Skip to main content

Quick Start Guide to Assembly Hubs

Assembly Hubs allow researchers to create Track Data Hubs on assemblies that are not in the UCSC Browser. By including the underlying reference sequence in UCSC twoBit format, as well as data tracks, researchers can browse and annotate any genome. We may have a GenArk Hub of your genome, or you can visit our assembly request page and we can build an assembly hub for you.

For more information please refer to the Assembly Hub User Guide. Below is also a section about starting GBiB Assembly Hubs.

STEP 1: In a publicly accessible directory, copy this Arabidopsis thaliana plant assembly hub, which includes an araTha1.2bit file, using the following wget command:

wget -r --no-parent --reject "index.html*" -nH --cut-dirs=3 http://genome.ucsc.edu/goldenPath/help/examples/hubExamples/hubAssembly/plantAraTha1/

Alternatively, if you do not have wget installed, you can curl these files individually. Perform the curl -O option in the location you wish to copy the files:

curl -O http://genome.ucsc.edu/goldenPath/help/examples/hubExamples/hubAssembly/plantAraTha1/hub.txt

If you use curl, be sure to recreate the structure with matching araTha1 and araTha1/bbi directories. Double check you have all the files against the hub directory:

https://genome.ucsc.edu/goldenPath/help/examples/hubExamples/hubAssembly/plantAraTha1/

STEP 2: Load the hub. The quickest way is to put the hubUrl of your hub.txt straight into a Browser URL, along with the genome you want to open:

https://genome.ucsc.edu/cgi-bin/hgTracks?genome=araTha1&hubUrl=http://yourURL/hub.txt

With the hub you just copied, that is:

https://genome.ucsc.edu/cgi-bin/hgTracks?genome=araTha1&hubUrl=https://genome.ucsc.edu/goldenPath/help/examples/hubExamples/hubAssembly/plantAraTha1/hub.txt

You can also add the hub through the interface instead: paste the hub.txt link into the Connected Hubs tab of the Track Data Hubs page, click the "Add Hub" button, then click the "Genome Browser" link in the top bar. Swap hgTracks for hgGateway in the URL above if you would rather land on the gateway page than the browser.

STEP 3: Congratulations! Your assembly hub should display!

If it does not, run hubCheck against your hub first. It reads the hub the same way the Browser does and reports problems such as missing files, malformed stanzas and unreadable data files, which is usually faster than working backwards from a blank display:

hubCheck http://yourURL/hub.txt

Also be sure all your files and directories are publicly accessible. You may wish to reset the browser occasionally to clear all existing data. For hubs to work, your server must also accept byte-ranges. You can check with the following command, which should show "Accept-Ranges: bytes":

curl -I http://yourURL/hub.txt

Now that you have the assembly hub copied from above, you can copy the directory and start to edit some of the documents such as genomes.txt, groups.txt, and trackDb.txt to understand how they work. Refer to the Assembly Hub User Guide to understand how to build a twoBit file for your own original fasta files. Read more about trackDb settings in the definition document.

Assembly hubs also support chromAlias and chromAuthority, which let the Browser map chromosome names across different naming schemes and display a preferred convention. A default naming scheme can be set using the chromAuthority setting.

This assembly hub is an abbreviated version of a much larger collection of plant assembly hubs. You can explore that collection in the GenArk plant genomes index, which carries several Arabidopsis thaliana assemblies alongside hundreds of other plants.

Please note that the Browser waits 5 minutes before checking for any changes to these files. When editing hub.txt, genomes.txt, trackDb.txt, and related hub files, shorten this delay by adding udcTimeout=1 to your URL. For more information, please see the Debugging and Updating Track Hubs section of the Track Hub User Guide. Also, for more detailed instructions on setting up a regular hub, please see the Setting Up Your Own Track Hub section of the Track Hub User Guide.

Setting up Blat and In-Silico PCR for an Assembly Hub

By running gfServers from your institution, you can enable blat on your assembly hubs. See Starting Blat and In-Silico PCR for an Assembly Hub for details.

Setting up an Assembly Hub on GBiB with Blat and In-Silico PCR included

With an operational installation of Genome Browser in a Box (GBiB), you can quickly and easily acquire an example assembly hub and run gfServers locally on the GBiB to enable Blat and In-Silico PCR. See the section Starting a Blat and In-Silico PCR enabled Assembly Hub on GBiB for more information.

Resources

Starting Blat and In-Silico PCR for an Assembly Hub

From the location of yourAssembly.2bit file, http://yourURL/yourAssembly/yourAssembly.2bit, you can start two gfServers, specifying a port for the assembly hub to access amino acid sequence, 17777 -trans, or DNA sequence, 17779, in this example:

gfServer start localhost 17777 -trans -mask yourAssembly.2bit &
gfServer start localhost 17779 -stepSize=5 yourAssembly.2bit &

Then you can edit the genomes.txt file of your assembly hub to include three lines in the stanza referring to yourAssembly, that would have matching port numbers:

   transBlat yourLab.yourInstitution.edu 17777
   blat yourLab.yourInstitution.edu 17779
   isPcr yourLab.yourInstitution.edu 17779

The assembly hub can be configured to talk to a dynamic BLAT server that loads a pre-built index when started by an xinetd super-server. This allows genomes to have a blat server without needing it to be resident in memory at all times. See Running your own gfServer and Adding BLAT servers for details on how to setup dynamic BLAT servers.

See the example genomes.txt, which has these lines commented out, and please note the uppercase "B" in transBlat. For more information, see the "Adding BLAT servers" section of the Assembly Hub User Guide. The Source Downloads page offers access to utilities with pre-compiled binaries such as gfServer found in a blat/ directory for your machine type on the downloads server, and further detail in the BLAT specification. Please note that because the -mask option in the above 17777 -trans gfServer option will mask all lower-case sequence from being matched, you may not wish to include it. See the above blat links and gfServer usage statement for more information.

If you have trouble connecting your blat servers with the browser or if the browser cannot access your files, check if your institution has a firewall that prevents the browser from sending multiple inquiries. If this is the case, ask your systems administrator to add the following IP addresses as exceptions so that access is not limited.

128.114.119.*
129.70.40.37
134.160.84.3
128.114.198.32

This will allow connections with the U.S.-based genome.ucsc.edu site, the Europe-based mirror, the Asia-based mirror, and the UCSC development server.

Starting a Blat and In-Silico PCR enabled Assembly Hub on GBiB

STEP 1. Acquire and install Genome Browser in a Box: http://genome.ucsc.edu/goldenPath/help/gbib.html. You may also wish to read this UCSC blog post.

STEP 2. With your GBiB operational, use your computer's terminal program to ssh into your GBiB: ssh browser@localhost -p 1235, using browser for the password.

STEP 3. Navigate to the GBiB's /folders directory and use sudo to wget this assembly hub:

cd /folders
sudo wget -r --no-parent --reject "index.html*" -nH --cut-dirs=3 http://genome.ucsc.edu/goldenPath/help/examples/hubExamples/hubAssembly/plantAraTha1/

STEP 4. You now have all the required files on your local machine and can load this plant assembly hub by using this URL and selecting it under the "group" category where "Plant araTha1" displays:

http://127.0.0.1:1234/cgi-bin/hgGateway?genome=araTha1&hubUrl=http://127.0.0.1:1234/folders/hubExamples/hubAssembly/plantAraTha1/hub.txt

STEP 5. To enable blat you must acquire the gfServer utility. The UCSC Genome Browser and Blat software are free for academic, nonprofit, and personal use. Commercial download and installation of the Blat and In-Silico PCR software may be licensed through Kent Informatics.

You can obtain just the gfServer utility on your GBiB with the following command that will create a bin directory and install the tool:

mkdir ~/bin -p; rsync -avP hgdownload.gi.ucsc.edu::genome/admin/exe/linux.x86_64/blat/gfServer ~/bin/

The GBiB also includes a tool you can run on the command line to download an entire suite of tools including gfServer: gbibAddTools

STEP 6. Navigate to the genomes.txt file of this assembly hub:

cd /folders/hubExamples/hubAssembly/plantAraTha1/

Edit the currently commented-out blat lines with sudo vi genomes.txt and use "x" when the cursor is over the # at the start of the line to remove it and :w! to save the changes and :q to quit.

blat localhost 17779
transBlat localhost 17777
isPcr localhost 17779

Please note that if you loaded your hub earlier, it will take five minutes (300 seconds) for the browser to check for any changes to genomes.txt, and that this delay can be shortened temporarily by adding &udcTimeout=10 to the URL. See more information in the Debugging and Updating section of the Track Hub User Guide.

STEP 7. Change directories to the 2bit file:

cd /folders/hubExamples/hubAssembly/plantAraTha1/araTha1

Run the two gfServer commands to start the blat servers:

gfServer start localhost 17777 -trans -mask araTha1.2bit &
gfServer start localhost 17779 -stepSize=5 araTha1.2bit & 

STEP 8. Load this plant assembly hub by using this URL and selecting it under the "group" category where "Plant araTha1" displays:

http://127.0.0.1:1234/cgi-bin/hgGateway?genome=araTha1&hubUrl=http://127.0.0.1:1234/folders/hubExamples/hubAssembly/plantAraTha1/hub.txt

On the blat page, http://127.0.0.1:1234/cgi-bin/hgBlat, you can now select the Arabidopsis thaliana assembly and blat plant amino acid sequences, such as IYQTRENKYIIGEIQITESERDRRRSSLPGNH or DNA sequences, such as TAAGTAAAAAATAATATGATTAAGACTAATAAATCTTAATAGTTAATACT.

On the PCR page, http://127.0.0.1:1234/cgi-bin/hgPcr, you can now select the Arabidopsis thaliana genome and enter a forward primer such as TAGGTCTGCACCTGTGGTTCAAAATTTT and a reverse primer such as CAATACAAGTCAACATTTTAGCGCCGAGA and click the "Flip Reverse Primer" box and then click submit to find matches on the assembly.