc---ccc------------------t-tg---------c-----------
             Pacific walrus  g-cgttctccgc---ccc------------------t-tg---------c-----------
               Weddell seal  g-cgctctccgc---ccc------------------t-tg---------c-----------
B D                 Megabat  g-cgc-ccccgt---ccc------------------t-cg---------c-----------
B D                Microbat  g-cgc-ccccgc---ccc------------------t-cg---------c-----------
              Big brown bat  g-cgc-ccccgc---ccc------------------t-cg---------c-----------
B D                Elephant  g-cgctcaccgc---cgg------------------g-cg---------c-----------
B D                 Manatee  g-cgctccgggc---cct------------------g-cg---------c-----------
           Cape golden mole  g-cgctctccgc---ccc------------------t-cg---------c-----------
B D                  Tenrec  g-cgctcgccgc---ccc------------------g-gg---------t-----------
                   Aardvark  g-tgctccctgc---cgc------------------t-cg---------c-----------
B D               Armadillo  ---gctcccgcc---cct------------------c-cg---------c-----------
B D             Zebra finch  ------gcacgg---tcc------------------t-ct---------cagcatctcacc
B D      American alligator  ------gtccaa---cct------------------g-ct---------gggga------a
      David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D                  Alpaca  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Inserts between block 4 and 5 in window
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Sheep 1bp
             Domestic goat 1bp
B D                  Horse 4bp
B D       White rhinoceros 7bp
B D                    Cat 4bp
B D                    Dog 4bp
B D                Ferret  4bp
B D                  Panda 4bp
            Pacific walrus 4bp
              Weddell seal 4bp
B D                Megabat 4bp
B D               Microbat 4bp
             Big brown bat 3bp
B D               Elephant 1bp
B D                Manatee 1bp
          Cape golden mole 1bp
B D                 Tenrec 1bp
                  Aardvark 1bp
B D              Armadillo 1bp

Alignment block 5 of 43 in window, 42880043 - 42880143, 101 bps 
B D                   Human  cctc-cgc--c--tccg-c-----------ct-----c---cgcctcc---tgcttagctcgc-g-c---
B D                   Chimp  -------c--c--tccg-c-----------ct-----c---cgcctcc---tgcttagctcgc-g-c---
B D                 Gorilla  -------c--c--tcct-c-----------ct-----c---cgcctcc---ggcttagctcgc-g-c---
B D               Orangutan  -------c--c--tcgt-c-----------ct-----c---cgcctcc---tgcttggctcgc-g-c---
B D                  Gibbon  -------c--c--tcct-c-----------cg-----c---cgccgcc---tgcttagctcgc-g-c---
B D                  Rhesus  -------c--c--t-----------------------------cctcc---gacttagctcgc-g-c---
B D     Crab-eating macaque  -------c--c--tcct-c-----------cg-----c---tgcctcc---ggcttagctcgc-g-c---
B D                  Baboon  -------c--c--tcct-c-----------cg-----c---tgcctcc---tgcttagctcgc-g-c---
               Green monkey  -------c--c--tcct-c-----------cg-----c---tgcctcc---tgcttagctcgc-g-c---
B D                Marmoset  -------c--t--tcct-c-----------ct-----c---cgcctcc---tgcttggctcgc-g-c---
B D         Squirrel monkey  -------c--t--tcct-t-----------ct-----c---cgcctcc---tgcttggctcgc-g-c---
B D                Bushbaby  ----------------t-c-----------cc-----g---ggcctcc---tactgctctcgc-g-t---
         Chinese tree shrew  -------c--t--tcct-c-----------ct-----c---cgcctcc---tactgagctccc-gtc---
B D                Squirrel  -----cac--c--tccg-c-----------ctcccggg---aggtcgc---gccttc-ctctg-c-c---
     Lesser Egyptian jerboa  -----ctc--c--tcct-c-----------ct-----c---ggcccca---gccggc-gtcgt-c-tggc
               Prairie vole  -----cgc--c--tggg-c-----------cc-----a---agctctg---gatttc-ctcgt-c-c---
B D         Chinese hamster  -----tgc--g--ggtg-c-----------cc-----a---aactccg---ggcttc-ctcct-c-c---
             Golden hamster  -----cgc--c--ggcg-c-----------cc-----a---agctctg---ggcttc-ctcct-c-c---
B D                   Mouse  -----cgc--c--tctg-t-----------cc-----g---agctctt---ggcttc-ctcgt-c-c---
B D                     Rat  -----cgc--c--tccg-c-----------cg-----g---ggctctc---ggtttc-cttgt-c-c---
B D          Naked mole-rat  -----gga--c--tggg-ctccagtccttacc-----g---cgtcc------------------c-t---
B D              Guinea pig  -----tgt--c--tgaa-c-----------ca-----g---cgtcc------------------c-t---
                 Chinchilla  -----tct--ctctgag-c-----------cc-----c----gtcc------------------c-t---
           Brush-tailed rat  -------------ggag-c-----------cc-----a---ggtac------------------t-t---
B D                  Rabbit  -----cgc--c--tcct-c-----------gg-----g---agctcgc---gtcttc-ctcgc-c-c---
B D                     Pig  --tc-ttc--c--ttct-c-----------ct-----c---cgcctcc---tccgaagctcgc-ggc---
B D                  Alpaca  ---------------cc-t-----------cc-----c---cgcc----------gggttcgc-gtc---
B D                 Dolphin  cctt-tcttct--cctt-c-----------tt-----a---cgcctac---tt-----------------
               Killer whale  cctt-cct--c--ccct-c-----------tt-----c---cgcctcc---t------------------
           Tibetan antelope  cctc-ttt--c--ttct-c-----------ct-----c---tgcctcc---tctggagttcgc-ttc---
B D                     Cow  cctc-ctc--c--ttct-c-----------ct-----c---cgcctcc---tctggagttcgc-tgc---
B D                   Sheep  cctc-ctc--c--ttct-c-----------ct-----c---tgcctcc---tctggagttcgc-ttc---
              Domestic goat  cctc-ctc--c--ttct-c-----------ct-----c---tgcctcc---tctggagttcgc-ttc---
B D                   Horse  cctc-ttc--c--ttct-c--tttctcctctt-----c---ggcctct---taccgagctcgc-gcc---
B D        White rhinoceros  cctc-ctc--c--tcct-c--tttctcctcct-----c---tgcctcc---taccgagctcgc-gtc---
B D                     Cat  cctc-ctc--t--tcct-c-----cgcctcct-----c---ggcctcc---tgcggaactcgc-gtc---
B D                     Dog  cct--------------------------cct-----c---cgcctcc---cgcggcgct--c-ggc---
B D                 Ferret   cctc-ctc--c--gccg-c-----cgccgcct-----c---ccccgcc---ccc---gct--c-gtc---
B D                   Panda  cctc-ctc--t--tcct-c-----cgcctcct-----c---ctcctcc---cgccgagct--c-gtc---
             Pacific walrus  cctc-ctc--t--tcct-c-----cacctcct-----c---cgcctcc---tgcggagct--c-gtc---
               Weddell seal  cctc-ttc--t--tcct-c-----cacctcct-----c---cgcctcc---tgcggagct--c-gtc---
B D                 Megabat  cctc-tgc--c--gccgcc-----------------------gcctcc---ttccgagctcgc-gtc---
B D                Microbat  cctc-ctg--c--tcca-c-----------------------gcctcc---cacggagctcgt-gcc---
              Big brown bat  cctc-ctg--c--tcca-c-----------------------gcctcc---cacggagctcgt-gtc---
B D                Elephant  ctgc-ctc--c--ttct-c-----------ct-----c---ctcctct--------gctcaat-t-c---
B D                 Manatee  ctgt-ttc--c--tcct-c-----------ct-----c---cgccttt---ttcaagctcccg-t-c---
           Cape golden mole  tagc-ctc--c--tcct-c-----------ct-----c---cgcttcc---ttccgaggccct-t-c---
B D                  Tenrec  cggc-ctg--c--gcct-c------------------------gtgcc---ctccgagcccct-t-g---
                   Aardvark  ctgc-ctc--c--gcct-c-----------ct-----ccttcgcttcc---ttttgagcttcc-t-t---
B D               Armadillo  ctgcgccg--c--cgcc-c-----------gg-----c---cacctcc---cgccgagtccccgt-c---
B D             Zebra finch  ----------------------------------------atgccagccttggccctgctgc--t-g---
B D      American alligator  ----------------------------------------gtgccggc---ggccccgcaccg-c-g---
      David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  -------ctact-----cgg-c-cc------------------------ggccc--------g--ccct-
                      Chimp  -------ctact-----cgg-c-cc------------------------ggccc--------g--ccct-
                    Gorilla  -------ctact-----cgg-c-cc------------------------ggccc--------g--ccct-
                  Orangutan  -------ctact-----cgg-c-cc------------------------ggccg--------g--ccct-
                     Gibbon  -------ctact-----cgg-c-cc------------------------ggccc--------g--ccct-
                     Rhesus  -------cttct-----cga-c-cc-------------------------gccg--------g--ccct-
        Crab-eating macaque  -------cttct-----cga-c-cc-------------------------gccg--------g--ccct-
                     Baboon  -------cttct-----cta-c-cc-------------------------gccg--------g--ccct-
               Green monkey  -------cttct-----cga-c-cg-------------------------gccg--------g--ccct-
                   Marmoset  -------cttct-----cgg-c-ccg---gcgc------ccgg-tacccgacct--------g--ccct-
            Squirrel monkey  -------cttcc-----cgg-c-tcg---gcgc------ccgg-tctccgacct--------g--ccca-
                   Bushbaby  -------ctcct-----ctg-c-ag----gcac------cgga-gtccccaacc--------t--tcct-
         Chinese tree shrew  -------ctcct-----agg-c-cgg---gctc------acaactcccccacct--------t--cccc-
                   Squirrel  ----cggcgctc-----aag-t-cc----------------------cgggcct--------t--cccc-
     Lesser Egyptian jerboa  ggccagggcccc-----agt-c-tc----------------------cctaatt--------t--ttct-
               Prairie vole  -------gtccc-----aag-tccc----------------------ccgacct--------c--cccc-
            Chinese hamster  -------gcccc-----aag-t-cc----------------------acgacct--------t--cccc-
             Golden hamster  -------gcccc-----aag-t-cc----------------------acgacct-------cc--cccc-
                      Mouse  -------gctcc-----aag-t-ac----------------------acgacct--------a--ctcc-
                        Rat  -------actcc-----aag-t-ac----------------------acgacct--------a--ctcc-
             Naked mole-rat  -------gtccc-----agg-c--------------------------cggcca-----------ggcc-
                 Guinea pig  -------ctccc-----agg-c--------------------------ctgctc--------c--agcc-
                 Chinchilla  -------ctggc-----agg-c--------------------------ccgctg-----------ggcc-
           Brush-tailed rat  -------ctccc-----agg-c--------------------------ctgccg--------caaggct-
                     Rabbit  -------ggcgccgccgaag-c-tc----------------------ccggcctaacccccac--cccc-
                        Pig  -------ttcct-----cgg-c-cca---gct-------cggagttc-cgatcc--------t--cccc-
                     Alpaca  -------ttcct-----ctg-c-cca---gcg-------ccgagtccccgatcc--------t--cccc-
                    Dolphin  ------------------------------ac-------tggagttcccgattc--------t--tcctc
               Killer whale  -------------------------------c-------cggagtccccgatcc--------t--cccc-
           Tibetan antelope  -------ttcct-----cgg-c-cca---gct-------cggactcccctatcc--------t--cccc-
                        Cow  -------ttcct-----cgg-c-ccg---gct-------cggagtcctcgatcc--------t--cccc-
                      Sheep  -------ttcct-----cgg-c-cca---gct-------cggagtccccgatcc--------t--cccc-
              Domestic goat  -------ttcct-----cgg-c-cca---gct-------cggagtccccgatcc--------t--cccc-
                      Horse  -------ttcct-----cttcc-ccc---ccgc------aggagttcccgaccc--------t--cccc-
           White rhinoceros  -------ttcct-----ctg-c-cca---gcac------aggagtccccgacac--------t--cccc-
                        Cat  -------ttcct-----ctg-t-ccg---gag------------------------------t--ccc--
                        Dog  -------ttcct-----cgg-c-cct---gca---------------------c--------t--cccc-
                    Ferret   -------ttcct-----cgg-c-ccg---gcg-------cggagtccccgacgc--------t--ccct-
                      Panda  -------ttcct-----ctg-t-ccg---gcgc------cgaagtccccgacgc--------t--ccct-
             Pacific walrus  -------ttcct-----ctg-c-ccg---gcgc------ccaactccccgacac--------t--cccc-
               Weddell seal  -------ttccc-----ctg-c-ccg---gcgc------ccaactccccgacac--------t--cccc-
                    Megabat  -------tccct-----ctg-c-cct---gctc------cagagtccccgaccc--------t--ccc--
                   Microbat  -------ctcct-----cga-t-ccc---gcgc------gggagtctccggtcc--------t--cccg-
              Big brown bat  -------ctccg-----aga-t-cgc---gcgc------gggaatctccgatcc--------t--cccg-
                   Elephant  -------ttcct-----caa-g-ctg---gctc------cccagtcccaggccc--------t--ccccc
                    Manatee  -------ttcct-----cga-c-ccg---gctg------ccaagtccccaaccc--------t--ccccc
           Cape golden mole  -------ttcctc----cag-c-cagt--gttg--------gagtccctgttcc--------t--ctcct
                     Tenrec  -------tccct-----cgg-c-ccgc--gctt---aa-ccaagtccctgaccc--------t--ccccg
                   Aardvark  -------ctcct-----ccg-c-cca---acgc------ctaaat-actgaccc--------t--ccgca
                  Armadillo  -------ctccg-----ccg-c-ccg---gcgc------ccgagtcccggaccc--------t--cctcc
                Zebra finch  -------ccctt-----gag-c-ctgtcacctc---agcaggggtaccaggaca--------g--caca-
         American alligator  -------ttcac-----cag-c-cagcagctgctggagctggagcatcagttca----agctg--aaca-
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  --gg----ctc--t-cgctttaat-ctc-aggaggc-ggtgt-cc--cag----------------ggt-
                      Chimp  --gg----ctc--t-cgctttaat-ctc-aggaggc-ggtgt-cc--cag----------------ggt-
                    Gorilla  --gg----ctc--t-cgctttaat-ctc-aggaggc-ggtgt-cc--cag----------------ggt-
                  Orangutan  --gg----ctc--t-cgctttaat-ctc-aggaggc-ggtgt-cc--cag----------------ggc-
                     Gibbon  --gg----ctc--t-cgctttaac-ctc-aggaggc-ggtgt-cc--cag----------------ggc-
                     Rhesus  --gg----ctc--t-cactttaat-ctc-aggaggc-ggcgt-cc--cag----------------ggc-
        Crab-eating macaque  --gg----ctc--t-cactttaat-ctc-aggaggc-ggcgt-cc--cag----------------ggc-
                     Baboon  --gg----ctc--t-cactttaat-ctc-aggaggc-ggcgt-cc--cag----------------ggc-
               Green monkey  --gg----ctc--t-cactttaat-ctc-aggaggc-ggcgt-cc--cag----------------ggc-
                   Marmoset  --gg----ctc--t-cgcttaaat-ctc-aggaggc-ggcgt-cc--cag----------------ggc-
            Squirrel monkey  --gg----ctc--t-cgcttaaat-ctc-aggaggc-ggcgt-cc--cag----------------ggc-
                   Bushbaby  --ga----ctc--t-cgcttttat-ttc-aggaggt-ggcgt-cc--aag----------------tgc-
         Chinese tree shrew  --ag----ttc--t-ctctttaat-caa-aggaggc-ggcgt-cc--tag----------------agc-
                   Squirrel  --ag----atc--t-cgctttaat-ctc-aggaggc-ggtgtccc--cag----------------ggc-
     Lesser Egyptian jerboa  --gg----ctc--t-cgctttaat-ctc-cggaggc-ggcgt-cc--cag----------------gac-
               Prairie vole  --ag----ctc--t-tgcttaaat-ctc-cggaggc-ggcgt-cc--tag------------------a-
            Chinese hamster  --ag----ctc--t-cgcttaaat-ctc-cggaggc-ggcgt-cc--aaa----------------gag-
             Golden hamster  --ag----ctc--t-cgcttaaat-ctc-cggaggt-ggcgt-cc--cag----------------gag-
                      Mouse  --ag----ttc--t-cgcttaaat-ctc-cggaggc-ggcgt-cc--cgg----------------gag-
                        Rat  --ag----ctc--t-cgcttaaat-ctc-cggaggc-ggcgt-cc--cag----------------gag-
             Naked mole-rat  --ag----aga--c-agctttaac-ctc-a-ggggc-ggggc-ca--cag----------------ggc-
                 Guinea pig  --ag----ggc--c-ggctttaac-ttc-agggggc-ggtgc-ca--ca-----------------gcc-
                 Chinchilla  --c-----agc--c-ggctttcac-ttc-aaggggc-ggtgc-ca--cag----------------ggc-
           Brush-tailed rat  --ag----agc--c-ggctttcac-ctc-cgggggc-ggtgc-ca--cag----------------ggc-
                     Rabbit  --cg----cta--g-cgctttaat-ctc-aggaggc-ggcgt-cc--gcc----------------ggc-
                        Pig  --gg----ctc--t-ggctttaat-ccc-cggaggc-ggtgt-cc--cag----------------ggc-
                     Alpaca  --gg----ctc--t-cgctttaat-ccc-gggaggc-ggtgt-cc--gag----------------tac-
                    Dolphin  g-gg----ctc--tccgccttaat-cccgagaaggctggtgt-tccgaag----------------tggg
               Killer whale  --gg----ctc--t-cgctttaat-cc--gggaggc-ggtgt-cc--gag----------------tgg-
           Tibetan antelope  --gg----ctc--t-tgctttaat-cct-gagaggc-ggtgt-cc--gag----------------cgc-
                        Cow  --gg----ctc--t-cgctttaat-cct-gggaggc-ggtgt-cc--gag----------------cgc-
                      Sheep  --gg----ctc--t-cgctttaat-cct-gggaggc-ggtgt-cc--gag----------------cgc-
              Domestic goat  --gg----ctc--t-cgctttaat-cct-gggaggc-ggtgt-cc--gag----------------cgc-
                      Horse  --tg----ctc--t-cgctttaat-ccc-gggaggcgggtgt-cc--gag----------------tgc-
           White rhinoceros  --tg----ctc--t-cgctttaat-ccc-gggaggc-ggttt-cc--gag----------------tgc-
                        Cat  ---------------cgctttaat-ccc-gggaggc-ggtgt-cg--gag----------------cgc-
                        Dog  --gg----ctc--t-cgctttaat-ccc-gggaggc-ggtgt-cc--aag----------------tgc-
                    Ferret   --gg----cgc--t-cgcttaaat-ccc-gggaggc-ggtgt-cc--gac----------------tg--
                      Panda  --gg----ctc--t-ctctttaat-ccc-gggaggc-ggtat-cc--aag----------------tgc-
             Pacific walrus  --gg----ctc--t-cgctttaat-ccc-gggaggc-ggtgt-cc--gag----------------tgc-
               Weddell seal  --gg----ctc--t-cgctttaat-ccc-gggaggc-ggtgt-cc---ag----------------tgc-
                    Megabat  --gg----ccc--t-cgcttaaat-ccc-gggaggc-ggtgt-cc--agg----------------tgc-
                   Microbat  --gg----ctc--g-cgctttaat-cct-gggaggc-ggcgt-cc--gag----------------tgc-
              Big brown bat  --gg----ctc--t-cgctttaat-ccc-gggaggc-ggcgt-cc--gag----------------cgc-
                   Elephant  cggg----ctc--t-cgctttaat-atc-cggaggc-ggtgt-cc--caa----------------gaa-
                    Manatee  c-gg----ctc--t-cgctttaac-ctc-tggaggc-ggggt-cc--cag----------------gga-
           Cape golden mole  --gg----ctc--t-tgctttaat-ctc-cagaggc-agcgg-cc--cag----------------gac-
                     Tenrec  --ggctgcctc--g-ggctttaat-ccc-cggaggc-ggcgt-cc--cag----------------gtt-
                   Aardvark  --gg----cgc--t-agctttaat-ctc-cggaggc-ggtgt-cc--cag----------------ggc-
                  Armadillo  c-cg----ctc--t-cgctttaat-ctc-gggaggc-ggtgt-cc--gag----------------cgc-
                Zebra finch  --gg----cacagc-tgcactgatgaac-aacaggc-----t-tc--aag-------------tgacac-
         American alligator  --ag----tac--c-tgtcccggc---c-taagcgc-----t-tc--gaggtggccacgtccctcatgc-
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  -ccagg-
                      Chimp  -ccagg-
                    Gorilla  -ccagg-
                  Orangutan  -ccagg-
                     Gibbon  -ccagg-
                     Rhesus  -ccagg-
        Crab-eating macaque  -ccagg-
                     Baboon  -ccagg-
               Green monkey  -ccagg-
                   Marmoset  -ccagg-
            Squirrel monkey  -ccagg-
                   Bushbaby  -ccagg-
         Chinese tree shrew  -ccaag-
                   Squirrel  -tcagg-
     Lesser Egyptian jerboa  -ccagg-
               Prairie vole  -tttag-
            Chinese hamster  -ccagg-
             Golden hamster  -ccagg-
                      Mouse  -ccagg-
                        Rat  -ccagg-
             Naked mole-rat  -ccagg-
                 Guinea pig  -ccggg-
                 Chinchilla  -ccagg-
           Brush-tailed rat  -ccagg-
                     Rabbit  -tctgg-
                        Pig  -ccagg-
                     Alpaca  -ccagg-
                    Dolphin  cctagg-
               Killer whale  -ccagg-
           Tibetan antelope  -ccagg-
                        Cow  -ccagg-
                      Sheep  -ccagg-
              Domestic goat  -ccagg-
                      Horse  -tcagg-
           White rhinoceros  -tcagg-
                        Cat  -ccagg-
                        Dog  -ccagg-
                    Ferret   -ccagg-
                      Panda  -ccagg-
             Pacific walrus  -ccagg-
               Weddell seal  -ccagg-
                    Megabat  -ccagg-
                   Microbat  -ccagg-
              Big brown bat  -ccagg-
                   Elephant  -ctaga-
                    Manatee  -cctga-
           Cape golden mole  -ccaag-
                     Tenrec  -ggagg-
                   Aardvark  -ccaaa-
                  Armadillo  -cccag-
                Zebra finch  -ttctgg
         American alligator  -tcacgg
       David's myotis (bat)  NNNNNNN
           Black flying-fox  NNNNNNN
             Bactrian camel  NNNNNNN

Inserts between block 5 and 6 in window
B D                Dolphin 623bp

Alignment block 6 of 43 in window, 42880144 - 42880188, 45 bps 
B D                   Human  gcgacacccc------caa----------gcggg-tcgcgggtcaccc-tgggc-------gggcggggg
B D                   Chimp  gcgacacccc------caa----------gcggg-tcgcgggtcaccc-tgggc-------gggcggggg
B D                 Gorilla  gcgacacccc------caa----------gcggg-tcgcgggtcaccc-tgggcg-ggcgggggcggggg
B D               Orangutan  gcgacacccc------caa----------gcggg-tcgcgggtcaccc-tgggc-------gggcggggg
B D                  Gibbon  gcgacacccc------caa----------gcggg-tctccggtcaccc-tgggc-------gggcggggg
B D                  Rhesus  gcaacacccc------caaat--------gcgcg-tcgcaggtcaccc-cgggc-------gggcgaggg
B D     Crab-eating macaque  gcaacacccc------caaat--------gcgcg-tcgcgggtcaccc-cgggc-------gggcgaggg
B D                  Baboon  gcaacacccc------caaat--------gcgcg-tcgcgggtcaccc-cgggc-------gggcgaggg
               Green monkey  gcaacacccc------caaat--------gcgcg-tcgcgggtcaccc-cgggc-------gggcgaggg
B D                Marmoset  gcgacacccc------caagc--------gcggg-tcccgggtcaccc-cggga-------gggcggggg
B D         Squirrel monkey  gcgacacccc------caaat--------gcggg-tcccgggtcaccc-cgggc-------aggc-gggg
B D                Bushbaby  gcgacacctc------cacgc--------gcggg-tcctgggtcacct-ggggctcggagaggggacggg
         Chinese tree shrew  gcgacacccc------caagc--------aaagg-tctccggtcacct-cgagc----agggggagggga
B D                Squirrel  gctacacccc-----ccaaac--------gcgaa-tccccgttcaacc-ggggcaggaggaggggacaag
     Lesser Egyptian jerboa  gtgacacccctaaacttaaac--------gcagg-tgccaggtcacct-aggccaggaggaggggacgaa
               Prairie vole  gcaacacccc------taaac--------gcagg-tgccgggtcacct-cggccaggaggaggggacgac
B D         Chinese hamster  gtaacacccc------taaac--------gcagg-tgccgggtcacct-cggccaggaggaggggacggc
             Golden hamster  gtaacacccc------taaac--------gcagg-tgccgggtcacct-cggccaggaggaggggacggc
B D                   Mouse  gtgacacccc------taaac--------gcagg---------cacct-cggccagaaggagggaacggc
B D                     Rat  gtgacacccc------taaac--------gcagg-tgcccggtcacct-cggccaagaggagggaacagc
B D          Naked mole-rat  accacg-ccc------cagac--------ac--g-ccccaggtcgc---------------cgagccagg
B D              Guinea pig  gctaca-ccc------cagac--------ac--gcccccagggcgc---------------agagttggg
                 Chinchilla  gctacgcccc------cagat--------ac--g-ccccaggtca----------------ggagccagg
           Brush-tailed rat  gctacacccc------cagac--------ac--g-ccccgtgtcac---------------ggagccctg
B D                  Rabbit  gcgacacccc------cag-c--------acagg-tcccgggccacct-gcggatgggggaggggacagc
B D                     Pig  gtgacacccc------caagc--------g-cgg-tcccaggtcacct-cgggc-------aggggg---
B D                  Alpaca  gagacacccc------caagc--------gccgg-tcccgggtcacct-cgggc-------gggggg---
B D                 Dolphin  gtgacacccc------caagc--------gccgg-tcccgggtcacct-cgggc-------aggggg---
               Killer whale  gtgacacccc------caagc--------gccgg-tcccgggtcacct-cgggc-------aggggg---
           Tibetan antelope  gcaacacccc------caagc--------gccgg-tcccgggtcacct-ccgac-------agaggg---
B D                     Cow  gcaacacccc------caagc--------gccgg-tcccgggtcacct-cggac-------agaggg---
B D                   Sheep  gcaacacccc------caagc--------gccgg-tcccgggtcacct-cggac-------agaggg---
              Domestic goat  gcaacacccc------caagc--------gccgg-tcccgggtcacct-cgggc-------agaggg---
B D                   Horse  gcgacacccc------caagc--------gttag-tcccgggtcacct-cgagg-------agggggagg
B D        White rhinoceros  gcgacacccc------caagc--------ctaag-tcccgggtcacct-cgtgt-------agggggagg
B D                     Cat  gcgacacccc------taaac--------gc-gg-tcccggggcacct-cgggc-------accgggagg
B D                     Dog  gcgacacccc------taaac--------gc-gg-tcccaggtcacct-ctggc-------agagggagg
B D                 Ferret   gtgacacccc------taaac--------gc-gg-tccccggtgacct-ccagc-------agggggagg
B D                   Panda  gcgacacccc------taaac--------gc-ag-tcccgggtcacct-ccggc-------agggtgggg
             Pacific walrus  gcgacacccc------taaac--------gc-gg-tcccgggtcacct-ccggc-------agggggagg
               Weddell seal  gcgacacccc------taaac--------gc-gg-tcccgggtcacct-ccggc-------agggggagg
B D                 Megabat  gcgacacccc------tgagtg----caagcagg-tccggggtcacct-ggggc-------agggggagg
B D                Microbat  gcaacacccc------ca-gt--------gcagg-tcc----cagtct-cgggc-------tgggggcgg
              Big brown bat  gcaacacccc------caggt--------gcagg-tcc----ccgtctccgggc-------tgggggcgg
B D                Elephant  gagacacgcc------ctagc--------gcagg-tc-taagtcacct-cgggc-------agggggagg
B D                 Manatee  gcgacacgcc------ctagc--------gcagg-tc-cgggtcacct-cgggc-------aggaggagg
           Cape golden mole  gtg--acgcc------cagga--------gcagg-tc-caggtcactt-cggac-------tggaggagg
B D                  Tenrec  gtgacacgcc------ctaga--------gccgg-tc-cgggtcacct-cggac-------agggggagg
                   Aardvark  atgacacgcc------ctaga--------gcggg-tc-caggtcacct-cggac-------agggggagg
B D               Armadillo  gcgacacgcc------caggc--------gcggg-tcgccggtcacct-cccgc-------aggaggcgg
B D             Zebra finch  ---------------------gaagcggggtgga----tggc---aga-ggggc-------ggg------
B D      American alligator  ---------------------agacccaggtggg-tactggcccgcgc-tgggc-------gggagcggc
      David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  ----------
                      Chimp  ----------
                    Gorilla  ----------
                  Orangutan  ----------
                     Gibbon  ----------
                     Rhesus  ----------
        Crab-eating macaque  ----------
                     Baboon  ----------
               Green monkey  ----------
                   Marmoset  ----------
            Squirrel monkey  ----------
                   Bushbaby  ----------
         Chinese tree shrew  ----------
                   Squirrel  ----------
     Lesser Egyptian jerboa  ----------
               Prairie vole  ----------
            Chinese hamster  ----------
             Golden hamster  ----------
                      Mouse  ----------
                        Rat  ----------
             Naked mole-rat  ----------
                 Guinea pig  ----------
                 Chinchilla  ----------
           Brush-tailed rat  ----------
                     Rabbit  ----------
                        Pig  ----------
                     Alpaca  ----------
                    Dolphin  ----------
               Killer whale  ----------
           Tibetan antelope  ----------
                        Cow  ----------
                      Sheep  ----------
              Domestic goat  ----------
                      Horse  ----------
           White rhinoceros  ----------
                        Cat  ----------
                        Dog  ----------
                    Ferret   ----------
                      Panda  ----------
             Pacific walrus  ----------
               Weddell seal  ----------
                    Megabat  ----------
                   Microbat  ----------
              Big brown bat  ----------
                   Elephant  ----------
                    Manatee  ----------
           Cape golden mole  ----------
                     Tenrec  ----------
                   Aardvark  ----------
                  Armadillo  ----------
                Zebra finch  ----cagcag
         American alligator  tcccccgcac
       David's myotis (bat)  NNNNNNNNNN
           Black flying-fox  NNNNNNNNNN
             Bactrian camel  NNNNNNNNNN

Inserts between block 6 and 7 in window
B D                  Horse 18bp
B D       White rhinoceros 16bp
B D                    Cat 7bp
B D                    Dog 53bp
B D                Ferret  56bp
B D                  Panda 81bp
            Pacific walrus 41bp
              Weddell seal 41bp
B D                Megabat 46bp
B D               Microbat 33bp
             Big brown bat 35bp
B D               Elephant 21bp
B D                Manatee 41bp
          Cape golden mole 19bp
B D                 Tenrec 28bp
                  Aardvark 32bp
B D              Armadillo 7bp

Alignment block 7 of 43 in window, 42880189 - 42880197, 9 bps 
B D                   Human  cgg----gg------gcgg
B D                   Chimp  cgg----gg------gcgg
B D                 Gorilla  cgg----gg------gcgg
B D               Orangutan  cgg----gg------gcgg
B D                  Gibbon  cgg----gg------gcgg
B D                  Rhesus  cgg----gt------gcgg
B D     Crab-eating macaque  cgg----gt------gcgg
B D                  Baboon  cgg----gt------gcgg
               Green monkey  cgg----gt------gcgg
B D                Marmoset  cgg----gt------gcgg
B D         Squirrel monkey  cgg----gc------gcgg
B D                Bushbaby  ccg----ga------gcgg
         Chinese tree shrew  cggacctga------gcgg
B D                Squirrel  ccg----ga------gcgg
     Lesser Egyptian jerboa  cgg----ag------gcca
               Prairie vole  cgg----ga------gcgc
B D         Chinese hamster  ccg----ga------gcgg
             Golden hamster  cag----ga------gcgg
B D                   Mouse  cag----ga------aagg
B D                     Rat  cag----ga------aagg
B D          Naked mole-rat  cag----gg------gcgg
B D              Guinea pig  ctg----ag------gctg
                 Chinchilla  cag----gg------gcgg
           Brush-tailed rat  gag----gg------gcgg
B D                  Rabbit  ccg----gg------g---
B D                     Pig  agg----gg------acgg
B D                  Alpaca  agg----gg------acgg
B D                 Dolphin  agg----gg------acgg
               Killer whale  agg----gg------acgg
           Tibetan antelope  agg----gg------acgg
B D                     Cow  agg----gg------acgg
B D                   Sheep  agg----gg------acgg
              Domestic goat  agg----gg------acgg
B D                   Horse  cag----gg------gccg
B D        White rhinoceros  tag----gg------gcgg
B D                     Cat  gcg----gg------gcgg
B D                     Dog  cgg----ag------gcgg
B D                 Ferret   ctc----gg------gtgg
             Pacific walrus  cgg----gg------gcgg
               Weddell seal  cag----gg------gtga
B D                 Megabat  cgg----cg------gctg
B D                Microbat  cgg----gg------aggg
              Big brown bat  cgg----gg------aagt
B D                Elephant  ccc----ag------cagg
B D                 Manatee  cgg----gg------accg
           Cape golden mole  cgg----gg------acca
B D                  Tenrec  cgg----gg------acct
                   Aardvark  cgg----gg------accg
B D             Zebra finch  cag----gg------ctgg
B D      American alligator  cgg----gggctgccctgg
B D                   Panda  ===================
      David's myotis (bat)  NNNNNNNNNNNNNNNNNNN
          Black flying-fox  NNNNNNNNNNNNNNNNNNN
            Bactrian camel  NNNNNNNNNNNNNNNNNNN
B D               Armadillo  ===================

Inserts between block 7 and 8 in window
B D                    Pig 48bp
B D                 Alpaca 50bp
B D                Dolphin 43bp
              Killer whale 43bp
          Tibetan antelope 44bp
B D                    Cow 44bp
B D                  Sheep 18360bp
             Domestic goat 17175bp
B D               Elephant 6bp
B D                Manatee 6bp
          Cape golden mole 6bp
B D                 Tenrec 6bp
                  Aardvark 6bp

Alignment block 8 of 43 in window, 42880198 - 42880224, 27 bps 
B D                   Human  c------------gg--------------------------------------g----------a-gga-
B D                   Chimp  c------------gg--------------------------------------g----------a-gga-
B D                 Gorilla  c------------gg--------------------------------------g----------a-gga-
B D               Orangutan  t------------gg--------------------------------------g----------a-gga-
B D                  Gibbon  c------------gg--------------------------------------g----------a-gga-
B D                  Rhesus  c------------gg--------------------------------------g----------a-gga-
B D     Crab-eating macaque  c------------gg--------------------------------------g----------a-gga-
B D                  Baboon  c------------gg--------------------------------------g----------a-gga-
               Green monkey  c------------gg--------------------------------------g----------a-gga-
B D                Marmoset  c------------gg--------------------------------------g----------a-gga-
B D         Squirrel monkey  c------------gg--------------------------------------g----------a-gga-
B D                Bushbaby  c------------tgtccc----------------------------------g----------g-gcg-
         Chinese tree shrew  c------------tgccccaggcgggcgggtccgggtccctggcgagagctagg----------a-gga-
B D                Squirrel  ccatcc--------c--------------------------------------g----------g-act-
     Lesser Egyptian jerboa  ctgtcc--------c--------------------------------------g----------g-gaa-
               Prairie vole  ctgtcc-------cg--------------------------------------g----------g-gaa-
B D         Chinese hamster  cggtcc-------gg--------------------------------------g----------g-gaa-
             Golden hamster  ctgtcc-------gg--------------------------------------g----------g-aaa-
B D                   Mouse  ctgtccaggagggag--------------------------------------g----------a-gga-
B D                     Rat  ctgtcc-------gg--------------------------------------g----------g-gaa-
B D          Naked mole-rat  ctccgg-------gc--------------------------------------g----------g-tg--
B D              Guinea pig  ctaccg-------gc--------------------------------------t----------------
                 Chinchilla  cgacca-------gg--------------------------------------g----------------
           Brush-tailed rat  ctacca-------ag--------------------------------------g----------------
B D                  Rabbit  ----gc-------gg--------------------------------------a----------g-gtg-
B D                     Pig  ------------cgg--------------------------------------g----------g-gga-
B D                  Alpaca  ------------cgg--------------------------------------g----------a-gga-
B D                 Dolphin  ------------cag--------------------------------------g----------a-gga-
               Killer whale  ------------cag--------------------------------------g----------a-gga-
           Tibetan antelope  ------------cga--------------------------------------g----------a-gga-
B D                     Cow  ------------cga--------------------------------------g----------a-gga-
B D                   Horse  ------------cgg--------------------------------------g----------a-gga-
B D        White rhinoceros  ------------cgg--------------------------------------g----------aggga-
B D                     Cat  ------------cgg--------------------------------------g----------a-gga-
B D                     Dog  -------------gg--------------------------------------g----------g-gga-
B D                 Ferret   ------------cag--------------------------------------g----------a-gga-
             Pacific walrus  ------------cgg--------------------------------------g----------a-gga-
               Weddell seal  ------------cgg--------------------------------------g----------a-gga-
B D                 Megabat  ------------cgg--------------------------------------g----------g-gga-
B D                Microbat  ------------ggc--------------------------------------ggggaggggccg-gga-
              Big brown bat  ------------ggc--------------------------------------g----------g-gga-
B D                Elephant  ------------ccg--------------------------------------g----------g-gcgg
B D                 Manatee  ------------ccg--------------------------------------g----------a-gga-
           Cape golden mole  ------------ccg--------------------------------------a----------a-aga-
B D                  Tenrec  ------------ccg--------------------------------------g----------a-gga-
                   Aardvark  ------------cgg--------------------------------------g----------a-aga-
B D               Armadillo  ------------ccg--------------------------------------g----------a-gga-
B D             Zebra finch  ----------------------------------------------------------------------
B D      American alligator  ----------------------------------------------------------------------
B D                   Panda  ======================================================================
      David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
          Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  --------------------ggcg-------ttt-ccc------------aa--ggg--aagt-------
                      Chimp  --------------------ggcg-------ttt-ccc------------ag--ggg--aagt-------
                    Gorilla  --------------------ggcg-------ttt-ccc------------aa--ggg--aagt-------
                  Orangutan  --------------------ggcg-------ttt-ccc------------aa--ggg--gagc-------
                     Gibbon  --------------------ggcg------tttt-ccc------------aa--ggg--aagc-------
                     Rhesus  --------------------ggcg-------ttt-ccc------------aa--ggg--aagc-------
        Crab-eating macaque  --------------------ggcg-------ttt-ccc------------aa--ggg--aagc-------
                     Baboon  --------------------ggcg-------ttt-ccc------------aa--ggg--aagc-------
               Green monkey  --------------------ggcg-------ttt-ccc------------aa--ggg--aagc-------
                   Marmoset  --------------------ggcg-------ttt-ccc------------gg--ggg--aagc-------
            Squirrel monkey  --------------------gacg-------ttt-cct------------gg--ggg--aagc-------
                   Bushbaby  --------------------ggcg-------gat-cc-------------ag--gga--aggc-------
         Chinese tree shrew  --------------------ggag-------ttt-ccc------------ca--gggaaaagc-------
                   Squirrel  --------------------ggaggaggagtttc-ccc------------ag--ggg--aagc-------
     Lesser Egyptian jerboa  --------------------ggaggaggagtttc-ccccgaggcggggggcg--gga--aagc-------
               Prairie vole  --------------------ggaggaggagtttc-ccc------------ga--ggg--aagc-------
            Chinese hamster  --------------------ggaggaggagtttc-ccc------------ga--ggg--aaac-------
             Golden hamster  --------------------ggaggaggagtttc-ccc------------ga--ggg--aaac-------
                      Mouse  --------------------ggaggaggagtttc-ccc------------ga--ggg--aagc-------
                        Rat  --------------------agaggaggagtttc-ccc------------ga--ggg--aagc-------
             Naked mole-rat  --------------------ggtggagg-----c-tcc------------cg--ggc--aggt-------
                 Guinea pig  -------------------------------------c------------aggaggc--gtct-------
                 Chinchilla  -------------------------------------c------------cg--ggc--aggt-------
           Brush-tailed rat  -------------------------------------c------------cg--ggc--aggt-------
                     Rabbit  --------------------gcaggatccttctt-tcc------------ct--gtt--tgg--------
                        Pig  --------------------ggag-------tttcccc------------c---ggg--aaaa-------
                     Alpaca  --------------------ggag-------tttcccc------------ca--ggg--aaag-------
                    Dolphin  --------------------gggg-------tttcttc------------ct--ggg--aaag-------
               Killer whale  --------------------gggg-------tttcttc------------ct--ggg--aaag-------
           Tibetan antelope  --------------------ggag-------tttcctc------------ca--ggg--aaag-------
                        Cow  --------------------ggag-------tttcctc------------ca--ggg--aaag-------
                      Horse  --------------------ggag-------ttt-ccc------------ca--ggg--aaag-------
           White rhinoceros  --------------------ggag-------tct-ccc------------cg--ggg--aaag-------
                        Cat  --------------------ggag-------tttcttc------------cc--ggg--aaag-------
                        Dog  --------------------ggag-------tttgccc------------cg--ggg--actg-------
                    Ferret   --------------------ggag-------tttcccc------------ca--ggg--aaag-------
             Pacific walrus  --------------------ggag-------tttcccc------------ca--ggg--aaag-------
               Weddell seal  --------------------ggag-------tttcccc------------ca--ggg--aaag-------
                    Megabat  --------------------ggag-------tct-ccc------------ag--cgg--a----------
                   Microbat  --------------------ggcg-------gtc-ccg------------gg--ggg--aagg-------
              Big brown bat  --------------------ggcg-------ttc-ccc------------ga--ggg--aagg-------
                   Elephant  ggaccaggaaggccagaggtggtg-------ttt-ccc------------gg--agg--aaac-------
                    Manatee  --------------------ggtg-------ttt-ccc------------gg--agg--aaag-------
           Cape golden mole  --------------------ggcg-------ttt-cct------------gg--agg--aaag-------
                     Tenrec  --------------------ggtg-------ttt-tcc------------ag--agc--agag-------
                   Aardvark  --------------------ggcg-------ttt-ccc------------gg--agg--aaag-------
                  Armadillo  --------------------ggag-------tcc-cca------------ga--ggg--gaag-------
                Zebra finch  -------------------------------------c------------ag--ctg--ggggcct----
         American alligator  -------------------------------------g------------gg--cgg--agggtctcacc
                      Panda  ======================================================================
       David's myotis (bat)  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
           Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

                      Human  --
                      Chimp  --
                    Gorilla  --
                  Orangutan  --
                     Gibbon  --
                     Rhesus  --
        Crab-eating macaque  --
                     Baboon  --
               Green monkey  --
                   Marmoset  --
            Squirrel monkey  --
                   Bushbaby  --
         Chinese tree shrew  --
                   Squirrel  --
     Lesser Egyptian jerboa  --
               Prairie vole  --
            Chinese hamster  --
             Golden hamster  --
                      Mouse  --
                        Rat  --
             Naked mole-rat  --
                 Guinea pig  --
                 Chinchilla  --
           Brush-tailed rat  --
                     Rabbit  --
                        Pig  --
                     Alpaca  --
                    Dolphin  --
               Killer whale  --
           Tibetan antelope  --
                        Cow  --
                      Horse  --
           White rhinoceros  --
                        Cat  --
                        Dog  --
                    Ferret   --
             Pacific walrus  --
               Weddell seal  --
                    Megabat  --
                   Microbat  --
              Big brown bat  --
                   Elephant  --
                    Manatee  --
           Cape golden mole  --
                     Tenrec  --
                   Aardvark  --
                  Armadillo  --
                Zebra finch  --
         American alligator  cc
                      Panda  ==
       David's myotis (bat)  NN
           Black flying-fox  NN
              Domestic goat  ==
                      Sheep  ==
             Bactrian camel  NN

Inserts between block 8 and 9 in window
B D               Bushbaby 10bp
B D                    Pig 1bp
B D                 Alpaca 1bp
B D                Dolphin 1bp
              Killer whale 1bp
          Tibetan antelope 1bp
B D                    Cow 1bp
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
            Pacific walrus 1bp
              Weddell seal 1bp
B D               Microbat 1bp
             Big brown bat 1bp
B D               Elephant 1bp
B D                Manatee 1bp
          Cape golden mole 1bp
B D                 Tenrec 1bp
                  Aardvark 1bp
B D              Armadillo 1bp

Alignment block 9 of 43 in window, 42880225 - 42880228, 4 bps 
B D                   Human  ccgg
B D                   Chimp  ccgg
B D                 Gorilla  ccgg
B D               Orangutan  ccgg
B D                  Gibbon  ccgg
B D                  Rhesus  ccgg
B D     Crab-eating macaque  ccgg
B D                  Baboon  ccgg
               Green monkey  ctgg
B D                Marmoset  ccgg
B D         Squirrel monkey  ccgg
B D                Bushbaby  ctgg
         Chinese tree shrew  ccgg
B D                Squirrel  cccg
     Lesser Egyptian jerboa  ccgg
               Prairie vole  ccag
B D         Chinese hamster  ccag
             Golden hamster  ccag
B D                   Mouse  ccag
B D                     Rat  ccag
B D          Naked mole-rat  cccg
B D              Guinea pig  ccaa
                 Chinchilla  ccag
           Brush-tailed rat  ccag
B D                     Pig  ccgg
B D                  Alpaca  ccgg
B D                 Dolphin  ccgg
               Killer whale  ccgg
           Tibetan antelope  ccgg
B D                     Cow  ccgg
B D                   Horse  ccgg
B D        White rhinoceros  ccgg
B D                     Cat  ccgg
B D                     Dog  ccgg
B D                 Ferret   ccgg
             Pacific walrus  ccga
               Weddell seal  ccga
B D                 Megabat  ctgg
       David's myotis (bat)  ccgg
B D                Microbat  ccgg
              Big brown bat  ccgg
B D                Elephant  ttgg
B D                 Manatee  ccgg
           Cape golden mole  ccca
B D                  Tenrec  cggg
                   Aardvark  ccgg
B D               Armadillo  cctg
B D             Zebra finch  ---g
B D      American alligator  ccgg
B D                   Panda  ====
          Black flying-fox  NNNN
             Domestic goat  ====
B D                   Sheep  ====
            Bactrian camel  NNNN
B D                  Rabbit  ----

Inserts between block 9 and 10 in window
B D             Guinea pig 11931bp

Alignment block 10 of 43 in window, 42880229 - 42880241, 13 bps 
B D                   Human  -----gac--gggtt-ccctg
B D                   Chimp  -----gac--gga-----ctg
B D                 Gorilla  -----gac--gggtt-ccctg
B D               Orangutan  -----gac--tggtt-ccctg
B D                  Gibbon  -----gac--gggtt-ctcag
B D                  Rhesus  -----gac--gggtt-cccag
B D     Crab-eating macaque  -----gac--gggtt-cccag
B D                  Baboon  -----gac--gggtt-cccag
               Green monkey  -----gac--tggtt-cccag
B D                Marmoset  -----gac--tcgct-ccagg
B D         Squirrel monkey  -----gac--ttgct-ccagg
B D                Bushbaby  -----gag--gagtt-tcccg
         Chinese tree shrew  -----gac--gagct-cctag
B D                Squirrel  -----gac--gcgcg-cc---
     Lesser Egyptian jerboa  -----ggc--gcgct-cctcc
               Prairie vole  -----ggc--gcgct-cctcc
B D         Chinese hamster  -----gga--gcgct-cctcc
             Golden hamster  -----ggc--gcgct-cctcc
B D                   Mouse  -----gga--gcgct-cctcc
B D                     Rat  -----gga--gcgct-cctcc
B D          Naked mole-rat  -----gcccaggtcc-ctg--
                 Chinchilla  -----gac--agacc-ctg--
           Brush-tailed rat  -----gac--agacg-ctg--
B D                  Rabbit  -----gat--gggct-cgt--
B D                     Pig  -----gac--gcgct-ct---
B D                  Alpaca  -----c-c--gggac-ct---
B D                 Dolphin  -----gac--gcgct-ct---
               Killer whale  -----gac--gcgct-ct---
           Tibetan antelope  -----cac--gcgct-cc---
B D                     Cow  -----cac--gcgct-cc---
B D                   Horse  -----cac--gcgca-cctga
B D        White rhinoceros  -----gac--gcgct-cctga
B D                     Cat  -----ggc--gctct-cctgg
B D                     Dog  -----gac--gggct-c--gg
B D                 Ferret   -----gaa--gcgct-tctgg
             Pacific walrus  -----gaa--gcgct-cctgg
               Weddell seal  -----gaa--gcgct-cctga
B D                 Megabat  ----------------ccggt
       David's myotis (bat)  -----gac--aagct-ccaga
B D                Microbat  -----gac--gcgct-ccaga
              Big brown bat  -----gac--gcgct-ccaga
B D                Elephant  -----gac--ggcta-ctcgc
B D                 Manatee  -----gac--agctc-cttgt
           Cape golden mole  -----gac--gcg-----gag
B D                  Tenrec  -----gac--gcgct-ccccg
                   Aardvark  -----gaa--gcgcctcttgt
B D               Armadillo  -----gct--gcgct------
B D             Zebra finch  gttaagcc--tcact------
B D      American alligator  agttggac--tcatg------
B D                   Panda  =====================
          Black flying-fox  NNNNNNNNNNNNNNNNNNNNN
             Domestic goat  =====================
B D                   Sheep  =====================
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNN
B D              Guinea pig  =====================

Inserts between block 10 and 11 in window
B D         Naked mole-rat 603bp

Alignment block 11 of 43 in window, 42880242 - 42880242, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
               Green monkey  t
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Bushbaby  a
         Chinese tree shrew  c
     Lesser Egyptian jerboa  c
               Prairie vole  c
B D         Chinese hamster  c
             Golden hamster  c
B D                   Mouse  c
B D                     Rat  c
                 Chinchilla  c
           Brush-tailed rat  t
B D                   Horse  c
B D        White rhinoceros  c
B D                     Cat  t
B D                     Dog  c
B D                 Ferret   c
             Pacific walrus  c
               Weddell seal  c
B D                 Megabat  c
       David's myotis (bat)  c
B D                Microbat  c
              Big brown bat  c
B D                Elephant  a
B D                 Manatee  c
           Cape golden mole  c
B D                  Tenrec  c
                   Aardvark  c
B D             Zebra finch  c
B D      American alligator  c
B D                   Panda  =
B D                     Pig  -
B D                 Dolphin  -
          Black flying-fox  N
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  -
              Killer whale  -
B D                     Cow  -
            Bactrian camel  N
B D              Guinea pig  =
B D                  Alpaca  -
B D                Squirrel  -
B D               Armadillo  -
B D                  Rabbit  -
B D          Naked mole-rat  =

Inserts between block 11 and 12 in window
                Chinchilla 955bp
          Brush-tailed rat 2bp

Alignment block 12 of 43 in window, 42880243 - 42880257, 15 bps 
B D                   Human  ctggctcaa------------------------ccccgg
B D                   Chimp  ctggctcaa------------------------ccccgg
B D                 Gorilla  ctggctcaa------------------------ccccgg
B D               Orangutan  ctggctcaa------------------------ccccgg
B D                  Gibbon  ctggctcaa------------------------ccccgg
B D                  Rhesus  ctggctcaa------------------------ccccgg
B D     Crab-eating macaque  ctggctcaa------------------------ccccgg
B D                  Baboon  ctggctcaa------------------------ccccgg
               Green monkey  ccggctcaa------------------------ccccgg
B D                Marmoset  ccggcccaa------------------------acccga
B D         Squirrel monkey  ccggcccaa------------------------cc----
B D                Bushbaby  gggg---aa----------------------gcccccgg
         Chinese tree shrew  cggc-----------------------------ccgcgg
B D                Squirrel  --------a------------------------gaacag
     Lesser Egyptian jerboa  ------aggt---------------------atgcggag
               Prairie vole  ------cca-------------------------catgg
B D         Chinese hamster  ------cca-------------------------catgg
             Golden hamster  ------cca-------------------------catgg
B D                   Mouse  ------cta------------------------gcaccg
B D                     Rat  ------cta------------------------gcaggg
B D                  Rabbit  --------------------------------------g
B D                   Horse  ----------------------------------ccccg
B D        White rhinoceros  ----------------------------------tcccc
B D                     Cat  ----------------------------------ccccg
B D                     Dog  ----------------------------------ccctg
B D                 Ferret   ----------------------------------cccgg
             Pacific walrus  ----------------------------------tcagg
               Weddell seal  ----------------------------------tcagg
B D                 Megabat  ----------------------------------cc---
       David's myotis (bat)  ----------------------------------ctggc
B D                Microbat  ----------------------------------ccggc
              Big brown bat  ----------------------------------ccggc
B D                Elephant  -----------------------------------ccgg
B D                 Manatee  -----------------------------------ctgg
           Cape golden mole  -----------------------------------ctgg
B D                  Tenrec  -----------------------------------ccgg
                   Aardvark  -----------------------------------ccgg
B D               Armadillo  -------------------------------------gg
B D             Zebra finch  ---------tgttccc---------cagcccggcccctg
B D      American alligator  ---------ccctcgcggcaggctgcacctgaggcccgg
B D                   Panda  =======================================
B D                     Pig  ---------------------------------------
B D                 Dolphin  ---------------------------------------
          Black flying-fox  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
             Domestic goat  =======================================
B D                   Sheep  =======================================
          Tibetan antelope  ---------------------------------------
              Killer whale  ---------------------------------------
B D                     Cow  ---------------------------------------
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Guinea pig  =======================================
B D                  Alpaca  ---------------------------------------
          Brush-tailed rat  =======================================
                Chinchilla  =======================================
B D          Naked mole-rat  =======================================

Inserts between block 12 and 13 in window
B D                  Horse 1bp
B D       White rhinoceros 1bp
B D                    Cat 1bp
B D                    Dog 1bp
B D                Ferret  1bp
            Pacific walrus 1bp
              Weddell seal 1bp
B D               Elephant 7bp
B D                Manatee 7bp
          Cape golden mole 7bp
B D                 Tenrec 7bp
                  Aardvark 7bp
B D              Armadillo 5bp
B D            Zebra finch 7bp
B D     American alligator 7bp

Alignment block 13 of 43 in window, 42880258 - 42880315, 58 bps 
B D                   Human  ctgcg---------------gagggacccat------aagggac----tc--tgg-gg--cgcttcccgg
B D                   Chimp  ctgcg---------------gagggacccat------aagggac----tc--tgg-gg--cgcttcccgg
B D                 Gorilla  ccgcg---------------gcgggaccaat------aagggat----tc--tgg-gg--cgcttcccgg
B D               Orangutan  ctgcg---------------gcggaacccac------aagggac----tc--tgg-gg--cgcttcccgg
B D                  Gibbon  ctgcg---------------gcgggacccag------gagggac----cc--tgg-gg--cgcttcccgg
B D                  Rhesus  ctgcg---------------gccggacccag------gagggac----tc--tgg-gg--cacttcccgg
B D     Crab-eating macaque  ctgcg---------------gccggacccag------gagggac----tc--tgg-gg--cacttcccgg
B D                  Baboon  ctgcg---------------gccggacccag------gagggac----tc--tgg-gg--cactttccgg
               Green monkey  ctgcg---------------tcgggacccag------gagggac----tc--tgg-gg--cacttctcgg
B D                Marmoset  ctgcg---------------gcgggacccag------gtgcgac----tc--tgg-gg--cacttcccgg
B D         Squirrel monkey  --------------------------cccag------gtgcgac----tc--tgg-gg--cacttcccgg
B D                Bushbaby  acgcg---------------gcgggacccag------aggagac----gc--ctg-gg--cacttccc-t
         Chinese tree shrew  ----------------------ggtaccctg------gacagac----tc--cgc-ag--cgcttcccgg
B D                Squirrel  ----------------------ggactccag------gac-gtc----ta---gg-gt--caggcacccg
     Lesser Egyptian jerboa  ----------------------aggacccgg------gagagac----cc---cgcgg--ctctttcctg
               Prairie vole  ----------------------cgggaccaa------aagagac----ca---aa-gg--catttccctg
B D         Chinese hamster  ----------------------cgggacctg------aagggac----cc---aa-gg--catttccctg
             Golden hamster  ----------------------cgggacctg------aagggac----cc---aa-gg--catttccctg
B D                   Mouse  ----------------------agagatcaa------actggac----tc---ta-gg--cattccccta
B D                     Rat  ----------------------agagaccag------accggac----tc---ga-gg--catttccctg
           Brush-tailed rat  ----------------------tgaactcaa------g---gac----tc----a-gg--cttttgcc--
B D                  Rabbit  ----------------------atgtaccg------------------ct---aa-ag--gactcctccg
B D                     Pig  ---cg---------------gcgggacccag------agggagc----tcc-ggg-gg--cg--------
B D                  Alpaca  ---tg---------------gccggacccag------agggagt----tcc-gag-gc--cg--------
B D                 Dolphin  ---cg---------------gcgggacccag------agggagc----cc--ggg-ga--cg--------
               Killer whale  ---cg---------------gcgggacccag------agggagc----cc--agg-ga--cg--------
           Tibetan antelope  ---tg---------------gagggacccag------agggagc----tcg-ggg-ga--cg--------
B D                     Cow  ---cg---------------gagggacccag------agggagc----tcg-ggg-ga--cg--------
B D                   Horse  ccacg---------------gtgggacccgg------agggaac----tc--ggg-gc---attccccgg
B D        White rhinoceros  ccgcg---------------gtgagacccag------cgggagc----tccgggg-ac---attccccgg
B D                     Cat  ccgcg---------------gggtggacccc------ttggagc----tc--cgg---------------
B D                     Dog  ccggc---------------gggggaacccc------atggagc----tc--cgg-gc------------
B D                 Ferret   cggct---------------ggggggatccc------acggag---------tgg-gtttcgttcccc--
             Pacific walrus  cggctgcggtgggggggaagggggaaacccc------ttgaagc----tc--cgg-acttcgttccgcac
               Weddell seal  cggct---------------agggggacccc------ttgaagc----tc--ccg-gcttcgttccccac
           Black flying-fox  ccgcg---------------gcgggacccag------agggagc----tg--ggg-gt--cgctcccccg
B D                 Megabat  --gcg---------------gcgggacccag------agggagc----tg--ggg-gt--cgctcccccg
       David's myotis (bat)  ccggg---------------gcggggcccag------agggaac----tt--ggg-ga--cgc-tcccag
B D                Microbat  ccggg---------------gcggggcccag------agggaac----ct--ggg-ga--cgc-tcccgg
              Big brown bat  ccggg---------------gcgggacccag------aaggaac----tt--ggg-ga--cgagccccgg
B D                Elephant  -agct---------------gggggacccag------agggaga----cccgaag-gc--cacttcctgg
B D                 Manatee  -ctct---------------gggggacgcag------aaggaga----ccggagg-gc--cgctttcccg
           Cape golden mole  -agaa---------------ggagagctctt------c------------------gc--tgcttcctgg
B D                  Tenrec  -tgcc---------------ggggaaccctt------c---------------------------ccgga
                   Aardvark  -cgct---------------ggggaac-----------aggaga----tccgaag-gc--cg--------
B D               Armadillo  -cgcc---------------gggacacg----------aggaag----tgccagg-ac--cg---agcgg
B D             Zebra finch  --------------------------ccctg------gagggct----ct--gcc-cc--ctctccatgg
B D      American alligator  --------------------------cagcggggcacgagggccagggcc--ggc-gg--cgcttcgtgc
B D                   Panda  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Guinea pig  ======================================================================
                Chinchilla  ======================================================================
B D          Naked mole-rat  ======================================================================

                      Human  ---gcccgg-----------------------------------------------cc-----acag---
                      Chimp  ---gcccgg-----------------------------------------------cc-----ccag---
                    Gorilla  ---gcccgg-----------------------------------------------cc-----ccag---
                  Orangutan  ---gccggg-----------------------------------------------cc-----ccag---
                     Gibbon  ---gcccgg-----------------------------------------------cc-----ccag---
                     Rhesus  ---gcccta-----------------------------------------------cc-----ccag---
        Crab-eating macaque  ---gcccta-----------------------------------------------cc-----ccag---
                     Baboon  ---gcccta-----------------------------------------------cc-----ccag---
               Green monkey  ---gccctg-----------------------------------------------cc-----ccag---
                   Marmoset  ---gccag-------------------------------------------------c-----ccag---
            Squirrel monkey  ---gccag-------------------------------------------------c-----tcag---
                   Bushbaby  ---gtctgg-----------------------------------------------ct-----ctag---
         Chinese tree shrew  ---gtctg------------------------------------------------cc-----ccag---
                   Squirrel  ---caggca---------------------------------------gtcggaggctgagaagagg---
     Lesser Egyptian jerboa  ---gc-----------------------------------------------------------------
               Prairie vole  ---gcagcg---------------------------------------acccgcctcc-----gtag---
            Chinese hamster  ---gcagcg---------------------------------------acaggcctcc-----ggag---
             Golden hamster  ---gcagcg---------------------------------------actggcctcc-----ggag---
                      Mouse  ---gcagcg---------------------------------------acccgcctcc-----ggac---
                        Rat  ---gcagcg---------------------------------------acccgcctct-----ggag---
           Brush-tailed rat  ------gag---------------------------------------atgcccgacc-----agag---
                     Rabbit  ---actgcc---------------------------------------ctcgg--tcc-----atag---
                        Pig  ---cttccg----------------------------------------------ttc-----ccgg---
                     Alpaca  ---cttccg----------------------------------------------tcc-----ccgg---
                    Dolphin  ---cttccg----------------------------------------------tcc-----ccag---
               Killer whale  ---cttccg----------------------------------------------tcc-----ccag---
           Tibetan antelope  ---cttcca----------------------------------------------tcc-----ccgg---
                        Cow  ---cttcca----------------------------------------------tcc-----tcgg---
                      Horse  ---gcctcg----------------------------------------------tcc-----cctg---
           White rhinoceros  ---acctcg----------------------------------------------tct-----cctggca
                        Cat  ----ctcgg----------------------------------------------tcc-----ccgg---
                        Dog  ---cccccc----------------------------------------------acc-----gcgg---
                    Ferret   ---caccca----------------------------------------------ccc-----ccgg---
             Pacific walrus  ccaccccca----------------------------------------------ccc-----cccg---
               Weddell seal  ccacccccc----------------------------------------------acc-----cccc---
           Black flying-fox  ---gcctcg----------------------------------------------tcc-----cctgg--
                    Megabat  ---gcctcg----------------------------------------------tcc-----cctgg--
       David's myotis (bat)  ---gcccag----------------------------------------------tct-----ccccg--
                   Microbat  ---gccc-g----------------------------------------------tct-----ccccg--
              Big brown bat  ---gccccg----------------------------------------------tct-----ccct---
                   Elephant  ---gcatag---------------------------------------------tcct-----ccct---
                    Manatee  ---gcttcg---------------------------------------------tgtt-----cccg---
           Cape golden mole  ---gtttcg---------------------------------------------tcct-----ccca---
                     Tenrec  ---gcttcg---------------------------------------------tcct-----tccg---
                   Aardvark  --------------------------------------------------------ct-----ccca---
                  Armadillo  ---gt---------------------------------------------------cc-----ccgg---
                Zebra finch  ---gtgct-------------------------------------------------------cca----
         American alligator  ---gggctacgggcgtgcagggggtggcgattgcggggcagcggggaggcccggggac-----ccg----
                      Panda  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Guinea pig  ======================================================================
                 Chinchilla  ======================================================================
             Naked mole-rat  ======================================================================

                      Human  ---------cgg------------------------cca
                      Chimp  ---------cgg------------------------cca
                    Gorilla  ---------cgg------------------------cta
                  Orangutan  ---------agg------------------------cca
                     Gibbon  ---------cgg------------------------cca
                     Rhesus  ---------cgg------------------------cca
        Crab-eating macaque  ---------cgg------------------------cca
                     Baboon  ---------cgg------------------------cca
               Green monkey  ---------cgg------------------------cca
                   Marmoset  ---------ccg------------------------cca
            Squirrel monkey  ---------cgg------------------------cca
                   Bushbaby  ---------cgg------------------------gca
         Chinese tree shrew  ---------cag------------------------gca
                   Squirrel  ---------cgc------------------------tgc
     Lesser Egyptian jerboa  ---------ctg------------------------ggt
               Prairie vole  ---------ctg------------------------ggc
            Chinese hamster  ---------cag------------------------cgc
             Golden hamster  ---------cag------------------------cgc
                      Mouse  ---------cag------------------------cgg
                        Rat  ---------cag------------------------ccg
           Brush-tailed rat  ---------ctg---------------------------
                     Rabbit  ---------taa------------------------cgg
                        Pig  ---------cgg------------------------gca
                     Alpaca  ---------cgg------------------------gca
                    Dolphin  ---------ccg------------------------gcc
               Killer whale  ---------ccg------------------------gcc
           Tibetan antelope  ---------cgg------------------------gca
                        Cow  ---------cgg------------------------gca
                      Horse  ---------tgg------------------------gca
           White rhinoceros  gtttaggactgg------------------------gga
                        Cat  ---------agggtcgagggcggcgtagggttctgagag
                        Dog  ---------tggcc----ggcagtgcagggctgggagca
                    Ferret   ---------cgg------------------------gca
             Pacific walrus  ---------cgg------------------------gca
               Weddell seal  ---------cgg------------------------gca
           Black flying-fox  ---------cgg------------------------gca
                    Megabat  ---------cgg------------------------gca
       David's myotis (bat)  ---------ccg------------------------gca
                   Microbat  ---------ccg------------------------gca
              Big brown bat  ---------ccg------------------------gca
                   Elephant  ---------cgg------------------------gca
                    Manatee  ---------cgg------------------------gca
           Cape golden mole  ---------ctg------------------------cta
                     Tenrec  ---------tgg------------------------gca
                   Aardvark  ---------tgg------------------------gca
                  Armadillo  ---------ccg------------------------gca
                Zebra finch  ---------------------------------------
         American alligator  ---------------------------------------
                      Panda  =======================================
              Domestic goat  =======================================
                      Sheep  =======================================
             Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
                 Guinea pig  =======================================
                 Chinchilla  =======================================
             Naked mole-rat  =======================================

Inserts between block 13 and 14 in window
B D                    Pig 29bp
B D                 Alpaca 19bp
B D                Dolphin 20bp
              Killer whale 20bp
          Tibetan antelope 20bp
B D                    Cow 20bp
B D                  Horse 503bp
B D       White rhinoceros 14bp
B D                    Cat 7bp
B D                    Dog 4bp
B D                Ferret  22bp
            Pacific walrus 23bp
              Weddell seal 23bp
B D               Elephant 29bp
B D                Manatee 30bp
          Cape golden mole 29bp
B D                 Tenrec 29bp
                  Aardvark 30bp
B D              Armadillo 29bp

Alignment block 14 of 43 in window, 42880316 - 42880318, 3 bps 
B D                   Human  ac---------------------------------------c
B D                   Chimp  gc---------------------------------------c
B D                 Gorilla  gc---------------------------------------c
B D               Orangutan  gc---------------------------------------c
B D                  Gibbon  ac---------------------------------------c
B D                  Rhesus  gc---------------------------------------c
B D     Crab-eating macaque  gc---------------------------------------c
B D                  Baboon  gc---------------------------------------c
               Green monkey  gc---------------------------------------c
B D                Marmoset  gc---------------------------------------c
B D         Squirrel monkey  gc---------------------------------------c
B D                Bushbaby  gtttagggttgcagaggaacacgtctccctccccacgtccgc
         Chinese tree shrew  gatgagggctggggaggagcgtgacttgctccctccca---c
B D                Squirrel  cc---------------------tctc----cccaagtccgc
     Lesser Egyptian jerboa  tc---------------------cctc----cccgtacccac
               Prairie vole  ac---------------------cctcgagggccaggcccat
B D         Chinese hamster  ac---------------------tctcgaggccccggcccat
             Golden hamster  ac---------------------cctcgaggtcccggcccaa
B D                   Mouse  ac---------------------ccttgaggcccagacccat
B D                     Rat  ac---------------------ccttgaggctcagacccaa
           Brush-tailed rat  ----------------------------------ataccca-
B D                  Rabbit  ac---------------------tggccgtccccccgccccc
B D                     Pig  ga----------------------------------------
B D                  Alpaca  gc----------------------------------------
B D                 Dolphin  gc----------------------------------------
               Killer whale  gc----------------------------------------
           Tibetan antelope  gc----------------------------------------
B D                     Cow  gc----------------------------------------
           Black flying-fox  -g----------------------------------------
B D                 Megabat  -g----------------------------------------
       David's myotis (bat)  -c----------------------------------------
B D                Microbat  -c----------------------------------------
              Big brown bat  -c----------------------------------------
B D                Elephant  cc----------------------------------------
B D                 Manatee  cc----------------------------------------
           Cape golden mole  tc----------------------------------------
B D                  Tenrec  tt----------------------------------------
                   Aardvark  cc----------------------------------------
B D               Armadillo  tc----------------------------------------
B D             Zebra finch  -------------------------------cct--------
B D      American alligator  -------------------------------ccc--------
B D                   Panda  ==========================================
             Domestic goat  ==========================================
B D                   Sheep  ==========================================
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Guinea pig  ==========================================
              Weddell seal  ==========================================
            Pacific walrus  ==========================================
B D                 Ferret   ==========================================
B D                     Dog  ==========================================
B D                     Cat  ==========================================
B D        White rhinoceros  ==========================================
B D                   Horse  ==========================================
                Chinchilla  ==========================================
B D          Naked mole-rat  ==========================================

Inserts between block 14 and 15 in window
B D                    Pig 2bp
B D                 Alpaca 2bp
B D                Dolphin 2bp
              Killer whale 2bp
          Tibetan antelope 2bp
B D                    Cow 2bp
          Black flying-fox 23bp
B D                Megabat 23bp
      David's myotis (bat) 23bp
B D               Microbat 27bp
             Big brown bat 23bp

Alignment block 15 of 43 in window, 42880319 - 42880337, 19 bps 
B D                   Human  tgcccctctccggtcc------------gcg
B D                   Chimp  tgcccctctccggtcc------------gcg
B D                 Gorilla  tgcccctctccggtcc------------gcg
B D               Orangutan  tgcccctctccggtcc------------gcg
B D                  Gibbon  tgcccctctccggtcc------------gtg
B D                  Rhesus  tgccccactcgggtcc------------gcg
B D     Crab-eating macaque  tgccccactcgggtcc------------gcg
B D                  Baboon  tgccccactcgggtcc------------gcg
               Green monkey  tgccccactcgggtcc------------gcg
B D                Marmoset  ggctcctctcaggtcc------------agg
B D         Squirrel monkey  tgcccctctcgggtct------------agg
B D                Bushbaby  tggacctctggggtct------------cca
         Chinese tree shrew  tggaccgctccggtct------------ccg
B D                Squirrel  aggtcctctccggtc-------------gcg
     Lesser Egyptian jerboa  tgcaccgctcaggt--------------ctc
               Prairie vole  gggaccgtcagggta-------------ccg
B D         Chinese hamster  gggcccggttgggt--------------ccg
             Golden hamster  gggcccgcttgggtc-------------ccg
B D                   Mouse  gggaactccagggtc-------------ctg
B D                     Rat  gggaacgccagggtc-------------ccg
           Brush-tailed rat  ----ccacgcggg---------------ccg
B D                  Rabbit  ggcaccttctg--------------------
B D                     Pig  ctccctctcacgtccc------------cg-
B D                  Alpaca  ttcccgccgtactcct------------cc-
B D                 Dolphin  ctccctccccacttcc------------cc-
               Killer whale  ctccctccccacttcc------------cc-
           Tibetan antelope  ctccctcccgcattccccgggaccgggacc-
B D                     Cow  ctccctcccgcattcc------------cc-
B D        White rhinoceros  -----tccccacatcc------------cc-
B D                     Cat  -tccctcccctcgtcc------------cc-
B D                     Dog  gtccctgcccttgtcc------------tc-
B D                 Ferret   ccccctcccc-cgtct------------cc-
B D                   Panda  gtccctcccctcgtcc------------cc-
             Pacific walrus  ctccctcctcgcgtcc------------cc-
               Weddell seal  ctccctcccctcctcc------------cc-
           Black flying-fox  ctcccgccccacgtcc------------gg-
B D                 Megabat  ctcccgccccacgtcc------------gg-
       David's myotis (bat)  ctctctccc--ggtcc------------gt-
B D                Microbat  ctccctccc-gggtcc------------gt-
              Big brown bat  ctcccgccccgagtcc------------gt-
B D                Elephant  ccatccttcctgaact------------gc-
B D                 Manatee  ccaacctccctggact------------gc-
           Cape golden mole  ctagcctccc-tgatt------------gca
B D                  Tenrec  acaccctctcaaaact------------gcg
                   Aardvark  ttaccctccctggatt------------gcg
B D               Armadillo  ccaccc--ccgaggcg------------acg
B D             Zebra finch  gggccagctcctgctc------------gc-
B D      American alligator  ggctcagcccctgccc------------gc-
             Domestic goat  ===============================
B D                   Sheep  ===============================
            Bactrian camel  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
B D              Guinea pig  ===============================
B D                   Horse  ===============================
                Chinchilla  ===============================
B D          Naked mole-rat  ===============================

Inserts between block 15 and 16 in window
B D                 Alpaca 18bp
B D                Dolphin 19bp
              Killer whale 19bp
          Tibetan antelope 19bp
B D                    Cow 19bp
B D       White rhinoceros 19bp
B D                    Cat 19bp
B D                    Dog 13bp
B D                Ferret  19bp
B D                  Panda 19bp
            Pacific walrus 19bp
              Weddell seal 19bp
          Black flying-fox 18bp
B D                Megabat 18bp
      David's myotis (bat) 19bp
B D               Microbat 19bp
             Big brown bat 19bp
          Cape golden mole 10bp
B D                 Tenrec 10bp
                  Aardvark 10bp
B D              Armadillo 10bp

Alignment block 16 of 43 in window, 42880338 - 42880376, 39 bps 
B D                   Human  gcgca--gcgctg-cccgagggctcgagtttgggttaaggaa-----------------
B D                   Chimp  gcgca--gcgctg-cccgagggctcgagtttgggttaaggaa-----------------
B D                 Gorilla  gcgca--gcgctg-cccgagggcttgagtttgggttaaggaa-----------------
B D               Orangutan  gcgca--gcgctg-cccgagggctcgagtttgggttaaggaa-----------------
B D                  Gibbon  gcgcc--gcgctg-cccgagggctcgagtttgggttaagtaa-----------------
B D                  Rhesus  gcgca--gcgctg-cccgagggctccagtttgggttaaggag-----------------
B D     Crab-eating macaque  gcgca--gcgctg-cccgagggctcgagtttgggttaaggag-----------------
B D                  Baboon  gcgca--gcgctg-cccgagggctcgagtttgggttaaggag-----------------
               Green monkey  gcgca--gcgctg-cccgagggctcgagtttgggttaaggag-----------------
B D                Marmoset  gcgca--gctctg-cccgagggctcgagtttgggttaaggag-----------------
B D         Squirrel monkey  gcgta--gctctg-cccgagggctcgagtttgggttaaggag-----------------
B D                Bushbaby  acaca--gcactg-------------agcttggatgaag--------------------
         Chinese tree shrew  gtgct--atgggt-ct---aggctccaatgtggattaagca------------------
B D                Squirrel  gggcg--acgcgg-tctgagggctgc-gtttgaatttaggag-----------------
     Lesser Egyptian jerboa  ctacc--gcgctg-cctttgaa------------tgaaggag-----------------
               Prairie vole  gcgcg--acaccg-tccttggactgctgtgtgaattaacggg-----------------
B D         Chinese hamster  gggcg--acactg-tctttggactgcagtgtggatgaagtgg-----------------
             Golden hamster  gcgcg--acgctg-tctttggactgc-----------agtgg-----------------
B D                   Mouse  ctgcg--acg-gg-tctttggactgcactattaaagaagtag-----------------
B D                     Rat  gtgcg--acg-ga-tctctggactgcac-----------gcg-----------------
           Brush-tailed rat  tagct--gcg--------tgga--------------gaaggg-----------------
B D                     Pig  ----------g-g-accgagcaggtcgccggcgcttcaggag-----------------
B D                  Alpaca  gcgct--tcgcgg-cccgaggagtcgagtttggattcaggag-----------------
             Bactrian camel  gcgct--tcgcgg-cccgaggagtcgagtttggattcaggag-----------------
B D                 Dolphin  gcgct--tcgc-g-cccgaacactcaagtcgggattcaggag-----------------
               Killer whale  gcgct--tcgc-g-cccgaaccctcgagtctggattcaggag-----------------
           Tibetan antelope  gcgct--ttgt-g-cccgaacgctcaagtttggattcggcaa-----------------
B D                     Cow  gcgcc--ttgt-g-cccgaacgctcaagtttgcattcggcaa-----------------
B D        White rhinoceros  gtgct-tcgca-g-cccgaggactcgagtttggattaagcag-----------------
B D                     Cat  gcgctttgggg-c-cccgaggtctcgagtttgggttaaggag-----------------
B D                     Dog  ----------------------------tttggatggaggag-----------------
B D                 Ferret   gcgcc------------------tcgaattcggattaaggaa-----------------
B D                   Panda  gcgct------------------tcgagtttggattaaggaa-----------------
             Pacific walrus  gcgct------------------tcgaattgggatgaaggaa-----------------
               Weddell seal  gcgct------------------tcgaattgggattaaggaa-----------------
           Black flying-fox  gagct--ttga-g--ccgaggactcgg-tttggattaaggag-----------------
B D                 Megabat  gagct--ttga-g--ccgaggactcgg-tttggattaaggag-----------------
       David's myotis (bat)  gcgct--tcca-g-cccgaggacgcga-tttgaactaagga------------------
B D                Microbat  gcgct--tcca-g-cccgaggactcga-tttgaactaaggag-----------------
              Big brown bat  gcact--tgca-g-cccgaggactcta-tttgaattaaagag-----------------
B D                Elephant  -gctc--aagagg-ccccgaactccgagtttggattaaggag-----------------
B D                 Manatee  -gctc--aagcag-ccccgggctctgagtttggattaaggag-----------------
           Cape golden mole  ggccc--aagaga-cccgaggcttcgaattcggaatgcgaag-----------------
B D                  Tenrec  ggccc--aagcgg-ccagggcaccccaagtttgaatgc---g-----------------
                   Aardvark  ggcca--aagcag-ccccaggctacgagtttggattaaggag-----------------
B D               Armadillo  gcgct--tcgcgg-acccgaggatcgagtctggattgaggag-----------------
B D             Zebra finch  ----------cca-catgcccgtggtgccgtagcctctttgcccgc-cactatttttat
B D      American alligator  ----------ccgtcccgcaggtgaagatctggttccagaaccggcgcatga-----ag
             Domestic goat  ===========================================================
B D                   Sheep  ===========================================================
B D              Guinea pig  ===========================================================
B D                  Rabbit  -----------------------------------------------------------
B D                   Horse  ===========================================================
                Chinchilla  ===========================================================
B D          Naked mole-rat  ===========================================================

Inserts between block 16 and 17 in window
B D                Manatee 728bp

Alignment block 17 of 43 in window, 42880377 - 42880385, 9 bps 
B D                   Human  -ggggatt-ct
B D                   Chimp  -ggggatt-ct
B D                 Gorilla  -gggtatt-ct
B D               Orangutan  -ggggatt-ct
B D                  Gibbon  -ggggatt-ct
B D                  Rhesus  -ggggatt-cc
B D     Crab-eating macaque  -ggggatt-cc
B D                  Baboon  -ggggatt-cc
               Green monkey  -ggggatt-cc
B D                Marmoset  -gaggatt-cc
B D         Squirrel monkey  -gaggatt-cc
         Chinese tree shrew  -gggtatt-ct
B D                Squirrel  -ggggatt-ct
     Lesser Egyptian jerboa  -gacgtcc-ct
               Prairie vole  -gaagacctta
B D         Chinese hamster  -aaagacc-ta
             Golden hamster  -aaagacc-ta
B D                   Mouse  -gaagccc-ca
B D                     Rat  -gaagccc-ca
           Brush-tailed rat  -ggtgact-cc
B D                  Rabbit  ---------ct
B D                     Pig  -cgggatt-ct
B D                  Alpaca  -ggggatc-ct
             Bactrian camel  -agggatc-ct
B D                 Dolphin  -ggagatt-ct
               Killer whale  -ggaaatt-ct
           Tibetan antelope  -cgggatt-ct
B D                     Cow  -ggggatt-ct
B D        White rhinoceros  -ggagatt-ct
B D                     Cat  -ggaactt-ct
B D                     Dog  -cagagtt-ct
B D                 Ferret   -ggaaatt-ct
B D                   Panda  -gggaatt-ct
             Pacific walrus  -gggaatt-ct
               Weddell seal  -gggaatt-ct
           Black flying-fox  -aggggtt-cc
B D                 Megabat  -aggggtt-cc
       David's myotis (bat)  -ggggatt-cc
B D                Microbat  -ggggatt-cc
              Big brown bat  -gggcatt-cc
B D                Elephant  -ggagatt-ct
B D                 Manatee  -ggtaatt-ct
           Cape golden mole  -agtgatt-tt
B D                  Tenrec  -ggtgatt-cg
                   Aardvark  -ggcgatt-ct
B D               Armadillo  -cgtgatt-ct
B D             Zebra finch  cagaattt-c-
B D      American alligator  tggaagcg-c-
             Domestic goat  ===========
B D                   Sheep  ===========
B D              Guinea pig  ===========
B D                Bushbaby  -----------
B D                   Horse  ===========
                Chinchilla  ===========
B D          Naked mole-rat  ===========

Inserts between block 17 and 18 in window
B D               Elephant 1183bp

Alignment block 18 of 43 in window, 42880386 - 42880433, 48 bps 
B D                   Human  ----------------------------gggga--gcgctcctggagtc-ct--g-ggtgag---ccccc
B D                   Chimp  ----------------------------gggga--gcgctcctggagtc-ct--g-ggtgag---cccct
B D                 Gorilla  ----------------------------gggga--gcgctcctggagtc-ct--g-ggtgag---ccccc
B D               Orangutan  ----------------------------gggga--gcgctcctcgagtc-ct--g-ggtgag---ccccc
B D                  Gibbon  ----------------------------gggga--gcgctcctcgagtc-ct--g-ggtgag---ccccc
B D                  Rhesus  ----------------------------gggga--gcgctcctcgagtc-ct--g-ggtaag---ccccc
B D     Crab-eating macaque  ----------------------------gggga--gcgctcctcgagtc-ct--g-gataag---ccccc
B D                  Baboon  ----------------------------gggga--gcgctcctcgagtc-ct--g-ggtaag---ccccc
               Green monkey  ----------------------------gagga--gcgctcctcgagtc-ct--g-ggtaag---tcccc
B D                Marmoset  ----------------------------tggga--gcgctcttccagtc-ct--g-ggtgag---ccccc
B D         Squirrel monkey  ----------------------------tggga--gggctcctcgagtc-ct--g-ggggag---ccccc
B D                Bushbaby  -----------------------------aggg--gcgctaatccaggc-cc----gctgaa---cccct
         Chinese tree shrew  ----------------------------gggga--gccctaatcgagtc-cccca-agtgag---ccctg
B D                Squirrel  ----------------------------cggg--------aatcgagtc-tc--cacgtgag----cagg
     Lesser Egyptian jerboa  ----------------------------gggga--gcgctaatcgagtc-cc--c-tggg----------
               Prairie vole  ----------------------------aggga--gcgctaacccggcc-cc--c-tggaag----cccg
B D         Chinese hamster  ----------------------------aggga--gtgctaacctggcc-cc--t-tggga---------
             Golden hamster  ----------------------------aggga--gcgctaacccggtc-cc--t-aggaag----ccca
B D                   Mouse  ----------------------------aggga--gcgctaacctggtc-cc--t-tgaaag----tctg
B D                     Rat  ----------------------------aggga--actctaatccggtc-cc--t-tggaag----tctg
           Brush-tailed rat  ----------------------------gggaa--gcactcacacagtc-cc--cacaggag----cacc
B D                  Rabbit  ----------------------------aggga--at--taaccggaac-cc--c-cgtgtgcgtccccg
B D                     Pig  ----------------------------gggga--gcgctgatcgcgtc-tc--g-tatcag---ccggc
B D                  Alpaca  ----------------------------gggg---gcgctgatcaagtc-tt--g-tatggg---ccggc
             Bactrian camel  ----------------------------gggg---gcgctgatcaagtc-tt--g-tatggg---ccggc
B D                 Dolphin  ----------------------------gggca--gtgctgaccgagtc-tc--g-cacgac---ccggc
               Killer whale  ----------------------------gggca--gtgctgaccgagtc-tc--g-tacgac---ccggc
           Tibetan antelope  ----------------------------gggga--gcgctgaccgagtc-tc--c-tgtaaa---ccggc
B D                     Cow  ----------------------------gggga--gcgctgaccgagtc-tc--c-tgtgaa---ccggc
B D        White rhinoceros  ----------------------------gggga--gcgctgacggagtc-cc--cgtgtgag---cccaa
B D                     Cat  ----------------------------ggggggggcagtgattgagtc-cc--tgccggag---cccc-
B D                     Dog  ----------------------------gggga--gcactgcctgag-c-cc--cgcgggag---cccca
B D                 Ferret   ----------------------------gggga--gccctgattgagtc-cc--tgggtgag---cccca
B D                   Panda  ----------------------------ggaga--gccctgactgagtc-cc--c-cgcgag---cccc-
             Pacific walrus  ----------------------------gggga--gcgctgattgggtc-cc--cgcgtgag---cccca
               Weddell seal  ----------------------------gggga-------gattgggtc-cc--cgcgtgag---cccca
           Black flying-fox  ----------------------------gagga--gcgtt------------------------------
B D                 Megabat  ----------------------------gagga--gcact------------------------------
       David's myotis (bat)  ----------------------------cggga--acgccgatcgggac-cc--c-tggtaa---tcccg
B D                Microbat  ----------------------------cggga--acgccgctcgggac-cc--c-tggtaa---tcccg
              Big brown bat  ----------------------------cggga--acgccgatggggac-cc--c-tagtca---ccccc
B D                 Manatee  ----------------------------ggcga--gcgctaatc-agtc-cc--gttgtata---agcct
           Cape golden mole  ----------------------------ggcga--gcgcagagctagtc-at--tttgtgca---cacct
B D                  Tenrec  ----------------------------ggaga--acgcgaatcgagcc-ct--tgaggctt---gccct
                   Aardvark  ----------------------------aggaa--gcgttgatccagtg-tt--cttatgag---ctcct
B D               Armadillo  ----------------------------------------gggccatcc-ct--ttgcgagg---accca
B D             Zebra finch  ag--agaagtgctcagccattcttcaccaggga-----tatatttaggc-ct--g-ttgatg---tcaca
B D      American alligator  agcaagaag----------------gccaagga----------gcaggcggc--g-caggag---gccga
B D                Elephant  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
B D              Guinea pig  ======================================================================
B D                   Horse  ======================================================================
                Chinchilla  ======================================================================
B D          Naked mole-rat  ======================================================================

                      Human  ggagctgctacc---tca
                      Chimp  ggagctgctacc---tca
                    Gorilla  ggagctgctacc---tca
                  Orangutan  ggagctgctacc---tca
                     Gibbon  ggagctgctacc---tca
                     Rhesus  ggagctgctacc---tca
        Crab-eating macaque  ggagctgctacc---tca
                     Baboon  ggagctgctacc---tca
               Green monkey  ggagctgctacc---tca
                   Marmoset  agagttgccact---tcc
            Squirrel monkey  agagctgccact---tca
                   Bushbaby  ggagctactgct---tca
         Chinese tree shrew  ggag-tgctgct---cca
                   Squirrel  gtagctccaatt---tcc
     Lesser Egyptian jerboa  ----ctgcaatt---tcc
               Prairie vole  ggagctgctg-g---ttc
            Chinese hamster  ----cctcta-g---t--
             Golden hamster  ggagctgcta-g---t--
                      Mouse  ggagtggctaca---ttc
                        Rat  ggagctgctata---ttc
           Brush-tailed rat  agggaggctaca---cca
                     Rabbit  g-----------------
                        Pig  cgggccctggca---cct
                     Alpaca  ggggtcttggct---c--
             Bactrian camel  ggggtcttggct---c--
                    Dolphin  caagccctggcg---ctg
               Killer whale  caagccctggcg---ctg
           Tibetan antelope  cgagccctggcg---caa
                        Cow  cgatccctggcg---cag
           White rhinoceros  ggagctgctgct---agc
                        Cat  -------ccacccacccc
                        Dog  gaagcagctgct---ccg
                    Ferret   ggatctgctgct---ccc
                      Panda  ------gctgct---ccg
             Pacific walrus  ggagctgctgctc-cccc
               Weddell seal  ggagctgctgctc-cccc
           Black flying-fox  ------------------
                    Megabat  ------------------
       David's myotis (bat)  ggagctgctgct---tcg
                   Microbat  ggagctgctgct---tcg
              Big brown bat  ggagctgctgct---tcg
                    Manatee  ggagcagc--------tg
           Cape golden mole  ggagttgctgct---acg
                     Tenrec  ggagttgcacca---ttg
                   Aardvark  ggagctgctgtt---tca
                  Armadillo  ggagtgggaccc---ctg
                Zebra finch  ------------------
         American alligator  ------------------
                   Elephant  ==================
              Domestic goat  ==================
                      Sheep  ==================
                 Guinea pig  ==================
                      Horse  ==================
                 Chinchilla  ==================
             Naked mole-rat  ==================

Inserts between block 18 and 19 in window
          Brush-tailed rat 596bp
          Black flying-fox 13bp
B D                Megabat 13bp
B D                Manatee 9bp
          Cape golden mole 10bp
B D                 Tenrec 9bp
                  Aardvark 10bp
B D              Armadillo 13bp

Alignment block 19 of 43 in window, 42880434 - 42880452, 19 bps 
B D                   Human  -----cgagctcct----------gtagg---------------cggcc
B D                   Chimp  -----cgagctcct----------gtagg---------------cggcc
B D                 Gorilla  -----cgagctccg----------gtagg---------------cggcc
B D               Orangutan  -----cgagctcct----------gcagg---------------cggcc
B D                  Gibbon  -----cgagctcct----------gcagg---------------cggcc
B D                  Rhesus  -----cgagctcct----------gcagg---------------cggcc
B D     Crab-eating macaque  -----cgagctcct----------gcagg---------------cggcc
B D                  Baboon  -----cgagctcct----------gcagg---------------cggcc
               Green monkey  -----cgagctcct----------gcagg---------------cggcc
B D                Marmoset  -----cgagctcct----------gcagg---------------ctgcc
B D         Squirrel monkey  -----cgagctcct----------gcagg---------------ctgcc
B D                Bushbaby  -----tgagcgcac----------atagg---------------tggcc
         Chinese tree shrew  -----cgaactcct----------gtggg---------------ccgct
B D                Squirrel  -----agacttcct----------gtaga-----agtgt----------
     Lesser Egyptian jerboa  -----ccaggctca----------gtaggtggcc---------------
               Prairie vole  -----acagtccca----------gcagg--------------------
B D         Chinese hamster  ---------tccca----------gcagg--------------------
             Golden hamster  ---------tccca----------gcagg--------------------
B D                   Mouse  -----ccaactccg----------acagg--------------------
B D                     Rat  -----ccagccccg----------acagg--------------------
B D                  Rabbit  ------gagccacc----------gtggg----------cggcc-----
B D                     Pig  -----ggga----------------------------------------
B D                 Dolphin  -----ggga----------------------------------------
               Killer whale  -----ggga----------------------------------------
           Tibetan antelope  -----ggga----------------------------------------
B D                     Cow  -----ggga----------------------------------------
B D        White rhinoceros  -----tgagctcctgtcggcggcc-------------------------
B D                     Cat  -----ggagctcct-----------------------------------
B D                     Dog  -----agagctcct-----------------------------------
B D                 Ferret   -----tgagctcct-----------------------------------
B D                   Panda  -----tgaactccc-----------------------------------
             Pacific walrus  -----tgagctcct-----------------------------------
               Weddell seal  -----tgagctcct-----------------------------------
       David's myotis (bat)  -----cgagctgct-----------------------------------
B D                Microbat  -----cgagctgct-----------------------------------
              Big brown bat  -----cgagctgct-----------------------------------
B D                 Manatee  -----taggcatct-----------------------------------
           Cape golden mole  -----taagcggcc-----------------------------------
B D                  Tenrec  -----taagcgccc-----------------------------------
                   Aardvark  -----taggcggcc-----------------------------------
B D               Armadillo  -----tctgcgctc-----------------------------------
B D             Zebra finch  gcagcacagggcc------------------------------------
B D      American alligator  gaagcagaagggc------------------------------------
B D                Elephant  =================================================
B D                 Megabat  =================================================
          Black flying-fox  =================================================
             Domestic goat  =================================================
B D                   Sheep  =================================================
            Bactrian camel  -------------------------------------------------
B D              Guinea pig  =================================================
B D                  Alpaca  -------------------------------------------------
B D                   Horse  =================================================
          Brush-tailed rat  =================================================
                Chinchilla  =================================================
B D          Naked mole-rat  =================================================

Inserts between block 19 and 20 in window
    Lesser Egyptian jerboa 9513bp
      David's myotis (bat) 522bp
B D               Microbat 89bp
             Big brown bat 42bp
B D                 Tenrec 4bp
                  Aardvark 5bp
B D              Armadillo 1bp

Alignment block 20 of 43 in window, 42880453 - 42880456, 4 bps 
B D                   Human  ggcc---
B D                   Chimp  ggcc---
B D                 Gorilla  ggcc---
B D               Orangutan  ggcc---
B D                  Gibbon  ggcc---
B D                  Rhesus  ggcc---
B D     Crab-eating macaque  ggcc---
B D                  Baboon  ggcc---
               Green monkey  ggcc---
B D                Marmoset  g------
B D         Squirrel monkey  g------
B D                Bushbaby  tgcg---
         Chinese tree shrew  cgcc---
B D        White rhinoceros  agcc---
B D                 Manatee  agcc---
           Cape golden mole  ggcc---
B D                  Tenrec  ggct---
                   Aardvark  ggcc---
B D               Armadillo  ggcc---
B D             Zebra finch  tgccagg
B D      American alligator  ggc---g
B D                     Rat  -------
            Golden hamster  -------
B D         Chinese hamster  -------
              Prairie vole  -------
B D                   Mouse  -------
    Lesser Egyptian jerboa  =======
B D                Elephant  =======
B D                   Panda  -------
B D                     Pig  -------
B D                 Megabat  =======
             Big brown bat  =======
B D                 Dolphin  -------
B D                Microbat  =======
      David's myotis (bat)  =======
          Black flying-fox  =======
             Domestic goat  =======
B D                   Sheep  =======
          Tibetan antelope  -------
              Killer whale  -------
B D                     Cow  -------
            Bactrian camel  -------
B D              Guinea pig  =======
B D                  Alpaca  -------
              Weddell seal  -------
            Pacific walrus  -------
B D                 Ferret   -------
B D                     Dog  -------
B D                Squirrel  -------
B D                  Rabbit  -------
B D                     Cat  -------
B D                   Horse  =======
          Brush-tailed rat  =======
                Chinchilla  =======
B D          Naked mole-rat  =======

Alignment block 21 of 43 in window, 42880457 - 42880466, 10 bps 
B D                   Human  ccgtcttggc
B D                   Chimp  ccgtcttggc
B D                 Gorilla  ccgtcttggc
B D               Orangutan  ccgtcttggc
B D                  Gibbon  ccgtcttggc
B D                  Rhesus  ccgtcctggc
B D     Crab-eating macaque  ccgtcctggc
B D                  Baboon  ccgtcctggc
               Green monkey  ccgtcctggc
B D                Marmoset  --gtcctggc
B D         Squirrel monkey  --gtcctggc
B D                Bushbaby  gggaagtgg-
         Chinese tree shrew  tagctctgga
B D                Squirrel  --gtcctctg
               Prairie vole  -----ctctc
B D                   Mouse  -----ctctg
B D                     Rat  -----ctctg
B D                  Rabbit  --ggcc----
B D                     Pig  -----ctcgc
B D                  Alpaca  ------ccgc
             Bactrian camel  ------cggc
B D                 Dolphin  -----cccgc
               Killer whale  -----cccgc
           Tibetan antelope  -----tctgc
B D                     Cow  -----ttcac
B D                Microbat  -----cctgg
              Big brown bat  -----cctgc
B D                 Manatee  ---------c
           Cape golden mole  ---------t
B D                  Tenrec  ---------t
                   Aardvark  ---------c
B D               Armadillo  ---------c
B D             Zebra finch  ccctcccaga
B D      American alligator  gcggcgagga
            Golden hamster  ----------
B D         Chinese hamster  ----------
    Lesser Egyptian jerboa  ==========
B D                Elephant  ==========
B D                   Panda  ----------
B D                 Megabat  ==========
      David's myotis (bat)  ==========
          Black flying-fox  ==========
             Domestic goat  ==========
B D                   Sheep  ==========
B D              Guinea pig  ==========
              Weddell seal  ----------
            Pacific walrus  ----------
B D                 Ferret   ----------
B D                     Dog  ----------
B D                     Cat  ----------
B D        White rhinoceros  ----------
B D                   Horse  ==========
          Brush-tailed rat  ==========
                Chinchilla  ==========
B D          Naked mole-rat  ==========

Inserts between block 21 and 22 in window
B D               Squirrel 6bp
B D                  Mouse 7514bp
B D                    Rat 2bp
B D                    Pig 5bp
B D                 Alpaca 5bp
            Bactrian camel 5bp
B D                Dolphin 5bp
              Killer whale 5bp
          Tibetan antelope 5bp
B D                    Cow 5bp
B D               Microbat 2bp
             Big brown bat 4bp
B D                Manatee 1bp
B D                 Tenrec 1bp
                  Aardvark 9bp
B D              Armadillo 9bp

Alignment block 22 of 43 in window, 42880467 - 42880508, 42 bps 
B D                   Human  ct------ccggggaa------------cc--cactg---------------------tagcctctgg--
B D                   Chimp  ct------ccggggaa------------cc--cactg---------------------tggcctctgg--
B D                 Gorilla  ct------ccggggaa------------cc--cactg---------------------tggcctctgg--
B D               Orangutan  ct------ccggggaa------------cc--cactg---------------------tggcttctgt--
B D                  Gibbon  ct------ccggggaa------------cc--cactg---------------------tggcctctgt--
B D                  Rhesus  ct------ccggggaa------------cc--cagtg---------------------tggcctctgt--
B D     Crab-eating macaque  ct------ccggggaa------------cc--cagtg---------------------tggcctctgt--
B D                  Baboon  ct------ccggggaa------------cc--cagtg---------------------tggcctctgt--
               Green monkey  ct------ccggggaa------------cc--cagtg---------------------tggcctctgt--
B D                Marmoset  ct------caggggaa-------------c--cactg---------------------tggcctctgg--
B D         Squirrel monkey  ct------caggggaa-------------c--cactg---------------------tggcctctgg--
B D                Bushbaby  ----------ggggta------------gcagcaatg---------------------tgacctctgt--
         Chinese tree shrew  gt------tcgggggg------------ac--caacg---------------------agacctctgt--
B D                Squirrel  ctctgggctggtggaccgggccaggttggc--ccagg---------------------aggtggccct--
               Prairie vole  ------ttctgcggac------------ac--caagg---------------------aggcctctgt--
B D         Chinese hamster  --------ctagggac------------at--caagg---------------------aggtttctgt--
             Golden hamster  --------gtgagaac------------at--caagg---------------------aggcctctgt--
B D                     Rat  --------ttggggac------------gc--caaa----------------------------------
B D                  Rabbit  ---------------------------ggc--cgtgg---------------------cgtctac-----
B D                     Pig  ----------------------------------ccc---------------------tgtgcccacg--
B D                  Alpaca  ----------------------------------ctc---------------------tgtgcccaag--
             Bactrian camel  ----------------------------------ctc---------------------tgtgcccaag--
B D                 Dolphin  ----------------------------------ctc---------------------tgtgccctcg--
               Killer whale  ----------------------------------ctc---------------------tgtgccctcg--
           Tibetan antelope  ----------------------------------ctc---------------------tgtaccttag--
B D                     Cow  ----------------------------------ctc---------------------tgtgtcctag--
B D        White rhinoceros  -----------------------------------------------------------cagccctcg--
B D                     Cat  ----------------------------------------------------------------------
B D                     Dog  ----------------------------------------------------------------------
B D                 Ferret   ----------------------------------------------------------------------
B D                   Panda  ----------------------------------------------------------------------
             Pacific walrus  ----------------------------------------------------------------------
               Weddell seal  ----------------------------------------------------------------------
           Black flying-fox  -----------------------------------tg---------------------tgagcccgcg--
B D                 Megabat  -----------------------------------tg---------------------tgagcccgcg--
B D                Microbat  -----------------------------------cc---------------------tgtgtccttg--
              Big brown bat  -----------------------------------cc---------------------tgtgccctcg--
B D                 Manatee  -----------------------------------------------tgggaa----acgcgcgcacc--
           Cape golden mole  ------------------------------------------------------------tgccc-----
B D                  Tenrec  ----------------------------------------------------------agtgcccaca--
                   Aardvark  ------------------------------------a--------tgtggaaac-ctgtgtgactgcagg
B D               Armadillo  ------------------------------------cggaaagtttgcggaga-----aaagcctccc--
B D             Zebra finch  --------------------------------------------cagagaggacaaacgggcactgcc--
B D      American alligator  --------------------------------------------caaggcggacgaggagctgctgct--
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Elephant  ======================================================================
      David's myotis (bat)  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
B D              Guinea pig  ======================================================================
B D                   Horse  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
B D          Naked mole-rat  ======================================================================

                      Human  -------gca-----a---------------------------------ggacc------------cag-
                      Chimp  -------gca-----a---------------------------------ggacc------------cag-
                    Gorilla  -------gca-----a---------------------------------ggacc------------cag-
                  Orangutan  -------gca-----a---------------------------------ggacc------------cag-
                     Gibbon  -------gca-----a---------------------------------ggacc------------cag-
                     Rhesus  -------gca-----g---------------------------------tgacc------------cag-
        Crab-eating macaque  -------gca-----g---------------------------------tgacc------------cag-
                     Baboon  -------gca-----g---------------------------------tgacc------------cag-
               Green monkey  -------gca-----g---------------------------------tgacc------------cag-
                   Marmoset  -------gca-----a---------------------------------ggacc------------cag-
            Squirrel monkey  -------gca-----a---------------------------------ggacc------------cag-
                   Bushbaby  -------gtg-----a---------------------------------ggacc------------tag-
         Chinese tree shrew  -------g-------a---------------------------------agacc------------cag-
                   Squirrel  ---------------a---------------------------------gggga------------ccg-
               Prairie vole  -------gca-----a---------------------------------ggacc------------cag-
            Chinese hamster  -------gtc-----a---------------------------------ggact------------cag-
             Golden hamster  -------gcc-----a---------------------------------ggatc------------cag-
                        Rat  ---------------a---------------------------------ggtcc------------cag-
                     Rabbit  ---------------a---------------------------------ggccg------------cag-
                        Pig  -------gcg-----a---------------------------------ggacc------------cag-
                     Alpaca  -------gcg-----a---------------------------------ggacc------------cag-
             Bactrian camel  -------gcg-----a---------------------------------ggacc------------cag-
                    Dolphin  -------gag-----a---------------------------------ggacc------------cag-
               Killer whale  -------gag-----a---------------------------------ggacc------------cag-
           Tibetan antelope  -------gcg-----a---------------------------------ggacc------------cag-
                        Cow  -------gcg-----a---------------------------------ggacc------------cag-
           White rhinoceros  -------acc-----ccggggactcgcgtagcctctgtgcccaaggcgaggacc------------cag-
                        Cat  -------------------------------------------------ggac---------------a-
                        Dog  -------------------------------------------------ggacc------------cgac
                    Ferret   -------------------------------------------------gggcg------------cga-
                      Panda  -------------------------------------------------ggacc------------aca-
             Pacific walrus  -------------------------------------------------ggacc------------cga-
               Weddell seal  -------------------------------------------------ggacc------------cga-
           Black flying-fox  -------gcg-----g---------------------------------ggacc------------cag-
                    Megabat  -------gcg-----g---------------------------------ggacc------------cag-
                   Microbat  -------gcg-----a---------------------------------gg-------------------
              Big brown bat  -------gcg-----a---------------------------------tg-------------------
                    Manatee  -------gtg-----a---------------------------------ggccc------------cag-
           Cape golden mole  ----------------------------------------------------------------------
                     Tenrec  -------gtg-----a---------------------------------ggacc------------cag-
                   Aardvark  gccgacggtg-----a---------------------------------ggatc------------cag-
                  Armadillo  -------ccg-----a---------------------------------agagc------------cag-
                Zebra finch  -------gccccatgg---------------------------------ggaccgctcctcgcccccag-
         American alligator  -------gcc-----g---------------------------------gggccg-----------gag-
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
                   Elephant  ======================================================================
       David's myotis (bat)  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
                 Guinea pig  ======================================================================
                      Horse  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
             Naked mole-rat  ======================================================================

                      Human  ------g-gt----------------
                      Chimp  ------gagt----------------
                    Gorilla  ------gagt----------------
                  Orangutan  ------gagt----------------
                     Gibbon  ------gagt----------------
                     Rhesus  ------gagt----------------
        Crab-eating macaque  ------gagt----------------
                     Baboon  ------gagt----------------
               Green monkey  ------gagt----------------
                   Marmoset  ------gagt----------------
            Squirrel monkey  ------gagt----------------
                   Bushbaby  ------gagt----------------
         Chinese tree shrew  ------t-------------------
                   Squirrel  ------ctgg----------------
               Prairie vole  ------ttgg----------------
            Chinese hamster  ------ttgg----------------
             Golden hamster  ------ttgg----------------
                        Rat  ------ttgg----------------
                     Rabbit  ------gagg----------------
                        Pig  ------gcgt----------------
                     Alpaca  ------gagt----------------
             Bactrian camel  ------gagt----------------
                    Dolphin  ------gagt----------------
               Killer whale  ------gagt----------------
           Tibetan antelope  ------gaat----------------
                        Cow  ------gaat----------------
           White rhinoceros  ------gagt----------------
                        Cat  ------gagc----------------
                        Dog  aagcagaacc----------------
                    Ferret   ------ggac----------------
                      Panda  ------gacc----------------
             Pacific walrus  ------gagc----------------
               Weddell seal  ------gagc----------------
           Black flying-fox  ------gagt----------------
                    Megabat  ------gagt----------------
                   Microbat  --------------------------
              Big brown bat  --------------------------
                    Manatee  ------cat-----------------
           Cape golden mole  --------------------------
                     Tenrec  ------gag-----------------
                   Aardvark  ------gag-----------------
                  Armadillo  ------ggt-----------------
                Zebra finch  ------ccaggcttggcactgcaggg
         American alligator  ------aagggctgcgggc-----gg
                      Mouse  ==========================
     Lesser Egyptian jerboa  ==========================
                   Elephant  ==========================
       David's myotis (bat)  ==========================
              Domestic goat  ==========================
                      Sheep  ==========================
                 Guinea pig  ==========================
                      Horse  ==========================
           Brush-tailed rat  ==========================
                 Chinchilla  ==========================
             Naked mole-rat  ==========================

Inserts between block 22 and 23 in window
B D                Manatee 13bp
          Cape golden mole 11bp
B D                 Tenrec 25bp
                  Aardvark 13bp
B D              Armadillo 63bp

Alignment block 23 of 43 in window, 42880509 - 42880562, 54 bps 
B D                   Human  a------gg-------------------ccttgggg-actgctggcc--caagc----------------
B D                   Chimp  c------gg-------------------ccttgggg-actgctggcc--taagc----------------
B D                 Gorilla  c------gg-------------------ccttgggg-actgctggcc--caagc----------------
B D               Orangutan  c------gg-------------------ccttggggaaccgctggcc--caagc----------------
B D                  Gibbon  c------gg-------------------ccttgggggaccgctggcc--caagc----------------
B D                  Rhesus  c------ag-------------------ccttgggggaccgctggcc--caagc----------------
B D     Crab-eating macaque  c------ag-------------------ccttgggggaccgctggcc--caagc----------------
B D                  Baboon  c------ag-------------------ccttgggggaccgctggcc--caagc----------------
               Green monkey  c------ag-------------------ccttgggggaccactggcc--caagc----------------
B D                Marmoset  c------gg-------------------ccttttggagccgctgacc--ggacc----------------
B D         Squirrel monkey  c------gg-------------------ccttttggggccgctgacc--cgagc----------------
B D                Bushbaby  c------ag-------------------cctcagaggactactggcc--ccagt----------------
         Chinese tree shrew  ---------------------------------------------cc--cagtc----------------
B D                Squirrel  c-----------------------------cc-----acgtac---------------------------
               Prairie vole  c------aa-------------------catc-----acctct---------------------------
B D         Chinese hamster  c------aa-------------------catc-----acctct---------------------------
             Golden hamster  c------aa-------------------catc-----acctct---------------------------
B D                     Rat  g------tg-------------------cat--------ccct---------------------------
B D                  Rabbit  cgcagcgag-------------------gacc-----gccc-----------------------------
B D                     Pig  c------tg-------------------ctcccagggcccgctggcc---gggc----------------
B D                  Alpaca  c------tg-------------------cgcccagggaccgctggcc--cgggc----------------
             Bactrian camel  c------tg-------------------cgcccagggaccgctggcc--cgggc----------------
B D                 Dolphin  c------tg-------------------ctcccaagggccgctggcc--cggac----------------
               Killer whale  c------tg-------------------ctcccaagggccgctggcc--cggac----------------
           Tibetan antelope  c------tg-------------------cttccggaggccgctgacc--cgggc----------------
B D                     Cow  c------tg-------------------gttccagaggccgctggcc--tgggc----------------
B D        White rhinoceros  c------gg--------------------cccccaggaccgctggcc--caggc----------------
B D                     Cat  g------tg---------------------------------tggcc--tctgt----------------
B D                     Dog  c------ag-------------------gcccccaggacccctggct--ctggc----------------
B D                 Ferret   c----------------------------ctc------ccgccggcc--tagg-----------------
B D                   Panda  c------ag-------------------actccgaggactgctggcc--c-ggc----------------
             Pacific walrus  c------ag-------------------cccccgaggacccctggcc--caggc----------------
               Weddell seal  c------ag-------------------cccctgaggacccctggcc--caggc----------------
           Black flying-fox  c------ag-------------------ccctcggagagcgctga-c--caggc----------------
B D                 Megabat  c------ag-------------------tccccggagagcgctga-c--caggc----------------
B D                Microbat  ------------------------------ccctgggaccgctgacc--caggc----------------
              Big brown bat  -----------------------------cccctgggaccgctgacc--caggc----------------
B D                 Manatee  -------atgcagcacgga---------gcccagaagatc------c--tctcc----------------
           Cape golden mole  -------aa-------------------tcctcgaagacctgtggtc--gcatc-----------aaagg
B D                  Tenrec  -------ag--agcggggagtggcc---tcctcgaagaccttgggct--taaccttttccggtgtggaca
                   Aardvark  -------acgcggcacaga---------gctgggaa----------------------------------
B D             Zebra finch  --------------------tggctgagctcctgggggctgctggcc--ccagc----------------
B D      American alligator  --------------------cggctg------cgggagctgcgggacagcgagc----------------
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Elephant  ======================================================================
      David's myotis (bat)  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
B D              Guinea pig  ======================================================================
B D               Armadillo  ======================================================================
B D                   Horse  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
B D          Naked mole-rat  ======================================================================

                      Human  -acgagtggcggg-------ga-cacagcg-cc----ggacg
                      Chimp  -acgagtggcggg-------ga-cacagcg-cc----ggacg
                    Gorilla  -acgagtggcggg-------ga-cacagcg-cc----ggacg
                  Orangutan  -acgagtggcggg-------ga-cacagcg-cc----gggcg
                     Gibbon  -acgagtggcgag-------ga-cacagcg-cc----gggcg
                     Rhesus  -acgagtggcagg-------ga-cacagcg-cc----aggcg
        Crab-eating macaque  -acgagtggcagg-------ga-cacagcg-cc----gggcg
                     Baboon  -acgagtggcagg-------ga-cacagcg-cc----gggcg
               Green monkey  -atgagtggcagg-------ga-cacagcg-cc----ggacg
                   Marmoset  -acgagtggtggg-------ga-cgcagcg-cc----gggcg
            Squirrel monkey  -acgagtggcggg-------ga---cagct-gc----gggcg
                   Bushbaby  -acaag--------------------------c----cggtg
         Chinese tree shrew  -acaagtgtcagg-------ga-cgctgcg-cc----tggcg
                   Squirrel  --aaag-gtccgg-------ga-tgcagcg-ccgctgggg-g
               Prairie vole  --aaagcgtaggt-------gg-ctcagct-cc----cag-g
            Chinese hamster  --taagtgtagtt-------ga-ctcagct-cc----ctg-g
             Golden hamster  --ttagtgtaggt-------gt-ttcagct-cc----cga-g
                        Rat  --taagcataggt-------gt-ttcagct-cc----ggg-t
                     Rabbit  ----ggcgcggga-------ga-ccctcccgcc----gag-g
                        Pig  -cctcgagcccaa-------ga-cgcagcg-ct----tgggg
                     Alpaca  -agtagagcccaa-------ggccggagcc-ct----tcgcg
             Bactrian camel  -agtagagcccaa-------ggacggagcc-ct----tcgcg
                    Dolphin  -actagagcccaa-------ga-cgcagcc-ct----ctgcg
               Killer whale  -actagagcccaa-------ga-cgcagcc-ct----ctgcg
           Tibetan antelope  -gctagagcctaa-------gg--------------------
                        Cow  -gctagagtccaa-------gg--------------------
           White rhinoceros  -accagagccaga-------ggacgcagcg-cc----gcgtg
                        Cat  -ccccacgcaa-g-------ga-----------------ccg
                        Dog  -gccc-------a-------ggacacagca-cc----gtgcg
                    Ferret   --ccagc--------------------------------ttt
                      Panda  -tcca----------------------------------ccg
             Pacific walrus  -accagcgccg-a-------ggacacaggg-ct----atgcg
               Weddell seal  -accagcgcca-a-------ggacacaggg-ct----gtgcg
           Black flying-fox  -cctagggtggga-------ggacccggcg-cc----gtgcg
                    Megabat  -cctagggtggga-------ggacccggcg-cc----gtgcg
                   Microbat  -acgagcgcccga-------gga-----------------cg
              Big brown bat  -acgagcgcccga-------gga-----------------cg
                    Manatee  agccagcccagaa-----------------------------
           Cape golden mole  attcagcaccgagctcggaa----------------------
                     Tenrec  agacagtcccggacttgcaa----------------------
                   Aardvark  ------------------------------------------
                Zebra finch  -acgggcaggggg-------ag-cacggcg-ct----gcacg
         American alligator  -ccgaggaggacg-------ag----gagg-cc----ggaca
                      Mouse  ==========================================
     Lesser Egyptian jerboa  ==========================================
                   Elephant  ==========================================
       David's myotis (bat)  ==========================================
              Domestic goat  ==========================================
                      Sheep  ==========================================
                 Guinea pig  ==========================================
                  Armadillo  ==========================================
                      Horse  ==========================================
           Brush-tailed rat  ==========================================
                 Chinchilla  ==========================================
             Naked mole-rat  ==========================================

Inserts between block 23 and 24 in window
B D               Microbat 1bp
B D                 Tenrec 25068bp
B D     American alligator 8bp

Alignment block 24 of 43 in window, 42880563 - 42880567, 5 bps 
B D                   Human  cccaa
B D                   Chimp  cccaa
B D                 Gorilla  cccaa
B D               Orangutan  ctcaa
B D                  Gibbon  cccaa
B D                  Rhesus  cccaa
B D     Crab-eating macaque  cccaa
B D                  Baboon  cccaa
               Green monkey  cccaa
B D                Marmoset  ccaaa
B D         Squirrel monkey  ccaaa
B D                Bushbaby  acaag
         Chinese tree shrew  tctgg
B D                Squirrel  ccaag
               Prairie vole  ctaaa
B D         Chinese hamster  ctaaa
             Golden hamster  ctgaa
B D                     Rat  ttaag
B D                  Rabbit  cccgg
B D                     Pig  tgggg
B D                  Alpaca  ccaag
             Bactrian camel  ccaag
B D                 Dolphin  ccgag
               Killer whale  ccgag
B D        White rhinoceros  ccaac
B D                     Cat  ccgag
B D                     Dog  ccaag
B D                 Ferret   ccctg
B D                   Panda  ccgag
             Pacific walrus  ccgag
               Weddell seal  ccgag
           Black flying-fox  ccaac
B D                 Megabat  ccaac
B D                Microbat  cccaa
              Big brown bat  cccag
B D      American alligator  cctac
B D                  Tenrec  =====
                  Aardvark  -----
B D                   Mouse  =====
    Lesser Egyptian jerboa  =====
          Cape golden mole  -----
B D                Elephant  =====
      David's myotis (bat)  =====
             Domestic goat  =====
B D                   Sheep  =====
          Tibetan antelope  -----
B D                     Cow  -----
B D              Guinea pig  =====
B D                 Manatee  -----
B D               Armadillo  =====
B D                   Horse  =====
          Brush-tailed rat  =====
                Chinchilla  =====
B D          Naked mole-rat  =====

Alignment block 25 of 43 in window, 42880568 - 42880581, 14 bps 
B D                   Human  ga---c-----cct--ccc--cagtc--
B D                   Chimp  ga---c-----cct--ccc--cagtc--
B D                 Gorilla  ga---c-----cct--ccc--cagtc--
B D               Orangutan  ga---c-----cct--ccc--cagtc--
B D                  Gibbon  ga---c-----cct--ccc--cagtc--
B D                  Rhesus  ga---c-----cct--ccc--cagtc--
B D     Crab-eating macaque  ga---c-----cct--ccc--cagtc--
B D                  Baboon  ga---c-----cct--ccc--cagtc--
               Green monkey  ga---c-----cct--ccc--cagtc--
B D                Marmoset  ga---c-----cct--ccc--gagac--
B D         Squirrel monkey  ga---c-----cct--tcc--cagac--
B D                Bushbaby  ga---c-----cct--tcc-tcagtg--
         Chinese tree shrew  ga---t-----cct--ccc--taggc--
B D                Squirrel  ga---c-----cct--tct--cggtt--
               Prairie vole  ga---c-----cct--ccc--tagtg--
B D         Chinese hamster  ga---c-----cct--ctc--tagtg--
             Golden hamster  ga---c-----cct--ccc--tagtg--
B D                     Rat  ga---c-----act--ctc--cggtg--
B D                  Rabbit  gc---cggcctcct--ccg--tcctg--
B D                     Pig  -a---c-----cct--ccc--caatc--
B D                  Alpaca  ga---c-----cct--ccg--cagtc--
             Bactrian camel  ga---c-----cct--ccg--cagtc--
B D                 Dolphin  ca---c-----cct--ccc--cagtc--
               Killer whale  ca---c-----cct--ccc--cagtg--
           Tibetan antelope  -a---c-----cct--ccc--cagtc--
B D                     Cow  -a--------------ccc--cagtc--
B D        White rhinoceros  ga----------cc--ctcggcagtc--
B D                     Cat  ga----------ccctctc--cagcc--
B D                     Dog  gc----------cc--gtc--cagcc--
B D                 Ferret   g------------c--ctg--cagct--
B D                   Panda  ga----------cc--ctc--cagcc--
             Pacific walrus  ga----------cc--ctc--cagcc--
               Weddell seal  ga----------cc--ctc--cagcc--
           Black flying-fox  gacccc-----ctc--ccc--taagc--
B D                 Megabat  gacccc-----ctc--ccc--taagc--
B D                Microbat  cacccc-----ccc--ccc--cagtc--
              Big brown bat  ga---c-----cct--ccc--tggcc--
B D                 Manatee  ga---t-----cct--ccc--cagcc--
           Cape golden mole  ga---t-----cct--ccc--taggc--
                   Aardvark  aa---t-----cct--cct--cagcc--
B D      American alligator  -----c-----act--cct--ccgactg
B D                  Tenrec  ============================
B D                   Mouse  ============================
    Lesser Egyptian jerboa  ============================
B D                Elephant  ============================
      David's myotis (bat)  ============================
             Domestic goat  ============================
B D                   Sheep  ============================
B D              Guinea pig  ============================
B D               Armadillo  ============================
B D                   Horse  ============================
          Brush-tailed rat  ============================
                Chinchilla  ============================
B D          Naked mole-rat  ============================

Inserts between block 25 and 26 in window
                  Aardvark 26980bp

Alignment block 26 of 43 in window, 42880582 - 42880602, 21 bps 
B D                   Human  cgcctaggc----------------tggcatttcttg
B D                   Chimp  cgcctaggc----------------tggcatttcttg
B D                 Gorilla  cgcctaggc----------------tggcatttcttg
B D               Orangutan  cgcctaggc----------------tggcctttcttg
B D                  Gibbon  cgcctaggc----------------tggcctttcttg
B D                  Rhesus  cgcctaggc----------------tggcctttcttg
B D     Crab-eating macaque  cgcctaggc----------------tggcctttcttg
B D                  Baboon  cgcctaggc----------------tggcctttcttg
               Green monkey  cgcctaggc----------------tggcctttcttg
B D                Marmoset  ctcctagaa----------------tgtcctttcttg
B D         Squirrel monkey  ctcctagac----------------tggcctttcttg
B D                Bushbaby  gccctcagc----------------cagcctttctca
         Chinese tree shrew  t------ac----------------agtccgatctca
B D                Squirrel  ccccttggc----------------ttttctt-----
               Prairie vole  tgcccagac----------------tttccta-----
B D         Chinese hamster  tgcccaggc----------------tttcctg-----
             Golden hamster  tgcccaggg----------------tttccgg-----
B D                     Rat  aagccaggc----------------tttccta-----
B D                  Rabbit  gggccaaag----------------tcccttg-----
B D                     Pig  cgctcggg-----------------tggcccttctcg
B D                  Alpaca  cgctgggg-----------------cggcatctctct
             Bactrian camel  cgttgggg-----------------cggcatctctct
B D                 Dolphin  ttcttggg-----------------cggctcttctct
               Killer whale  ctcttggg-----------------cggctcttctct
           Tibetan antelope  ctcttggg-----------------gggcctttttct
B D                     Cow  ctattggg-----------------gggcctttttct
B D        White rhinoceros  ctactgtg-----------------cggcctttccct
B D                     Cat  ctcctgtgc----------------ctgccttttttt
B D                     Dog  caccggtgc----------------cagcctttcctg
B D                 Ferret   cccaagttc----------------caa-----gtcc
B D                   Panda  tgcctgggc----------------cagcctttcttt
             Pacific walrus  tgcctgggc----------------cagcctttcttt
               Weddell seal  tgcctgggc----------------cagcctttcttt
           Black flying-fox  gccctgtg-----------------cgtcttttctct
B D                 Megabat  tccctgtg-----------------cgtcttttctct
B D                Microbat  tttctgag-----------------ccccccttctct
              Big brown bat  ctcctgag-----------------ccgcccgtctc-
B D                 Manatee  cacctcagt----------------cggcctttg---
           Cape golden mole  cacct---------------------ggac-------
B D      American alligator  ctccgaggccgacgacgaggagccgcagccccgcg--
B D                  Tenrec  =====================================
                  Aardvark  =====================================
B D                   Mouse  =====================================
    Lesser Egyptian jerboa  =====================================
B D                Elephant  =====================================
      David's myotis (bat)  =====================================
             Domestic goat  =====================================
B D                   Sheep  =====================================
B D              Guinea pig  =====================================
B D               Armadillo  =====================================
B D                   Horse  =====================================
          Brush-tailed rat  =====================================
                Chinchilla  =====================================
B D          Naked mole-rat  =====================================

Inserts between block 26 and 27 in window
B D               Squirrel 12bp
              Prairie vole 46bp
B D        Chinese hamster 110bp
            Golden hamster 18bp
B D                    Rat 9bp
B D                    Pig 15bp
B D                 Alpaca 15bp
            Bactrian camel 15bp
B D                Dolphin 15bp
              Killer whale 15bp
          Tibetan antelope 15bp
B D                    Cow 15bp
B D       White rhinoceros 13bp
B D                    Cat 15bp
B D                    Dog 15bp
B D                Ferret  15bp
B D                  Panda 15bp
            Pacific walrus 15bp
              Weddell seal 15bp
          Black flying-fox 15bp
B D                Megabat 15bp
B D               Microbat 14bp

Alignment block 27 of 43 in window, 42880603 - 42880671, 69 bps 
B D                   Human  ----g-----cccc----cac----c---------agc-gtc--------c---gg-tggaaagtg--ct
B D                   Chimp  ----g-----cccc----cac----c---------agc-gtc--------c---gg-tggaaatgg--ct
B D                 Gorilla  ----g-----cccc----cac----c---------agc-gtc--------c---gg-tggaaaggg--cg
B D               Orangutan  ----g-----cccc----cac----c---------agc-gtc--------c---tg-tggaaaggg--ct
B D                  Gibbon  ----g-----ctcc----cac----c---------agc-gta--------c---gg-tggaaaggg--ct
B D                  Rhesus  ----g-----cccc----cac----c---------agc-gtc--------c---ag-tggaaaggg--ct
B D     Crab-eating macaque  ----g-----cccc----cac----c---------agc-gtc--------c---ag-tggaaaggg--ct
B D                  Baboon  ----g-----cccc----cac----c---------agc-gtc--------c---ag-tggaaaggg--ct
               Green monkey  ----g-----cccc----cac----c---------agc-gtc--------c---ag-tggaaaggg--ct
B D                Marmoset  ----g------tcc----cgc----c---------agc-gtc--------c---ct-tggaaaggg--gt
B D         Squirrel monkey  ----g-----cccc----cgc----c---------agc-gtt--------c---tg-tggaaaggg--gt
B D                Bushbaby  ----g------ccc----tgg----a---------aac-gtc--------c--ttg-aagaagggg--ct
         Chinese tree shrew  ----a-----atcc----ctt----c---------agctgtcggagcctgc---ag-tggaaaaga--ct
B D                Squirrel  ----g-----cctccagtctc----ccctcctcctaac-gtc--------t---cc-tggacagcg--tt
               Prairie vole  ----g-----cccccagcacc----c---------aaa-gtc--------c---cc-tgggaagc-----
             Golden hamster  ----g-----tccgaagcccc----c---------aaa-gtt--------c---cc-tgggaagc-----
B D                     Rat  ----a-----tctcttgggtc----c---------gaa-gtc--------c---tc------agc-----
B D                  Rabbit  ----g-----cctc----gtc----c---------cac-atc--------cgagtt-gaaagagc-----
B D                     Pig  ----g-----cccc----tcc----c---------tct-ccc--------t---gg-----gaacg--tc
B D                  Alpaca  ----g-----cccc----tcc----c---------cct-ccc--------t---gg-----gaaca--ac
             Bactrian camel  ----g-----cccc----tcc----c---------cct-ccc--------t---gg-----gaaca--ac
B D                 Dolphin  ----g-----tccc----tcc----c---------cct-ccc--------t---ca-----gtacg--tc
               Killer whale  ----g-----tccc----tcc----c---------cct-ccc--------t---ca-----gtaca--tc
           Tibetan antelope  ----g-----tccc----tcc----c---------ctt-ccc--------t---ca-----gaacg--tc
B D                     Cow  ----g-----tccc----tcc----c---------ctt-ccc--------t---ca-----gaacg--tc
B D        White rhinoceros  ----g-----tccc----tcc-cccc---------gcc-ctc--------g---ga-------acg--tc
B D                     Cat  ----g-----tcac----ccc----c---------acc-ttc--------c---cc-------ttg--tc
B D                     Dog  ----g-----ctcc----tcc----c---------acc-ctc--------c---gg-------aca--cc
B D                 Ferret   ----g-----g---------------------------------------------------------cc
B D                   Panda  ----g-----ttcc----tcc----c---------acc-ctc--------c---cg-------acg--cc
             Pacific walrus  ----g-----tgcc----ccc-ctcc---------acc-ctc--------c---cg-------aag--cc
               Weddell seal  ----g-----tccc----cccacccc---------acc-ctc--------c---cg-------acg--cc
           Black flying-fox  ----gtgtaacccc----agc----c---------ccc-tcc--------t---cgcctcctggaaggca
B D                 Megabat  ----gtgtaacccc----agc----c---------ccc-tcc--------t---cgcctcctcaaa--ca
B D                Microbat  ----g-----tccc----ttc----c---------ccc-tcc--------t---cg------ggac--gt
              Big brown bat  ----------tccc----tcc----c---------acc-tcc--------t---cg------ggac--gt
B D                 Manatee  ---------tctgc----cct----c---------agc-tct--------c---aa------gtcc--ct
           Cape golden mole  ----------ctgc----ctt----c---------agt-act--------c---aa------gttc--cg
B D      American alligator  gcagg-----cacc----tgc----c---------tcc-gcc--------c---cc-----agccc--cg
B D                  Tenrec  ======================================================================
                  Aardvark  ======================================================================
B D         Chinese hamster  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
B D                Elephant  ======================================================================
      David's myotis (bat)  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
B D              Guinea pig  ======================================================================
B D               Armadillo  ======================================================================
B D                   Horse  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
B D          Naked mole-rat  ======================================================================

                      Human  cccc----cggatggtcccaggtctctc---gg--cac--caccggccagg
                      Chimp  cccc----cggatggtcccaggtctctc---gg--cac--caccggcctgg
                    Gorilla  cccc----aggatggtcccagg--tctc---gg--cac--caccggccagg
                  Orangutan  cccc----aggatggtctcgggtctctc---gg--tac--caccagccagg
                     Gibbon  cccc----aggagagtcccagg--tctc---tg--cac--caccggccagg
                     Rhesus  cccc----aggagggtcccaggtctctc---tg--cac--cactggccagg
        Crab-eating macaque  cccc----aggagggtcccaggtctctc---tg--cac--cactggccagg
                     Baboon  cccc----aggagggtcccaggtctctc---tg--cac--cactggccagg
               Green monkey  cccc----aggagggtcccaggtctctc---tg--cac--cactggccagg
                   Marmoset  cccc----agga-ggtcccaggtctccc---tg--cac--gactggccagg
            Squirrel monkey  cccc----agga-ggtcccaggtctccc---tg--cag--gactggccagg
                   Bushbaby  ccca----ggagtggcccgaggcctctt---g-----------------gg
         Chinese tree shrew  ccgc----agga-ggagctgtctttccc---tg--aac--cacagg--ggt
                   Squirrel  cccc----agaggg-acacgacatcttttagtg--ggc--catcgg-tgga
               Prairie vole  ttcc----agaggcaatgggacattgct---tg--tac--cgaggg-tggg
             Golden hamster  ttcc----agagggcctgggatgttatt---tg--tac--cgaggg-tgga
                        Rat  cccc----agctcccagaaactgttact---tg--tac--cgaagg-tggg
                     Rabbit  tccccaggagcggcccgcgggcggcacc---gg--gcc--tgaatg-gggt
                        Pig  ccca----ggagcggctccacgtcctcc---cgcccac--ctaaggcaaga
                     Alpaca  ccca----agagtggc-tgaagtcttcc---cgcccac--ctaagacgaga
             Bactrian camel  ccca----agagtggc-tgaagtcttcc---cgcccac--ctaagaggaga
                    Dolphin  ccca----agagtggcttgaggtcttcc---cgcccac--ctaacgcaaga
               Killer whale  ccca----agagtggcttgaggtcttcc---cgcccac--ctaaggcaaga
           Tibetan antelope  ccca----ggagtggcttgaggtcttcc---tgccccc-actaagg-----
                        Cow  ccca----ggagtggcttgaggtcttcc---tgcccccaactaagg-----
           White rhinoceros  ccca----ggagtggcgctaagacttcc---tacccgc--taaaggcaagg
                        Cat  ccca----gcagtggttaaagggctacc---cac-cat--cacggacaagg
                        Dog  ccag----ggagcacggacaggtcttcc---ca-gcac--ggcaggcaagg
                    Ferret   ccca----cgagtggtgtgaggtcttcc---cacgcag--cgcaggcaagg
                      Panda  ccca----ggagggggttgaggtcttcc---cacgcac--cgcgggcaagg
             Pacific walrus  ccca----ggagtggcgagaggtcttcc---catgcac--ctcaggcaagg
               Weddell seal  ccca----ggagtggcgagaggccttcc---cacgcac--cgcaggcaagg
           Black flying-fox  ccca----ggagcggcgcgaggacttcc---tgcccac--cgatggcaagg
                    Megabat  ccca----gaagcggcgcgaggacttcc---tg-ccac--cgatggcaagg
                   Microbat  ccca----gcaggggcgccaggagtccc---cgcccac--ccaaggcaggg
              Big brown bat  ccca----gcaggggcgccaggagtccc---cgcccac--ccacggcaggg
                    Manatee  ccct----aggatggcacatggtcttcc---aa--gaa-cccaaggcaagg
           Cape golden mole  cccc----agagtggttcgtggtgttcc---cgccgaa--ccaacgcaaag
         American alligator  cccc----agtgaggc---------tcc---cg--cac--ccccgccccgg
                     Tenrec  ===================================================
                   Aardvark  ===================================================
            Chinese hamster  ===================================================
                      Mouse  ===================================================
     Lesser Egyptian jerboa  ===================================================
                   Elephant  ===================================================
       David's myotis (bat)  ===================================================
              Domestic goat  ===================================================
                      Sheep  ===================================================
                 Guinea pig  ===================================================
                  Armadillo  ===================================================
                      Horse  ===================================================
           Brush-tailed rat  ===================================================
                 Chinchilla  ===================================================
             Naked mole-rat  ===================================================

Alignment block 28 of 43 in window, 42880672 - 42880694, 23 bps 
B D                   Human  gc--gggagtgaggaagtg-g--tggga-
B D                   Chimp  gc--gggagtgaggaagtg-g--tggga-
B D                 Gorilla  gc--gggagtgaggaagtg-g--tggga-
B D               Orangutan  gc--gggagtgaggaagcg-g--tggga-
B D                  Gibbon  gc--gggagtgaggaagcg-g--tggga-
B D                  Rhesus  gt--gggattgaggaagcg-g--tggga-
B D     Crab-eating macaque  gt--gggattgaggaagcg-g--tggga-
B D                  Baboon  gt--gggagtgaggaagcg-g--tggga-
               Green monkey  gt--gggagtgaggaagcg-g--tggga-
B D                Marmoset  gc--gggaatgaggaa-ta-g--tggga-
B D         Squirrel monkey  gc--gggagtgaggga-tc-g--tgggg-
B D                Bushbaby  gt--agggatgaggacac--g--tagaa-
         Chinese tree shrew  gc--ggggatgagaaagcc-g--tggg--
B D                Squirrel  ac--ccggctgaggaa-------tatg--
               Prairie vole  gc--agaaatgaggcaagg-ga-tgtg--
             Golden hamster  gc--agaaatgaggagggg-gagtgcg--
B D                     Rat  gc--agaggtgaggtggca-ga-gaag--
B D                  Rabbit  gc--gccggggtggtcgga----------
B D                     Pig  gaccagg---gagggaaga-g--ggtga-
B D                  Alpaca  aacagggggtgaggaaaga-g--ggtga-
             Bactrian camel  aacagggggtgaggaaaga-g--ggtga-
B D                 Dolphin  gacagggggtgaggaaaga-g--ggtaa-
               Killer whale  gacagggggtgaggaaaga-g--ggtaa-
           Tibetan antelope  --cagagggtgagggaaaa-g--ggtga-
B D                     Cow  --cagagggtgagggtaaa-g--ggtga-
B D        White rhinoceros  gt--------gaggaaaag-g--gataa-
B D                     Cat  gcg-ggggggggggggaagcg--gggga-
B D                     Dog  gac-g---------------c--ggtga-
B D                 Ferret   gac-gcccgggagggaaa--g--ggtga-
B D                   Panda  gac-gccggaaaagaaag--g--ggtga-
             Pacific walrus  gac-gcgggagtagaaaga-g--ggtga-
               Weddell seal  gac-gggggagaggaaaga-g--agtga-
           Black flying-fox  gac-gggggtgagaaaagc-a--ggtga-
B D                 Megabat  gac--ggggtgag-acagc-a---gtga-
B D                Microbat  gacaagggctgaggaaagg-g--agtga-
              Big brown bat  gaccggggatgaggagagg-g--agtg--
B D                 Manatee  cacagcgggtgaggaaggg-g--atggaa
           Cape golden mole  gacagcggataaaaaaggg-g--atggga
B D                  Tenrec  =============================
                  Aardvark  =============================
B D         Chinese hamster  =============================
B D                   Mouse  =============================
    Lesser Egyptian jerboa  =============================
B D                Elephant  =============================
      David's myotis (bat)  =============================
             Domestic goat  =============================
B D                   Sheep  =============================
B D              Guinea pig  =============================
B D               Armadillo  =============================
B D                   Horse  =============================
          Brush-tailed rat  =============================
                Chinchilla  =============================
B D          Naked mole-rat  =============================

Inserts between block 28 and 29 in window
B D                 Rabbit 334bp
B D                    Pig 2bp
B D                 Alpaca 2bp
            Bactrian camel 2bp
B D                Dolphin 2bp
              Killer whale 2bp
          Tibetan antelope 2bp
B D                    Cow 2bp
B D       White rhinoceros 2bp
B D                    Cat 2bp
B D                    Dog 2bp
B D                Ferret  2bp
B D                  Panda 2bp
            Pacific walrus 2bp
              Weddell seal 2bp
          Black flying-fox 2bp
B D                Megabat 2bp
B D               Microbat 2bp
             Big brown bat 2bp

Alignment block 29 of 43 in window, 42880695 - 42880706, 12 bps 
B D                   Human  cacacctcagcc
B D                   Chimp  cacacctcagcc
B D                 Gorilla  cacacctcagcc
B D               Orangutan  cacacctcagcc
B D                  Gibbon  cacacctcagcc
B D                  Rhesus  cacacctcagtc
B D     Crab-eating macaque  cacacctcagtc
B D                  Baboon  cacacctcagtc
               Green monkey  cacacctcagtc
B D                Marmoset  tacacctcaggc
B D         Squirrel monkey  tacacctcagcc
B D                Bushbaby  cacacctcagct
         Chinese tree shrew  tgcacctcagcc
B D                Squirrel  cct----cagtt
               Prairie vole  ctatctgtagtc
             Golden hamster  ctctctgcagtc
B D                     Rat  ttctctgcagtc
B D                     Pig  tgaactctcgtc
B D                  Alpaca  ggaatcttcgtt
             Bactrian camel  gaaatcttagtt
B D                 Dolphin  taaatct-----
               Killer whale  caaatct-----
           Tibetan antelope  taaagcttagct
B D                     Cow  taaagcttagct
B D        White rhinoceros  taaaccttagtc
B D                     Cat  taaaccttc-tc
B D                     Dog  taagcctcagtc
B D                 Ferret   taaaccgtagtc
B D                   Panda  taacccttagcc
             Pacific walrus  taaaccttagcc
               Weddell seal  taaaccttagtc
           Black flying-fox  tgccccttagtc
B D                 Megabat  tgccccttagtc
B D                Microbat  taaactttggtc
              Big brown bat  taaactttggtc
B D                 Manatee  taaacctcggaa
           Cape golden mole  taaacctcagaa
B D                  Tenrec  ============
                  Aardvark  ============
B D         Chinese hamster  ============
B D                   Mouse  ============
    Lesser Egyptian jerboa  ============
B D                Elephant  ============
      David's myotis (bat)  ============
             Domestic goat  ============
B D                   Sheep  ============
B D              Guinea pig  ============
B D               Armadillo  ============
B D                  Rabbit  ============
B D                   Horse  ============
          Brush-tailed rat  ============
                Chinchilla  ============
B D          Naked mole-rat  ============

Inserts between block 29 and 30 in window
          Black flying-fox 1bp

Alignment block 30 of 43 in window, 42880707 - 42880728, 22 bps 
B D                   Human  ag-g--aagacgtggc-tgttcccgg
B D                   Chimp  ag-g--aagacgtggc-tgttcccgg
B D                 Gorilla  ag-g--aagacgtggc-tgtttccgg
B D               Orangutan  ag-g--aagacgtggc-tgttcccgg
B D                  Gibbon  ag-g--aagacgtggc-tgctcccgg
B D                  Rhesus  ag-g--aagacgtggc-tcttcctgg
B D     Crab-eating macaque  ag-g--aagacgtggc-tcttcctgg
B D                  Baboon  ag-g--aagacgtggc-tgtttctgg
               Green monkey  ag-g--aagacgtggc-tgttcctgg
B D                Marmoset  c--a--aggacttggc-tgtttgcgg
B D         Squirrel monkey  cgaa--aagacttggc-tgttcgcgg
B D                Bushbaby  ca-g--gagataaggc-ttttccctg
         Chinese tree shrew  ca-g--aga---cagc-ttttctcgg
B D                Squirrel  ca-g--aagacccgcc-cttcccc--
               Prairie vole  tc-t--aagacccggt-cttccac--
             Golden hamster  tc-t--gagaccaagt-catccac--
B D                     Rat  tt-t--acaacctggt-cttctac--
B D                     Pig  ta-g--aaggcatggctttctgccc-
B D                  Alpaca  ca-g--aaggcatggc-ttttccat-
             Bactrian camel  ca-g--aaggcatggc-ttttccat-
B D                 Dolphin  --------------------tgcct-
               Killer whale  --------------------tgcct-
           Tibetan antelope  -----------------ttctactt-
B D                     Cow  -----------------ttctgcct-
B D        White rhinoceros  ca-g--aagccctggc-tttccctct
B D                     Cat  ca-g--aaggca-ggc-tcttccctg
B D                     Dog  ca-ggagaggcgtggc-tcttccctg
B D                 Ferret   ca-a--aaggcttggc-ttttcccgg
B D                   Panda  ca-g--aaggcttggc-ttttccctg
             Pacific walrus  ca-g--aaagtatggc-ttttccctg
               Weddell seal  ca-a--aaggcctgtc-ttttccctg
           Black flying-fox  cg-a---aggcttggc-ttgaga---
B D                Microbat  ca-g--ccggca-ggc-ttccac---
              Big brown bat  cg-g---aggca--gc-ttccac---
B D                 Manatee  ca-a--aaggcctgac-tgtctccct
           Cape golden mole  ct-g--aaggcctgat-ttcgcccct
B D                  Tenrec  ==========================
                  Aardvark  ==========================
B D         Chinese hamster  ==========================
B D                   Mouse  ==========================
    Lesser Egyptian jerboa  ==========================
B D                Elephant  ==========================
      David's myotis (bat)  ==========================
             Domestic goat  ==========================
B D                   Sheep  ==========================
B D              Guinea pig  ==========================
B D               Armadillo  ==========================
B D                  Rabbit  ==========================
B D                   Horse  ==========================
          Brush-tailed rat  ==========================
                Chinchilla  ==========================
B D          Naked mole-rat  ==========================

Inserts between block 30 and 31 in window
B D                Ferret  1677bp
          Black flying-fox 4bp
B D               Microbat 12bp
             Big brown bat 11bp

Alignment block 31 of 43 in window, 42880729 - 42880754, 26 bps 
B D                   Human  g-cacttgagaggttctttc--taatgtt---
B D                   Chimp  g-cacttgagaggttctttc--taatgtt---
B D                 Gorilla  g-cacttgagaggttctttc--taatgtt---
B D               Orangutan  g-cacttcagaggttctttc--caatgtt---
B D                  Gibbon  g-cacttcagaggttctttc-----tgtt---
B D                  Rhesus  g-cacttcagaggttctttc--caatgtt---
B D     Crab-eating macaque  g-cacttcagaggttctttc--caatgtt---
B D                  Baboon  g-cacttcagaggttctttc--caatgtt---
               Green monkey  g-cacttcagaggttctttc--caacgtt---
B D                Marmoset  g-cgcttcagacgttctttc--cagtgtc---
B D         Squirrel monkey  g-cgcttcagacgttctttc--cagtgtc---
B D                Bushbaby  g-gacttcagag----tctc--caatatt---
         Chinese tree shrew  g-tgttttagaggtacttccgatgtcgtt---
B D                Squirrel  --cacttctgaagccccttg-gcaag-tc---
               Prairie vole  --tactt---------------cagg------
             Golden hamster  --tactt---------------cagg------
B D                     Rat  --tacttgacagactccgag-acact------
B D                     Pig  g-tccttgagaggctctttc--caacgct---
B D                  Alpaca  catccttaagaggctctttc--caatgct---
             Bactrian camel  catccttacgaggctctttc--caatgct---
B D                 Dolphin  c-tctttaagaggctctttt--caatgct---
               Killer whale  c-tttttaagaggctctttt--caatgct---
           Tibetan antelope  c-cttttaagaggctcttcc--caatgtc---
B D                     Cow  c-cttttaagaggctcttcc--caatgtc---
B D        White rhinoceros  -gtctttaagaggtgctttc--caaggct---
B D                     Cat  ---tccttaggatctctttc--caaatt----
B D                     Dog  --tcctgcaga--ctctttc--caatgca---
B D                   Panda  --cccttcagaagctctttc--cagtgct---
             Pacific walrus  --tccttcagaagctcttcg--cagtgct---
               Weddell seal  --tccttcagaagctctttc--cagtgct---
           Black flying-fox  -----gcaagaggctctttg--cgatgct---
B D                Microbat  -ctccttaagtggctctcgc--caatgct---
              Big brown bat  -ctccttacgtggctcttcc--caatgct---
B D                 Manatee  -gtaagtcatagcctctttc--caatgtggtt
           Cape golden mole  -gtacttcagagcttctttc--cagttagatt
B D                  Tenrec  ================================
                  Aardvark  ================================
B D         Chinese hamster  ================================
B D                   Mouse  ================================
    Lesser Egyptian jerboa  ================================
B D                Elephant  ================================
      David's myotis (bat)  ================================
             Domestic goat  ================================
B D                   Sheep  ================================
B D              Guinea pig  ================================
B D                 Ferret   ================================
B D               Armadillo  ================================
B D                  Rabbit  ================================
B D                   Horse  ================================
          Brush-tailed rat  ================================
                Chinchilla  ================================
B D          Naked mole-rat  ================================

Inserts between block 31 and 32 in window
B D                    Pig 3bp
B D                 Alpaca 3bp
            Bactrian camel 3bp
B D                Dolphin 3bp
              Killer whale 3bp
          Tibetan antelope 3bp
B D                    Cow 3bp
B D       White rhinoceros 8bp
B D                    Dog 3bp
B D                  Panda 6bp
            Pacific walrus 3bp
              Weddell seal 3bp
          Black flying-fox 3bp
B D               Microbat 3bp
             Big brown bat 8964bp

Alignment block 32 of 43 in window, 42880755 - 42880756, 2 bps 
B D                   Human  tg
B D                   Chimp  tg
B D                 Gorilla  tg
B D               Orangutan  tg
B D                  Gibbon  tg
B D                  Rhesus  tg
B D     Crab-eating macaque  tg
B D                  Baboon  tg
               Green monkey  tg
B D                Marmoset  tg
B D         Squirrel monkey  tg
B D                Bushbaby  tg
         Chinese tree shrew  tg
B D                Squirrel  tg
B D                     Pig  tg
B D                  Alpaca  tg
             Bactrian camel  tg
B D                 Dolphin  tg
               Killer whale  tg
           Tibetan antelope  tg
B D                     Cow  tg
B D                     Cat  tg
B D                     Dog  tg
             Pacific walrus  tg
               Weddell seal  tg
           Black flying-fox  tg
B D                Microbat  tg
B D                 Manatee  tg
           Cape golden mole  tg
B D                  Tenrec  ==
                  Aardvark  ==
B D                     Rat  --
            Golden hamster  --
B D         Chinese hamster  ==
              Prairie vole  --
B D                   Mouse  ==
    Lesser Egyptian jerboa  ==
B D                Elephant  ==
B D                   Panda  ==
             Big brown bat  ==
      David's myotis (bat)  ==
             Domestic goat  ==
B D                   Sheep  ==
B D              Guinea pig  ==
B D                 Ferret   ==
B D               Armadillo  ==
B D                  Rabbit  ==
B D        White rhinoceros  ==
B D                   Horse  ==
          Brush-tailed rat  ==
                Chinchilla  ==
B D          Naked mole-rat  ==

Alignment block 33 of 43 in window, 42880757 - 42880757, 1 bps 
B D                   Human  c
B D                   Chimp  c
B D                 Gorilla  c
B D               Orangutan  c
B D                  Gibbon  c
B D                  Rhesus  c
B D     Crab-eating macaque  c
B D                  Baboon  c
               Green monkey  c
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Bushbaby  c
         Chinese tree shrew  c
B D                Squirrel  c
B D                  Alpaca  c
             Bactrian camel  c
B D                 Dolphin  c
               Killer whale  c
           Tibetan antelope  c
B D                     Cow  c
B D                     Cat  c
B D                     Dog  c
             Pacific walrus  c
               Weddell seal  c
           Black flying-fox  c
B D                Microbat  c
B D                 Manatee  c
           Cape golden mole  c
B D                  Tenrec  =
                  Aardvark  =
B D                     Rat  -
            Golden hamster  -
B D         Chinese hamster  =
              Prairie vole  -
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                Elephant  =
B D                   Panda  =
B D                     Pig  -
             Big brown bat  =
      David's myotis (bat)  =
             Domestic goat  =
B D                   Sheep  =
B D              Guinea pig  =
B D                 Ferret   =
B D               Armadillo  =
B D                  Rabbit  =
B D        White rhinoceros  =
B D                   Horse  =
          Brush-tailed rat  =
                Chinchilla  =
B D          Naked mole-rat  =

Alignment block 34 of 43 in window, 42880758 - 42880758, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
               Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  g
B D                Squirrel  a
B D                  Alpaca  a
           Tibetan antelope  a
B D                     Cow  a
B D                     Cat  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                Microbat  a
B D                 Manatee  a
           Cape golden mole  a
B D                  Tenrec  =
                  Aardvark  =
B D                     Rat  -
            Golden hamster  -
B D         Chinese hamster  =
              Prairie vole  -
B D                   Mouse  =
    Lesser Egyptian jerboa  =
B D                Elephant  =
B D                   Panda  =
B D                     Pig  -
             Big brown bat  =
B D                 Dolphin  -
      David's myotis (bat)  =
             Domestic goat  =
B D                   Sheep  =
              Killer whale  -
            Bactrian camel  -
B D              Guinea pig  =
B D                 Ferret   =
B D                     Dog  -
B D               Armadillo  =
B D                  Rabbit  =
B D        White rhinoceros  =
B D                   Horse  =
          Brush-tailed rat  =
                Chinchilla  =
B D          Naked mole-rat  =

Alignment block 35 of 43 in window, 42880759 - 42880759, 1 bps 
B D                   Human  a
B D                   Chimp  a
B D                 Gorilla  a
B D               Orangutan  a
B D                  Gibbon  a
B D                  Rhesus  a
B D     Crab-eating macaque  a
B D                  Baboon  a
               Green monkey  a
B D                Marmoset  a
B D         Squirrel monkey  a
B D                Bushbaby  a
         Chinese tree shrew  a
B D                Squirrel  a
B D                  Alpaca  a
           Tibetan antelope  a
B D                     Cat  a
             Pacific walrus  a
               Weddell seal  a
           Black flying-fox  a
B D                Microbat  a
B D                 Manatee  a
B D                  Tenrec  =
                  Aardvark  =
B D                     Rat  -
            Golden hamster  -
B D         Chinese hamster  =
              Prairie vole  -
B D                   Mouse  =
    Lesser Egyptian jerboa  =
          Cape golden mole  -
B D                Elephant  =
B D                   Panda  =
B D                     Pig  -
             Big brown bat  =
B D                 Dolphin  -
      David's myotis (bat)  =
             Domestic goat  =
B D                   Sheep  =
              Killer whale  -
B D                     Cow  -
            Bactrian camel  -
B D              Guinea pig  =
B D                 Ferret   =
B D                     Dog  -
B D               Armadillo  =
B D                  Rabbit  =
B D        White rhinoceros  =
B D                   Horse  =
          Brush-tailed rat  =
                Chinchilla  =
B D          Naked mole-rat  =

Inserts between block 35 and 36 in window
            Pacific walrus 1bp
              Weddell seal 1bp
B D               Microbat 215bp

Alignment block 36 of 43 in window, 42880760 - 42880760, 1 bps 
B D                   Human  t
B D                   Chimp  t
B D                 Gorilla  t
B D               Orangutan  t
B D                  Gibbon  t
B D                  Rhesus  t
B D     Crab-eating macaque  t
B D                  Baboon  t
               Green monkey  t
B D                Marmoset  c
B D         Squirrel monkey  c
B D                Bushbaby  c
         Chinese tree shrew  t
B D                Squirrel  t
B D                 Manatee  t
B D                  Tenrec  =
                  Aardvark  =
B D                     Rat  -
            Golden hamster  -
B D         Chinese hamster  =
              Prairie vole  -
B D                   Mouse  =
    Lesser Egyptian jerboa  =
          Cape golden mole  -
B D                Elephant  =
B D                   Panda  =
B D                     Pig  -
             Big brown bat  =
B D                 Dolphin  -
B D                Microbat  =
      David's myotis (bat)  =
          Black flying-fox  -
             Domestic goat  =
B D                   Sheep  =
          Tibetan antelope  -
              Killer whale  -
B D                     Cow  -
            Bactrian camel  -
B D              Guinea pig  =
B D                  Alpaca  -
              Weddell seal  =
            Pacific walrus  =
B D                 Ferret   =
B D                     Dog  -
B D               Armadillo  =
B D                  Rabbit  =
B D                     Cat  -
B D        White rhinoceros  =
B D                   Horse  =
          Brush-tailed rat  =
                Chinchilla  =
B D          Naked mole-rat  =

Inserts between block 36 and 37 in window
B D                Manatee 84bp

Alignment block 37 of 43 in window, 42880761 - 42880786, 26 bps 
B D                   Human  tgtgggg----gctcagaattcaccagaat
B D                   Chimp  tgtgggg----gctcagaattcaccagaat
B D                 Gorilla  tgtgggg----gctcagaattcaccagaat
B D               Orangutan  tgtgggg----gctcagaattcaccagaat
B D                  Gibbon  tgtgggg----gctcagaattcaccagaat
B D                  Rhesus  tgcgggg----gctcagaattcaccagaat
B D     Crab-eating macaque  tgcgggg----gctcagaattcaccagaat
B D                  Baboon  tgcgggg----gcgcagaattcaccagaat
               Green monkey  tgcgggg----gctcagaattcaccagaat
B D                Marmoset  tgtgcgg----gctcggaattcaccggaat
B D         Squirrel monkey  tgtgggg----gctcagaattcaccggaat
B D                Bushbaby  tgtgagg----cctctgggtacatca----
         Chinese tree shrew  tgtgagg----tctcaggatacacaa----
B D                Squirrel  tgtg-ga----gctcagcttacac------
           Black flying-fox  tacgcagagcaacacagaactcggtagaat
           Cape golden mole  -gtccgg----acttccgacgcattcgagt
B D                  Tenrec  ==============================
                  Aardvark  ==============================
B D                     Rat  ------------------------------
            Golden hamster  ------------------------------
B D         Chinese hamster  ==============================
              Prairie vole  ------------------------------
B D                   Mouse  ==============================
    Lesser Egyptian jerboa  ==============================
B D                Elephant  ==============================
B D                   Panda  ==============================
B D                     Pig  ------------------------------
             Big brown bat  ==============================
B D                 Dolphin  ------------------------------
B D                Microbat  ==============================
      David's myotis (bat)  ==============================
             Domestic goat  ==============================
B D                   Sheep  ==============================
          Tibetan antelope  ------------------------------
              Killer whale  ------------------------------
B D                     Cow  ------------------------------
            Bactrian camel  ------------------------------
B D              Guinea pig  ==============================
B D                  Alpaca  ------------------------------
B D                 Manatee  ==============================
              Weddell seal  ==============================
            Pacific walrus  ==============================
B D                 Ferret   ==============================
B D                     Dog  ------------------------------
B D               Armadillo  ==============================
B D                  Rabbit  ==============================
B D                     Cat  ------------------------------
B D        White rhinoceros  ==============================
B D                   Horse  ==============================
          Brush-tailed rat  ==============================
                Chinchilla  ==============================
B D          Naked mole-rat  ==============================

Inserts between block 37 and 38 in window
          Black flying-fox 5976bp

Alignment block 38 of 43 in window, 42880787 - 42880821, 35 bps 
B D                   Human  -----ttaataggaccgt---agaccagaattcatcaccccaa
B D                   Chimp  -----ttaataggaccgtaggagaccagaattcatcgccccaa
B D                 Gorilla  -----ttaataggaccgtaggagaccagaattcatcaccccaa
B D               Orangutan  -----ttaataggaccgtaggagaccagaattcgccaccccaa
B D                  Gibbon  -----ttaacaggactgtaggagaccagaattcgtcaccccaa
B D                  Rhesus  -----ttaataggactggaggagaccagaattcaccaccccaa
B D     Crab-eating macaque  -----ttaataggactggaggagaccagaattcaccaccccaa
B D                  Baboon  -----ttaataggactggaggagaccagaattcaccaccccaa
               Green monkey  -----ttaataggactggaggagaccagaattcgccaccccaa
B D                Marmoset  -----ttaataggaccagaggaga-------------------
B D         Squirrel monkey  -----ttcataggaccagaggagaccagaattcaccaccccaa
B D                Bushbaby  ------------------------------------cctccaa
         Chinese tree shrew  -------------------------------------ccccaa
B D                Squirrel  -----------------------------------tgcccaga
               Prairie vole  -----------------------------------tgacc--a
             Golden hamster  -----------------------------------tg-----a
B D                     Rat  -----------------------------------cggccaaa
           Cape golden mole  tctgatgaacagcactta---ggaccagatctctcctctttaa
B D                  Tenrec  ===========================================
                  Aardvark  ===========================================
B D         Chinese hamster  ===========================================
B D                   Mouse  ===========================================
    Lesser Egyptian jerboa  ===========================================
B D                Elephant  ===========================================
B D                   Panda  ===========================================
B D                     Pig  -------------------------------------------
             Big brown bat  ===========================================
B D                 Dolphin  -------------------------------------------
B D                Microbat  ===========================================
      David's myotis (bat)  ===========================================
          Black flying-fox  ===========================================
             Domestic goat  ===========================================
B D                   Sheep  ===========================================
          Tibetan antelope  -------------------------------------------
              Killer whale  -------------------------------------------
B D                     Cow  -------------------------------------------
            Bactrian camel  -------------------------------------------
B D              Guinea pig  ===========================================
B D                  Alpaca  -------------------------------------------
B D                 Manatee  ===========================================
              Weddell seal  ===========================================
            Pacific walrus  ===========================================
B D                 Ferret   ===========================================
B D                     Dog  -------------------------------------------
B D               Armadillo  ===========================================
B D                  Rabbit  ===========================================
B D                     Cat  -------------------------------------------
B D        White rhinoceros  ===========================================
B D                   Horse  ===========================================
          Brush-tailed rat  ===========================================
                Chinchilla  ===========================================
B D          Naked mole-rat  ===========================================

Inserts between block 38 and 39 in window
          Cape golden mole 42537bp

Alignment block 39 of 43 in window, 42880822 - 42880861, 40 bps 
B D                   Human  -----gtaggactggagg-agaccagaatctgctaccccaacatag
B D                   Chimp  -----gtaggactggagg-agaccagaatctgctaccccaacatag
B D                 Gorilla  -----gtaggactggagg-agaccagaatctgctaccccaacatag
B D               Orangutan  -----gtaggactggagg-agaccagaatctgctaccccaaaatag
B D                  Gibbon  -----gtaggactggagg-agaccagaatctgctaccccaaaatag
B D                  Rhesus  -----gtaggactggagg-agaccagaagctgctaccccaaaacag
B D     Crab-eating macaque  -----gtaggactggagg-agaccagaagctgctaccccaaaacag
B D                  Baboon  -----gtaggactggagg-agaccagaagctgctaccccaaaatag
               Green monkey  -----gtaggactggagg-agaccagaagctgctaccccaaaatag
B D                Marmoset  ----------------------ccagaatccgccacctccaaacag
B D         Squirrel monkey  -----gtaggcctggagg-agcccagaatccgccgcctccaagcag
B D                Bushbaby  -----atttggctgtaga-aagctagtgta-gccaccccaaagt-g
         Chinese tree shrew  aatatagatgactgga---agatcaaaatatgccaccccaaaatag
B D                Squirrel  -----gtacccagcagagcaggcca----------cccccaggcag
               Prairie vole  -----gcagtctcctaag----------------------------
             Golden hamster  -----gtagtcttctaag----------------------------
B D                     Rat  -----ataaggctctaag-agacca--------------gaagcag
B D                  Tenrec  ==============================================
                  Aardvark  ==============================================
B D         Chinese hamster  ==============================================
B D                   Mouse  ==============================================
    Lesser Egyptian jerboa  ==============================================
          Cape golden mole  ==============================================
B D                Elephant  ==============================================
B D                   Panda  ==============================================
B D                     Pig  ----------------------------------------------
             Big brown bat  ==============================================
B D                 Dolphin  ----------------------------------------------
B D                Microbat  ==============================================
      David's myotis (bat)  ==============================================
          Black flying-fox  ==============================================
             Domestic goat  ==============================================
B D                   Sheep  ==============================================
          Tibetan antelope  ----------------------------------------------
              Killer whale  ----------------------------------------------
B D                     Cow  ----------------------------------------------
            Bactrian camel  ----------------------------------------------
B D              Guinea pig  ==============================================
B D                  Alpaca  ----------------------------------------------
B D                 Manatee  ==============================================
              Weddell seal  ==============================================
            Pacific walrus  ==============================================
B D                 Ferret   ==============================================
B D                     Dog  ----------------------------------------------
B D               Armadillo  ==============================================
B D                  Rabbit  ==============================================
B D                     Cat  ----------------------------------------------
B D        White rhinoceros  ==============================================
B D                   Horse  ==============================================
          Brush-tailed rat  ==============================================
                Chinchilla  ==============================================
B D          Naked mole-rat  ==============================================

Inserts between block 39 and 40 in window
              Prairie vole 5bp
            Golden hamster 13bp
B D                    Rat 2bp

Alignment block 40 of 43 in window, 42880862 - 42880935, 74 bps 
B D                   Human  tcctctttggcacattgatgatt--tggaa-----------ctggttatgttg-aggaactgcaga---c
B D                   Chimp  tcctctttggcacattgatgatt--tggaa-----------ctggttatgttg-agaaactgcaga---c
B D                 Gorilla  tcctctttggcacattgatgatt--tggaa-----------ctggttatgttg-agaaactgcaga---c
B D               Orangutan  tcctctttggcacattgttgatt--tggaa-----------ctgatgatgttg-agaaactgcaga---c
B D                  Gibbon  tcctcttaggcacattgatgatt--tggaa-----------ctggttatgtta-agaaactgcaga---c
B D                  Rhesus  tcctctttggcatactgatgatt--tggaa-----------ctggttatgttg-agaaactgcaga---c
B D     Crab-eating macaque  tcctctttggcatactgatgatt--tggaa-----------ctggttatgttg-agaaactgcaga---c
B D                  Baboon  tcctctttggcatactgatgatt--tggaa-----------ctggttatgttg-agaaactgcaga---c
               Green monkey  tcctctttggcacactggttatt--tggaa-----------ctggttatgttg-agaaactgcaga---c
B D                Marmoset  ccctctccggcatattgatgatt--tggaa-----------ctggttatgttg-agaaactgcagg---c
B D         Squirrel monkey  ccctctctggcatattgatgatt--tggaa-----------ctggttatgtag-agaaactgcagg---c
B D                Bushbaby  acttctttggcatatttattatc--agaaa-----------ctggtccttttg-aggcactgcaga----
         Chinese tree shrew  tcctctttagcatagtt----tt--tgaag-----------ctgg-----ttg-agaaactgcaaa---g
B D                Squirrel  tcctccct-gcatactgatgggc--tggag-----------ccagtgttttgg----aagtgtagacagc
               Prairie vole  --ctccct------ctgagacgagccagag-----------ctgttgattttg-tagaactgaagaagac
B D         Chinese hamster  --ttccgt------ctgacacctg-cagag----cagcgacctggtgattttg-cgaaactgaagaagac
             Golden hamster  --ctctgt------ctgacacctg-cggagtggctggcggtctggtgattttgccgaaactgaagaagac
B D                     Rat  --ctcgct------ctagcgagca-ccgag-----------ctggtgattttc----gactaaagctgcc
B D                  Tenrec  ======================================================================
                  Aardvark  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
          Cape golden mole  ======================================================================
B D                Elephant  ======================================================================
B D                   Panda  ======================================================================
B D                     Pig  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                 Dolphin  ----------------------------------------------------------------------
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
          Black flying-fox  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ----------------------------------------------------------------------
              Killer whale  ----------------------------------------------------------------------
B D                     Cow  ----------------------------------------------------------------------
            Bactrian camel  ----------------------------------------------------------------------
B D              Guinea pig  ======================================================================
B D                  Alpaca  ----------------------------------------------------------------------
B D                 Manatee  ======================================================================
              Weddell seal  ======================================================================
            Pacific walrus  ======================================================================
B D                 Ferret   ======================================================================
B D                     Dog  ----------------------------------------------------------------------
B D               Armadillo  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Cat  ----------------------------------------------------------------------
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
B D          Naked mole-rat  ======================================================================

                      Human  -ac--------cagagtacct----ctgagaaaa
                      Chimp  -ac--------cagagtacct----ctgagaaaa
                    Gorilla  -ac--------cagagtacct----ctgagaaaa
                  Orangutan  -ac--------cggagtacct----ctgagcaac
                     Gibbon  -ac--------tggagtacct----ctgagaaac
                     Rhesus  -ac--------cggagtacct----ctgagaaac
        Crab-eating macaque  -ac--------cggagtacct----ctgagaaac
                     Baboon  -ac--------cggagtacct----ctgagaaac
               Green monkey  -ac--------cggagtacct----ctgagaaac
                   Marmoset  -ac--------aggg-tacct----ctgagaaac
            Squirrel monkey  -ac--------agggttacct----ctgagaaac
                   Bushbaby  -------------------gt----ctgaaaagc
         Chinese tree shrew  -cc--------cag--cagct----ctgaaaagt
                   Squirrel  -cc----------------ct----ctggaaaac
               Prairie vole  -ac--------tggagaagcc----cagaataac
            Chinese hamster  aac--------tggaggagcc----cagaaaaac
             Golden hamster  -ac--------tggaggagcc----cagaaaaac
                        Rat  -cccttttgcatggggcagctgcaactacaaaaa
                     Tenrec  ==================================
                   Aardvark  ==================================
                      Mouse  ==================================
     Lesser Egyptian jerboa  ==================================
           Cape golden mole  ==================================
                   Elephant  ==================================
                      Panda  ==================================
                        Pig  ----------------------------------
              Big brown bat  ==================================
                    Dolphin  ----------------------------------
                   Microbat  ==================================
       David's myotis (bat)  ==================================
           Black flying-fox  ==================================
              Domestic goat  ==================================
                      Sheep  ==================================
           Tibetan antelope  ----------------------------------
               Killer whale  ----------------------------------
                        Cow  ----------------------------------
             Bactrian camel  ----------------------------------
                 Guinea pig  ==================================
                     Alpaca  ----------------------------------
                    Manatee  ==================================
               Weddell seal  ==================================
             Pacific walrus  ==================================
                    Ferret   ==================================
                        Dog  ----------------------------------
                  Armadillo  ==================================
                     Rabbit  ==================================
                        Cat  ----------------------------------
           White rhinoceros  ==================================
                      Horse  ==================================
           Brush-tailed rat  ==================================
                 Chinchilla  ==================================
             Naked mole-rat  ==================================

Inserts between block 40 and 41 in window
        Chinese tree shrew 263bp

Alignment block 41 of 43 in window, 42880936 - 42881171, 236 bps 
B D                   Human  -tgcccttttgta--aaggaaatttgcacctataaaggaaatgtt----tgtt------agtcagca---
B D                   Chimp  -tgcccttttgta--aaggaaatttgcacctataaaggaaatgtt----tgtt------agtcagca---
B D                 Gorilla  -tgcccttttgta--aaggaaatttgcacctataaaggaaatgtt----tgtt------agtcagca---
B D               Orangutan  -tgcccttttgta--aaggaaatttgcacctataaaggaaacgtt----tgtt------agtcaaca---
B D                  Gibbon  -tgcccttttgtg--aaggaaacgtgcacctataaaagaaatgtt----cgtt------agtcaaca---
B D                  Rhesus  -tgctcttttgta--aaggaaatttgcacctataaaggaaatgtt----catt------agtcagca---
B D     Crab-eating macaque  -tgctcttttgta--aaggaaatttgcacctataaaggaaatgtt----catt------agtcagca---
B D                  Baboon  -tgctcttttgta--aaggaaatttgcacctataaaggaaatgtt----catt------agtcaaca---
               Green monkey  -tgctcttttgta--aaggaaatttgcacctataaaggaactgtt----catt------agtcaaca---
B D                Marmoset  ---cacttttgta--aaggaaatttgcacctataaaagaaatggt----catt------agtcaaca---
B D         Squirrel monkey  ---cacttttcta--aaggaaattcgcatctataaaggaaatggt----cgtg------agtcaaca---
B D                Bushbaby  -t-cccctctgta--aagaaactttacatccctaggtgaaaggat----cctg------agtaaagg---
         Chinese tree shrew  -tgcccttttgta--aaggaaatttacatatataaaggaaatgtt----catg------ggtaaagg---
B D                Squirrel  ttgcccttgtgta------caggaaatgtccatcttcaaaggact----ttttcattagtgtaaagg---
               Prairie vole  tgccacttttgtaggggggcgcttcacaaccac-aaaaaccggcc----tctt------tgtaagggtgt
B D         Chinese hamster  tacgccttttgta-gggcgtagtacacaaccacaaaaaaacggcctctttctt------tgtaaagg---
             Golden hamster  tacgccttttgta-ggatgcagttcacaaccac--aaaaatggcc----tctt------tgtaaagg---
B D                     Rat  taaaacaacaaaa-tgacaaggaaaaaagaaaaagaaaaacgtcc----tctt------tgtaaagg---
B D                  Tenrec  ======================================================================
                  Aardvark  ======================================================================
B D                   Mouse  ======================================================================
    Lesser Egyptian jerboa  ======================================================================
          Cape golden mole  ======================================================================
B D                Elephant  ======================================================================
B D                   Panda  ======================================================================
B D                     Pig  ----------------------------------------------------------------------
             Big brown bat  ======================================================================
B D                 Dolphin  ----------------------------------------------------------------------
B D                Microbat  ======================================================================
      David's myotis (bat)  ======================================================================
          Black flying-fox  ======================================================================
             Domestic goat  ======================================================================
B D                   Sheep  ======================================================================
          Tibetan antelope  ----------------------------------------------------------------------
              Killer whale  ----------------------------------------------------------------------
B D                     Cow  ----------------------------------------------------------------------
            Bactrian camel  ----------------------------------------------------------------------
B D              Guinea pig  ======================================================================
B D                  Alpaca  ----------------------------------------------------------------------
B D                 Manatee  ======================================================================
              Weddell seal  ======================================================================
            Pacific walrus  ======================================================================
B D                 Ferret   ======================================================================
B D                     Dog  ----------------------------------------------------------------------
B D               Armadillo  ======================================================================
B D                  Rabbit  ======================================================================
B D                     Cat  ----------------------------------------------------------------------
B D        White rhinoceros  ======================================================================
B D                   Horse  ======================================================================
          Brush-tailed rat  ======================================================================
                Chinchilla  ======================================================================
B D          Naked mole-rat  ======================================================================

                      Human  --gatctgt-accaggaagagagctgttcccggacaacttttatcacctg--ggaaacttttatctgcct
                      Chimp  --gatctat-accaggaagagagctgttcccggacaacttttatcacctg--ggaaacttttatctgcct
                    Gorilla  --gatctgt-accaggaagagagctgttcccggacaacttttatcacctg--ggaaacttttatctgcct
                  Orangutan  --tatctgt-accaggaagagagctgttcccggacgacttttatcacctg--ggaaacttttatctgcct
                     Gibbon  --gatctgt-accaggaagagagctgttccctgtcaacttttatcacctg--ggaaacttttatctgcct
                     Rhesus  --tatttgt-accaggaagagagctgttccc-gacaacctctgtcacctg--ggaaactttcatctgcct
        Crab-eating macaque  --tatttgt-accaggaagagagctgttccc-gacaacctctgtcacctg--ggaaactttcatctgcct
                     Baboon  --tatctgt-accaggaagagagctgttccc-gacaacctctgtcacctg--ggaaacttttatctgcct
               Green monkey  --tatctgt-accaggaagagagctgttccc-gacaacctctgtcacctg--ggaaacttttatctgcct
                   Marmoset  --tatctga-accaggaagagagctgttcctggac-acttttatcacttg--ggaaacttttatctgcct
            Squirrel monkey  --tatctga-accaggaagagagctgttcctggac-acttttatcacttg--ggaaacttttatctgcct
                   Bushbaby  --tgcc-----ccaggaa------------------acgtcaatcacccagtgggaacctccctctgcat
         Chinese tree shrew  --catctga-agcaggaagagagccagttccaggc-aattttatcacctg--agatgctgtta-------
                   Squirrel  --t-tcagc-a-gaaaaagagaactgctcca-ggcagctctggtcaccaa--gagtccttagtcctgact
               Prairie vole  catgtctgt-gccgaaaagagagcttctctatga-gacgtttatccaccc--aatctttctctccaggct
            Chinese hamster  --tgtctgt-accaggaagggagctgctctatggcaacttttatccaccc--agtttttctctccaggct
             Golden hamster  --tgtctgtaaccaggaagagagctgttctatggcaacttttatccaccc--agtctttctctccaggct
                        Rat  --tgtctgc-accagggagagagctgcttgatgggaacttttatctcccc--agggttttccctctagcc
                     Tenrec  ======================================================================
                   Aardvark  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
           Cape golden mole  ======================================================================
                   Elephant  ======================================================================
                      Panda  ======================================================================
                        Pig  ----------------------------------------------------------------------
              Big brown bat  ======================================================================
                    Dolphin  ----------------------------------------------------------------------
                   Microbat  ======================================================================
       David's myotis (bat)  ======================================================================
           Black flying-fox  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ----------------------------------------------------------------------
               Killer whale  ----------------------------------------------------------------------
                        Cow  ----------------------------------------------------------------------
             Bactrian camel  ----------------------------------------------------------------------
                 Guinea pig  ======================================================================
                     Alpaca  ----------------------------------------------------------------------
                    Manatee  ======================================================================
               Weddell seal  ======================================================================
             Pacific walrus  ======================================================================
                    Ferret   ======================================================================
                        Dog  ----------------------------------------------------------------------
                  Armadillo  ======================================================================
                     Rabbit  ======================================================================
                        Cat  ----------------------------------------------------------------------
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
             Naked mole-rat  ======================================================================

                      Human  cacac----------------------------------------------gg-caacctgcgttcacca
                      Chimp  cacacggcaacctgcgttcaccacacag-----------------------gg-caacctgcgttcacca
                    Gorilla  cacacggcaacctgcgttcaccacacagggcaacctgcgttcaccacacacgg-caacctgcgttcacca
                  Orangutan  cacat----------------------------------------------gg-caacctgcgttcacca
                     Gibbon  cacac----------------------------------------------gg-caaactgcgttcacca
                     Rhesus  cactg----------------------------------------------gg-caacctgtgttcgcca
        Crab-eating macaque  cactg----------------------------------------------gg-caacctgtgttcgcca
                     Baboon  cactg----------------------------------------------gg-caacctgtgttcacca
               Green monkey  cactg----------------------------------------------gg-caacctgtgttcgcca
                   Marmoset  cccac----------------------------------------------gg-caacctgtg-tcacca
            Squirrel monkey  cccac----------------------------------------------gg-caacctgtg-tcacca
                   Bushbaby  aacaa----------------------------------------------ag-cgatctgtaccca-gg
         Chinese tree shrew  -agga----------------------------------------------gg-caacttttgcttacca
                   Squirrel  ctgga----------------------------------------------gt-----------------
               Prairie vole  tttcc----------------------------------------------cc-----------ctagca
            Chinese hamster  tcccc----------------------------------------------gc-----------------
             Golden hamster  ccccc----------------------------------------------accccccctgcgcctaacc
                        Rat  ctccc----------------------------------------------ag-----------------
                     Tenrec  ======================================================================
                   Aardvark  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
           Cape golden mole  ======================================================================
                   Elephant  ======================================================================
                      Panda  ======================================================================
                        Pig  ----------------------------------------------------------------------
              Big brown bat  ======================================================================
                    Dolphin  ----------------------------------------------------------------------
                   Microbat  ======================================================================
       David's myotis (bat)  ======================================================================
           Black flying-fox  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ----------------------------------------------------------------------
               Killer whale  ----------------------------------------------------------------------
                        Cow  ----------------------------------------------------------------------
             Bactrian camel  ----------------------------------------------------------------------
                 Guinea pig  ======================================================================
                     Alpaca  ----------------------------------------------------------------------
                    Manatee  ======================================================================
               Weddell seal  ======================================================================
             Pacific walrus  ======================================================================
                    Ferret   ======================================================================
                        Dog  ----------------------------------------------------------------------
                  Armadillo  ======================================================================
                     Rabbit  ======================================================================
                        Cat  ----------------------------------------------------------------------
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
             Naked mole-rat  ======================================================================

                      Human  gacacct-cctctcctcacgctcccct-----cactc--ctcca--ccgctccccagaagcctcaaaccc
                      Chimp  gacacct-cctctcctcacgctcccct-----cactc--ctcca--ccgctccccagaagcctcaaaccc
                    Gorilla  gagacct-cctctcctcacgctcccct-----cactc--ctcca--ccgctccccagaagcctcaaaccc
                  Orangutan  gacaccc-cctctcctcacgctccctt-----cactc--ctcca--ccgctcctcagaagcctcaaaccc
                     Gibbon  gacacct-cctctcctcacgctcccct-----cactc--ctcca--ccgctccccagaagcctcaaaccc
                     Rhesus  gacacct-cctctccttacgctcccct-----cactc--ctcca--ccactccccagaagcctcaaaccc
        Crab-eating macaque  gacacct-cctctccttacgctcccct-----cactc--ctccaccccactccccagaagcctcaaaccc
                     Baboon  gacacct-cctctccttacgctcccct-----cactc--ctcca--ccgctccccagaagcctcaaaccc
               Green monkey  gacacct-cctctccttacgctcccct-----cactc--ctcca--ccgctccccagaggcctcaaaccc
                   Marmoset  ggcatct-cctcccctcactctcccct-----cactc--ctcca--tagctccccagaagcctcaaaccc
            Squirrel monkey  aacacct--ctcccctcactct-ccct-----cactc--ctctg--tagctccccagaagcctcaaaccc
                   Bushbaby  ggcgttt-cctcccctcccccacccaa-----gtttg--cctcc--acactccccacagg------accc
         Chinese tree shrew  g-ctttc-cctcctctcaccctcccat-----attttggcccca--tggc-----------------cac
                   Squirrel  ----ccttatcaccaggactgtcctgc-------tgt--cccta--c-----agcagggactgcaaacc-
               Prairie vole  cattcccgtttacctccacagacctat---agcttgc--ctcca--caac-ccacacaggcagcaaacc-
            Chinese hamster  ---ccct-----ccacccccagcccatccccgtttgc--ttcct--c----------------cagaccc
             Golden hamster  catccctatttgctttcaccaaaccctcagagtttgc--ctcca--cga---tacccatgaagcaaacct
                        Rat  --------tttgcttccatggaccccccgtagcttgc--cttca--caac-caccacagg-agcaaatct
                     Tenrec  ======================================================================
                   Aardvark  ======================================================================
                      Mouse  ======================================================================
     Lesser Egyptian jerboa  ======================================================================
           Cape golden mole  ======================================================================
                   Elephant  ======================================================================
                      Panda  ======================================================================
                        Pig  ----------------------------------------------------------------------
              Big brown bat  ======================================================================
                    Dolphin  ----------------------------------------------------------------------
                   Microbat  ======================================================================
       David's myotis (bat)  ======================================================================
           Black flying-fox  ======================================================================
              Domestic goat  ======================================================================
                      Sheep  ======================================================================
           Tibetan antelope  ----------------------------------------------------------------------
               Killer whale  ----------------------------------------------------------------------
                        Cow  ----------------------------------------------------------------------
             Bactrian camel  ----------------------------------------------------------------------
                 Guinea pig  ======================================================================
                     Alpaca  ----------------------------------------------------------------------
                    Manatee  ======================================================================
               Weddell seal  ======================================================================
             Pacific walrus  ======================================================================
                    Ferret   ======================================================================
                        Dog  ----------------------------------------------------------------------
                  Armadillo  ======================================================================
                     Rabbit  ======================================================================
                        Cat  ----------------------------------------------------------------------
           White rhinoceros  ======================================================================
                      Horse  ======================================================================
           Brush-tailed rat  ======================================================================
                 Chinchilla  ======================================================================
             Naked mole-rat  ======================================================================

                      Human  cca-----tttctttctgtcactcagagtgacagataag
                      Chimp  cca-----tttctttctgtcactcagagtgacaaataag
                    Gorilla  cca-----tttctttctgtcactcagagtgacaaataag
                  Orangutan  cca-----tttctttctgtcactcagagtgacaaataag
                     Gibbon  cca-----tttctttctgttactcagagtgacagataag
                     Rhesus  cca-----tttctttgtgtcactcagagtgaca------
        Crab-eating macaque  cca-----tttctttgtgtcactcagagtgaca------
                     Baboon  cca-----tttctttgtgtcactcagagtgaca------
               Green monkey  cca-----tttctttgtgtcactcagagtgaca------
                   Marmoset  cca-----ttcctttctgtcgctcgaagtaacacataag
            Squirrel monkey  cca-----ttcctttc-------------------taag
                   Bushbaby  ccaactggtttctt-------ctcag-------------
         Chinese tree shrew  cta-----ttcctatctg-agctcaggatgacacacaag
                   Squirrel  ctt-----gttctttctgtagtttgacgtggcctacaag
               Prairie vole  cta-----tttctctgtagaacctggtagagaaggttaa
            Chinese hamster  cca-----gagtttgcctccaca----------------
             Golden hamster  cta-----tttttctgtatcacttggtggagtatataag
                        Rat  ctt-----gttctctgtattacctggtagag-ggataag
                     Tenrec  =======================================
                   Aardvark  =======================================
                      Mouse  =======================================
     Lesser Egyptian jerboa  =======================================
           Cape golden mole  =======================================
                   Elephant  =======================================
                      Panda  =======================================
                        Pig  ---------------------------------------
              Big brown bat  =======================================
                    Dolphin  ---------------------------------------
                   Microbat  =======================================
       David's myotis (bat)  =======================================
           Black flying-fox  =======================================
              Domestic goat  =======================================
                      Sheep  =======================================
           Tibetan antelope  ---------------------------------------
               Killer whale  ---------------------------------------
                        Cow  ---------------------------------------
             Bactrian camel  ---------------------------------------
                 Guinea pig  =======================================
                     Alpaca  ---------------------------------------
                    Manatee  =======================================
               Weddell seal  =======================================
             Pacific walrus  =======================================
                    Ferret   =======================================
                        Dog  ---------------------------------------
                  Armadillo  =======================================
                     Rabbit  =======================================
                        Cat  ---------------------------------------
           White rhinoceros  =======================================
                      Horse  =======================================
           Brush-tailed rat  =======================================
                 Chinchilla  =======================================
             Naked mole-rat  =======================================

Inserts between block 41 and 42 in window
              Prairie vole 1bp
            Golden hamster 7600bp

Alignment block 42 of 43 in window, 42881172 - 42881188, 17 bps 
B D                   Human  cctcaatcatcgggctg
B D                   Chimp  cctcaatcatcgggctg
B D                 Gorilla  cctcaatcatcgggctg
B D               Orangutan  cctcaatcatcgggctg
B D                  Gibbon  cctcaatcatcaggctg
B D                  Rhesus  ----aatcatctggctg
B D     Crab-eating macaque  ----aatcatctggctg
B D                  Baboon  ----aatcatctggctg
               Green monkey  ----aatcatctggctg
B D                Marmoset  cctcaatcatctggctg
B D         Squirrel monkey  cctcagtcatctggctg
B D                Bushbaby  -ctcaa-----------
         Chinese tree shrew  tctcaatcgt----ttg
B D                Squirrel  cctcaatggtctggctg
               Prairie vole  -------ccctggacaa
B D                     Rat  cctaggtcctcagacaa
B D                  Tenrec  =================
                  Aardvark  =================
            Golden hamster  =================
B D         Chinese hamster  -----------------
B D                   Mouse  =================
    Lesser Egyptian jerboa  =================
          Cape golden mole  =================
B D                Elephant  =================
B D                   Panda  =================
B D                     Pig  -----------------
             Big brown bat  =================
B D                 Dolphin  -----------------
B D                Microbat  =================
      David's myotis (bat)  =================
          Black flying-fox  =================
             Domestic goat  =================
B D                   Sheep  =================
          Tibetan antelope  -----------------
              Killer whale  -----------------
B D                     Cow  -----------------
            Bactrian camel  -----------------
B D              Guinea pig  =================
B D                  Alpaca  -----------------
B D                 Manatee  =================
              Weddell seal  =================
            Pacific walrus  =================
B D                 Ferret   =================
B D                     Dog  -----------------
B D               Armadillo  =================
B D                  Rabbit  =================
B D                     Cat  -----------------
B D        White rhinoceros  =================
B D                   Horse  =================
          Brush-tailed rat  =================
                Chinchilla  =================
B D          Naked mole-rat  =================

Inserts between block 42 and 43 in window
B D               Squirrel 150bp

Alignment block 43 of 43 in window, 42881189 - 42881200, 12 bps 
B D                   Human  ctgca-c-------------cttttt
B D                   Chimp  ctgca-c-------------cttttt
B D                 Gorilla  ctgca-c-------------cttttt
B D               Orangutan  ctaca-c-------------cttgct
B D                  Gibbon  ctaca-c-------------cttttt
B D                  Rhesus  ctgta-c-------------cttttt
B D     Crab-eating macaque  ctgta-c-------------cttttt
B D                  Baboon  ctgta-c-------------cttttt
               Green monkey  ctgtatc-------------tttttt
B D                Marmoset  ctgtt-t-------------cttttc
B D         Squirrel monkey  ctgtt-c-------------cttttc
B D                Bushbaby  ----a-t-------------cttttt
         Chinese tree shrew  ctgtt-t-------------ctttgc
               Prairie vole  tctca-cagtctcagactgattttta
B D         Chinese hamster  accca-c-------------------
B D                     Rat  tctca-cagtctcagatcgattttta
B D                  Tenrec  ==========================
                  Aardvark  ==========================
            Golden hamster  ==========================
B D                   Mouse  ==========================
    Lesser Egyptian jerboa  ==========================
          Cape golden mole  ==========================
B D                Elephant  ==========================
B D                   Panda  ==========================
B D                     Pig  --------------------------
             Big brown bat  ==========================
B D                 Dolphin  --------------------------
B D                Microbat  ==========================
      David's myotis (bat)  ==========================
          Black flying-fox  ==========================
             Domestic goat  ==========================
B D                   Sheep  ==========================
          Tibetan antelope  --------------------------
              Killer whale  --------------------------
B D                     Cow  --------------------------
            Bactrian camel  --------------------------
B D              Guinea pig  ==========================
B D                  Alpaca  --------------------------
B D                 Manatee  ==========================
              Weddell seal  ==========================
            Pacific walrus  ==========================
B D                 Ferret   ==========================
B D                     Dog  --------------------------
B D                Squirrel  ==========================
B D               Armadillo  ==========================
B D                  Rabbit  ==========================
B D                     Cat  --------------------------
B D        White rhinoceros  ==========================
B D                   Horse  ==========================
          Brush-tailed rat  ==========================
                Chinchilla  ==========================
B D          Naked mole-rat  ==========================

View table schema

Go to Conservation track controls

Data last updated: 2014-02-08

Downloads for data in this track are available:

Description

This track shows multiple alignments of 100 vertebrate species and measurements of evolutionary conservation using two methods (phastCons and phyloP) from the PHAST package, for all species. The multiple alignments were generated using multiz and other tools in the UCSC/Penn State Bioinformatics comparative genomics alignment pipeline. Conserved elements identified by phastCons are also displayed in this track. PHAST/Multiz are built from chains ("alignable") and nets ("syntenic"), see the documentation of the Chain/Net tracks for a description of the complete alignment process.

PhastCons is a hidden Markov model-based method that estimates the probability that each nucleotide belongs to a conserved element, based on the multiple alignment. It considers not just each individual alignment column, but also its flanking columns. By contrast, phyloP separately measures conservation at individual columns, ignoring the effects of their neighbors. As a consequence, the phyloP plots have a less smooth appearance than the phastCons plots, with more "texture" at individual sites. The two methods have different strengths and weaknesses. PhastCons is sensitive to "runs" of conserved sites, and is therefore effective for picking out conserved elements. PhyloP, on the other hand, is more appropriate for evaluating signatures of selection at particular nucleotides or classes of nucleotides (e.g., third codon positions, or first positions of miRNA target sites).

Another important difference is that phyloP can measure acceleration (faster evolution than expected under neutral drift) as well as conservation (slower than expected evolution). In the phyloP plots, sites predicted to be conserved are assigned positive scores (and shown in blue), while sites predicted to be fast-evolving are assigned negative scores (and shown in red). The absolute values of the scores represent -log p-values under a null hypothesis of neutral evolution. The phastCons scores, by contrast, represent probabilities of negative selection and range between 0 and 1.

Both phastCons and phyloP treat alignment gaps and unaligned nucleotides as missing data, and both were run with the same parameters.

UCSC has repeatmasked and aligned all genome assemblies, and provides all the sequences for download. For genome assemblies not available in the genome browser, there are alternative assembly hub genome browsers. Missing sequence in any assembly is highlighted in the track display by regions of yellow when zoomed out and by Ns when displayed at base level (see Gap Annotation, below).

Primate subset
OrganismSpeciesRelease dateUCSC versionAlignment type
BaboonPapio hamadryasNov 2008Baylor Pham_1.0/papHam1Reciprocal best net
BushbabyOtolemur garnettiiMar 2011Broad/otoGar3Syntenic net
ChimpPan troglodytesFeb 2011CSAC 2.1.4/panTro4Syntenic net
Crab-eating macaqueMacaca fascicularisJun 2013Macaca_fascicularis_5.0/macFas5Syntenic net
GibbonNomascus leucogenysOct 2012GGSC Nleu3.0/nomLeu3Syntenic net
GorillaGorilla gorilla gorillaMay 2011gorGor3.1/gorGor3Reciprocal best net
Green monkeyChlorocebus sabaeusJun 2013Chlorocebus_sabeus 1.0/chlSab1Syntenic net
HumanHomo sapiensFeb 2009GRCh37/hg19reference species
MarmosetCallithrix jacchusMar 2009